WorldWideScience

Sample records for general primer caso

  1. El primer caso de leontiasis ósea en Colombia

    Directory of Open Access Journals (Sweden)

    Alfonso Bonilla Naar

    1949-04-01

    Full Text Available Presentamos hoy un caso exótico de la patología humana, una enfermedad aún no definida en su etiopatogenia, la leontiasis ósea. Fue descrita por l\\Ialpighi en 1697, y recibió tal denominación de Virchow desde 1864. Si juzgamos por la revisión de Pugh (1 en los últimos diez años de la Clínica Mayo, en que sólo se han hallado 10 casos de una entidad parecida llamada "Displasia fibrosa de' los huesos", localizada en el cráneo solamente, y que este autor considera como una fase anterior de la Leontiasis, tenemos que concluir que se trata de una entidad muy rara. Además, en lo consultado, incluyendo obras enciclopédicas, es tan escasa la información (sólo en Cecil hay una hoja escrita con criterio definido por Bauer (2 que nos reafirma la importancia de esta comunicación. Deseosos de conocer las publicaciones hechas en los últimos veinte años (1927-1947 revisamos el Index Medicus de Norteamérica a partir del estudio de Marx (3 sobre la anatomía patológica de la leontiasis, trabajo citado por Bauer (2 y que consideramos de importancia para definir la enfermedad, ya que anterior a esta época es improbable que existiera un criterio claro sobre la leontiasis, confundiéndola con muchas otras entidades similares, como veremos luego.

  2. Primer caso de canibalismo registrado para el gecko de Lima, Phyllodactylus sentosus (Reptilia, Phyllodactylidae)

    OpenAIRE

    Valdez, Fernando; Cossios, E. Daniel

    2017-01-01

    Se reporta un caso de canibalismo en el gecko de Lima, Phyllodactylus sentosus Dixon & Huey, 1970 donde un macho adulto devoró a un juvenil. Tras una búsqueda de literatura, no se encontró casos reportados en otras especies del mismo género, por lo que se considera que este es el primer reporte de canibalismo en Phyllodactylus. We report a case of cannibalism for the Lima leaf-toed gecko, Phyllodactylus sentosus, in which an adult male devoured a juvenile. No reported cases were found in o...

  3. Reporte del primer caso humano de infección parasitaria por Mammomonogamus laryngeus en Colombia

    Directory of Open Access Journals (Sweden)

    Jhon Carlos Castaño

    2006-09-01

    Full Text Available Los parásitos del género Mammomonogamus afectan el tracto respiratorio de mamíferos domésticos. La especie M. laryngeus es un nemátodo donde la hembra y el macho están unidos en permanente cópula produciendo una forma distintiva de letra "Y" mayúscula. En el mundo han sido reportados hasta el momento poco más de 100 casos de infección en humanos. Este reporte describe el primer paciente infectado en Colombia (Armenia, Quindío, quien presentó como sintomatología tos crónica productiva de dos meses de duración, con inmediata y total recuperación clínica luego de la expulsión del parásito en el esputo durante un fuerte acceso de tos. Este reporte incluye la descripción morfológica del gusano adulto, así como un breve resumen de la epidemiología y manifestaciones clínicas en humanos. También se presentan las fotografías tomadas al parásito, donde se observan algunos de los detalles morfológicos principales, que sirvieron para su identificación.

  4. Primer reporte de Phoneutrismo en el Perú: Presentación de dos casos

    Directory of Open Access Journals (Sweden)

    Ciro Maguiña Vargas

    2008-07-01

    Full Text Available Se presentan dos casos de mordedura de la araña Phoneutria spp. atendidos en el Hospital Nacional Cayetano Heredia (HNCH en los años 2005 y 2008. En ambos casos la mordedura fue de sintomatología leve y de buena evolución, y se debió a un accidente laboral en personas que trabajan en mercados de venta de fruta al extraer plátanos de cajas procedentes de Tingo María (Selva central. El phoneutrismo es un accidente por arácnidos poco común; sin embargo, sería un problema importante de salud pública sobretodo en las zonas rurales en donde el comercio de plátanos es una de las principales fuente de ingresos de la población. El personal médico no conoce del todo a esta araña, así como la clínica de sus mordeduras, por ello presentamos estos casos que permitirán reconocer estos accidentes para su adecuado manejo y control. (Rev. Med Hered. 2008;19:128-133

  5. The proper generalized decomposition for advanced numerical simulations a primer

    CERN Document Server

    Chinesta, Francisco; Leygue, Adrien

    2014-01-01

    Many problems in scientific computing are intractable with classical numerical techniques. These fail, for example, in the solution of high-dimensional models due to the exponential increase of the number of degrees of freedom. Recently, the authors of this book and their collaborators have developed a novel technique, called Proper Generalized Decomposition (PGD) that has proven to be a significant step forward. The PGD builds by means of a successive enrichment strategy a numerical approximation of the unknown fields in a separated form. Although first introduced and successfully demonstrated in the context of high-dimensional problems, the PGD allows for a completely new approach for addressing more standard problems in science and engineering. Indeed, many challenging problems can be efficiently cast into a multi-dimensional framework, thus opening entirely new solution strategies in the PGD framework. For instance, the material parameters and boundary conditions appearing in a particular mathematical mod...

  6. Reporte del primer caso de implante exitoso de asistencia ventricular izquierda HeartMate II como terapia de destino en Suramérica

    Directory of Open Access Journals (Sweden)

    Antonio Figueredo

    2016-11-01

    Full Text Available Se describe el caso de una paciente de sexo femenino de 55 años de edad, con insuficiencia cardiaca congestiva descompensada secundaria a cardiopatía dilatada idiopática y con contraindicación para trasplante cardiaco, en quien se implanta de manera exitosa el primer dispositivo de asistencia ventricular izquierda HeartMate II en Suramérica.

  7. Reporte del primer caso de enfermedad de Chagas transplacentaria analizado por AP-PCR en Moniquirá, Boyacá

    Directory of Open Access Journals (Sweden)

    Concepción Judith Puerta

    2009-12-01

    Conclusiones. Éste es el primer caso de enfermedad de Chagas transplacentaria reportado en el municipio de Moniquirá, que demuestra que esta forma de transmisión ocurre en el país. La presencia de infección mixta por ambos grupos de T. cruzi en las muestras del recién nacido, sugiere infección mixta en la madre, con mayor prevalencia de T. cruzi I, al menos en el hemocultivo.

  8. Las condiciones de vida durante el primer franquismo. El caso de las Islas Baleares

    Directory of Open Access Journals (Sweden)

    David Ginard i Ferón

    2002-12-01

    Full Text Available From 1939 to 1951 the majority of the inhabitants of the Balearic Islands suffered a sharp decline in standards of living, which seems surprising when taking into account the relative economic boom of the previous decades and the reduced impact of the 1936-1939 war on the production system. Using a varied range of sources, particularly reports from the National Institute of Statistics, the Civil Government, the regional Parliament, Chambers of Commerce, the regional Falange headquarters and a number of municipal governments, a series of variables such as the unfavourable price-income relationship, the increase in levels of economic corruption, and the decline of basic daily supplies, health provision, housing and education have been analysed. The peculiar production system of the Balearic Islands, characterized at that time by the predominance of the consumer goods industry and export of agricultural produce, is one of the main reasons explaining the far-reaching effects of the general post-war economic crisis on to the Balearic archipelago.

  9. Eficacia del primer tratamiento sistémico con glucocorticoides en la enfermedad inflamatoria intestinal. Revisión sistemática y serie de casos

    OpenAIRE

    López San Román, Antonio

    2009-01-01

    Los glucocorticoides son un fármaco de eficacia alta en pacientes con enfermedad inflamatoria intestinal, consiguiendo inducir respuesta en aproximadamente un 70% de los pacientes, respuesta que perdura a largo plazo en casi la mitad de los casos. La mayor edad al diagnóstico y al inicio del primer tratamiento son los principales factores predoctores de mala respuesta a los glucocorticoides. Una política de inmunosupresión precoz de los pacientes que no se hubieran beneficiado a largo plazo d...

  10. Esguince de tobillo de primer grado como causa de paresia del nervio peroneo común. Caso clínico

    OpenAIRE

    Í. Úbeda-Pérez de Heredia; G.Á. Sobrá-Hidalgo

    2015-01-01

    Los esguinces de tobillo, con mecanismo de inversión, son incidencias comunes en la población y constituyen las lesiones más frecuentes en el deporte. Eventualmente pueden ocasionar una neuropatía del nervio peroneo común, debido a un mecanismo de tracción indirecta, a través del nervio peroneo superficial. Se presenta el caso clínico de un varón de 37 años que, tras sufrir un esguince de tobillo de primer grado durante la práctica deportiva, presentó una paresia intensa del nervio peroneo co...

  11. Páncreas heterotópico como causa de invaginación intestinal: primer caso reportado en el Perú

    Directory of Open Access Journals (Sweden)

    Carlos Bazán Zender

    2015-09-01

    Full Text Available El páncreas heterotópico (PH es una condición rara en la población pediátrica. Los casos de PH que conllevan a una invaginación ileal, son infrecuentes en niños y muy raramente reportados, usualmente mostrándose con síntomas de obstrucción intestinal. Se presenta el caso de un paciente varón de un año de edad, con una historia crónica de anorexia, irritabilidad, dolor abdominal, acompañado de episodios intermitentes de sangrado tipo "jalea de grosella" que evoluciona a sangrado rectal rutilante. El paciente presenta un diagnóstico concomitante de colitis alérgica, lo cual prolonga el tratamiento quirúrgico efectivo en un centro asistencial externo. En la tomografía abdominal se encuentra el signo de la "escarapela" clásico. En la laparotomía exploratoria se confirma invaginación ileoileal, se encuentra una masa que el laboratorio de histopatología confirma como PH. A nuestro conocimiento, es el primer caso de invaginación por PH pediátrico reportado en el Perú.

  12. El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

    Directory of Open Access Journals (Sweden)

    Inês Moital

    2014-11-01

    Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

  13. Trasplante simultáneo de páncreas y riñón: reporte del primer caso realizado en el Perú

    Directory of Open Access Journals (Sweden)

    José De Vinatea

    2010-04-01

    Full Text Available El trasplante simultáneo de páncreas y riñón es la opción terapéutica ideal para pacientes con diabetes mellitus tipo 1 con insuficiencia renal crónica. Permite recuperar la insulino-independencia y evita la necesidad de diálisis, mejorando notablemente la calidad de vida. Así mismo, la restitución de la euglicemia logra que las complicaciones tardías de la diabetes no progresen e incluso regresionen, prolongando la supervivencia global de estos pacientes. Estos beneficios superan a los riesgos de la cirugía y de la inmunosupresión inherentes al trasplante. A nivel mundial, desde 1966, en que se llevó a cabo el primer trasplante de páncreas en Minnesota (Estados Unidos, se han registrado más de 20 000 trasplantes de páncreas, con resultados cada vez mejores gracias al refinamiento en las técnicas quirúrgicas y a los nuevos esquemas de inmunosupresión. En el presente caso clínico, se reporta y describe la realización del primer trasplante simultáneo de páncreas y riñón en el Perú.

  14. La deserción universitaria en primer año : Análisis de la situación de los ingresantes de la Facultad de Ciencias Naturales y Museo de La Plata a través del estudio de caso Introducción a la Botánica

    OpenAIRE

    Cristina, Inés

    2010-01-01

    Objetivo general: Indagar los motivos que pueden generar la alta deserción de alumnos ingresantes en la Facultad de Ciencias Naturales y Museo de la UNLP, tomando como caso de estudio la materia Introducción a la Botánica. Objetivos específicos  Identificar situaciones recurrentes que puedan orientar sobre las posibles causas de deserción de alumnos en el primer año de la carrera de Licenciatura en Biología de la Facultad de Ciencias Naturales y Museo, tomando ...

  15. Manejo exitoso de hernia diafragmática congénita con ECMO. Primer reporte de caso en México

    Directory of Open Access Journals (Sweden)

    Ulises Garza-Serna

    2017-11-01

    Full Text Available INTRODUCCIÓN: la hernia diafragmática congénita es una enfermedad que afecta a 1 de 3000 recién nacidos, con un alto índice de morbilidad y mortalidad, especialmente si se presenta con otras malformaciones como las anomalías congénitas cardiacas. El manejo del paciente con este padecimiento debe ser tratado de forma multidisciplinaria e incluir su evaluación prenatal y atención posnatal. OBJETIVO: reportar el primer caso exitoso en México de un paciente con hernia diafragmática congénita manejado con membrana de oxigenación extracorpórea. CASO CLÍNICO: paciente masculino de 37.5 semanas de gestación con diagnóstico prenatal de hernia diafragmática congénita a las 24 semanas de gestación sin otras anomalías congénitas; índice pulmón/ cabeza de 1.7. A las seis horas de nacido presentó saturación de oxígeno preductal de 78% y posductal a 58% con índice de oxigenación de 41, a pesar del tratamiento agresivo médico y ventilatorio, por lo que se necesitó la intervención e implementación de la membrana de circulación extracorpórea.

  16. Esguince de tobillo de primer grado como causa de paresia del nervio peroneo común. Caso clínico

    Directory of Open Access Journals (Sweden)

    Í. Úbeda-Pérez de Heredia

    2015-06-01

    Full Text Available Los esguinces de tobillo, con mecanismo de inversión, son incidencias comunes en la población y constituyen las lesiones más frecuentes en el deporte. Eventualmente pueden ocasionar una neuropatía del nervio peroneo común, debido a un mecanismo de tracción indirecta, a través del nervio peroneo superficial. Se presenta el caso clínico de un varón de 37 años que, tras sufrir un esguince de tobillo de primer grado durante la práctica deportiva, presentó una paresia intensa del nervio peroneo común que se constató mediante estudio ecográfico y electroneuromiográfico. El cuadro se resolvió con tratamiento conservador y electroestimulación. Pese a su rareza, ha de conocerse la asociación entre el esguince de tobillo y la lesión del nervio peroneo común y debe evaluarse la función de dicho nervio en todos los pacientes con esguince de tobillo en sus diferentes grados, tanto en su exploración inicial como en el seguimiento posterior.

  17. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  18. Endocarditis por Brucella canis: primer caso documentado en un paciente adulto en Argentina Brucella canis endocarditis: first documented case in Argentina

    Directory of Open Access Journals (Sweden)

    Valeria Manias

    2013-03-01

    Full Text Available Se describe el primer caso documentado de endocarditis por Brucella canis en Argentina. El paciente fue un varón adulto que consultó por edemas en miembros inferiores, registros febriles aislados de 2 meses de evolución y dolor precordial opresivo que irradiaba a brazo izquierdo. Negaba contacto con animales de cría o consumo de productos sin pasteurización. Estudios cardiológicos constataron endocarditis infecciosa. Se resuelve cirugía de recambio valvular ante fracaso terapéutico empírico con cefalotina, ampicilina y gentamicina. Los hemocultivos fueron positivos (4 de 4 muestras con bacilos gram negativos. Se realizó la identificación con técnica API 20 NE (bioMérieux, el método automatizado Phoenix (BD y las pruebas bioquímicas convencionales, sin concluir género ni especie. Se derivó la cepa al departamento de Bacteriología Especial INEI-ANLIS "Dr. Carlos G. Malbrán" donde se identificó al aislamiento como Brucella canis. Se rotó el esquema terapéutico a doxiciclina, rifampicina y trimetoprima-sulfametoxazol con buena evolución. La importancia del caso radica en la posible falla del tratamiento antimicrobiano empírico administrado para endocarditis, ya que B. canis no responde a los antimicrobianos convencionales para esta patología.We herein present the case of an adult male patient who consulted for lower extremity edema, a 2- month history of fever and oppressive chest pain radiating to the left arm. He referred neither contact with breeding animals nor consumption of unpasteurized dairy products. A diagnosis of endocarditis was confirmed by cardiac studies. Since the empirical treatment with cephalotin, ampicillin and gentamicin failed, the patient underwent aortic valve replacement. A total of four blood cultures were positive with a gram-negative rod. Bacterial identification was performed using the API 20 NE technique (bioMerieux, the Phoenix automated method (BD and conventional biochemical tests which were

  19. ¿Pueden los niños adquirir y aplicar conocimientos de emprendimiento?. El caso del subprograma, mi primer empresa: “emprender jugando”

    Directory of Open Access Journals (Sweden)

    Javier Damián Simón

    2015-01-01

    Full Text Available En México el tema de la Educación en Emprendimiento (EE en escuelas primarias es una línea emergente en la investigación educativa. El objetivo principal de la investigación fue evaluar la estructura y puesta en marcha de los planes de negocio elaborados por niños en el marco del subprograma Mi Primer Empresa: “emprender jugando”. La investigación fue descriptiva y exploratoria. Participaron 26 alumnos, 15 varones y 11 mujeres que cursaban el quinto y sexto grado en la Escuela Primaria Rural Benito Juárez ubicada en la localidad del Edén del municipio de San Juan Bautista Tuxtepec, Oaxaca. Se estudiaron tres variables: plan de negocio, conocimientos teóricos de emprendimiento y, habilidades de emprendimiento infantil. Se aplicó un cuestionario y un documento base de la estructura del plan de negocios que proporcionó la Fundación Educación Superior Empresa (FESE y, el análisis de la información fue hecha mediante el software estadístico SPSS V.19. En términos generales los resultados muestran que los participantes sí adquirieron y aplicaron conocimientos teóricos de emprendimiento pues fueron capaces de desarrollar el plan de negocio correspondiente a su mini empresa.

  20. La adaptación de la responsabilidad social empresarial de empresas multinacionales en México: Caso General Motors México

    Directory of Open Access Journals (Sweden)

    Rosalía Guadalupe Castillo-Villar

    2015-12-01

    Full Text Available Como consecuencia de la globalización, la discusión alrededor de las acciones de la responsabilidad social empresarial (RSE de empresas multinacionales ha aumentado en los últimos años. El objetivo de este trabajo es contribuir a la discusión sobre la adaptación o no de estos programas, de tal forma que se adapten a las expectativas y necesidades de la sociedad huésped. En este caso se aporta al estudio en México. Para esto se contribuye en primer lugar un breve marco conceptual de los conceptos independientes, para proceder a la argumentación a favor de esta interacción en particular y por último, se trata un breve ejemplo de esta interacción a través de un caso de estudio de la empresa General Motors que refleja claramente la adaptación de programas de RSE al mismo tiempo que sigue guías corporativas mundiales. En este trabajo se utiliza el análisis de los reportes anuales oficiales de responsabilidad social que publica la compañía como base para el análisis

  1. Presentación del primer caso humano de parasitismo por Macracanthorhynchus hirudinaceus en el Perú y breve revisión

    Directory of Open Access Journals (Sweden)

    María Beltrán F. de Estrada

    1997-07-01

    Full Text Available Se reporta un caso humano portador de Macracanthorhynchus hirudinaceus. Se trata de un varón de 45 años de edad, natural de la provincia de Chota, departamento de Cajamarca, Perú; con molestias digestivas. El diagnóstico se hizo por el hallazgo de huevos de Macracanthorhynchus hirudinaceus en las heces. Además se encontró Trichuris trichiura, Ancylostoma duodenale, Trichostrongylus sp, Blastocystis hominis y Entamoeba coli. Esta es la primera comunicación de un caso humano de M. hirudinaceus para el Perú.

  2. Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

    Science.gov (United States)

    Ballesteros Benavides, Maria Elvira

    Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los

  3. Chikungunya: enfermedad vírica emergente: irrupción en el ámbito laboral: primer caso declarado en España como accidente de trabajo

    Directory of Open Access Journals (Sweden)

    Marta Cerrillo Arranz

    Full Text Available La enfermedad del Chikungunya es una infección causada por el virus Chikungunya y transmitida al hombre por la picadura de mosquitos vectores del género Aedes. Aun siendo endémica de otros países, la elevada movilidad actual de la población por motivos lúdicos, laborales, comerciales y migratorios junto a la presencia del vector competente (Aedes albopictus en numerosas zonas geográficas de España, hace que haya irrumpido en nuestro territorio en los últimos años. La palabra Chikungunya deriva del idioma Makonde (Mozambique. Significa "el que se encorva" en referencia a la postura frecuentemente adoptada por dolor articular. A pesar de su escasa mortalidad, la morbilidad puede ser elevada, afectando de forma significativa a la actividad de vida diaria y capacidad laboral del paciente, reflejado en el consecuente absentismo laboral y repercusión económica. En España, tanto desde el Servicio Sanitario Público como desde los Servicios Médicos de Salud Laboral y Servicios de Prevención, se debe estar preparado para el diagnóstico, seguimiento, tratamiento y prevención de enfermedades hasta ahora desconocidas en nuestro ámbito de trabajo. Este artículo describe el primer caso laboral en España por enfermedad del Chikungunya importada por contagio en Haití.

  4. Primer reporte de un caso importado de Malaria por Plasmodium ovale curtisi en Paraguay, confirmado por diagnóstico molecular

    Directory of Open Access Journals (Sweden)

    Florencia del Puerto

    2015-04-01

    Full Text Available En países donde el Plasmodium ovale no es común, los microscopistas tienden a identificarlo de manera errónea como Plasmodium vivax. En este trabajo reportamos la identificación de la especie P. ovale curtisi por el método de PCR múltiple semianidada (SnM-PCR y la secuenciación de la subunidad pequeña del gen del ARN 18S, en un paciente paraguayo de 44 años de edad que vino en el 2.013 de Guinea Ecuatorial, África Occidental, a quien se le diagnosticó una infección por P. vivax por microscopía convencional. El empleo de métodos moleculares para la identificación de casos importados de infección con especies del género Plasmodium es uno de los objetivos principales en el control y la prevención de la malaria en Paraguay, teniendo en cuenta que el país se encuentra en fase de pre-eliminación de la enfermedad.

  5. Subrogación uterina: Aspectos médicos y jurídicos del primer caso con sustento legal en la Argentina

    Directory of Open Access Journals (Sweden)

    M. Fernanda Urquiza

    2014-06-01

    Full Text Available Una mujer de 38 años de edad fue derivada a nuestro centro para un tratamiento de maternidad subrogada, por haber sufrido la ablación subtotal de su útero a causa de una hemorragia puerperal grave. Su perfil hormonal y estructura ovárica eran normales. El esposo tenía fertilidad probada y un espermograma normal. La subrogante era una mujer de 39 años, fértil, con dos hijos propios y con un largo vínculo de amistad con la paciente. Luego de una estimulación con gonadotropinas y antagonista de Gn-RH se obtuvieron 6 ovocitos maduros por punción folicular, que originaron 4 embriones por fertilización in vitro. Tres de ellos evolucionaron y fueron transferidos a la subrogante, lográndose un embarazo único que concluyó con el nacimiento de una niña normal que ya tiene dos años cumplidos. Se inició una acción solicitando la inscripción de la beba ya nacida a nombre de los padres procreacionales. El juez finalmente la otorgó basándose en las pruebas y testimonios aportados, los antecedentes en la jurisprudencia internacional, y el hecho de que según el artículo 19 de la Constitución Nacional: "Ningún habitante de la Nación será obligado a hacer lo que no manda la ley, ni privado de lo que ella no prohíbe". Este es un ejemplo casi ideal de cómo se puede desarrollar un caso de subrogación. Sin embargo, hay que tener en cuenta que en nuestro país no existe aún un marco regulatorio para estos tratamientos, por lo que no queda exenta la posibilidad de conflicto.

  6. Consideraciones generales sobre población, desarrollo y medio ambiente, el caso de Tijuana, Baja California

    OpenAIRE

    Margarita Barajas Tinoco; Elizabeth Méndez Mungaray

    1992-01-01

    A partir de las relaciones que se pueden encontrar entre la sociedad y el medio ambiente natural, en este trabajo se destacan los elementos que dentro de la planeación general se orientan a la población y el desarrollo. El concepto de "calidad de vida", en sentido amplio, es tomado como indicador de desarrollo para problematizar contradicciones manifiestas entre un crecimiento urbano particular y su déficit de infraestructura social y problemas de medio ambiente. Como estudio de caso ilustrat...

  7. Delegaciones y oficinas de prensa españolas en el extranjero durante el primer franquismo: el caso francés (1936-1942

    Directory of Open Access Journals (Sweden)

    Antonio César MORENO CANTANO

    2009-03-01

    Full Text Available Francia fue uno de los enclaves más importantes de la propaganda franquista en Europa durante los años de la Guerra Civil española y la Segunda Guerra Mundial. En el presente artículo analizaremos las características generales que presentaron las Delegaciones y Oficinas de Prensa y Propaganda españolas en el extranjero durante 1936-1945. Posteriormente, dirigiremos nuestra atención a Francia, analizando el importante papel que desarrollaron en ese país los carlistas, falangistas y catalanistas franquistas de Cambó. Estudiaremos, en definitiva, las iniciativas que se acometieron desde Francia en beneficio de la España franquista y las adversidades que en el logro de tal objetivo tuvieron que superar, tanto externas como internas. hðF

  8. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  9. Consideraciones generales sobre población, desarrollo y medio ambiente, el caso de Tijuana, Baja California

    Directory of Open Access Journals (Sweden)

    Margarita Barajas Tinoco

    1992-09-01

    Full Text Available A partir de las relaciones que se pueden encontrar entre la sociedad y el medio ambiente natural, en este trabajo se destacan los elementos que dentro de la planeación general se orientan a la población y el desarrollo. El concepto de "calidad de vida", en sentido amplio, es tomado como indicador de desarrollo para problematizar contradicciones manifiestas entre un crecimiento urbano particular y su déficit de infraestructura social y problemas de medio ambiente. Como estudio de caso ilustrativo se toma a la ciudad de Tijuana, espacio territorial que enfrenta una problemática urbana, manifiesta entre otros escenarios, en su medio ambiente natural y social.

  10. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  11. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  12. Congenital generalized lipodystrophia: a case report; Lipodistrofia generalizada congenita: relato de um caso

    Energy Technology Data Exchange (ETDEWEB)

    Malheiros, N.R.; Marchiori, E.; Praxedes, M.C.; Machado, D.M.; Carvalho, A.A.V. [Universidade Federal Fluminense, Niteroi, RJ (Brazil). Dept. de Radiologia

    1995-01-01

    Congenital generalized lipodystrophia is a rare genetic disorder, transmitted as an autosomal recessive trait and is prevalent on female. This paper presents a case of a man, 36-year-old, suffering from congenital generalized lipodystrophia with clinical features of diabetes mellitus and dyspnea. Radiographic findings have shown cystic areas in the skeleton, interstitial pulmonary fibrosis and paucity of abdominal fat. Radiological and anatomo-pathological aspects are presented as well as a review of the medical literature about the case. (author). 8 refs, 4 figs.

  13. La teoría general de Keynes y su pertinencia para el caso colombiano

    Directory of Open Access Journals (Sweden)

    Jorge Cáceres De La Roche

    1987-07-01

    Full Text Available The novelty of General Theory is the method applied by Keynes in understanding the functioning and results of a market oriented economy. "An organized method to the reasoning of concrete problems", which is reflected in the elaboration of a theoretical scheme that gathers the characteristics from the real world in which we live -a monetary production economy-. The application of the global supply and demand scheme, developed by Keynes, permits to explain how the internal and external happenings have rebound on the Colombia's employment situation

  14. DERECHO INTERNACIONAL, DIVERSIDAD CULTURAL Y RESISTENCIA SOCIAL: EL CASO DE LA LEY GENERAL FORESTAL EN COLOMBIA

    OpenAIRE

    Bonilla-Maldonado, Daniel

    2015-01-01

    El derecho internacional ha sido reiteradamente cuestionado por su carácter excluyente y sus usos imperiales. Estas críticas describen de manera precisa muchas de sus estructuras y dinámicas. Sin embargo, el derecho internacional puede ser un instrumento útil para proteger los intereses legítimos de los Estados del Sur Global, en general, y de los distintos grupos sociales y culturales que los componen, en particular. El uso estratégico de sus normas y procedimientos puede contribuir eficient...

  15. Anestesia general para cesárea. Papel del sugammadex en la calidad y la seguridad del acto anestésico. Reporte de caso

    OpenAIRE

    Tafur B, Luis Alberto; Lema Flórez, Eduardo

    2012-01-01

    La cesárea es una de las intervenciones quirúrgicas más realizadas en el planeta. En el 5% de los casos se practica bajo anestesia general (7,5 millones de anestesias generales para cesárea cada año). Debido a sus requerimientos particulares (paciente con estómago lleno, necesidad de relajación neuromuscular, bienestar del binomio madre-hijo, expectativas de pronta atención del recién nacido por parte de la madre y relativa corta duración del procedimiento) la anestesia general representa un ...

  16. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  17. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  18. Disección traumática de la arteria carótida interna y embolismo cerebral en un jugador de fútbol: Reporte del primer caso

    Directory of Open Access Journals (Sweden)

    Luisa S. Talledo Paredes

    2012-03-01

    Full Text Available Reportamos el caso de un varón de 18 años quien sufrió contusión cervical por impacto con balón de fútbol. Tres días después fue hospitalizado con hemiplejia derecha directa y afasia de expresión. La resonancia magnética cerebral mostró lesión isquémica izquierda en ganglios basales. El doppler carotideo evidenció trombo desde el origen de la arteria carótida común izquierda extendida a la arteria carótida interna izquierda (CII y la angiotomografía documentó disección de CII (lesión traumática carotídea tipo IV. Se optó por anticoagulación con warfarina y fisioterapia de rehabilitación; con evolución favorable. La incidencia de la injuria traumática carotídea es muy rara, más aún en futbolistas; el tratamiento es aún controversial, por lo que consideramos de interés el reporte de este caso.

  19. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  20. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  1. First report of a human case of polycystic echinococcosis due to Echinococcus vogeli from neotropical area of Peru, South America Primer reporte de un caso humano de echinococcosis poliquística causada por E. vogeli procedente del área neotropical del Perú, America del Sur

    Directory of Open Access Journals (Sweden)

    José R. Somocurcio

    2004-02-01

    Full Text Available We report a human case of polycystic hidatidosis due to Echinococcus vogeli from Contamana (Department of Loreto village located in the central jungle of Peru. The patient is a 44 year-old lady, teacher, who carried a painless liver mass since a year ago. She was submitted to abdominal surgery and the liver mass was removed and showed multiple cysts containing colorless liquid as is showed in the polycystic hidatidosis. The morphology and measure of the hooks obtained from the liquid contained in the cysts are from Echinococcus vogeli. It is the first report of this parasitism in Perú.Reportamos un caso humano de hidatidosis poliquística debido a Echinococcus vogeli procedente de Contamana (Departamento de Loreto, localidad ubicada en la selva central del Perú. La paciente es una mujer de 44 años de edad, profesora, quien portaba una hepatomegalia no dolorosa de un año de evolución. Sometida a intervención quirúrgica, se removió la masa hepática que macroscópicamente mostró múltiples quistes conteniendo líquido incoloro. El examen microscópico correspondió a una hidatidosis poliquística. El examen y medida de los ganchos obtenidos del contenido de los quistes correspondieron a Echinococcus vogeli. Es el primer reporte de este parasitismo en el Perú.

  2. Primer implante de electrodo de estimulación selectiva del haz de His en Colombia: Reporte de dos casos First implantation of selective his bundle pacing in Colombia: Report of two cases

    Directory of Open Access Journals (Sweden)

    Jorge E Velásquez

    2010-06-01

    Full Text Available Se conoce que la estimulación en el ápex del ventrículo derecho produce disincronía ventricular y muchas veces los pacientes desarrollan miocardiopatía dilatada, lo que ha llevado a realizar una estimulación más fisiológica. Con el reciente desarrollo tecnológico de los electrodos para la estimulación selectiva del haz de His (fisiológica, se quiere mostrar la experiencia en el implante de este tipo de electrodos en los dos primeros casos del servicio de electrofisiología de la Clínica Medellín.Pacing in the right ventricular apex is known to produce ventricular dysynchrony and patients often develop dilated cardiomiopathy. For this reason, a more physiological stimulation has been performed. With the recent technological development of electrodes for selective stimulation of the His bundle, we want to show the experience of this type of implantation in the first two cases made in the electrophysiology laboratory in Medellin.

  3. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  4. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  5. Cerebral aspergillosis due to Aspergillus fumigatus in AIDS patient: first culture - proven case reported in Brazil Aspergilosis cerebral causada por Aspergillus fumigatus en paciente con SIDA: primer reporte de caso demostrado por cultivo en Brasil

    Directory of Open Access Journals (Sweden)

    José E. Vidal

    2005-06-01

    Full Text Available Cerebral aspergillosis is a rare cause of brain expansive lesion in AIDS patients. We report the first culture-proven case of brain abscess due to Aspergillus fumigatus in a Brazilian AIDS patient. The patient, a 26 year-old male with human immunodeficiency virus (HIV infection and history of pulmonary tuberculosis and cerebral toxoplasmosis, had fever, cough, dyspnea, and two episodes of seizures. The brain computerized tomography (CT showed a bi-parietal and parasagittal hypodense lesion with peripheral enhancement, and significant mass effect. There was started anti-Toxoplasma treatment. Three weeks later, the patient presented mental confusion, and a new brain CT evidenced increase in the lesion. He underwent brain biopsy, draining 10 mL of purulent material. The direct mycological examination revealed septated and hyaline hyphae. There was started amphotericin B deoxycholate. The culture of the material demonstrated presence of the Aspergillus fumigatus. The following two months, the patient was submitted to three surgeries, with insertion of drainage catheter and administration of amphotericin B intralesional. Three months after hospital admission, his neurological condition suffered discrete changes. However, he died due to intrahospital pneumonia. Brain abscess caused by Aspergillus fumigatus must be considered in the differential diagnosis of the brain expansive lesions in AIDS patients in Brazil.La aspergilosis cerebral es una causa rara de lesión expansiva cerebral en pacientes con SIDA. Presentamos el primer reporte de un absceso cerebral causado por Aspergillus fumigatus en un paciente brasileño con SIDA. El paciente, de 26 años de edad, presentaba antecedentes de infección por el virus de la inmunodeficiencia humana (VIH, tuberculosis pulmonar y toxoplasmosis cerebral. Manifestó fiebre, tos, disnea y dos episódios de convulsiones. La tomografía computadorizada (TC demostró una lesión hipodensa parasagital y bi-parietal con

  6. Queratitis por Acanthamoeba sp.: primer caso confirmado por aislamiento y tipificación molecular en Bahía Blanca, provincia de Buenos Aires, Argentina Acanthamoeba sp. keratitis: first case confirmed by isolation and molecular typification in Bahía Blanca, Buenos Aires Province, Argentina

    Directory of Open Access Journals (Sweden)

    M. L. Gertiser

    2010-06-01

    Full Text Available Algunas especies del género Acanthamoeba provocan queratitis amebiana (QA, una infección de la córnea muy dolorosa, generalmente unilateral, con compromiso importante de la visión. Se presenta el caso de una mujer de 31 años usuaria de lentes de contacto con hábitos inadecuados de higiene y conservación de las lentes. La paciente consultó por enrojecimiento y dolor intenso en el ojo derecho, de dos meses de evolución. Luego del examen oftalmológico y ante la sospecha de una etiología parasitaria se realizó una biopsia de la zona lesionada, que se destinó al análisis bacteriológico y parasitológico en el laboratorio. También se remitieron los líquidos de lavado y el estuche de las lentes. No se detectó crecimiento bacteriano en las muestras. Los cultivos para la búsqueda de Acanthamoeba resultaron positivos en todos los especímenes analizados. Las amebas aisladas fueron clasificadas morfológica y molecularmente como pertenecientes al género Acanthamoeba. El presente trabajo muestra el primer caso de queratitis por Acanthamoeba de la ciudad de Bahía Blanca identificado por el laboratorio mediante procedimientos de alto valor diagnóstico.Some species of the Acanthamoeba genus cause keratitis, a very painful, most likely unilateral corneal infection , associated with eye and vision impairment. We here present a case of a 31-year-old female patient, a regular user of soft contact lenses without good practices of lens hygiene and handling. The patient attended medical consultation after two months of inflammation and pain in her right eye. After ophthalmological studies, and due to suspicion of a parasitic infection, a biopsy was performed and the sample submitted for bacteriological and parasitological analyses. Moreover, contact lens holders and lens cleaning solutions were studied. The samples yielded negative results for bacterial infection. However, cultivation of all samples showed the presence of amoeboid parasites

  7. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  8. ANÁLISIS DE LA CALIDAD DEL REGISTRO DE PARO CARDÍACO EN CASOS DE RESPONSABILIDAD MÉDICO LEGAL EN MÉDICOS GENERALES, 1999-2007

    Directory of Open Access Journals (Sweden)

    Gabriel Barragán

    2009-01-01

    Full Text Available Antecedentes. El registro del paro cardíaco es una actividad que se debe acompañar en la reanimación cerebro cardio pulmonar. En Colombia no existe un formato de registro oficial de paro cardiorrespiratorio, lo que dificulta la investigación en reanimación y la conducción de los procesos de responsabilidad médica que se deriven de esta atención. Objetivo. Analizar la calidad del registro de paro cardíaco en casos de responsabilidad médico legal iniciada a médicos generales que tuvieron asesoría científica del Fondo para Auxilio de Demandas de la Sociedad Colombiana de Anestesiología y Reanimación (SCARE-FEPASDE, 1999-2007. Material y métodos. Se realizó una investigación tipo serie de casos, en donde se incluyeron los casos de paro cardiorrespiratorio que tuvieron demanda médico legal y que fueron atendidos por médicos generales, entre 1999 y 2007, y que requirieron asesoría jurídica por SCARE-FEPASDE. La información se registró en tablas de Excel®, según las recomendaciones Utstein. La calificación de calidad se hizo por tres médicos expertos en responsabilidad médica de manera independiente. Se utilizó un formato de calificación sobre la proporción de registros realizados sobre 25 ítem posibles. La calidad se consideró alta (mayor de 95% ítem, media (70-94% ítem y baja (menor de 70%. En los casos de desacuerdo se realizó consenso. Resultados. Se incluyeron en total 83 casos. La calidad del registro del paro fue media en 49 casos (59%, baja en 32 casos (39% y alta en dos casos. Conclusión. El registro de paro cardiorrespiratorio en casos de responsabilidad médica es de mediana calidad, por lo que no se alcanza a cumplir con los estándares internacionales y las guías al estilo Utstein.

  9. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  10. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  11. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  12. Transplante cardiaco en niños: reporte del primer caso atendido en la Fundación Cardiovascular de Colombia Cardiac transplantation in children: report of the first case treated in the Colombian Cardiovascular Foundation

    Directory of Open Access Journals (Sweden)

    Víctor R Castillo

    2006-10-01

    Full Text Available En los últimos años, el trasplante cardiaco ha mejorado sustancialmente la calidad de vida y la sobrevida de los niños con enfermedad cardiaca terminal. En la actualidad, es un procedimiento rutinario en centros especializados; sin embargo, pese a los numerosos avances, existen complicaciones a largo plazo, como el rechazo tardío, la enfermedad vascular del injerto y los desórdenes linfoproliferativos que limitan la sobrevida y la calidad de vida (2. Estas limitaciones podrían disminuirse con la identificación oportuna de los donantes potenciales, lo cual permite disponer de órganos de mejor calidad, el mejoramiento del soporte al donante, un adecuado sistema de transporte y de preservación de los órganos, la actualización y el mejoramiento de los protocolos de manejo, y la utilización de nuevos fármacos. La escasa disponibilidad de donantes obliga a la implementación de estrategias para sensibilizar a la comunidad en general sobre la necesidad de adoptar una cultura de donación de órganos. Para alcanzar las metas del tratamiento, ofrecer una rehabilitación integral y lograr la pronta reincorporación del paciente con trasplante a la sociedad, se requieren programas de educación y apoyo multidisciplinario no sólo para los mismos pacientes sino para sus familias.During the last years, cardiac transplantation has substantially improved survival and life quality in children with terminal heart disease. It is actually a routine procedure in specialized centers. Nevertheless, in spite of the numerous advances, there are long-term complications, such as late rejection, implant vascular disease and lymphoproliferative disorders that limit survival and life quality (2. These limitations could be diminished by an opportune identification of the potential donors, allowing best quality organs disposal, improvement of donor support, adequate transport and preservation system, updating and improvement of treatment protocols and new

  13. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  14. Compromiso y clima organizacional: caso de estudio del hospital general de rio verde, S.L.P.

    OpenAIRE

    Ramón Gerardo Recio Reyes; David Gómez Sánchez; Héctor López Gama; Eugenia Inés Martínez López

    2012-01-01

    The present study aims to identify the relationship between organizational climate, measured in four dimensions (motivation, leadership, participation and reciprocity), and organizational commitment studied in three dimensions (affective, normative and continuity), as well as associating them with the sociodemographic characteristics of workers Rioverde General Hospital, S. L. P is a crosssectional study on the type of descriptive and correlational research, in addition to focusing on quantit...

  15. Woolly hair generalizado: caso clínico e revisão da literatura Generalized woolly hair: case report and literature review

    Directory of Open Access Journals (Sweden)

    Tiago Torres

    2010-02-01

    Full Text Available O termo woolly hair, ou cabelo lanoso, refere-se a uma variante anormal de cabelo, que pode ser parcial ou generalizado. As variantes de woolly hair generalizado são raras e podem ocorrer isoladamente ou associadas a outras alterações cutâneas e extracutâneas. Desta forma, nestes doentes, é necessário a exclusão de certos síndromes, como o de Noonan e cardiofaciocutâneo (CFC, que cursam com importante morbilidade e mortalidade. É descrito o caso clínico de uma criança com woolly hair generalizado e queratose pilar, mas que, após avaliação dos vários órgãos e sistemas, não foi encontrada qualquer alteração ou característica associada a esses síndromes.The term woolly hair, or tightly curled hair, refers to a structural anomaly of scalp hair, which can be partial or generalized. Generalized woolly hair variants are rare and can occur in isolation or in association with other cutaneous and extra-cutaneous abnormalities. Thus, it is important to dismiss in these patients the diagnosis of syndromes such as the Noonan syndrome and Cardiofaciocutaneous syndrome, which have high morbidity and mortality rates. We report the clinical case of a 7 year-old boy with generalized woolly hair and keratosis pilaris. After an evaluation of organs and systems, no alteration or characteristics associated with these syndromes were found.

  16. SINERGISMO FARMACODINÁMICO. A PROPÓSITO DE UN CASO INTERVENIDO QUIRÚRGICAMENTE DE URGENCIA BAJO ANESTESIA GENERAL.

    Directory of Open Access Journals (Sweden)

    Yesid Pallares Villarreal

    2004-01-01

    Full Text Available Presentamos una paciente femenina geriatrica con antecedentes de hipertensiòn arterial y trastornos psiquiatricos intervenida quirurgicamente de urgencia por un cuadro doloroso abdominal, con una interaccion farmacodinamica por sinergismo del doxepin y captopril potenciada por los efectos de la anestesia general. La hipotensiòn arterial fue la forma clínica de presentación. La paciente se recibió hipotensa por la administración preoperatoria de doxepin tratamiento de base y de captopril tratamiento impuesto por crisis hipertensiva antes de su llegada al hospital. Después de la inducción de la anestesia general desarrolla hipotensión arterial que sólo responde a la administración de noradrenalina. En un inicio se interpreta como un shock séptico en fase hipodinámica por el cuadro doloroso abdominal y la vasoplejia pero descartadas otras causas se concluye como hipotensión arterial de origen farmacológico con relación a la ingestión de antidepresivos triciclicos e inhibidores de la enzima convertora de angiotensina I en angiotensina II por su acción sobre el sistema nervioso simpático por potenciada por los agentes anestésicos. La paciente fue dada de alta del hospital satisfactoriamente a los 7 dias de operada.

  17. Perfil de ingreso de alumnos con buen desempeño académico en el primer año de estudios. El caso de la Escuela de Diseño de la Universidad De La Salle Bajío

    Directory of Open Access Journals (Sweden)

    María Daniela Esparza Olmos

    2011-01-01

    Full Text Available Introducción: El sistema educativo universitario se ha enfrentado a varios retos en los últimos tiempos, lo que ha implicado establecer políticas de admisión que permitan seleccionar a los estudiantes que cumplan con el perfil de ingreso, permitiendo generar estrategias para mejorar su desempeño académico a lo largo de sus estudios, y con ello elevar las cifras de la eficiencia terminal. Es así como el objetivo de esta investigación fue caracterizar el perfil de ingreso de los alumnos que mostraron un buen desempeño académico en el primer año de la licenciatura de diseño industrial, diseño de modas y calzado, diseño gráfico y diseño ambiental de la Universidad De La Salle Bajío. Método: La distribución final de la muestra estuvo formada por 256 alumnos de ambos sexos al analizarse estadísticamente los resultados de sus pruebas en el proceso de admisión de las cohortes del 2005 al 2008, para posteriormente correlacionarlas con el promedio del primer año de sus estudios. Resultados: Los resultados permitieron observar las semejanzas y diferencias entre las cuatro licenciaturas con respecto al perfil general de ingreso en la Escuela de Diseño. Asimismo, se encontró que los alumnos que presentaron en periodo de excelencia, obtuvieron mejor desempeño académico en el primer año de estudios. Conclusión: Conocer el perfil de ingreso servirá de parámetro en los siguientes procesos de admisión, además permitirá diseñar estrategias que fortalezcan las capacidades y habilidades de los alumnos al ingresar a la educación superior, de tal manera que se eleven los índices de eficiencia terminal y con ello mejorar la calidad en los programas académicos de licenciatura en la Escuela de Diseño.

  18. Prerrequisitos generales para la formulación de políticas sociales de inclusión: Caso Venezuela

    Directory of Open Access Journals (Sweden)

    Isabel Rodríguez Colmenares

    2012-01-01

    Full Text Available En este trabajo se realiza un acercamiento a las políticas públicas sociales, para lo cual se consideran algunos prerrequisitos generales con el propósito de organizar una propuesta sobre los procesos de formulación de la política social de inclusión, tomando como referencia específica el caso venezolano. La investigación fue soportada por una revisión y análisis biblio-hemerográfico. Los hallazgos indican que la identificación de estos prerrequisitos conforma una matriz integradora de variables que permite atender la complejidad de la política social de inclusión, desde una racionalidad y lógica distinta a la tradicional de corte reduccionista-economicista. Se concluye que, para alcanzar una interpretación integral de la política social de inclusión, en la perspectiva del enfoque de derechos sociales, hay que considerar la dinámica espacial; el entramado cultural; el ámbito demográfico– intergeneracional; el comportamiento del sistema político, el Estado y la administración pública; la relación sociedad-Estado-economía; y la articulación modelo de desarrollo y política social

  19. Frecuencia de casos de úlceras de presión y factores asociados a su desarrollo en adultos mayores hospitalizados en servicios de Medicina de un hospital general.

    Directory of Open Access Journals (Sweden)

    Carmen Eliana Peralta Vargas

    2009-01-01

    Full Text Available Objetivo: Determinar la frecuencia de casos de úlcera de presión y los factores asociados más importantes para su aparición en pacientes adultos mayores hospitalizados en el servicio de medicina de un hospital general. Material y métodos: Estudio prospectivo, observacional. Se estudiaron a todos los pacientes mayores de 60 años, hospitalizados en el servicio de medicina del Hospital Nacional Cayetano Heredia, entre diciembre de 2006 y abril de 2007. Se evaluaron diferentes variables demográficas, clínicas, así como diversos síndromes geriátricos; en dos grupos de pacientes, quienes desarrollaron úlcera de presión y los que no desarrollaron úlcera de presión. Se utilizó chi cuadrado y el análisis multivariado para determinar asociación estadística. Resultados: Se incluyeron 463 adultos mayores, la frecuencia de casos de úlcera de presión fue 11,4%. Las variables que estuvieron asociadas con el desarrollo de úlcera de presión, con una significancia estadística en el análisis univariado fueron: edad mayor de 70 años, dependencia parcial o total, deterioro cognitivo moderado o severo, incontinencia urinaria, malnutrición, riesgo moderado y alto para desarrollar úlcera de presión según escala de Norton, neumonía y accidente cerebrovascular como diagnósticos de ingreso, uso de catéter vesical, sujeción mecánica, dispositivos externos locales en zonas de prominencias óseas, la presencia de cuidador y el desarrollo de infección pulmonar intrahospitalaria. Luego del análisis multivariado solo: malnutrición (OR =6,87; IC 95%, 1,38-34,06 p=0,01 y sujeción mecánica (OR=8,09; IC 95%, 2,47-26,41 p=0,001 fueron los factores de riesgo. Conclusiones: La úlcera de presión es una condición frecuente en el adulto mayor hospitalizado. Los factores asociados a su aparición fueron malnutrición y sujeción mecánica.(Rev Med Hered 2009;20:16-21.

  20. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  1. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  2. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  3. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  4. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  5. Picnodistosis: El caso de Toulouse-Lautrec

    Directory of Open Access Journals (Sweden)

    Gabriel Alcalá-Cerra

    2006-01-01

    Full Text Available El pintor francés Henri de Toulouse-Lautrec fue el primer caso de picnodisostosis reconocido a nivel mundial. En este texto se analizan las distintas manifestaciones de la picnodisostosis y se hace énfasis en las que el artista presentó y se detallan desde el punto de vista que brindan los conocimientos surgidos a través del tiempo sobre la fisiopatología de esta enfermedad.

  6. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  7. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  9. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  10. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  11. Tratamiento Odontopediatrico de un paciente Vih (+)bajo anestesia general: Primer caso en el Postgrado de Odontología infantil en la Facultad de Odontología Universidad Central de Venezuela

    OpenAIRE

    GUERRA, MARIA E; CASANOVA, MARIA E.; SUÁREZ, JOSÉ A.; SALAZAR, ALEJANDRO

    2003-01-01

    Resumen El Síndrome de Inmunodeficiencia Adquirida, es una enfermedad de alta mortalidad causada por el Virus de Inmunodeficiencia Humana (VIH), el cual se caracteriza por un defecto adquirido aparentemente irreversible, en la inmunidad celular, que predispone al huésped a infecciones oportunistas severas y /o neoplásicas inusuales. Se estima que el Virus de Inmunodeficiencia Humana infecta a 1.000 niños cada día en el mundo, el 90% de éstos se han contaminado durante el embarazo, parto o lac...

  12. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  13. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  14. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo

    2012-12-01

    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.690

  15. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  16. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  17. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  18. Algebraic topology a primer

    CERN Document Server

    Deo, Satya

    2018-01-01

    This book presents the first concepts of the topics in algebraic topology such as the general simplicial complexes, simplicial homology theory, fundamental groups, covering spaces and singular homology theory in greater detail. Originally published in 2003, this book has become one of the seminal books. Now, in the completely revised and enlarged edition, the book discusses the rapidly developing field of algebraic topology. Targeted to undergraduate and graduate students of mathematics, the prerequisite for this book is minimal knowledge of linear algebra, group theory and topological spaces. The book discusses about the relevant concepts and ideas in a very lucid manner, providing suitable motivations and illustrations. All relevant topics are covered, including the classical theorems like the Brouwer’s fixed point theorem, Lefschetz fixed point theorem, Borsuk-Ulam theorem, Brouwer’s separation theorem and the theorem on invariance of the domain. Most of the exercises are elementary, but sometimes chal...

  19. Desarrollo de un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de educación general básica

    OpenAIRE

    Chaglla Cholota, Kléber Fabián

    2016-01-01

    1. Introducción. --2. Plantemiento de la Propuesta de Trabajo. --3. Marco Teórico. --4. Metodología. --5. Resultados. --6. Conclusiones y Recomendaciones. El presente proyecto de investigación propone desarrollar un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de Educación General Básica en la Unidad Educativa Intercultural Bilingüe “Huayna Capac”. Con el uso de este sitio web los docentes podrán generar material e...

  20. Primer on bioproducts

    International Nuclear Information System (INIS)

    Christie, P.; Mitchell, H.; Holmes, R.; Ogilvie, K.B.; Layzell, D.

    2004-11-01

    This document provides a general introduction to biotechnology, bioproducts and alternatives to fossil fuels and petrochemicals. It includes an introduction to the concept of bioproducts, a description of common products that can be manufactured using biomass and an overview of the ways bioproducts are made. It also addresses issues such as risks and benefits of bioproduct technologies and the environmental, social and economic considerations of bioproducts. The possibilities of using biofuels and bioenergy for heat and power, to fuel vehicles and as a fuel for fuel cells were also discussed. Biogas from municipal and farm wastes is currently used to drive some gas turbines for power generation. The role of biochemicals and biomaterials in industrial processes and products was also reviewed along with some domestic and international bioproducts already developed and innovative products under development. The document also explains how plants, animals and other organisms can be used to replace or complement fossil fuels to help generate energy and make chemicals, plastics and other materials. While some reports suggest that bioproducts consume less energy and produce less greenhouse gases than conventional products, other reports suggest that they are rarely superior to conventional products and some may even contribute to the eutrophication of lakes, rivers and other surface waters. figs., 80 refs

  1. Enhanced quantization: a primer

    International Nuclear Information System (INIS)

    Klauder, John R

    2012-01-01

    Although classical mechanics and quantum mechanics are separate disciplines, we live in a world where Planck’s constant ℏ > 0, meaning that the classical and quantum world views must actually coexist. Traditionally, canonical quantization procedures postulate a direct linking of various c-number and q-number quantities that lie in disjoint realms, along with the quite distinct interpretations given to each realm. In this paper we propose a different association of classical and quantum quantities that renders classical theory a natural subset of quantum theory letting them coexist as required. This proposal also shines light on alternative linking assignments of classical and quantum quantities that offer different perspectives on the very meaning of quantization. In this paper we focus on elaborating the general principles, while elsewhere we have published several examples of what this alternative viewpoint can achieve; these examples include removal of singularities in classical solutions to certain models, and an alternative quantization of several field theory models that are trivial when quantized by traditional methods but become well defined and nontrivial when viewed from the new viewpoint. (paper)

  2. Un Caso de Brucelosis en Bogotá

    Directory of Open Access Journals (Sweden)

    Raúl Paredes Manrique

    1948-11-01

    Full Text Available Después de más de un año de observación presentamos un caso de Fiebre Ondulante aparentemente infectado en Bogotá. Aunque no se trata del primer caso hallado en esta ciudad, tiene el interés de la escasa frecuencia de aparición de la enfermedad entre nosotros, de la comprobación del diagnòstico por métodos distintos de la aglutinación y per el tratamiento llevado a cabo.

  3. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    OpenAIRE

    Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera

    2010-01-01

    Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...

  4. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  5. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  6. Enfermedad de Pompe de inicio temprano. A propósito de un caso

    OpenAIRE

    Grandez-Urbina, J. Antonio; Bustamante-Ubillus, Claudio; Farro-Calderon, Rossy; Linares-Alarcon, Ismael; Goyzueta-Knox, Silvana

    2013-01-01

    La enfermedad de Pompe es una enfermedad inusual de presentación temprana, causada por el déficit de la síntesis de α 1-4 glucosidasa ácida. Presentamos un caso de inicio insidioso descompensado evidenciándose dificultad respiratoria y cardiomiopatía. La enfermedad de Pompe es muy infrecuente, siendo el primer caso reportado en nuestro medio.

  7. Enfermedad de Pompe de inicio temprano: A propósito de un caso

    Directory of Open Access Journals (Sweden)

    J. Antonio Grandez-Urbina

    2013-10-01

    Full Text Available La enfermedad de Pompe es una enfermedad inusual de presentación temprana, causada por el déficit de la síntesis de α 1-4 glucosidasa ácida. Presentamos un caso de inicio insidioso descompensado evidenciándose dificultad respiratoria y cardiomiopatía. La enfermedad de Pompe es muy infrecuente, siendo el primer caso reportado en nuestro medio.

  8. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  9. La oposición en el autoritarismo. El caso del Partido Demócrata Cristiano durante el régimen del general Pinochet en Chile

    Directory of Open Access Journals (Sweden)

    Carlos Huneeus

    2016-01-01

    Full Text Available ¿De qué recursos dispone la oposición en un régimen militar? ¿Cuáles son las arenas institucionales en las cuales pueden actuar sus dirigentes? Estas son las preguntas que orientan este artículo a través del examen del caso chileno. El artículo analiza la oposición llevada a cabo por el Partido Demócrata Cristiano ( pdc a la dictadura militar comandada por Augusto Pinochet y los recursos políticos que dispuso para ello. La argumentación es que los recursos que tiene la oposición provienen especialmente de la tradición democrática, destacando los partidos y ciertas instituciones como la Iglesia católica, cuando tiene una jerarquía que mantiene distancia con la dictadura. La importancia de estos recursos depende de la magnitud de la ruptura con las instituciones democráticas provocada por la instauración autoritaria. Entre los recursos de los que dispuso el pdc destaca el apoyo que recibió de la Christlich Demokratische Union (Unión Demócrata Cristiana/ cdu de Alemania. El análisis se centra entre los años 1973 y 1982, cuando la colectividad alemana estaba en la oposición, y considera las expresiones de ese apoyo en Chile y en Alemania.

  10. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  11. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  12. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  13. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  14. Caso e caos

    CERN Document Server

    Ruelle, David

    1992-01-01

    Caso e caos – Il caso ha la sua ragione. Ma quale? E cos’è in realtà il caso? Da dove viene e come può fare irruzione nella nostra descrizione dell’universo? A tutte queste domande, in una chiara e lucida esposizione, cerca di dare risposta David Ruelle. Curiosando tra i risultati scientifici del XX secolo e soffermandosi anche su fenomeni e problemi estranei alla scienza tradizionale – le lotterie, gli oroscopi, la teoria dei giochi, la genesi della turbolenza – Ruelle ci guida a conoscere il caso avendo la matematica, la fisica e tutte le scienze naturali come compagne. Ancora oggi il modo in cui il caso irrompe nelle nostre vite e nel mondo può essere un mistero, ma grazie ai progressi della scienza, qui raccontati, riusciamo a saperne un poco di più.

  15. Pustulosis exantemática aguda generalizada asociada a Epstein Barr: A propósito de un caso. Acute generalized exanthematous pustulosis associated to Epstein Barr: A propose of a case

    Directory of Open Access Journals (Sweden)

    A L Scaglione

    2008-12-01

    Full Text Available La pustulosis exantemática aguda generalizada (PEAG es una rara afección de hipersensibilidad, inducida principalmente por drogas y se manifiesta por una erupción aguda de pústulas estériles, acompañada de fiebre, que regresa en pocos días luego de discontinuar el fármaco causante. Se comunica el caso de una paciente de 23 años de edad, sin antecedentes de psoriasis que consulta por fiebre y una erupción pustulosa generalizada, asociada a la ingesta previa de amoxicilina y ácido clavulánico en el contexto de una mononucleosis infecciosa, con resolución espontánea del cuadro. El cultivo microbiológico no objetivó gérmenes patógenos.Acute generalized exanthematous pustulosis (AGEP is a rare skin eruption most commonly caused by medications. It is characterized by an acute eruption of sterile pustules and it is accompanied by an episode of fever, which regresses a few days after discontinuation of the drug that caused the condition. We report a case 23 year-old woman without history of psoriasis, that consults for fever and an acute generalized pustular eruption after amoxicillin, with clavulanic acid administration in a mononucleosis infection context, which resolved spontaneously. The microbiologic culture was negative for pathogenic germens.

  16. Guías de abordaje de problemas de conducta de los niños y niñas del Primer Año de Educación General Básica Jaime Burbano Alomía.

    OpenAIRE

    Dávila Tena, Hiparía Magdalena

    2011-01-01

    Diseñar guías de orientación metodológica para paliar los problemas de conducta que afectan a los niños /as, del Primer Año de Educación General Básica ‘’Jaime Burbano Alomía ‘’ En el presente año lectivo 2110-2011 Los problemas de conducta existentes en el entorno educativo de la ciudad de Otavalo, constituyen el motivo más elocuente para el desarrollo del presente trabajo, ello nos da la oportunidad idónea para emprender cambios sustanciales en las formas de diagnóstico para enfrenta...

  17. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  18. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  19. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  20. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  1. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  2. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  3. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  4. Psychiatric disorders and psychiatric consultation in a general hospital: a case- control study Transtornos psiquiátricos e solicitações de interconsulta psiquiátrica em hospital geral: um estudo de caso controle

    Directory of Open Access Journals (Sweden)

    Sumaia Inaty Smaira

    2003-03-01

    Full Text Available INTRODUCTION: Psychiatric consultation (PC has been considered an efficient tool to develop research, to track and to give assistance benefiting patients, health professionals and the institution. However, it has not been much used in Brazil. Although 30 to 50% of general hospital (GH inpatients may present a psychiatric disorder, only 1 to 12% of them are referred to assessment. The aims of this study were: to assess mental disorders in a GH; to identify which of these patients are sent to psychiatric care; to verify alleged reasons for referral to psychiatric consultation, and to examine the relationship between PC and psychiatric learning (during medical school and residence. METHODS: A case-control patient study was conducted (47 cases and 94 controls to analyze in detail the following variables: socio-demographic; clinical; degree of information (about the disease and diagnostic/therapeutic procedures, and relationship between patient and health team. Psychiatric diagnoses were made according to the ICD-10 criteria. The Self Report Questionnaire (SRQ, the CAGE and Brief Psychiatric Rating Scale (BPRS were used as well as a specifically designed questionnaire to collect clinical and demographic data. RESULTS: Behavioral alterations, either of elation or of depression, were the main for requesting a PC ; 95.8% of the cases and 27.7% of the controls had a mental disorder. Organic mental disorders and alcohol-related disorders were the most frequent diagnoses in group I (cases, while anxiety, depressive and alcohol-related disorders were predominant in group II (controls. Control group patients were better informed and more able to establish an appropriate relationship with the health team than case patients. The logistic regression showed CAGE-positive patients having 12.85 times greater risk of being referred to PC, followed by unemployed patients (2.44 times more PC referrals. DISCUSSION: The SRQ and CAGE were quite useful in the screening

  5. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  6. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  7. LINEAMIENTOS PARA EL DISEÑO DE PLANES DE CAPACITACIÓN TURÍSTICA, CASO DE ESTUDIO: CANTÓN GENERAL VILLAMIL

    Directory of Open Access Journals (Sweden)

    Julio Enrique Gavilanes Valle

    2015-10-01

    Full Text Available General Villamil Playas es un municipio costero de la provincia del Guayas, su economía está basada principalmente en la pesca siendo esta una actividad ancestral, no así el turismo que es relativamente joven en el cantón. Precisamente por estas circunstancias, algunas instituciones gubernamentales y privadas han dictado capacitaciones a los prestadores de servicios. El objetivo de esta investigación es el de generar lineamientos para el diseño articulado de nuevos programas de capacitación basada en las experiencias previas de capacitaciones realizadas en el cantón. Los instrumentos de investigación utilizados para este trabajo incluyeron el diseño y aplicación de entrevistas y encuestas a los diversos actores sociales que se convirtieron en informantes clave para el desarrollo del trabajo. Los resultados obtenidos muestran que las capacitaciones no han sido articuladas en un solo programa por tal motivo suele existir repetición u omisión de temas claves para el desarrollo del turismo en el cantón. Como conclusión se muestra la necesidad de crear lineamientos para el desarrollo de nuevos programas de capacitación, cuyo diseño este basado en la recolección de información estratégica sobre la comunidad y sus prioridades en materia formativa.

  8. Estudio comparativo de los eslóganes electorales y comerciales: el caso de las elecciones generales españolas de 2008

    Directory of Open Access Journals (Sweden)

    Manuel Garrido-Lora

    2013-01-01

    Full Text Available Este artículo presenta un estudio comparativo entre los eslóganes políticos y los eslóganes comerciales utilizados en la comunicación publicitaria de España. La investigación, sin precedentes en el ámbito español, pretende descubrir las diferencias y semejanzas estratégicas, conceptuales y formales entre ambos tipos de eslóganes. De este modo, los resultados de un estudio previo del autor en el ámbito de la comunicación comercial se comparan con el análisis de los eslóganes empleados por los principales partidos políticos españoles durante las elecciones generales de marzo de 2008. Las conclusiones muestran interesantes cualidades diferenciales de los eslóganes políticos que deben ser consideradas por los investigadores y profesionales de la comunicación publicitaria: brevedad, densidad semántica, retórica moderada, baja perdurabilidad o uso estratégico son algunas de ellas.

  9. Producción científica institucional y posicionamiento nacional: el caso del Hospital General de México

    Directory of Open Access Journals (Sweden)

    Macías-Chapula, C. A.

    2004-12-01

    Full Text Available The purpose of this work was to identify the scientific output, position and visibility of Mexico’s General Hospital (Hospital General de México-HGM. A literature search in the following databases was conducted for the period 1990-2003, in order to obtain the hospital’s scientific production: NCR, MEDLINE, LILACS, ARTEMISA, PERIODICA, and CLASE. The hospital scientific visibility was identified through the analysis of 140 documents retrieved from MEDLINE, for the period 1999-2003. Similarly, in order to obtain the scientific position of HGM at the national level, a bibliographic search was conducted in NCR and MEDLINE. Data were analyzed both manually and through BIBEXCEL 2001 and EXCEL 2000. Results included the retrieval of 1.647 references from the above mentioned databases. The subject content visibility indicated that the scientific production of the hospital was mainly related to comparative studies, treatment, and retrospective studies. As for the scientific position of the hospital, a rank 9 (r = 1-78in NCR and rank 12 (r = 1-74 in MEDLINE, was obtained. The study obtained the production, scientific position and visibility of the hospital through the databases used. HGM scientific production showed a high trend in the clinical medicine area and a low productivity in the social and humanistic fields. The thematic production of the hospital does not coincide with its main mortality causes; however, the hospital remains within the main 15 health research institutions at a national level. Finally, the document describes the implications of the study and the needed research actions, in order to support the adequate science policy lines of the hospital.

    El propósito de este trabajo fue el de identificar la producción, visibilidad y posicionamiento científico del Hospital General de México (HGM. Para la identificación de la producción del hospital, se condujo una investigación bibliográfica en las siguientes bases de datos

  10. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  11. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  12. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  13. Les conditions d’exercice du travail des cadres de premier niveau : une étude de cas First level managers’ working conditions: a case study Las condiciones de ejercicio del trabajo de los supervisores de primer nivel : un estudio de caso

    Directory of Open Access Journals (Sweden)

    Geneviève Baril-Gingras

    2010-11-01

    -level managers’ work and the influence of the conditions in which it is done. The study proceeded by observations of 12 managers’ work activity, in the form of work chronicles, and by interviews based on these observations. The article presents and discusses three types of results: some examples of how the prescribed task is converted into an effective task and of its translation into their work activity; a synthesis of how they perceive their role or "effective task"; and observations about the gap between this perception and their working conditions, in particular because of a quantitative work overload, limited actual autonomy, and obstacles to the planning and long-term development of their services. Therefore, these conditions do not seem favourable to the positive role they want to play and that is expected of them in relation to their work teams.El trabajo de los supervisores de primer nivel, ha conocido en estos últimos años, varios cambios. En la red de salud de Québec observamos una reducción importante de su número. Ahora bien, los supervisores juegan un rol importante en cuanto a la salud (física y psicológica y a la seguridad de los equipos de trabajo, ya que definen ciertas condiciones de realización del trabajo y ciertos aspectos del medio ambiente psicosocial. El presente estudio, tiene como objetivo comprender mejor el trabajo de los supervisores e influenciar las condiciones de realización del mismo. La metodología comprende observaciones de 12 supervisores de primer nivel, bajo la forma de crónicas de trabajo y entrevistas en base a esas observaciones. El artículo presenta tres tipos de resultados : ejemplos de la manera como la tarea prescrita es convertida en tarea efectiva y de su traducción dentro de la actividad de trabajo de los supervisores ; una síntesis de la forma como perciben su rol o ‘’tarea efectiva’’ y finalmente, la diferencia entre la manera como los supervisores perciben su rol y las condiciones de la realizaci

  14. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  15. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  16. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  17. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  18. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  19. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  20. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  1. Primer reporte de parasitismo de una garrapata blanda del género Ornithodoros (Ixodida: Argasidae sobre Rhinella arenarum (Anura: Bufonidae en el departamento de Valle Fértil, San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Acosta, Juan Carlos

    2012-08-01

    Full Text Available El objetivo de la presente comunicación es reportar por primera vez un caso de parasitismo en Rhinella arenarum y a la vez mencionar el primer registro del género Ornithodoros en el departamento de Valle Fértil, San Juan, Argentina. Siendo el primer registro de parasitismo de anfibios por Ornithodoros en la Argentina y el segundo para el neotrópico.

  2. Las iniciativas tecnológicas de la Subdirección General de Coordinación Bibliotecaria y el apoyo a la investigación en España: primer balance y perspectivas

    Directory of Open Access Journals (Sweden)

    Carrato Mena, María Antonia

    2006-02-01

    Full Text Available The Subdirectorate for Library Coordination of the Ministry of Culture develops activities with a direct impact on the research work. This unit plays an important role on cataloguing, preserving and disseminating information about bibliographic heritage, as it is responsible of creating and supporting the Spanish Bibliographic Heritage Union Catalogue. The Subdirectorate is also working on the digitalization of large collections as the Virtual Library of Historic Press and it has also implemented an application that provides access to digitized documents by using metadata harvesting techniques. It also publishes statistics with a wide range of essential data useful to investigate about libraries from social, economical, anthropological and librariahship points of view. Besides, it promotes and disseminates standards for information exchange and it coordinates library cooperation projects. All these ini t iatives have had results such as a virtual reference service, catalogues and, over all, a better access to information resourcesLa Subdirección General de Coordinación Bibliotecaria del Ministerio de Cultura desarrolla diversas actividades con una repercusión directa en la labor investigadora. Esta unidad desempeña un papel esencial en la catalogación, preservación y difusión del patrimonio bibliográfico que se concreta, entre otros aspecto, en la creación y mantenimiento del Catálogo Colectivo del Patrimonio Bibliográfico Español. La Subdirección ha emprendido la digitalización de fondos y la elaboración de instrumentos de recuperación de cara al establecimiento de grandes colecciones virtuales, como la de Prensa Histórica. Además, ha desarrollado un harvester basado en el protocolo OAI/PHM que permite la captación y preservación de documentos electrónicos. Publica estadísticas que recogen datos de forma exhaustiva y sistemática, necesarios para el estudio de las bibliotecas desde diferentes puntos de vista: bibliotecon

  3. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  4. Anestesia venosa total (AVT) em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia general intravenosa (AVT) en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA) in an infant with Werdnig-Hoffmann disease: case report

    OpenAIRE

    Marco Antonio Cardoso de Resende; Elizabeth Vaz da Silva; Osvaldo José Moreira Nascimento; Alberto Esteves Gemal; Giseli Quintanilha; Eliana Maria Vasconcelos

    2010-01-01

    JUSTIFICATIVA E OBJETIVOS: A doença de Werdnig-Hoffmann é a causa mais comum de hipotonia no lactente e quando presente logo após o nascimento tem pior prognóstico. Fraqueza muscular simétrica, arreflexia e fasciculações da língua são característicos. A maioria dos lactentes morre antes dos dois anos por insuficiência respiratória. O presente relato apresenta um caso com técnica venosa total durante anestesia. RELATO DO CASO: Paciente feminina, branca, um ano, 10 kg, estado físico ASA III, co...

  5. EEES, COMPETENCIAS Y APRENDIZAJE DEL DERECHO ROMANO MEDIANTE EL MÉTODO DEL CASO (I: EL DOBLE MATRIMONIO

    Directory of Open Access Journals (Sweden)

    Elisa Muñoz Catalan

    2013-01-01

    Full Text Available Con la realización del presente trabajo pretendemos investigar sobre la importancia actual de aplicar el método del caso en la enseñanza del Derecho Romano, frente a las tradicionales clases teóricas y magistrales. Reparando, muy especialmente, en el alcance de las exigencias metodológicas surgidas con los nuevos planes del estudio Grado en Derecho en el marco del EEES; así como en el desarrollo de una serie de competencias generales y específicas en los estudiantes, que les van a ser muy útiles una vez que finalicen el Grado y se enfrenten a las dificultades del mercado actual, ya que se consideran como los verdaderos protagonistas del proceso de enseñanza-aprendizaje. Por tanto, con la puesta en práctica de este primer caso sobre doble matrimonio romano, ausencia de testamento y herederos legítimos, intentamos acercar al alumnado al casuismo jurisprudencial romano; de este modo, comprenderán que lo importante no es dar la solución al supuesto planteado, sino razonar jurídicamente consiguiendo, a través de debates en grupos, un conocimiento más profundo de las reglas e instituciones aplicables.

  6. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  7. Anestesia venosa total (AVT em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia general intravenosa (AVT en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA in an infant with Werdnig-Hoffmann disease: case report

    Directory of Open Access Journals (Sweden)

    Marco Antonio Cardoso de Resende

    2010-04-01

    á presente después del nacimiento su pronóstico empeora. La debilidad muscular simétrica, la arreflexia y las fasciculaciones de la lengua son sus características. La mayoría de los lactantes fallece antes de los dos años por insuficiencia respiratoria. El presente relato presenta un caso con la técnica venosa total durante la anestesia. RELATO DEL CASO: Paciente femenina, blanca, de un año, 10 kg, estado físico ASA III, con enfermedad de Werdnig-Hoffmann diagnosticada desde los dos meses de edad. Candidata a la gastrostomía y fundoplicatura en la técnica abierta y traqueostomía. Monitorización con cardioscopio, presión arterial no invasiva, oxímetro de pulso, estetoscopio precordial y temperatura rectal posterior a la venoclisis. Fue preoxigenada y después de recibir el bolo de atropina (0,3 mg, se le realizó la inducción anestésica con remifentanil bolo (20 µg y propofol (30 mg. Después de la intubación traqueal fue ventilada de forma controlada manualmente, en sistema sin absorvedor de CO2, Baraka, FAG de 4 L.min-1, FiO2 0,5 (0(2/N(20. Mantenida bajo anestesia con propofol 250 µg.kg-1.min-1 y remifentanil 0,3 µg.kg-1.min-1 en infusión continua manual. El tiempo quirúrgico fue de 150 minutos. El despertar se dio en 8 minutos después del término de la infusión, con ventilación espontánea. A las dos horas, fue transferida a la unidad pediátrica y recibió alta al 4º día del postoperatorio. CONCLUSIONES: La elección de la técnica anestésica prioriza la seguridad que proviene de la familiaridad del manejo de los fármacos existentes. En los niños con enfermedades neuromusculares, la anestesia general intravenosa con remifentanil y propofol en sistemas de infusión, por la duración de la acción extremadamente corta, puede influir en la evolución de la enfermedad favorablemente.BACKGROUND AND OBJECTIVES: Werdnig-Hoffmann disease is the most common cause of hypotonia in infants and its prognosis is worse if it is present shortly after

  8. Hipertiroidismo congénito, Reporte de dos casos

    Directory of Open Access Journals (Sweden)

    Víctor Clemente Mendoza Rojas

    2014-04-01

    Full Text Available Introducción: El hipertiroidismo es una patología tiroidea poco frecuente en neonatos, relacionada con el antecedente materno de enfermedad de Graves, y por lo tanto con el paso transplacentario de inmunoglobulinas estimulantes del receptor de TSH. Presentación de casos: Reportamos dos casos de sexo femenino, que se presentaron en el Hospital Universitario de Santander. El primero de los casos se manifestó en la primera semana; el segundo caso se presentó tardíamente después del primer mes de vida. Los síntomas que presentaron en común fueron taquicardia persistente e hiperactividad. En uno de los casos la presentación clínica fue confundida con una infección bacteriana, debido a la presencia de fiebre. Se confirma el diagnóstico con los niveles de TSH muy suprimidos y T4 libre elevada, al menos al doble del límite superior. Los dos casos observaron medicamentos antitiroideos y propanolol con buena evolución clínica y de laboratorios; no se observamos complicaciones a corto o largo plazo como arritmias o craneosinostosis. Discusión: El hipertiroidismo congénito es una patología poco frecuente y siempre debe ser sospechado en recién nacidos de madres con antecedente de enfermedad de Graves, sus manifestaciones pueden presentarse prenatalmente o postnatalmente, y su diagnóstico y tratamiento deben ser oportunos para evitar secuelas a largo plazo o incluso la muerte

  9. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  10. Enfermedad de creutzfeldt-jakob en el Perú: reporte de once casos

    Directory of Open Access Journals (Sweden)

    Luis Torres-Ramírez

    Full Text Available La enfermedad de Creutzfeldt-Jakob (ECJ es una enfermedad neurológica fatal producida por la isoforma patológica de la proteína priónica humana. Se reporta las características clínicas de seis casos de la forma esporádica de ECJ con diagnóstico definitivo por histopatología, y cinco casos con diagnóstico probable, en pacientes atendidos en el Instituto Nacional de Ciencias Neurológicas del Perú. La edad de inicio en los casos definitivos fue de 55,8 años y, en los probables, de 59,6 años, con predominio del sexo masculino. El tiempo de enfermedad fue de 8,8 meses. Se encontró un EEG típico en 50% de los casos definitivos y 80% de los probables. La proteína 14-3-3 en líquido cefalorraquídeo fue positiva en un caso probable y los hallazgos típicos en resonancia magnética se observaron en dos casos probables. Todos los casos cursaron con una evolución clínica típica de la enfermedad, y se considera el primer reporte de ECJ en el Perú

  11. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  12. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  13. A los tuyos con razón o sin ella Redes de poder, candidaturas y recomendaciones en el estado soberano de Santander (1859-1886). El caso de la red del general Solón Wilches Calderón

    OpenAIRE

    Guerra, Adriano Israel

    2015-01-01

    Esta investigación busca primero, a manera de balance, presentar los textos realizados sobre el tema específico del General Solón Wilches Calderón en el Estado Soberano de Santander. Luego se profundiza en el concepto central que estamos utilizando: Redes de poder, sin dejar de definir otros aspectos teóricos. El primer capítulo tiene por objetivo principal dibujar el mapa político durante el Estado Soberano de Santander estableciendo sus principales actores, grupos, conflictos y sus proyecto...

  14. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  15. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  16. A primer on linear models

    CERN Document Server

    Monahan, John F

    2008-01-01

    Preface Examples of the General Linear Model Introduction One-Sample Problem Simple Linear Regression Multiple Regression One-Way ANOVA First Discussion The Two-Way Nested Model Two-Way Crossed Model Analysis of Covariance Autoregression Discussion The Linear Least Squares Problem The Normal Equations The Geometry of Least Squares Reparameterization Gram-Schmidt Orthonormalization Estimability and Least Squares Estimators Assumptions for the Linear Mean Model Confounding, Identifiability, and Estimability Estimability and Least Squares Estimators F

  17. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  18. Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae reproducidas en cautiverio

    Directory of Open Access Journals (Sweden)

    Adan Villagarcía Olmeño

    2015-01-01

    Full Text Available En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772. La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

  19. Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae) reproducidas en cautiverio

    OpenAIRE

    Adán Villagarcia Olmeño; Enrique Cuevas

    2014-01-01

    En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772). La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

  20. A primer on string theory

    CERN Document Server

    Schomerus, Volker

    2017-01-01

    Since its conception in the 1960s, string theory has been hailed as one of the most promising routes we have to unify quantum mechanics and general relativity. This book provides a concise introduction to string theory explaining central concepts, mathematical tools and covering recent developments in physics including compactifications and gauge/string dualities. With string theory being a multidisciplinary field interfacing with high energy physics, mathematics and quantum field theory, this book is ideal for both students with no previous knowledge of the field and scholars from other disciplines who are looking for an introduction to basic concepts.

  1. Dos estudios de casos

    Directory of Open Access Journals (Sweden)

    Hernán Guillermo Salazar Morales

    1989-04-01

    Full Text Available RESUMEN A continuación se presenta dos casos de estudio en donde se puede apreciar a la forma  como se establecen  las relaciones en una organización y lo que una DECISION  puede llegar a incidir en el desarrollo de las operaciones de una empresa. Decisiones basadas en la intuición, o en corazonadas, frecuentemente conducen en dirección equivocada, ocasionando pérdidas en tiempo, personal y dinero. El proceso de toma de decisiones deben ser TAREAS ESTRUCTURADAS que se sustenten con hechos. Su ejecución debe hacerse secuencialmente y cumplir con cada uno de sus pasos. El diseño de los  casos está orientado para que  sirvan como material de aplicación en la asignatura de  taller de planeación.

  2. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  3. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  4. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  5. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  6. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  7. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  8. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  9. Caracterización clínica y epidemiológica de los casos de dengue: experiencia del Hospital General de Culiacán, Sinaloa, México Clinical and epidemiologic characteristics of dengue cases: the experience of a general hospital in Culiacan, Sinaloa, Mexico

    Directory of Open Access Journals (Sweden)

    María Guadalupe Ramírez-Zepeda

    2009-01-01

    Full Text Available OBJETIVO: Documentar las características clínicas y epidemiológicas de los pacientes con dengue atendidos en un hospital de Culiacán, Sinaloa, México. MÉTODOS: Estudio transversal, observacional y analítico realizado en el Hospital General Dr. Bernardo J. Gastélum de Culiacán entre el 1 de octubre y el 2 de diciembre de 2003. Se evaluó la asociación entre las variables independientes (las características clínicas y epidemiológicas de los pacientes y la variable dependiente (diagnóstico confirmado de dengue hemorrágico mediante el análisis de regresión simple. Las variables que mostraron una relación significativa (P 100 000/mm3 en casos con cuadros clínicos graves (fuga capilar que no se clasificaron como dengue hemorrágico por no cumplir todos los criterios establecidos por la OMS.OBJECTIVES: To document the clinical and epidemiological characteristics present in dengue patients served by a hospital in Culiacan, Sinaloa, Mexico. METHODS: A cross-sectional, observational, and analytical study was carried out at the Hospital General Dr. Bernardo J. Gastélum de Culiacan from 1 October to 2 December 2003. Associations between the independent variables (the patients' clinical and epidemiological characteristics and the dependent variable (confirmed hemorrhagic dengue were determined through simple regression analysis. The variables that were significantly associated (P 100000/mm3 were confirmed in cases with acute clinical symptoms (capillary leak that were not classified as hemorrhagic dengue due to falling short of the criteria established by WHO.

  10. El desarrollo de la identidad profesional del profesorado: el caso del especialista de música

    Directory of Open Access Journals (Sweden)

    José Luis Aróstegui Plaza

    2013-01-01

    Full Text Available En este artículo me propongo hacer una revisión del concepto de identidad social y de sus implicaciones para la formación del profesorado de música. Para ello hablaré, en primer lugar, de los conceptos de «identidad social» y de su variante, las «identidades sonoras», que forma parte de él. En segundo, se verá su implicación para la formación de la «identidad profesional» del profesorado de música. Finalmente, haré una reflexión de las consecuencias que pueden sacarse para toda la formación del profesorado. El caso del profesorado de música puede ser ilustrativo de cómo una concentración en contenidos o en competencias, las mismas para todo el mundo, nos lleva a un modelo de profesorado muy distinto a otro centrado en la comprensión del significado de las interacciones que se producen en el aula. Me propongo, pues, ofrecer datos que puedan ser interesantes para quienes estén interesados en la formación del profesorado de música, al tiempo que se aborda una cuestión relevante para la formación del profesorado en general.

  11. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  12. Porfirias poco frecuentes: Casos detectados en la población argentina Non frequent porphyrias in the argentinean population

    Directory of Open Access Journals (Sweden)

    V A Melito

    2006-12-01

    Full Text Available Las porfirias son consecuencia de fallas en el metabolismo del hemo. Se clasifican según el tipo de sintomatología clínica prevalente o el órgano donde se expresa preferencialmente la falla metabólica. En general la deficiencia enzimática está asociada a mutaciones en los genes que codifican para cada una de las enzimas. Están descritos 7 tipos de porfiria diferentes. Se transmiten por carácter autosómico dominante a excepción de la PCE, la PHE y la NPA que son recesivas. Sin embargo, están reportadas variantes homocigotas para el resto de las porfirias de pronóstico y evolución mucho más grave que la forma heterocigota. La descripción de estos casos poco frecuentes, sus tratamientos y evolución, facilitarían tanto el diagnóstico diferencial de la porfiria como el conocimiento de las posibilidades terapéuticas en cada caso. Asimismo para las porfirias heterocigotas con manifestación infantil, su identificación temprana y tratamiento aseguraría una mejor evolución minimizando los riesgos asociados. Se han diagnosticado 5 casos de porfirias agudas en niñas: 2 de PAI, 2 de PV y 1 de CPH. Entre las porfirias cutáneas se presentan 25 casos de PCT infantil, el primer caso de PHE en Argentina, 4 casos de PCE infantil y 1 en un adulto y 2 casos de PPE con compromiso hepatobiliar.The Porphyrias are a group of diseases resulting from partial deficiencies in one of the heme biosynthetic enzymes. These disorders can be classified on the basis of their clinical manifestations or according the organ where the metabolic deficiency is mainly expressed. In general this enzyme deficiency is associated with mutations in the genes which codify each enzyme. There are 7 types of Porphyrias. They are autosomal dominant disorders with the exception of PCE, PHE and NPA which are recessive. However, some rare and severe cases with recessive inheritance have also been reported. The description of these infrequent cases and their treatments and

  13. Primer trasplante de intestino en Chile: Caso clínico

    OpenAIRE

    Buckel G,Erwin; Ferrario B,Mario; Uribe M,Mario; González G,Gloria; Godoy L,Jorge; Fluxá G,Fernando; Quera P,Rodrigo; Codoceo R,Verner; Morales B,Jorge; Benavente M,David; Santander D,María Teresa; Herzog O,Cristina

    2009-01-01

    Small bowel transplantation is associated with a patient survival at one and five years, of 80% and 63%, respectively. We repon a 36 year-old female with short bowel syndrome, subjected to the first small bowel transplantation performed in Chile. A cadaveric gran was used. Immunosuppression was achieved by means of alemtuzumab, tacrolimus, sirolimus, micofenolate mofetil and steroids. Serial endoscopies and biopsies were performed during seven months after transplantation. The most important ...

  14. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  15. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  16. Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

    NARCIS (Netherlands)

    Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

    1994-01-01

    Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

  17. Tres casos de odontomas

    Directory of Open Access Journals (Sweden)

    Salvador Javier Santos Medina

    2015-03-01

    Full Text Available Los odontomas son los tumores odontogénicos más comunes, casi siempre se diagnostican accidentalmente, en exámenes radiográficos; pueden sospecharse al retardar el brote dentario o producir maloclusiones. Se clasifican en odontomas compuestos y complejos, ambos constituidos por estructuras dentales como: esmalte, dentina, cemento y tejido pulpar. Su eliminación quirúrgica y la biopsia es el tratamiento de elección. El propósito de este trabajo es reportar tres casos de pacientes atendidos en el Hospital Pediátrico de Las Tunas, todos remitidos previamente por el ortodoncista. El primero, tipo compuesto, en un escolar de 9 años de edad, masculino, asociado a un 31 retenido; el segundo caso se trata de un gran odontoma complejo en una escolar de 11 años de edad, femenina, que produjo interferencia en el brote del 11 y el tercero compuesto; en un escolar de 10 años, masculino, en la línea media entre 11 y 21, con producción de diastema y brote del 12 por palatino. De ellos uno fue descubierto por un examen radiográfico de rutina y los otros dos sospechados por la maloclusión secundaria; todos se trataron quirúrgicamente. Estos casos demuestran la frecuencia de estos tumores en la cavidad bucal y la importancia de la realización de exámenes clínicos y radiográficos para su detección y tratamiento precoz, así como la importancia de la interrelación entre el ortodoncista y el maxilofacial en la resolución satisfactoria de esta entidad

  18. um estudo de caso

    OpenAIRE

    Costa, Cátia Filipa Pereira da

    2011-01-01

    Dissertação apresentada à Universidade Fernando Pessoa como parte dos requisitos para obtenção do grau de Mestre em Psicologia Jurídica As situações de abuso sexual de crianças nas quais o perpetrador pertence ao sexo feminino obtiveram ao longo dos últimos anos um acrescido reconhecimento por parte da comunidade científica, evidenciado pelo significativo incremento das investigações no âmbito desta temática consistindo na sua maioria estudos de caso. Um conjunto de particularidades encont...

  19. Estudio comparativo del modelo de gestión de outsourcing a insourcing en el área de tecnologías de la información. Caso General Motors Ecuador

    OpenAIRE

    Armas Vargas, Andrés David; Chávez Ordóñez, Andrea Estefanía

    2016-01-01

    La presente tesis de Maestría describe y compara el Modelo de Gestión Outsourcing que fue utilizado en el área de TI de GM OBB del Ecuador, versus el Modelo de Gestión Insourcing que está siendo utilizado en la actualidad. A través de la misma se determina si el cambio ha tenido resultados beneficiosos para el área y en consecuencia para la empresa. La investigación realizada es de tipo cualitativo, para su desarrollo se utilizó el método estudio de caso por tratarse de un tema singular, refe...

  20. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  1. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  2. Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

    Directory of Open Access Journals (Sweden)

    Gabriel Natalio Castillo

    2015-05-01

    Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

  3. Carlo Caso (1940 - 2007)

    CERN Multimedia

    Leonardo Rossi

    Carlo Caso (1940 - 2007) Our friend and colleague Carlo Caso passed away on July 7th, after several months of courageous fight against cancer. Carlo spent most of his scientific career at CERN, taking an active part in the experimental programme of the laboratory. His long and fruitful involvement in particle physics started in the sixties, in the Genoa group led by G. Tomasini. He then made several experiments using the CERN liquid hydrogen bubble chambers -first the 2000HBC and later BEBC- to study various facets of the production and decay of meson and baryon resonances. He later made his own group and joined the NA27 Collaboration to exploit the EHS Spectrometer with a rapid cycling bubble chamber as vertex detector. Amongst their many achievements, they were the first to measure, with excellent precision, the lifetime of the charmed D mesons. At the start of the LEP era, Carlo and his group moved to the DELPHI experiment, participating in the construction and running of the HPC electromagnetic c...

  4. dos estudios de caso

    Directory of Open Access Journals (Sweden)

    Daniel Kersffeld

    2013-01-01

    Full Text Available La UNASUR se ha destacado desde sus inicios en la compleja labor de mediación y resolución de conflictos internacionales. Para ello, esta entidad multilateral ha apelado a distintas fórmulas políticas tendientes al encausamiento de problemáticas y conflictos apartados del camino de la institucionalidad y de los medios tradicionales de resolución. Con todo, y pese a la búsqueda de caminos alternativos, han sido las cumbres presidenciales la principal herramienta destinada a encontrar soluciones innovadoras y respetuosas del orden democrático y constitucional de los países sudamericanos. En este artículo se analiza de manera específica la actuación de la unasur en dos casos de profunda gravedad institucional: el intento de golpe de Estado ocurrido en Ecuador el 30 de septiembre de 2010 y el derrocamiento del ex presidente Fernando Lugo en Paraguay en junio de 2012. Luego de analizar estos dos casos extremos, y las implicancias políticas generadas, se avanza en una visión comprensiva acerca del éxito o el fracaso del papel político de la unasur como instancia de resolución de conflictos a nivel internacional.

  5. Bloqueo aurículo-ventricular de primer grado en tirotoxicosis aguda First degree atrio-ventricular block in acute thyrotoxicosis

    Directory of Open Access Journals (Sweden)

    Antonio R. Vilches

    2004-02-01

    Full Text Available El cuadro clínico de la tirotoxicosis incluye síntomas cardiovasculares variados. La taquicardia sinusal es el trastorno electrocardiográfico más frecuente y los trastornos de conducción son extremadamente raros como modo de presentación. Comunicamos un caso de bloqueo aurículo-ventricular de primer grado en una paciente con hipertiroidismo recién diagnosticado y que comenzó días antes de la consulta con un cuadro general inespecífico. Su evaluación ulterior demostró que se trataba de una tirotoxicosis aguda autoinmune, y su tratamiento con metimazol corrigió el trastorno totalmente. Se discuten los mecanismos fisiopatológicos involucrados y las implicancias clínicas desde el punto de vista del internista.Thyrotoxicosis may present with a variety of cardiovascular symptoms. Sinus tachycardia is the most frequently encountered electrocardiographic abnormality and conduction disturbances are extremely uncommon. We present a case of first degree atrio-ventricular block in a patient with newly diagnosed hyperthyroidism and discuss the underlying pathophysiological mechanisms and the clinical implications from the internist’s standpoint.

  6. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  7. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  8. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  9. CRIPTOCOCOSE: RELATO DE CASO

    Directory of Open Access Journals (Sweden)

    Fernanda Alvarez GENTIL

    2016-12-01

    Full Text Available Criptococose, doença infecciosa fúngica, oportunista, potencialmente fatal, que acomete animais silvestres e domésticos, principalmente cachorro e gato e o homem. Causada pela levedura, Cryptococcus neoformans. Mais frequente em adultos, comumente diagnosticada em pacientes imunodeprimidos, como os soropositivos, fator predisponente mais frequente. Outros fatores são: uso prolongado de medicações imunossupressoras, doenças como diabetes, sarcoidose, doença de Hodgkin e outras neoplasias hematológicas, lúpus eritematoso, artrite reumatoide, doença de Behçet, e transplante de vísceras sólidas. Geralmente adquirida pela inalação do agente etiológico. Objetivo: este estudo objetiva relatar o caso de um paciente portador de criptococose, que esteve invernado no Hospital São José do Avaí (HSJA de Itaperuna, no mês de setembro de 2016, corroborando na literatura descrita sobre o tema, justifica-se o tema pela raridade do caso. Metodologia: inicialmente realizou-se pesquisa bibliográfica através da seleção de autores que asseguraram uma fundamentação teórico-metodológica que serviu de arcabouço para o desenvolvimento do estudo. A metodologia apresentada refere-se a um relato de caso, realizado a partir do prontuário do paciente e dos exames disponíveis. Resultados: a Radiografia de tórax evidenciou massa pulmonar em lobo inferior direito e a Tomografia de tórax também demonstrou esse acometimento; sendo realizada biópsia desse fragmento, que consolidou o diagnóstico de criptococose. A lâmina do paciente, corada com hematoxilina-eosina demonstrou aspectos característicos do acometimento por esse fungo. Conclusão: para o tratamento, pode-se utilizar antifúngicos como a anfotericina B associado com 5-flucitosina, em infecções disseminadas; ou fluconazol e itraconazol, para infecções cutâneas. 

  10. La evaluación de impacto y la evaluación de proceso en un sistema general de evaluación. Introducción al tema mediante un estudio de caso: el Programa Tortilla.

    Directory of Open Access Journals (Sweden)

    Herrera Ramos J. Mario

    2009-12-01

    Full Text Available En México se ha institucionalizado la cultura de la evaluación de los programas sociales. A pesar de los esfuerzos del Consejo Nacional de Evaluación de la Política Social la evaluación de proceso, a diferencia de la de impacto, no ha recibido la atención que merece dentro de esa cultura. Mediante una regresión de Poisson, se presenta un ejemplo de la utilidad que tiene la evaluación de proceso para identificar puntos críticos en la eficiencia y la gestión de un programa. El caso de estudio se construye con la información de un programa que inicia en 1986 y desaparece en 2003: el Programa Tortilla.

  11. Nuevos casos de Paracoccidioidomicosis

    Directory of Open Access Journals (Sweden)

    J Casquero

    1998-01-01

    Full Text Available La paracoccidioidomicosis es causada por el hongo Paracoccidioides brasiliensis. Esta infección es crónica y usualmente asintomática en niños. La distribución geográfica está limitada a Centroamérica y América del Sur. En el presente estudio se describen las características clínicas y epidemiológicas de 06 casos confirmados de paracoccidioidomicosis por el Instituto Nacional de Salud. Se observó la presencia del hongo por examen directo y cultivo en muestras de biopsias, absceso, y aspirado de ganglio. Las pruebas de inmunodifusión fueron realizadas en muestras de sangre provenientes de 04 pacientes. Todos los pacientes proceden de zonas tropicales o semitropicales (Tingo María, Oxapampa, Pucallpa y Chanchamayo que tienen una precipitación media anual de 1500 mm/año, humedad relativa del 82%, temperatura anual de 28°C - 30°C y altura inferior a 1814 m.s.n.m. Las principales características sintomatológicas encontradas incluyen aumento del tamaño de ganglios y tuberculosis pulmonar. P. brasiliensis fue aislado en 2/6 pacientes y en 4/6 de los casos se observó la presencia de anticuerpos precipitantes por inmunodifusión. Se concluye que el 83% de los pacientes presentaron linfoadenopatias y el laboratorio permite confirmar el diagnóstico.

  12. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  13. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  14. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  15. Ludopatía y epilepsia en demencia frontotemporal: Reporte de dos casos

    Directory of Open Access Journals (Sweden)

    Sheila Castro-Suarez

    Full Text Available RESUMEN La demencia frontotemporal es un trastorno neurodegenerativo cuyo subtipo más común es la variante conductual. Es considerada la causa de demencia más frecuente en menores de 60 años. Se presentan dos casos no emparentados cuyos síntomas típicos fueron: deterioro progresivo de la cognición, del comportamiento, alteraciones psiquiátricas como desinhibición, actos impulsivos, apatía, falta de empatía, estereotipias y cambios en los hábitos de alimentación. La resonancia magnética cerebral, en ambos casos, mostró atrofia frontotemporal a predominio izquierdo; en la evaluación neuropsicológica se evidenció alteraciones de las funciones ejecutivas. El primer caso cursó con ludopatía como síntoma inicial, motivo por el cual permaneció por un año en un centro psiquiátrico, siendo el segundo en Latinoamérica y uno de los pocos casos reportados en el mundo. El segundo caso presentó crisis epilépticas en su evolución.

  16. El tamaño del Poder Legislativo como modulador del sistema electoral en la democracia representativa, el caso costarricense

    Directory of Open Access Journals (Sweden)

    Diego González Fernández

    2014-07-01

    Full Text Available El tamaño de los poderes legislativos es, dentro de las democracias representativas contemporáneas, un modulador fundamental del sistema electoral. Más aún, en sistemas donde lo que prima son las fórmulas electorales de carácter proporcional –fórmula Hare, Hare Modificado, D’Hondt, entre otras- en la elección de los legisladores, como es el caso costarricense, y en general, en toda América Latina. Siendo así, se parte de dos premisas básicas: en primer término, un parlamento con mayor número de integrantes se traduce en que el sistema electoral realizará una repartición más adecuada de diputaciones por partido político; y, en segundo lugar, esta proposición se complementa defendiendo que en los poderes legislativos donde la relación de proporcionalidad entre representante-representado, es decir, el número de habitantes que representa un legislador muestre mayor proximidad, expresará una tendencia a una mayor calidad en la democracia. A partir de estas premisas, se vislumbra el fin de este artículo el cual estudia primeramente la perspectiva teórica del tema, para después profundizar en el abordaje contemporáneo con detalle en el caso costarricense. Ello mediante un estudio al artículo 106 de la Constitución Política y un abordaje comparativo con la región latinoamericana.

  17. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  18. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  19. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  20. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  1. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  2. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  3. DIVERTÍCULO RECTAL. REPORTE DE UN CASO

    OpenAIRE

    Ángel-P, Alberto; Cardona-R, Danilo

    2017-01-01

    RESUMEN Introducción: La enfermedad diverticular del colon es frecuente en la población general, afectando al 50% de las personas mayores de 50 años, sin embargo, los divertículos ubicados en el recto son excepcionalmente raros. El objetivo de este estudio es informar el caso de un hombre de 67 años con enfermedad diverticular de colon sigmoides y colon transverso, con un divertículo rectal que se diagnosticó durante una colonoscopia ambulatoria. Caso clínico: Hombre de 67 años quien cons...

  4. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  6. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  7. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  8. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  9. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  10. El caso Moro

    Directory of Open Access Journals (Sweden)

    Óscar Hernández Chinarro

    2012-06-01

    Full Text Available Se cumple el trigésimo tercer aniversario del secuestro y asesinato de Aldo Moro, todavía persisten muchos interrogantes sobre el caso. La historiografía de los últimos 20 años ha explicado la muerte de Moro como un hecho ineludible. La ratificación del Compromiso Histórico presentada por Berlinguer determinó que la CIA organizase una acción punitiva cuya finalidad era la eliminación física de Moro. El presente artículo intenta desmitificar el papel jugado por los servicios secretos norteamericanos y centra su atención en las Brigadas, planteando una nueva hipótesis para entender que ocurrió durante esos 55 días y que determinó la muerte de MoroPalabras claves: Aldo Moro, Brigadas Rojas, Italia, 1978, Democracia Cristiana, Mario Moretti, Estados Unidos _________________________AbstractUpon completion of the thirty-third anniversary the kidnapping and murder of Aldo Moro, there are still many questions about the case. The historiography of the last 20 years explained Moro's death as an inescapable fact. Ratification of Historic Commitment by Berlinguer determined that the CIA organize a punitive action was aimed at the physical elimination of Moro. This article attempts to demystify the role played by the U.S. secret services and focuses on the Brigades, proposing a new hypothesis to understand what happened during those 55 days and determined the death of Moro.Keywords: Aldo Moro, Red Brigades, Italy, 1978, Christian democracy,  Mario Moretti, United States

  11. MEXCODE* CASO DE ESTUDIO

    Directory of Open Access Journals (Sweden)

    Gabriel Arturo García Gómez

    2000-01-01

    Full Text Available El caso plantea la reactivación de un proyecto que se presentó en el año 1995 como alternativa para el desarrollo del centro del Valle y mejora de la eficiencia en el manejo del comercio exterior de la Cuenca Pacífica. El proyecto se revivió a raíz de la necesidad de la compañía patrocinadora de mejorar sus flujos de caja proyectados y la reciente autorización para su funcionamiento. El proyecto es el popularmente denominado “Puerto Seco” de la ciudad de Guadalajara de Buga, internamente nombrado Mexcode. Los estudios iniciales estaban encaminados a que el proyecto fuera manejado por el municipio de Buga, sin embargo, posteriormente se vio la necesidad de buscar que pasara a manos de la empresa privada. El municipio, después de analizar las propuestas de varios inversionistas de la región en las cuales se evaluaba la ubicación dentro de la zona de los predios de sus empresas, su área, proximidad a la línea férrea y a la doble calzada Buga-Tuluá (sitio de paso del 80% de la carga de importación y exportación por Buenaventura y evaluar aspectos relativos a su trayectoria empresarial y compromiso con el desarrollo de la región, decidió otorgarle el proyecto al Grupo Empresarial Agri-Supplies S.A.

  12. COMENTARIO AL CASO PINOCHET

    Directory of Open Access Journals (Sweden)

    Alberto Contreras Clunes

    2002-01-01

    Full Text Available El fallo en el caso Pinochet tiene distintas formas de ser analizado. De partida, desde un punto de vista político, también constitucional, del derecho penal. Sin embargo, nos abocaremos al estudio desde el punto de vista procesal, en especial a lo referido al Debido Proceso. Para ello se analizará los presupuestos, la solución dada por la Excma. Corte Suprema y las consecuencias del mismo. Además, se criticará la solución dada, desde la óptica de las garantías procesales del imputado, contenidas en el nuevo proceso penal y lo dispuesto en la Constitución y la Convención Americana de Derechos Humanos. Finalmente, se argumentará en favor de una interpretación finalista y armónica de la Constitución y los tratados internacionales de derechos humanos.The verdict of the Pinochet Case has different ways of being analyzed: from the political, the constitutional, and the penal law points of view. However, we will approach this study from the legal point of view, especially to that referred to as the Proper Process. To do this, the budgets, the solution given by the Most Excellent Supreme Court, and its consequences will be analyzed. Furthermore, the given solution will be criticized from the point of view of the legal guarantees of the accused contained in the new penal process and what is contained in the Constitution and in the American Convention of Human Rights. In conclusion, we will argue in favor of a final and harmonious interpretation of the Constitution and the international agreement of human rights.

  13. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  14. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  15. Celulitis por Acinetobacter junii-johnsonii adquirida en la comunidad: una presentación de caso

    Directory of Open Access Journals (Sweden)

    Andrés F. Henao-Martínez

    2012-06-01

    Full Text Available La infección de piel y tejidos blandos por Acinetobacter no relacionada con trauma es una presentación inusual. La mayoría de los casos descritos presentan enfermedades concomitantes y son causados por Acinetobacter baumanii. Se describe un caso de celulitis no traumática por A. junii-johnsonii con bacteriemia, de inicio en la comunidad y asociado con el tratamiento médico. De acuerdo con nuestro conocimiento, éste sería el primer caso reportado de infección de tejidos blandos y piel por A. juniijohnsonii.La vesícula hemorrágica podría ser una característica clínica de celulitis por Acinetobacter.   doi: http://dx.doi.org/10.7705/biomedica.v32i2.652

  16. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  17. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

  18. Vasculitis inducida por metimazol: Reporte de caso

    Directory of Open Access Journals (Sweden)

    Miguel Pinto

    2011-07-01

    Full Text Available Se reporta el caso de una paciente con enfermedad de Graves, que presentó vasculitis asociada al uso de metimazol. Mujer de 14 años, que acudió a consulta por presentar intolerancia al calor, tremor distal y palpitaciones. El examen físico mostró bocio difuso, y el perfil tiroideo, TSH suprimida y hormonas tiroideas elevadas. Los anticuerpos antiperoxidasa tiroidea fueron positivos. Se inició tratamiento con metimazol y beta bloqueadores. Después de 20 días, la paciente regresó por presentar malestar general, fiebre, poliartralgia, lesiones cutáneas maculopapulares y edema de miembros inferiores. Los anticuerpos antinucleares fueron negativos y los anticuerpos anticitoplasma de los neutrófilos (ANCA, positivos. Se suspendió el metimazol y se inició prednisona. Después de 10 días de tratamiento, las molestias desaparecieron y la paciente recibió I 131.Las vasculitis asociadas al uso de tionamidas son poco frecuentes, no dependen de la dosis y están asociadas a la presencia de anticuerpos tipo ANCA. Clásicamente, afectan a los vasos pequeños de la piel; sin embargo, también pueden afectar los riñones y pulmones. El cuadro clínico se caracteriza por artralgias y mialgias. En algunos casos puede ocurrir insuficiencia renal de grado variable. En la mayoría de casos, el cuadro remite con la suspensión de la droga; pero, en algunos se requiere el uso de glucocorticoides o inmunosupresores.(Rev Med Hered 2011;22:147-150.

  19. Análisis económico del activismo judicial: el caso de la Corte Constitucional colombiana

    Directory of Open Access Journals (Sweden)

    Jairo Andrés Castaño Peña

    2014-01-01

    Full Text Available Este escrito presenta una aproximación al fenómeno del activismo judicial desde la perspectiva del Análisis Económico del Derecho (AED. Como cometido, pretende mostrar que existen una serie de incentivos y de circunstancias que hacen que las decisiones de la Corte Constitucional colombiana se puedan calificar como activistas. Para tal fin, en primer lugar, se establecen unos derroteros básicos para la comprensión de la actividad judicial, específicamente de las funciones de control de constitucionalidad y de revisión de acción de tutela de la Corte Constitucional de Colombia; en segundo lugar, se realiza un acercamiento al concepto de activismo judicial, para, a continuación, presentar la formulación de políticas públicas y la creación de leyes como productos dentro de un modelo de mercado, esto con el fin de explicar y mostrar, desde el Análisis Económico del Derecho, las razones que explican la existencia del fenómeno del activismo judicial en el caso colombiano. En último lugar, se presentan dos casos de activismo judicial por parte de la Corte Constitucional colombiana: en primer término, el caso de la protección del derecho a la vivienda digna, o caso del UPAC, y en segundo término, el caso de la protección de los derechos de los recicladores de oficio; casos, uno y otro, donde se puede ver que existen incentivos que provocan decisiones activistas.

  20. Aspectos epidemiológicos relacionados con la lactancia materna durante el primer año de vida

    Directory of Open Access Journals (Sweden)

    Orlando Díaz Tabares

    2002-06-01

    Full Text Available Se realizó un estudio transversal para determinar el comportamiento de algunas variables epidemiológicas relacionadas con la lactancia materna durante el primer año de vida, y se tomaron como muestra las 24 madres que viven en el área del Consejo Popular número 2 de San Cristóbal, que parieron en los meses de enero, febrero y marzo del año 2000, las cuales fueron encuestadas al cumplir el año de parida. Se encontró una duración media de la lactancia materna exclusiva equivalente a 77 días, y de la lactancia materna en general de 137. Se comprobó riesgo relativo para el destete antes del cuarto mes de parida los casos de uso de tetes y biberones y exposición al estrés. Predominó la infección del tracto urinario, seguida por la enfermedad diarreica aguda (EDA entre los niños que enfermaron, y la mayor protección de la lactancia materna exclusiva se observó para la EDA.A crosswise study was carried out to determine the performance of some epidemiological variables related to breast feeding during the first year of life of the newborn and the sample was composed by 24 mothers who live in an area of People´s council No. 2 of San Cristobal, gave birth in January, February and March, 2000 and were surveyed one year after their deliveries. . The average length of exclusive breast-feeding was 77 days and of general breast feeding was 137 days. Relative risks were demonstrated for weaning before the fourth month of life in cases using pacifiers and feeding bottles and exposed to stress. Urinary tract infection prevailed, followed by acute diarrhea among sick infants and the greatest protection of the exclusive breast feeding was provided for acute diarrhea.

  1. Neuroblastomicose: registro de três casos

    Directory of Open Access Journals (Sweden)

    Ehrenfried O. Wittig

    1968-03-01

    Full Text Available São relatados três casos de neuroblastomicose de sintomatologia variada (urna forma tumoral cerebelar, urna forma abscedante troncular e cerebral e urna forma granulomatosa difusa. No caso da forma tumoral cerebelar havia associação com cisticercose cerebral. Alterações medulares não foram evidenciadas no único caso em que foi possível examinar êste setor do sistema nervoso central (caso 2.

  2. Raquitismo carencial: relato de caso

    OpenAIRE

    Porto, Juliana Antola et al.

    2005-01-01

    Introdução: O raquitismo é uma doença do tecido ósseo em formação, onde há falha na calcificação e conseguinte acúmulo de tecido osteóide. O raquitismo carencial é decorrente da deficiência dos precursores da vitamina D, sendo a causa de raquitismo mais facilmente evitável e tratável. Objetivo: Relatar um caso, revisar a etiopatogenia e o tratamento do raquitismo carencial. Relato de caso: Paciente masculino com 2 anos de idade, previamente hígido, consulta com dificuldade de deambular progre...

  3. Glucogenosis tipo I: reporte de dos casos en dos hermanos de Cartagena de Indias-Colombia

    OpenAIRE

    Alvear-Sedán Ciro; Barboza-Ubarnes, Miryam; Bonillas-Fierro Miguel [q.e.p.d

    2011-01-01

    CASO CLÍNICO: # 1. Producto del primer embarazo de padres no consanguíneos, con lactancia hasta los dos años. A los 18 meses deedad presentó distensión abdominal, hepatomegalia difusa no dolorosa, diarrea de mes y medio, debilidad generalizada, edemaprogresivo en cara y pies, anasarca y anemia. Vesícula, bazo y riñones normales y examen neurológico sin alteraciones. Nopresentó hipoglucemia, ácido láctico normal. Pruebas hepáticas alteradas; colesterol, triglicéridos y ácido úrico en el límite...

  4. Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae reproducidas en cautiverio

    Directory of Open Access Journals (Sweden)

    Adán Villagarcia Olmeño

    2014-12-01

    Full Text Available En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772. La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

  5. Escuela Inclusiva: estudio de caso sobre la inclusión del Trastorno de Espectro Autista

    OpenAIRE

    Ortuñez Vegas, Sonia

    2016-01-01

    La educación inclusiva sigue siendo hoy una asignatura pendiente. Este trabajo plantea, un estudio de casos en dos colegios de Zaragoza, respecto a las dificultades y las necesidades que tienen los docentes a la hora de trabajar con niños autistas y de qué manera podría ser posible la inclusión de este alumnado en centros ordinarios. En primer lugar realizamos un breve resumen del trastorno del espectro autista y la evolución de la educación inclusiva. En segundo lugar, se pres...

  6. Algunas enseñanzas de las crisis bancarias recientes: el caso uruguayo

    OpenAIRE

    José Manuel Quijano

    2005-01-01

    El trabajo indaga en algunas de las características de las crisis bancarias del presente así como en el desenlace que las mismas han tenido en los últimos años. Se analiza el caso de Uruguay y se hace referencia al de Argentina, quienes transitaron por una importante crisis cambiaria y bancaria en 1982 y veinte años después, en 2002, volvieron a tropezar con una nueva crisis de dimensión más amplia que la anterior y de graves consecuencias económicas y sociales. El primer apart...

  7. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  8. Validez de constructo y fiabilidad del «Cuestionario de ansiedad social para adultos» (CASO) en Colombia

    OpenAIRE

    Salazar, Isabel C; Caballo, Vicente E; Arias, Benito

    2016-01-01

    El «Cuestionario de ansiedad social para adultos» (CASO) es una medida de autoinforme desarrollada para los países de habla española y portuguesa. El objetivo de este estudio fue analizar la validez de constructo y la fiabilidad del CASO en Colombia. Participaron 5477 personas de la población general contestando el CASO y la «Escala de ansiedad social de Liebowitz-versión de autoinforme» (LSAS-SR). El análisis paralelo y el análisis factorial exploratorio del CASO arrojaron una solución de ci...

  9. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  10. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  11. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  12. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  13. Prototecosis Informe de tres casos

    Directory of Open Access Journals (Sweden)

    Miguel Guzmán

    1983-12-01

    Full Text Available Se presentan tres casos clínicos de prototecosis vistos y estudiados en el lnstituto Nacional de Salud. Uno corresponde a la forma tegumentaria y los otros dos a formas de bursitis del olécranon. Se discuten los aspectos biológicos, clínicos y de laboratorio de esta rara entidad causada por algas.

  14. Leucemia viral felina simultánea con otras patologías en tres casos clínicos diferentes

    OpenAIRE

    Ortiz A, José F

    2011-01-01

    La leucemia viral felina (ViLeF) es una patología, que se asocia con la presentación de varias enfermedades; el artículo presenta tres casos de pacientes cada uno con patologías diferentes que a su vez fueron positivos a ViLeF; no se descarta que esta enfermedad esté relacionada o sea la causa de las tres patologías, en el primer caso se encontró una anemia arregenerativa, en el otro, un carcinoma mamario y en el último, un proceso compatible con una peritonitis felina. Se describen la sintom...

  15. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  17. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  18. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  19. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  20. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  1. Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

    OpenAIRE

    Héctor Armando Durán Peralta; Luis Fernando Córdoba C

    2007-01-01

    Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando...

  2. Análisis de estabilidad del reactor pftr para una reacción con cinética de primer orden utilizando la funcional de lyapunov

    OpenAIRE

    Durán Peralta, Héctor Armando; Córdoba C, Luis Fernando

    2010-01-01

    Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizand...

  3. Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy

    2012-01-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS

  4. Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.

    Energy Technology Data Exchange (ETDEWEB)

    Linebarger, John Michael; Maffitt, S. Louise (New Mexico Institute of Mining and Technology, Albuquerque, NM); Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy

    2011-10-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.

  5. Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael

    2011-08-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.

  6. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  7. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  8. Consecuencias hidrogeológicas del cese de actividades mineras. El caso del "socavón general de desagüe" de Linares (Jaén)

    OpenAIRE

    Benavente Herrera, José; Hidalgo Estévez, Mari Carmen; Marín Lechado, Carlos; Rubio Campos, J. C.

    2002-01-01

    The general drainage gallery of the Linares mining district was designed to minimize elevation cost from dewatering the deepest levels of the underground works. Following the mining closure and the flooding of the mining voids, this gallery (the so-called "socavón") is draining by gravity groundwater resources of the Linares batolith. In addition, an exploitation of these resources is taking place by pumping directly from old shafts, some of them connected through the gallery. The gallery dis...

  9. MÉTODO DE CASOS. UNA METODOLOGÍA ACTIVA PARA ADQUIRIR APRENDIZAJES SIGNIFICATIVOS EN QUÍMICA

    Directory of Open Access Journals (Sweden)

    Clotilde Pizarro

    2015-01-01

    Full Text Available En este trabajo se aplica lametodología de casos en estudiantes de primer año de la carrera de Ingeniería en Prevención de Riesgos y Medioambiente. Para lo cual se presenta un caso real de contaminación, ocurrido en una escuela de la región de Valparaíso llamada “La Greda”. Se inicia la aplicación del caso entregando un extracto de la información recolectada de los medios de información y se les realiza una breve inducción acerca de la metodología a aplicar. Luego se realiza un plenario, en el que se debate acercade las posibles soluciones al problema y estableciendo una relación entre el caso y las unidades del programa de química.Se concluye que la aplicación del método de casos, fue una herramienta fructífera en los rendimientos obtenidos por los estudiantes, ya que el porcentaje de aprobación en promedio fue de un 75%, el cual es considerablemente mayor que años anteriores.

  10. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  11. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  12. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  13. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  14. Uveomeningencefalites: registro de dois casos

    Directory of Open Access Journals (Sweden)

    Wilson Luiz Sanvito

    1982-03-01

    Full Text Available Após considerações a propósito das manifestações clínicas das uveomeningencefalites, são relatados dois casos com características clínicas ligeiramente diferentes. No caso 1 tratava-se da doença de Harada, tendo o paciente apresentado quadro meningítico agudo acompanhado de confusão mental. O exame do líquido cefalorraquidiano evidenciou um quadro inflamatório do tipo linfo-monocitário e o paciente evoluiu com distúrbios acentuados da memória e uveíte bilateral. Após alguns meses de evolução, a doença deixou como seqüelas uma síndrome de Korsakoff e ambliopia acentuada no olho esquerdo. No caso 2 tratava-se de doença de Behcet, tendo o paciente apresentado dois surtos de meningite do tipo linfomonocitário, lesões herpetiformes na genitalia e uveíte no olho direito que evoluiu para amaurose. São feitas considerações sobre os aspectos etiopatogênicos destas afecções e sobre o controvertido uso dos corticosteróides em seu tratamento.

  15. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  16. El conocimiento científico como construcción social: Observaciones sobre el caso del VIH/SIDA desde las distinciones de la teoría general de los sistemas sociales

    Directory of Open Access Journals (Sweden)

    Karla Hernández

    2015-01-01

    Full Text Available El objetivo de este trabajo es problematizar el conocimiento científico desde una perspectiva sociológica a partir de la propuesta de la teoría general de los sistemas Sociales de Niklas Luhmann. En particular, se analiza la forma de construcción del conocimiento científico sobre el VIH/SIDA como un producto del sistema funcional científico y se reflexiona sobre las implicaciones que derivan de la utilización de conceptos como distinción, sistema/entorno, autopoiesis, diferenciación y acoplamiento estructural en la observación y construcción de un hecho científico. Ello nos sitúa en un debate con las propuestas tradicionalmente ofrecidas por los estudios sociales de la ciencia, así como con sus respectivos presupuestos teóricos.

  17. Complicações e seqüelas neurológicas da anestesia regional realizada em crianças sob anestesia geral: um problema real ou casos esporádicos? Complicaciones y secuelas neurológicas de la anestesia regional realizada en niños bajo anestesia general: ¿ Un problema real o casos esporádicos? Neurological complications and damage of regional block in children under general anesthesia: a real problem or sporadic cases?

    Directory of Open Access Journals (Sweden)

    Verônica Vieira da Costa

    2006-12-01

    mayoría de las veces se realiza después de la anestesia general, sea realmente segura. Existe el riesgo potencial de una lesión neurológica permanente o temporal cuando el paciente no puede informar la eventual parestesia o dolor, durante la realización de la anestesia regional, lo que genera inseguridad por parte de los anestesiólogos. El objetivo de este estudio fue el de evaluar la prevalencia de complicaciones y de secuelas neurológicas de la anestesia regional en niños bajo anestesia general. MÉTODO: En un análisis prospectivo se estudiaron niños sometidos a intervenciones quirúrgicas ortopédica y plástica reparadora bajo anestesia regional asociada a la anestesia general. La inducción y el mantenimiento de la anestesia fueron por vía venosa o por inhalación. Después de la anestesia general se realizaba anestesia regional y se evaluaba la existencia de complicaciones inmediatas, el número de punciones realizadas, complicaciones de medio plazo y la presencia de secuelas neurológicas. RESULTADOS: En un período de 13 meses se estudiaron 499 niños de los dos sexos, con edad promedio entre 6 y 7 años. La mayoría de los pacientes se sometió a la anestesia general asociada a la peridural lumbar o caudal. La prevalencia de complicación inmediata fue de un 3,6%, siendo la más frecuente el sangramiento al momento de la punción. La prevalencia de complicaciones en medio plazo fue de un 1,1%, siendo la más frecuente la hipoestesia y no hubo secuela neurológica a largo plazo. CONCLUSIONES: Los resultados del presente estudio están a tono con los de otros autores con relación a la baja prevalencia de complicaciones de la anestesia regional en niños bajo anestesia general, sin dejar secuelas neurológicas. Eso puede ser atribuido al uso de material adecuado y a la experiencia del equipo de anestesia.BACKGROUND AND METHODS: It has been questioned whether regional block in children, which most of the time is done under general anesthesia, is really

  18. Presión e intereses en torno al cargo de protector general de indios del Nuevo Reino de León: el caso de Nicolás de Villalobos, 1714-1734

    Directory of Open Access Journals (Sweden)

    Baeza Martín, Ascensión

    2010-06-01

    Full Text Available The pernicious transformation undergone by the system of use of the indigenous workpeople in the Nuevo Reino de Leon, characterized by the ravages and slavery to the Indians in the encomiendas or congregas, provoked their rebelliousness. The frequent assaults to the Spanish colonists and their properties, as well as the expeditions and punishments of these against the natives reflected the hard conditions of life in that province of the northeast of the Viceroyalty of Nueva España and the constant been military of the same one. With the substantial changes implanted from the viceregal government by means of the shipment in 1714 of the commissioner Francisco de Barbadillo Victoria and the creation by this one of the employment of General Indians Protector in that earth, one was to restrain this uncontrollable situation. The difficulty of which the figure of the protector, so necessary in the first times of the reforms, held fast, would let see the partisanship, passions and interests of the authorities and the diverse social sectors of that border region.

    La perniciosa transformación sufrida por el sistema de utilización de la mano de obra indígena en el Nuevo Reino de León, caracterizado por los estragos y esclavitud a los indios en las encomiendas o congregas, provocaban su rebeldía. Los frecuentes asaltos a los colonos españoles y sus propiedades, así como las expediciones y castigos de estos contra los aborígenes reflejaban las duras condiciones de vida en esa provincia del nordeste del Virreinato de Nueva España y el constante estado de guerra de la misma. Con los substanciales cambios implantados desde el gobierno virreinal mediante el envío en 1714 del comisionado Francisco de Barbadillo Victoria y la creación por éste del cargo de protector general de indios en esa tierra, se trató de frenar esta incontrolable situación. La dificultad de que se afianzara la figura del protector, tan necesaria en los primeros tiempos

  19. um estudo de caso

    Directory of Open Access Journals (Sweden)

    Maria N. Marques

    2007-01-01

    Full Text Available The Federal Designation nº 5440/05 establishes definitions and procedures for water quality control of supplying systems and defines mechanisms and instruments for transmitting information, to the general consumer, about the water quality for human consumption. The current guidelines for drinking-water standards (‘Portaria’ nº 518/04, item VI in article 9º of section IV: they charge the responsible ones for the operation of the water system to supply all the consumers information about the quality of the distributed water, in the terms of the Consumer Defense Code. A Water Quality Index (WQI is a numeric expression used to evaluate the quality of given body of water, which is easily understood by the population. Therefore, the purpose in this paper is to identify, among the several water quality indices described in the literature, a dynamic index of water quality for supplying, which may be used as a tool to simplify the report of the water quality data.

  20. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  1. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. Gestão do desempenho humano: um estudo de caso em um Hospital Geral de Fortaleza (CE Administration of the human acting: a case study in a General Hospital of Fortaleza, Ceará State

    Directory of Open Access Journals (Sweden)

    Maria de Fátima Marrocos Fontenele

    2010-06-01

    Full Text Available A temática deste trabalho apresenta questões sobre a prática da avaliação de desempenho funcional em uma organização pública de saúde. Este eixo de análise ganha destaque a partir das dificuldades de desenvolvimento de sistemas de avaliação com alianças entre políticas de concessão de incentivos financeiros, em um contexto cultural peculiar. Nesse sentido, é necessário admitir os limites dessa ferramenta gerencial. A partir de uma pesquisa qualitativa, utilizou-se um roteiro semiestruturado de perguntas aplicado aos servidores de um hospital geral público do Estado do Ceará. Obteve-se a caracterização do sistema de avaliação de desempenho utilizado pela instituição, podendo-se verificar sua adequação aos modelos propostos na literatura e a pertinência de seus propósitos com as percepções e expectativas dos servidores pesquisados.The thematic of this work presents questions on the practice of the Evaluation of functional performance in an organization of public health. This axle of analysis gains importance from the difficulties of developing evaluation systems with alliances between policies of concession of financial incentives, in a specific cultural context. In this direction, it is necessary to admit the limits of this management tool. From a qualitative research, a semi-structured questionnaire was applied to the staff (public servers of a public general hospital of Ceará State. It was observed the characterization of the performance evaluation system used in the institution, being able to verify its adequacy to the models proposed in the literature and the relevancy of its intentions with the perceptions and expectations of the searched servers.

  3. Filosofia naturale della causalità e del caso

    CERN Document Server

    Born, Max

    1962-01-01

    Introduzione ; causalità e determinismo ; esemplificazione : l'astronomia e la meccanica delle particelle ; contiguità ; principio di antecedenza e termodinamica ; caso ; caso e antecedenza ; materia ; caso ; conclusioni metafisiche.

  4. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  5. Infección pulmonar por Mycobacterium avium en paciente VIH/SIDA: Primer reporte en Perú

    Directory of Open Access Journals (Sweden)

    Juan Carrasco

    Full Text Available El complejo Mycobacterium avium (MAC es un patógeno que se encuentra en el medioambiente y causa infecciones tanto en pacientes inmunocompetentes como inmunocomprometidos. Se presenta el caso de un paciente VIH positivo varón de 38 años infectado por P. jirovecii y aparentemente infectado por Mycobacterium tuberculosis desde el año 2009, el cual fue tratado con antibioticoterapia para pneumocistosis y terapia antituberculosis (TB logrando mejoría parcial. En el año 2012 se le realizó nuevamente examen de cultivo y un nuevo tratamiento anti TB, frente a la sospecha de estar en presencia de una cepa de TB multidrogorresistente se recomienda realizar la identificación micobacteriana. El examen de cultivo fue positivo y el resultado genotípico resultó positivo para MAC. Se reporta el primer caso de un paciente VIH/SIDA con infección pulmonar por MAC en el Perú, así como una breve revisión de los aspectos epidemiológicos, clínicos y de tratamiento

  6. Elaboración y aplicación de una guía didáctica de técnicas Grafoplásticas “Aprendiendo con mis Manitas” para el desarrollo de la motricidad fina, para los niños y niñas del primer año de educación general básica de la unidad educativa verbo divino, de la parroquia Veintimilla, de la ciudad de Guaranda, provincia Bolívar, período 2013- 2014.

    OpenAIRE

    Gutiérrez Jarrín, Flor Patricia

    2015-01-01

    El tema denominado la elaboración y aplicación de una guía didáctica de técnicas grafoplásticas “Aprendiendo con mis Manitas” para el desarrollo de la motricidad fina, para los niños y niñas del primer año de Educación General Básica de la Unidad Educativa Verbo Divino, de la Parroquia Veintimilla, de la Ciudad de Guaranda, provincia Bolívar, período 2013- 2014. Se realizó con el objetivo de demostrar que la aplicación de las diferentes técnicas grafoplásticas permitieron desarrollar en lo...

  7. A Primer on Waste Water Treatment.

    Science.gov (United States)

    Department of the Interior, Washington, DC. Federal Water Pollution Control Administration.

    This information pamphlet is for teachers, students, or the general public concerned with the types of waste water treatment systems, the need for further treatment, and advanced methods of treating wastes. Present day pollution control methods utilizing primary and secondary waste treatment plants, lagoons, and septic tanks are described,…

  8. A Brief Primer on Self-Esteem

    Science.gov (United States)

    Robins, Richard W.; Trzesniewski, Kali H.; Donnellan, M. Brent

    2012-01-01

    Since the construct of "self-esteem" was first introduced over 100 years ago, a wealth of knowledge has been accumulated. Several conclusions about the nature of self-esteem can be reached that provide a foundation for future practice and research. In general, research shows that high self-esteem is associated with the behaviors, goals, and coping…

  9. A Primer on Developing Measures of Effectiveness

    Science.gov (United States)

    2010-08-01

    does not tell us how to secure the general populace, so we have to continue our research. In The Quest for Viable Peace, Ben Lovelock reports that...Resolution, ed. Robert C. Orr (Washington, DC: The CSIS Press, 2004), 40. 17. Ibid., 42. 18. Ben Lovelock , “Securing a Viable Peace: Defeating Militant

  10. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  11. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  12. Síndrome biopercular: presentación de dos casos y revisión de la literatura

    Directory of Open Access Journals (Sweden)

    Carlos Santiago Uribe

    2008-06-01

    Las pacientes presentan diplejía facio-faringo-gloso-masticatoria y parálisis volitiva selectiva de músculos oro-faciales. La evaluación neuropsicológica evidenció compromiso cognitivo, emocional y de la interacción social como parte de un síndrome de la convexidad frontal en el primer caso y, de retardo mental, en el segundo caso. La fonoaudiología demostró que las dos pacientes tenían dificultades en el proceso de masticación y deglución, y dificultades graves en el lenguaje verbal. El pronóstico de recuperación del lenguaje verbal es pobre, pero muchos pacientes pueden recuperar la deglución.

  13. Capital social y desarrollo económico. Los casos de Silicon Valley y Villa El Salvador

    Directory of Open Access Journals (Sweden)

    Pablo Galaso Reca

    2005-01-01

    Full Text Available Este artículo se refiere a las relaciones existentes entre el capital social y el desarrollo económico. Para ello, en primer lugar presenta un marco teórico que muestra la evolución del concepto de capital social, su clasificación, medición y algunas aplicaciones prácticas. Posteriormente, explica teóricamente los efectos del capital social en el desarrollo económico. Finalmente, analiza dos experiencias de desarrollo económico altamente vinculadas con el concepto de capital social: los casos de Silicon Valley y Villa El Salvador.

  14. Insulinoma canino: relato de caso

    Directory of Open Access Journals (Sweden)

    L. Padovani

    Full Text Available RESUMO O insulinoma é um tumor das células β do pâncreas, que têm a função de produzir e secretar insulina e, geralmente são malignos em cães. O presente trabalho descreve o diagnóstico e o manejo terapêutico de três casos de insulinoma. Os sinais clínicos dos animais relatados variaram de acordo com a severidade e a duração da hipoglicemia. O diagnóstico presuntivo se deu através dos sinais clínicos e da dosagem de insulina sérica no momento de mais intensa hipoglicemia e, o diagnóstico definitivo foi obtido por meio de exame histopatológico nos três casos relatados. O tratamento realizado variou de acordo com a intensidade dos sinais clínicos.

  15. Dermatomiositis: a propósito de 3 casos interesantes

    Directory of Open Access Journals (Sweden)

    Zianna Almanza Liranza

    2010-12-01

    Full Text Available Se presentan los casos de 3 pacientes atendidos en el Hospital Pediátrico «Juan Manuel Márquez», 2 de las cuales presentaron como primeras manifestaciones debilidad en los miembros inferiores y artritis que dificultaba la marcha de forma progresiva. El tercer paciente presentaba lesiones escamosas en la piel, hipopigmentadas en la cara y los miembros, acompañadas de astenia y artritis de las rodillas. Se realizaron estudios para concluir el diagnóstico, incluida la biopsia de músculo. Se aplicaron los criterios para confirmar el diagnóstico de dermatomiositis y se excluyeron otras enfermedades según el cuadro clínico y los exámenes complementarios realizados. A los 2 primeros pacientes se les indicó tratamiento inmunomodulador con prednisona y metotrexato, y al tercer paciente se le indicó prednisona y azathioprina. Se observó una buena respuesta al tratamiento y control de la enfermedad. El primer paciente falleció a los 4 meses de tratamiento a causa de complicaciones (vasculitis intestinal y sepsis asociada al tratamiento quirúrgico. Los restantes pacientes se siguen actualmente por consulta.

  16. Los intercambios virtuales lingüísticos y culturales en educación superior: un estudio de caso

    Directory of Open Access Journals (Sweden)

    María Victoria Guadamillas Gómez

    2017-03-01

    Full Text Available El estudio describe una intervención docente llevada a cabo en el campo de la telecolaboración interinstitucional y con el doble objetivo de incrementar el tiempo de práctica oral para la mejora lingüística (inglés/español y favorecer la toma de conciencia intercultural entre estudiantes universitarios en los contextos español y británico. La metodología aplicada da cuenta de las percepciones de estos participantes de manera cualitativa y del grado de implicación y participación de los discentes. En primer lugar, en este estudio de caso abordamos el término telecolaboración y recogemos aportaciones recientes en este ámbito; en segundo lugar, presentamos el proyecto y sus tres fases principales: toma de decisiones, desarrollo y evaluación. A continuación, analizamos los resultados de participación y los comentarios positivos y negativos obtenidos de los universitarios, según se refieran a los aspectos lingüísticos o culturales o a otros más generales relacionados con la experiencia de participación. Por último, en la discusión y las conclusiones hablamos del éxito de esta experiencia, el cual reside en la planificación y el diseño de tareas que han originado una alta participación.

  17. Getting Started: A Social Media Primer.

    Science.gov (United States)

    Ferguson, Dalya M; Kao, Lillian S

    2017-09-01

    Social media use has increased both in the general public and in the surgical profession. A variety of social media platforms have been used, with Twitter being one of the most common and interactive platforms. Common uses by surgeons and scientists for social media include dissemination of information, information exchange, education, research recruitment, community consultation for clinical trials, and hospital or surgeon ratings. As social media use increases, a new language as well as metrics has been developed to track impact and reach of research incorporating social media platforms. All surgeons should be encouraged to familiarize themselves with social media, regardless of whether or not they choose to actively engage in it.

  18. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  19. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  20. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  1. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  2. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  3. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  4. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  5. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  6. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  7. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  8. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  9. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  10. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  11. A primer for Chiral Perturbative Theory

    International Nuclear Information System (INIS)

    Scherer, Stefan; Schindler, Matthias R.; George Washington Univ., Washington, DC

    2012-01-01

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques. (orig.)

  12. A primer for chiral perturbation theory

    CERN Document Server

    Scherer, Stefan

    2012-01-01

    Chiral Perturbation Theory, as effective field theory, is a commonly accepted and well established working tool, approximating quantum chromodynamics at energies well below typical hadron masses. This volume, based on a number of lectures and supplemented with additional material, provides a pedagogical introduction for graduate students and newcomers entering the field from related areas of nuclear and particle physics. Starting with the the Lagrangian of the strong interactions and general symmetry principles, the basic concepts of Chiral Perturbation Theory in the mesonic and baryonic sectors are developed. The application of these concepts is then illustrated with a number of examples. A large number of exercises (81, with complete solutions) are included to familiarize the reader with helpful calculational techniques.

  13. La influencia del crimen organizado transnacional en el proceso de formulación de políticas públicas. Estudio de caso: Argentina 2001-2013

    OpenAIRE

    Marín Osorio, Iván Felipe

    2016-01-01

    Este estudio de caso analiza la influencia del Crimen Organizado Transnacional en la formulación de Políticas Públicas de seguridad en Argentina entre 2001 y 2013. En contraste con otros estudios, se considera que la relación de estos dos fenómenos debe recoger aspectos fundamentales de un enfoque de seguridad integral y multidimensional. En el caso de Argentina, durante 2001 el Crimen Organizado Transnacional ocupó el primer lugar en la agenda pública, lo cual derivó en una serie de acciones...

  14. Ascite meconial - relato de caso

    Directory of Open Access Journals (Sweden)

    Celeste Gomez Sardinha Oshiro

    2016-10-01

    Full Text Available INTRODUÇÃO: A ascite meconial resultante da perfuração intestinal fetal tem baixa incidência (1:30.000 nascimentos e elevada mortalidade (50%. Os achados ecográficos fetais incluem ascite e calcificações intra-abdominais. OBJETIVO: Relatar um caso de ascite meconial neonatal no Conjunto Hospitalar de Sorocaba. METODOLOGIA: Descrição do referido caso e revisão de literatura. RELATO DE CASO: Recém-nascido de J.A.P., masculino, de parto cesáreo por iteratividade em 12/05/2016, cuja mãe com 44 anos, sem intercorrências no pré-natal, negou consanguinidade, vícios e infecções; ultrassonografia obstétrica evidenciou ascite moderada, circunferência abdominal >p95, hepatomegalia e hidrocele. Ao nascimento, idade gestacional 3 8 2 /7 semanas, peso=3630g, comprimento=49 cm, Apgar 8/9. Apresentava abdome globoso, fígado a 4 cm do rebordo costal direito e hidrocele volumosa. Realizada paracentese com saída de 310 ml de líquido esverdeado (meconial. No 5o dia de vida, durante laparotomia, observou-se aderência de alças intestinais, perfuração de íleo terminal a 8 cm da vávula íleo-cecal, sendo realizada ileostomia. O anátomo-patológico de apêndice cecal evidenciou processo inflamatório crônico, neovascularização e fibrose. Paciente recebeu nutrição parenteral por 14 dias; houve progressão da dieta do 6o ao 36o dia de vida, recebendo alta em aleitamento materno e boa recuperação clínica. CONCLUSÃO: A ascite meconial por perfuração intestinal deve ser considerada no diagnóstico diferencial de ascite fetal. O diagnóstico ecográfico pré-natal é fundamental para o prognóstico pós-natal.

  15. Complex Adaptive Systems of Systems (CASOS) engineering environment.

    Energy Technology Data Exchange (ETDEWEB)

    Detry, Richard Joseph; Linebarger, John Michael; Finley, Patrick D.; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Ames, Arlo Leroy

    2012-02-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex physical-socio-technical systems which we must understand to design a secure future for the nation. The Phoenix initiative implements CASoS Engineering principles combining the bottom up Complex Systems and Complex Adaptive Systems view with the top down Systems Engineering and System-of-Systems view. CASoS Engineering theory and practice must be conducted together to develop a discipline that is grounded in reality, extends our understanding of how CASoS behave and allows us to better control the outcomes. The pull of applications (real world problems) is critical to this effort, as is the articulation of a CASoS Engineering Framework that grounds an engineering approach in the theory of complex adaptive systems of systems. Successful application of the CASoS Engineering Framework requires modeling, simulation and analysis (MS and A) capabilities and the cultivation of a CASoS Engineering Community of Practice through knowledge sharing and facilitation. The CASoS Engineering Environment, itself a complex adaptive system of systems, constitutes the two platforms that provide these capabilities.

  16. Criptococose palpebral: relato de caso

    OpenAIRE

    Souza,Murilo Barreto; Melo,Carlos Sergio Nascimento; Silva,Cristiana Silveira; Santo,Ruth Miyuki; Matayoshi,Suzana

    2006-01-01

    Relata-se o caso de uma paciente portadora de síndrome da imunodeficiência adquirida empiricamente tratada com esquema tríplice para tuberculose miliar. Durante a evolução clínica a paciente cursou com lesões comprometendo a pálpebra e conjuntiva tarsal à direita. A hipótese diagnóstica inicial foi de tuberculose ocular com comprometimento conjuntival e palpebral. A biópsia da lesão conjuntival mostrou presença do Criptococcus neoformans. Após o início do tratamento específico com anfotericin...

  17. El caso de Buzios - Brasil

    Directory of Open Access Journals (Sweden)

    Juana A. Norrild

    2007-01-01

    Full Text Available La relación entre sexo y turismo ha seguido diferentes caminos, desde el turismo para GLS hasta el turismo nudista o la prostitución. No obstante aún son pocas las iniciativas que tienden a interrumpir el flagelo, que deja grandes secuelas sociales y escandaliza a la opinión pública. Probablemente por el tabú que históricamente ha significado el sexo, suele ser problemática toda relación en la que esté implicado. Este artículo describe un estudio de caso realizado en el centro turístico de Buzios, en Brasil, donde se aplicaron tres variables en las cuales se encuentra involucrada la mujer, el turismo aparece como revelador del sexismo existente en la sociedad y queda manifiesta la eficacia de una política social de concientización en dos de las variables.

  18. Un caso inusual de rabdomiosarcoma

    Directory of Open Access Journals (Sweden)

    Caridad Verdecia Cañizares

    2011-09-01

    Full Text Available Los sarcomas de partes blandas aparecen a cualquier edad, aunque son más frecuentes en la cuarta década de la vida. Se denominan así a aquellos tumores que se originan en las estructuras que soportan el cuerpo o envuelven los órganos y tejidos, y es el rabdomiosarcoma el tumor de partes blandas más frecuente en edad pediátrica. Es rara la condición de intratabilidad, mientras que son frecuentes las recaídas tempranas y tardías después del tratamiento. Presentamos un caso de una paciente diagnosticada en etapa de recién nacida con una mala respuesta al tratamiento, con progresión en el curso de este (algo no habitual, pues, generalmente, existe una buena respuesta inicial y después puede haber recaídas.

  19. Feline dental radiography and radiology: A primer.

    Science.gov (United States)

    Niemiec, Brook A

    2014-11-01

    Information crucial to the diagnosis and treatment of feline oral diseases can be ascertained using dental radiography and the inclusion of this technology has been shown to be the best way to improve a dental practice. Becoming familar with the techniques required for dental radiology and radiography can, therefore, be greatly beneficial. Novices to dental radiography may need some time to adjust and become comfortable with the techniques. If using dental radiographic film, the generally recommended 'E' or 'F' speeds may be frustrating at first, due to their more specific exposure and image development requirements. Although interpreting dental radiographs is similar to interpreting a standard bony radiograph, there are pathologic states that are unique to the oral cavity and several normal anatomic structures that may mimic pathologic changes. Determining which teeth have been imaged also requires a firm knowledge of oral anatomy as well as the architecture of dental films/digital systems. This article draws on a range of dental radiography and radiology resources, and the benefit of the author's own experience, to review the basics of taking and interpreting intraoral dental radiographs. A simplified method for positioning the tubehead is explained and classic examples of some common oral pathologies are provided. © ISFM and AAFP 2014.

  20. Electronic medical devices: a primer for pathologists.

    Science.gov (United States)

    Weitzman, James B

    2003-07-01

    Electronic medical devices (EMDs) with downloadable memories, such as implantable cardiac pacemakers, defibrillators, drug pumps, insulin pumps, and glucose monitors, are now an integral part of routine medical practice in the United States, and functional organ replacements, such as the artificial heart, pancreas, and retina, will most likely become commonplace in the near future. Often, EMDs end up in the hands of the pathologist as a surgical specimen or at autopsy. No established guidelines for systematic examination and reporting or comprehensive reviews of EMDs currently exist for the pathologist. To provide pathologists with a general overview of EMDs, including a brief history; epidemiology; essential technical aspects, indications, contraindications, and complications of selected devices; potential applications in pathology; relevant government regulations; and suggested examination and reporting guidelines. Articles indexed on PubMed of the National Library of Medicine, various medical and history of medicine textbooks, US Food and Drug Administration publications and product information, and specifications provided by device manufacturers. Studies were selected on the basis of relevance to the study objectives. Descriptive data were selected by the author. Suggested examination and reporting guidelines for EMDs received as surgical specimens and retrieved at autopsy. Electronic medical devices received as surgical specimens and retrieved at autopsy are increasing in number and level of sophistication. They should be systematically examined and reported, should have electronic memories downloaded when indicated, will help pathologists answer more questions with greater certainty, and should become an integral part of the formal knowledge base, research focus, training, and practice of pathology.

  1. Oil, gas and other energies, a primer

    International Nuclear Information System (INIS)

    Legault, A.

    2007-09-01

    At a time when the topic of energy is front and centre, this book examines the basic concepts that are essential to grasping the energy issues of the 21 st century. Ail the main questions that people have about energy, especially oil and gas, are addressed, providing students, academics, journalists, representatives of government and other institutions and interested readers in general with the information they need to understand the complex, multifaceted energy sector. Abundantly illustrated, this book represents five years of exhaustive research on a fascinating and highly controversial topic. If discusses all the processes related to fossil forms of energy, from the formation of hydrocarbons (crude oil and natural gas) to the delivery of oil and gas to consumers. It also examines renewable energy options and climate change issues in addressing the major geopolitical challenges facing the energy sector. Content: 1 - The Extraordinary History of the Earth; 2 - The Formation of Oil and Gas; 3 - Energy, Past and Present; 4 - Renewable Energies; 5 - The Essence of Oil and Gas; 6 - Geography of Oil and Gas; 7 - The Outlook for Petroleum Prices and Demand Until 2030; 8 - Global Warming; 9 - Liquefied Natural Gas;10 - The Big Three: Russia, China and the United States

  2. A project manager's primer on data validation

    International Nuclear Information System (INIS)

    Ramos, S.J.

    1991-01-01

    While carrying out their central responsibility of conducting an environmental investigation in a high- quality, timely, and cost-effective manner, project managers also face a significant challenge due to the many inherent uncertainties associated with characterizing and remediating sites. From all aspects and considerations (health and financial risks; and technical, professional, and legal defensibility/credibility), the project manager must minimize the uncertainty associated with making decisions based on environmental data. A key objective for every project manager is to produce sufficient data of known and acceptable quality. In simple terms, the level of confidence in the gathered data directly relates to: (1) the upfront determination of the types and uses of the data needed (which drives the required quality of the data); (2) the ongoing verification that the prescribed methods by which the data are to be obtained and analyzed are being followed; and (3) the validation of the verified data to determine whether the preestablished data quality objectives have been met, therefore making the data adequate for their intended use(s). This paper focuses on the third clement of the equation for data quality, therefore implying that the first two elements (planning and verification) have been accomplished. The open-quotes Who,close quotes open-quotes What,close quotes open-quotes Why,close quotes open-quotes Whenclose quotes and open-quotes Howclose quotes of data validation are discussed in general terms

  3. El laboratorio virtual mediante el simulador interactive physics y su incidencia en el aprendizaje de cinemática en los estudiantes del primer año de bachillerato general unificado del colegio “Chambo”, periodo 2015-2016.

    OpenAIRE

    Padilla Padilla, Mauro David

    2017-01-01

    In the first year of bachillerato, the problem of how to relate theory and practice in a discipline such as physics, exact science where learning theoretically is not necessary with practice as its main axis among teachers and students. The present research aims to apply the virtual laboratory through the Interactive Physics simulator in the learning of kinematics in the first year students of Bachillerato General Unificado at the "Chambo" school, term 2015-2016, with a quasi-experimental des...

  4. Light front field theory: an advanced primer

    International Nuclear Information System (INIS)

    Martinovic, L.

    2007-01-01

    We present an elementary introduction to quantum field theory formulated in terms of Dirac's light front variables. In addition to general principles and methods, a few more specific topics and approaches based on the author's work will be discussed. Most of the discussion deals with massive two-dimensional models formulated in a finite spatial volume starting with a detailed comparison between quantization of massive free fields in the usual field theory and the light front (LF) quantization. We discuss basic properties such as relativistic invariance and causality. After the LF treatment of the soluble Federbush model, a LF approach to spontaneous symmetry breaking is explained and a simple gauge theory - the massive Schwinger model in various gauges is studied. A LF version of bosonization and the massive Thirring model are also discussed. A special chapter is devoted to the method of discretized light cone quantization and its application to calculations of the properties of quantum solitons. The problem of LF zero modes is illustrated with the example of the two/dimensional Yukawa model. Hamiltonian perturbation theory in the LF formulation is derived and applied to a few simple processes to demonstrate its advantages. As a byproduct, it is shown that the LF theory cannot be obtained as a 'light-like' limit of the usual field theory quantized on a initial space-like surface. A simple LF formulation of the Higgs mechanism is then given Since our intention was to provide a treatment of the light front quantization accessible to postgradual students, an effort was made to discuss most of the topics pedagogically and number of technical details and derivations are contained in the appendices (Author)

  5. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  6. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  7. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  9. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  10. SÍNDROME NEUROTÓXICO POR MORDEDURA DE Latrodectus mactans: REPORTE DE UN CASO PEDIÁTRICO Y REVISIÓN DE LITERATURA.

    Directory of Open Access Journals (Sweden)

    Oscar Alberto Castejón Cruz

    2015-06-01

    Full Text Available Lactrodectismo es un síndrome producido por mordedura de araña del género Latrodectus, el agente conocido como “Viuda Negra”. La incidencia es de 400 casos por año y su mortalidad de 1%. Siendo este el primer caso pediátrico reportado en Honduras. Caso Clínico: Escolar de 9 años, visita el área de Emergencia con 6 horas de evolución de mordedura de araña en mano derecha, ardor, dolor, enrojecimiento en sitio de la lesión, mialgias, artralgias, temblor fino y debilidad a la deambulación con disminución notable de la fuerza. Al evaluarlo taquicárdico, hipertenso con signos de agitación psicomotriz, diaforesis, edema bipalpebral, distensión abdominal y priapismo. Manejándose como un caso grave y egresado sin complicación alguna. Conclusiones: Este caso debe servir como guía para lograr un diagnóstico rápido, de tal manera que el diagnóstico de lactrodectismo sea considerado en los hospitales de manera oportuna. Palabras Clave: Araña viuda negra, picadura de araña, pediatría.

  11. Síndrome de Allgrove. Informe de casos.

    OpenAIRE

    Alejandro Román; Catalina Montoya; Juliana Zapata; Juan Manuel Alfaro; Vital Balthazar

    2009-01-01

    El síndrome de Allgrove fue descrito en 1978 por Allgrove et al. como una entidad familiar de origen desconocido caracterizada por deficiencia aislada de glucorticoides, acalasia esofágica y producción defectuosa de lágrimas, por lo que ha sido denominado síndrome triple AAA (adrenal insufficiency, achalasia, alacrima); por lo general aparece durante la primera década de la vida con disfagia o con crisis suprarrenal severa; son pocos los casos diagnosticados de novo en los adultos en quienes...

  12. Best Practices marketing relacional. Caso práctico

    OpenAIRE

    Cardama Otero, Maria

    2016-01-01

    el proyecto quiere servir de guía de buenas prácticas para el marketing digital de un comercio. Se desarrolla un caso práctico referido a una tienda de ropa infantil. This Project studies how a firm should develop a digital marketing strategy. We aim to propose ways to establish collaborative relationships to deliver value to customers and stakeholders, and see how they should be integrated in the overall value proposition. A general framework of best practices is described and applied to ...

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  16. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  17. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  18. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  19. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  20. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  1. Endocarditis infecciosa activa: 152 casos

    Directory of Open Access Journals (Sweden)

    Lucía R. Kazelian

    2012-04-01

    Full Text Available La endocarditis infecciosa es una enfermedad de baja incidencia que en las últimas décadas mostró modificaciones respecto de su presentación, posibilidad diagnóstica y tratamiento. A pesar de estos avances, la mortalidad hospitalaria sigue siendo muy elevada. Nuestro objetivo fue analizar las características de los pacientes con endocarditis infecciosa activa y su relación con la mortalidad hospitalaria a lo largo de 16 años. Se realizó un registro prospectivo entre 1994 y 2010 de pacientes ingresados con endocarditis. Se analizaron características clínicas, evolución y tratamiento y se registraron los eventos intrahospitalarios. Ingresaron 152 pacientes, 64.5% varones, edad 45 ± 16 años, las causas más frecuentes de cardiopatía de base fueron: congénita 32 (21% y reumática 20 (13.2%. Los motivos de internación fueron síndrome febril 116 (76.3% e insuficiencia cardíaca 61 (40.1%. Se identificó el agente infeccioso en 106 (69.7% de los casos, el más frecuente fue Streptococcus viridans. El ecocardiograma mostró vegetaciones en 123 (80.9% de los pacientes y 88 (57.8% presentaron complicaciones durante su internación, siendo la más frecuente la insuficiencia cardíaca. Se indicó tratamiento quirúrgico en 96 (63.1% de los casos, fundamentalmente por insuficiencia cardíaca en 66. La mortalidad hospitalaria global fue 46 (30.2%. El desarrollo de complicaciones en la internación, la indicación de cirugía y la presencia de insuficiencia cardíaca refractaria al tratamiento fueron predictores independientes de mortalidad hospitalaria, mientras que la presencia de vegetaciones resultó un predictor independiente de mejor supervivencia. La identificación temprana de estos predictores descriptos podría ayudar a mejorar los resultados.

  2. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  3. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  4. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  5. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  6. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  7. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  8. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  9. Abdomen agudo ocasionado por apendicitis aguda de probable origen tuberculoso. Informe de un caso

    OpenAIRE

    Montiel-Jarquín, Álvaro José; Alvarado-Ortega, Iván; Romero-Figueroa, María del Socorro; Rodríguez-Pérez, Fabiola; Rodríguez-Lima, Felipe; Loria-Castellanos, Jorge

    2017-01-01

    RESUMEN Antecedentes: la apendicitis aguda tuberculosa es una enfermedad rara, constituye de 0,001 % a 0,01 % de las formas clínicas de tuberculosis. Se presenta un caso de apendicitis aguda probablemente tuberculosa como causa de abdomen agudo quirúrgico. Caso clínico: hombre de 29 años con cuadro de dolor abdominal leve a moderado que se intensificó y localizó en el hemiabdomen derecho, claudicación, febrícula, vómito, mal estado general, leucocitosis de 11 300/µL y neutrofilia de 91 %....

  10. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  11. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  12. Hemofilia A neonatal: reporte de un caso en Sincelejo (Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Mendoza-Herrera

    2013-01-01

    Full Text Available La hemofilia es una enfermedad hemorrágica hereditaria caracterizada por la deficiencia funcional o cuantitativa del factor VIII (hemofilia A o del factor IX (hemofilia B de la coagulación. El diagnóstico de la hemofilia es eminentemente clínico; situación clave que ofrece una ventana de oportunidad para que el médico de primer nivel de atención esta - blezca un diagnóstico oportuno y eficiente. Los datos clínicos de los dos tipos de hemofilia son sustancialmente idénticos y varían solo en relación con el grado de la deficiencia. En este trabajo se describe un caso de un recién nacido que presentó un hematoma como consecuencia de una venopunción. El paciente presentó prolongación en el tiempo parcial de tromboplastina y una disminución del Factor VIII de la coagulación, confirmándose el diagnóstico de hemofilia A. Se inició tratamiento con factor VIII recombinante y el paciente presentó una gran mejoría de cuadro clínico. Este trabajo tiene como objetivo alertar al cuerpo médico sobre la importancia de conside - rar esta enfermedad dentro del diagnóstico diferencial en los síndromes hemorrágicos del recién nacido, incluso sin la existencia de antecedentes famili ares. El tratamiento apropiado generará un impacto positivo en la salud de los pacientes y su familia, reduciendo con ello las complicaciones, costos por hos pitalización y muerte.

  13. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  14. Al encuentro del lugar: caso de La parada del tonto en Concepción, Chile

    Directory of Open Access Journals (Sweden)

    Hugo Capellà

    2014-09-01

    Full Text Available Los lugares de encuentro se establecen en torno a nodos que terminan por convertirse en hitos colectivos, más allá de su forma. En el caso de La parada del tonto en la ciudad de Concepción, nos encontramos con un curioso ejemplo de un céntrico punto de encuentro que ha terminado por convertirse en un lugar con nombre propio. En el presente artículo nos centraremos, en primer lugar, en la construcción de lugares desde su dimensión no solo espacial, sino también temporal, incidiendo en la importancia histórica que han tenido los relojes como hito temporal. En segundo lugar, nos adentraremos en el caso de estudio específico de La parada del tonto, de su transformación de nodo hasta convertirse en hito de referencia colectiva. Finalmente, concluiremos con una teorización sobre la dimensión universal del hito temporal, como sentido del lugar o topoi, cohesionador de un legado colectivo.

  15. Estudio de caso y aprendizaje cooperativo en la universidad

    Directory of Open Access Journals (Sweden)

    Pedro Aramendi Jauregui

    2014-01-01

    Full Text Available Diseñar los planes de estudio en función del desarrollo de competencias demanda cambios metodológicos importantes. El método de caso es una de las estrategias de enseñanza y aprendizaje más adecuadas para desarrollar las competencias orientadas al trabajo en equipo y al fomento de la colaboración. El artículo que se presenta es un resumen del proyecto de innovación “El estudio de caso y el aprendizaje cooperativo en la universidad” (PIE-2010-2012 financiado por la Universidad del País Vasco. El objetivo general del proyecto es implementar el método de caso en las asignaturas de Organización de Centros (SocioEducativos (titulaciones de Pedagogía y Educación Social. MÉTODO: Se han seleccionado dos grupos de segundo curso de la titulación de Educación Social (uno en euskera y otro en castellano y otros dos del mismo curso de Pedagogía en ambos idiomas. En uno de los grupos de cada titulación se trabajaron técnicas de dinámica de grupo y en otro se desarrolló la estrategia del método de caso sin la ayuda de ellas. El alumnado evaluó la experiencia mediante un diario de grupo. RESULTADOS: Los datos indican que el alumnado está satisfecho con las actividades de aprendizaje realizadas en clase, las competencias de la titulación se desarrollan de manera satisfactoria y el funcionamiento de los grupos experimentales, en general, es mejor que el de los grupos control. La eficacia del trabajo grupal está estrechamente vinculada con variables de tipo relacional. DISCUSIÓN: La cooperación, la ayuda y la supervisión de tareas entre los miembros del grupo fomentan la interacción y el sentimiento de seguridad entre los estudiantes que tienen dificultades para lograr los objetivos de aprendizaje. Un alumno o alumna que se siente respaldado por su grupo a nivel académico, afectivo y relacional probablemente va a percibir un contexto de trabajo más seguro, inclusivo y acogedor.

  16. Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

    Directory of Open Access Journals (Sweden)

    Cesar Augusto Hernández-Suarez

    2016-09-01

    Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

  17. Caracterización de la fibrosis quística en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Gladys Fuentes Fernández

    Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

  18. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  19. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  20. An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, M. D.; Higgins, R. H.

    1985-01-01

    The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

  1. Agenda pública local. Los casos de los municipios de El Carmen de Viboral y Turbo, Antioquia-Colombia

    Directory of Open Access Journals (Sweden)

    Olga Lucía Zapata Cortés

    2016-01-01

    Full Text Available La conformación de la agenda gubernamental en los municipios de El Carmen de Viboral y Turbo recorrió caminos diferentes. En el primer caso, se propuso una Asamblea Municipal como espacio de participación en el marco de la formulación del Plan de Desarrollo; en el segundo caso, se prefirió la contratación de un consultor externo para la elaboración del Plan de Desarrollo y hubo escasa participación ciudadana. Mediante un estudio de caso, apoyado en el análisis documental y el enfoque de corrientes múltiples para el estudio de la agenda pública, se observan formas diferenciadas de conformar la agenda, así como de aprovechar la participación de las comunidades en este proceso. También se observa que a pesar de las capacidades y fortalezas que trae consigo la presencia de la universidad pública en estos municipios, la incidencia de la Universidad de Antioquia en la configuración de la agenda local es escasa.

  2. Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

    Directory of Open Access Journals (Sweden)

    Héctor Armando Durán Peralta

    2007-01-01

    Full Text Available Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR, en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando la funcional de Lyapunov. Se trabaja con una cinética de primer orden pues un objetivo de este artículo es mostrar cómo se aplica la funcional de Lyapunov al análisis de un reactor de parámetros distribuidos, dado que es casi inexistente la literatura sobre el método de la funcional de Lyapunov aplicada a la estabilidad de reactores (técnica usada en el análisis de estabilidad de sistemas en ingeniería eléctrica. El análisis de estabilidad dio como resultado perfiles de temperatura y concentración asintóticamente estables para los casos PFTR isotérmico, no isotérmico con constante cinética independiente de la temperatura y PFTR no isotérmico adiabático. Para el PFTR con retiro de calor el análisis condujo a una región de estabilidad asintótica y a una región incierta donde puede o no haber oscilaciones.

  3. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  4. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  5. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  7. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  8. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  9. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  10. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  11. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  12. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  13. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  14. Teratocarcinosarcoma rinosinusal: Reporte de un caso

    OpenAIRE

    González G,Claudia; Iñiguez,Rodrigo; Aranís Jiménez,Carolina; Castiblanco Galvis,Adriana

    2008-01-01

    Teratocarcinosarcoma rinosinusal es una neoplasia maligna infrecuente y rara, que combina elementos de teratoma y carcinosarcoma. Se compone de epitelio benigno o maligno (fibroblastos), mesénquima (cartílago, hueso o músculo liso) y elementos neurales. Hasta el año 2008 se han reportado un total de 63 casos de ubicación rinosinusal. Presentamos el caso de un teratocarcinosarcoma de fosa nasal, en un hombre de 67 años de edad, que consultó por obstrucción nasal rápidamente progresiva. La lesi...

  15. Afasia global sem hemiparesia: relato de caso

    OpenAIRE

    SILVA,MARCUS TULIUS TEIXEIRA DA; CAVALCANTI,JOSÉ LUÍS DE SÁ; MOREIRA,DENISE MADEIRA

    2000-01-01

    Afasia global geralmente é acompanhada por hemiparesia direita devido à extensão da lesão subjacente. Recentemente têm sido registrados na literatura casos em que tal síndrome ou não se acompanha do déficit motor ou este é apenas transitório, sendo esta condição conhecida como afasia global sem hemiparesia (AGSH). Relatamos caso de AGSH devido a infarto cerebral embólico cardiogênico, corroborando a tese de que esta condição pode ter valor preditivo para o diagnóstico de infartos embólicos....

  16. Relato de caso: esclerose tuberosa

    Directory of Open Access Journals (Sweden)

    Samuel Simis

    2016-10-01

    Full Text Available Introdução: O Complexo de Esclerose Tuberosa (CET é uma síndrome neurocutânea transmitida hereditariamente, de traço autossômico dominante e que se manifesta por uma tríade clássica: deficiência mental, convulsões e adenoma sebáceo. A mutação responsável pela síndrome está presente em até 85% dos portadores de CET e.ocorre nos genes supressores tumorais TSC1 e TSC2, que produzem hamartina e tuberina, respectivamente.A prevalência do CET é de 1:10.000 a 1:170.000, atinge mais indivíduos do sexo masculina e é rara em negros. Relato de Caso: R.C.S.B., paciente do sexo feminino, 16 anos, vem encaminhada ao ambulatório de neurologia devido a quadro de convulsões tônico-clônicas generalizadas e crises de ausência diárias há 1 ano, mas com história de convulsões aos 2 anos que cessaram espontaneamente. Está em tratamento com fenitoína 200mg/dia e carbamazepina 800mg/dia, mas ainda apresenta crises de ausência. A paciente apresenta as lesões cutâneas típicas do CET: adenomas sebáceos (angiofibroma em face distribuídos simetricamente entre nariz e bochechas, envolvendo ainda fronte e queixo. Não há sinais de retardo mental. A ressonância nuclear magnética revelou imagens com padrão compatível com áreas de desmielinização. O eletroencefalograma encontrava-se normal. Conclusão: O tratamento do CET ainda é um desafio para muitos neurologistas, uma vez que não há tratamento específico para doença. A paciente deve contar com equipe multidisciplinar, por vezes é necessário acompanhamento com neurologista, dermatologista, geneticista, psicólogos e outros, dependendo das manifestações do CET. A finalidade terapêutica é a qualidade de vida da paciente, que pode ser prejudicada pelas várias convulsões ou alterações estéticas da doença.

  17. Síndrome de carcinoma de células basales nevoides (Síndrome Gorlin: reporte de dos casos y revisión de la literatura

    Directory of Open Access Journals (Sweden)

    María del Carmen Castro-Mujica

    Full Text Available RESUMEN El síndrome Gorlin (SG es una condición genética, con patrón de herencia autosómico dominante, con penetrancia completa y expresividad variable, debida a mutaciones germinales en los genes PTCH1 o SUFU, los cuales son componentes de la vía molecular Sonic hedgehog. El SG se caracteriza por la presencia de múltiples carcinomas de células basales nevoides, quistes odontogénicos, calcificación de la hoz del cerebro y lesiones en sacabocado en palmas y plantas. Este es el primer reporte de casos en el Perú sobre pacientes con SG, que cuentan con evaluación y asesoría genética. Presentamos dos casos de SG que cumplen criterios clínicos del síndrome y una revisión de la literatura.

  18. Cáncer de mama bilateral sincrónico. Revisión de la literatura y presentación de un caso

    Directory of Open Access Journals (Sweden)

    Lidia Torres Ajá

    2012-05-01

    Full Text Available Se conoce como cáncer bilateral sincrónico a los tumores primarios en ambas mamas, que son diagnosticados simultáneamente. Su aparición es poco frecuente, y se presenta aproximadamente en el 1- 2,5 % de todos los pacientes. Se informa el caso de una paciente de 57 años, que acudió a consulta por presentar nódulos mamarios bilaterales, diagnosticados, mediante biopsia por parafina, como cánceres mamarios histológicamente diferentes. Es el primer caso de cáncer mamario bilateral sincrónico diagnosticado en la provincia de Cienfuegos, por lo cual consideramos de interés su publicación y divulgación.

  19. Reintegro y permanencia universitaria en Bogotá : el caso de la Facultad de Ingeniería de la Universidad Distrital, 2000-2009

    OpenAIRE

    Díaz Franco, María Camila

    2012-01-01

    El presente trabajo de investigación, estudia a través del caso de la cohorte del 2000 de la Facultad de Ingeniería de la Universidad Distrital, el tipo de coyuntura que le permitió a este grupo de jóvenes reingresar a la Universidad y culminar la carrera al haber tenido que abandonarla en un primer momento, por problemas socio-económicos y/o académicos. Por medio del estudio del reintegro universitario, este trabajo se enmarca en el campo, poco explorado, de la existencia y efectividad de m...

  20. Espasmos epilépticos de inicio tardío: presentación de un caso clínico

    OpenAIRE

    Capote, Gabriela; Cerisola, Alfredo; Scavone, Cristina

    2009-01-01

    Introducción: los espasmos epilépticos son un tipo específico de crisis epiléptica caracterizada por una contracción muscular breve y brusca que abarca predominantemente el tronco y las extremidades. Cuando aparecen durante el primer año de vida, se presentan en salvas y se asocian al patrón electroencefalográfico típico de hipsarritmia, constituyen el síndrome de West. Es interesante discutir la clasificación nosológica de los casos que se presentan con espasmos epilépticos en salvas de inic...

  1. Incremento de la competencia comunicativa en dos adultos con Parálisis Cerebral mediante el dispositivo Makey-Makey. Un estudio de caso

    OpenAIRE

    Calleja, Marina; Luque, María Luisa; Rodríguez, José Miguel; Liranzo, Ana

    2015-01-01

    En este trabajo se presentan dos casos de parálisis cerebral (PC) de componente espástico y con graves problemas de comunicación como resultado de una fuerte disartria. Esta disartria les produce una baja inteligibilidad de habla, lo que les crea grandes dificultades en los procesos de interacción comunicativa y social. El objetivo de este estudio fue doble. En primer lugar, comprobar si era posible convertir el dispositivo conocido como Makey-Makey (Mk-Mk), inicialmente concebido...

  2. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  3. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  4. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  5. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  6. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  7. ANÁLISIS DE LOS PROCESOS DE PARTICIPACIÓN PÚBLICA, CASO DE ESTUDIO: “FACULTAD DE CIENCIAS INFORMÁTICAS-ULEAM”

    Directory of Open Access Journals (Sweden)

    Alex Santamaría Philco

    2015-12-01

    Full Text Available Esta contribución sintetiza un análisis realizado a la aplicación de un proceso de participación pública por medio de un prototipo informático en un experimento realizado con estudiantes y docentes de la Universidad Laica Eloy Alfaro de Manabí, con el propósito de obtener datos para el futuro diseño de un método estándar adaptable a cualquier dominio de aplicación incorporando a las Tecnologías de Información y Comunicación “TIC’s”. En primer lugar, con una base teórica, se hace uso de un modelo de proceso que representa el ciclo de vida de un proceso de participación pública. En segundo lugar se diseña el prototipo de soporte, utilizando la metodología de desarrollo Rational Unified Process “RUP”, que permite la automatización del modelo, el cual consta de dos herramientas: una orientada al usuario experto en participación pública desarrollada en Visual Studio .Net; y una segunda orientada al participante o ciudadano en general creada para un entorno web en lenguaje PHP. Posteriormente, la integración de ambas herramientas y su correcto funcionamiento se evalúan con pruebas funcionales, no funcionales y la aplicación a un caso de estudio con estudiantes y docentes universitarios permitiendo obtener resultados favorables que demuestran la aplicabilidad del trabajo propuesto.

  8. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  9. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  10. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  11. Un caso de hernia diafragmatica (Agenesia parcial del hemídiafragma izquierdo plastia del díafragma con pulmón atelectásico

    Directory of Open Access Journals (Sweden)

    Alfonso Bonilla Naar

    1951-06-01

    Full Text Available Hospital de la Misericordia. Servicio del doctor Martínez. Sala Rosa. C. J. P. E. 10 años. N. El Charquito (Soacha. F. de L .Septi~tnbre 12 de 1950. F. de S. Noviembre 5 de 1950. D. Preliminar, neumonía. C. de ingreso. Consulta porque desde hace dos días tiene dolor abdominal difuso, vómito, estreñimiento, anorexia y fiebre (vomitó un Ascaris. Se trata del primer caso operado en nuestro medio de una hernia diafragmática (por agenesia y vale anotar que según Meyer (1 quien cita a Sagal, hasta 1.933 sólo se conocian doce casos. Harrington (2 cita 12 casos en la Mayo Clinic. Hasta ahora, el defecto del diafragma se había cerrado con faciaperirrenal o con músculo (gran dorsal. En este caso se ensayó con éxito una plastia con un lóbulo pulmonar atelectásico. (Original.

  12. Primer aislamiento en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina

    Directory of Open Access Journals (Sweden)

    Laura Errecalde

    Full Text Available Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a la meticilina adquirido en la comunidad. Durante el tratamiento con vancomicina y daptomicina, se observó un aumento gradual de la CIM de vancomicina de 1 µg/ml (VSSA a 2 µg/ml (h-VISA y a 4 µg/ml (VISA, y la emergencia de no sensibilidad a daptomicina (CIM = 4 µg/ml. Al suspender la vancomicina y la daptomicina, la cepa revirtió al fenotipo de sensibilidad a ambas drogas. Es mandatorio evaluar por CIM la sensibilidad a vancomicina y a daptomicina intratratamiento cuando estas drogas se usan como terapia.

  13. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  14. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  16. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  17. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  18. Cuartos molares supernumerarios: relato de caso clínico

    Directory of Open Access Journals (Sweden)

    Daniela Nascimento Silva

    2006-04-01

    Full Text Available Los dientes supernumerarios se diagnostican mediante exámenes radiográficos de rutina, pues generalmente son asintomáticos. Los cuartos molares representan el segundo grupo de dientes supernumerarios con más frecuencias; ocurren en posición distal a los terceros molares, especialmente en el maxilar superior, y en la mayoría de casos, estos están incluidos. El objetivo de este artículo es realizar la presentación de un caso, de una mujer de 30 anos con los cuartos molares incluidos en el maxilar inferior y describir la técnica para su remoción.Supernumerary teeth are generally asymptomatic and are diagnosed by routine X-ray tests. The fourth molar teeth represent the second group of the most frequent supernumerary teeth, occur in distal position to the third molar teeth, specially in the superior maxilla and, in most of the cases, they are included. The aim of this paper is to comment on the case of a 30-year-old woman with the fourth molar teeth included in the inferior maxilla and to describe the technique used for their removal.

  19. Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

    Science.gov (United States)

    Pitta, João; Branco, Teresa C; Portugal, Jaime

    2018-05-01

    Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

  20. Análisis del clima familiar y resiliencia en una muestra de estudiantes universitarios de primer curso

    OpenAIRE

    Caamaño Fandiño, Alba María

    2016-01-01

    Traballo Fin de Grao en Educación Social. Curso 2015-2016 [ES] La modalidad elegida para desarrollar este Trabajo de Fin de Grado es la de iniciación a la investigación de campo. Así, este estudio se plantea con el objetivo general de analizar la resiliencia y el clima familiar en una muestra del alumnado universitario de primer año, en esta ocasión, perteneciente a la Universidad de Santiago de Compostela. La sociedad cambia constantemente y, con ella, las necesidades de los individuos...

  1. HIPOTIROIDISMO CANINO, PRESENTACION DE UN CASO ATIPICO

    Directory of Open Access Journals (Sweden)

    Juan Carlos Ballut P

    2004-12-01

    Full Text Available Este trabajo describe las características clínicas de un caso de hipotiroidismo atípico, catalogado como de presentaciónoculta, caracterizado por signos relacionados con miopatía, neuropatía, deterioro del estado mental, sangrado

  2. INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz

    2013-01-01

    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  3. Brain MRI lesions in neuromyelitis optica: clinical case; Lesiones cerebrales de resonancia magnetica en neuromielitis optica: caso clinico

    Energy Technology Data Exchange (ETDEWEB)

    Rosales Bravo, Luis Guillermo; Heyden Cordero, Marvin; Chinchilla Weinstok, Dennis; Mendelewicz Goldwaig, Isaias, E-mail: neurologia.cima@gmail.com [Caja Costarricense del Seguro Social, Hospital Mexico, Div. de Neurologia, San Jose (Costa Rica)

    2011-10-15

    Many cases of patients with neuromyelitis optica have submitted without demyelinating lesions in the cerebral white matter, it has documented that this entity can cause from the onset of illness or through its natural evolution. Diagnostic methods currently as Magnetic Resonance Imaging (MRI) and specific antibodies in plasma (such as antiaquaporin-4) have been diagnosed of neuromyelitis optica cases that were initially confused with multiple sclerosis. Disease in Costa Rica has been little prevalent and is not exactly known what the prevalence and incidence. The degree of disorder is illustrated through a case study, both in the cerebral white matter as spinal cord, in a patient with neuromyelitis optica during a follow-up period of 4 years. This is the first case that has been reported in the scientific literature of Costa Rica. (author) [Spanish] Muchos casos de pacientes con neuromielitis optica se han presentado sin lesiones desmielinizantes en la sustancia blanca cerebral, se ha documentado que esta entidad puede causarlas desde el inicio de la enfermedad o a traves de su evolucion natural. Los metodos de diagnostico en la actualidad como la Imagen por Resonancia Magnetica (IRM) y la determinacion de anticuerpos especificos en plasma (como la antiaquaporina-4) han logrado diagnosticar algunos casos de neuromielitis optica que inicialmente fueron confundidos con esclerosis multiple. La enfermedad en Costa Rica ha sido poco prevalente y no se ha conocido con exactitud cual es la prevalencia e incidencia. El grado de afeccion ha sido ilustrado a traves de un caso clinico, tanto en la sustancia blanca cerebral como espinal, en un paciente con neuromielitis optica durante un periodo de seguimiento de 4 anos. Este es el primer caso que ha sido reportado en la literatura cientifica de Costa Rica. (autor)

  4. CASO AlbAm S.A.

    Directory of Open Access Journals (Sweden)

    Ricardo Goulart Serra

    2015-12-01

    Full Text Available RESUMO Os analistas financeiros da AlbAm, uma empresa do setor de autopeças, devem avaliar duas opções de aquisições (Cardblue e Garciadores. O objetivo do caso é servir de oportunidade para os alunos vivenciarem uma decisão de investimentos por meio do lucro econômico. Uma análise superficial certamente levará a decisão equivocada. Levando-se todos os aspectos do caso em consideração, chegar-se-á a uma solução que pode surpreender alguns alunos, uma vez que a empresa melhor gerida não será a melhor oportunidade de investimento. Também se pode aproveitar o caso para discutir a superficialidade da adoção do EBITDA como métrica de gestão comparativamente a uma métrica de valor agregado (lucro econômico - a melhor solução também não é aquela que gera o maior aumento em EBITDA. O caso pode ser usado em disciplinas de finanças (finanças corporativas ou avaliação de empresas em cursos de graduação, pós-graduação ou especialização. Todas as empresas e pessoas relatadas neste caso são fictícias.

  5. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  6. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  7. Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba

    Directory of Open Access Journals (Sweden)

    Carlos Ramírez Pérez

    2009-12-01

    Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis

  8. Protagonismo de los alumnos en el aprendizaje: Una experiencia en el primer curso de medicina

    Directory of Open Access Journals (Sweden)

    Agustín Hidalgo

    Full Text Available Objetivo. Presentar y analizar la experiencia realizada en una asignatura del primer curso del Grado de Medicina para abordar competencias formativas en documentación, método científico y humanismo médico. Sujetos y métodos. Participaron 151 alumnos distribuidos en grupos de 5-6 estudiantes para realizar los trabajos propuestos en forma de seminarios y aprendizaje basado en problemas (ABP, utilizando, entre otros materiales, narraciones literarias e imágenes de cuadros pictóricos cuyo análisis y discusión se presentaron oralmente. En las prácticas se inició a los estudiantes en la búsqueda y evaluación de la información. Un ensayo y las clases teóricas completan los métodos utilizados. Todos los materiales a utilizar estuvieron disponibles en el campus virtual. Resultados. La asistencia a prácticas, seminarios y ABP fue próxima al 100%, y a clases teóricas, del 67%. Los alumnos mostraron inquietud intelectual en las tareas. El método ha demostrado una elevada implicación en el proceso de autoaprendizaje, capacidad de autorregulación en el trabajo, trabajo en grupo, grado de adquisición de conceptos y capacidad de redactar documentos. La adecuación de los contenidos a los objetivos ha sido considerada favorable por más del 70% de los alumnos. El grado de adquisición de las competencias fue favorable en un 80% de los casos. Conclusiones. Las características de la asignatura pueden fomentar la inquietud científica y el humanismo médico entre los alumnos. La literatura y la lectura de cuadros pueden contribuir a identificar los aspectos del acto médico y a desarrollar la observación de las características físicas y conductuales en los pacientes.

  9. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  10. Generalized Superconductivity. Generalized Levitation

    International Nuclear Information System (INIS)

    Ciobanu, B.; Agop, M.

    2004-01-01

    In the recent papers, the gravitational superconductivity is described. We introduce the concept of generalized superconductivity observing that any nongeodesic motion and, in particular, the motion in an electromagnetic field, can be transformed in a geodesic motion by a suitable choice of the connection. In the present paper, the gravitoelectromagnetic London equations have been obtained from the generalized Helmholtz vortex theorem using the generalized local equivalence principle. In this context, the gravitoelectromagnetic Meissner effect and, implicitly, the gravitoelectromagnetic levitation are given. (authors)

  11. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  12. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  13. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  14. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  15. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  16. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  17. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  18. Química general II

    OpenAIRE

    Olba Torrent, Amparo

    2018-01-01

    El document forma part dels materials docents programats mitjançant l'ajut del Servei de Política Lingüística de la Universitat de València Temes de l'assignatura: Química general II del primer curs del Grau de Química Topics of the course: General Chemistry II in the first year of the Degree in Chemistry

  19. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  20. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  1. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  2. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  3. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  4. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  5. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  6. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  7. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  8. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  9. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  10. Considerações sobre avaliação de estabelecimentos de saúde sob gestão de OSS: o caso do Hospital Geral do Grajaú Considerations on evaluation of health facilities management under the model of Social Organizations of Health: the case of Grajaú General Hospital

    Directory of Open Access Journals (Sweden)

    Amanda Alves Tibério

    2010-09-01

    Full Text Available OBJETIVOS: A partir da década de 1990, em face de um cenário de limitações de recursos do Estado para financiamento de serviços essenciais à população, novas formas de administração pública começam a ser implementadas. Uma das principais formas adotadas refere-se à delegação da administração de hospitais públicos do estado de São Paulo às Organizações Sociais de Saúde (OSS. O artigo propõe um formato de avaliação da gestão das políticas públicas de saúde via OSS no município de São Paulo, a partir do caso do Hospital Geral do Grajaú. PROCEDIMENTOS METODOLÓGICOS: A avaliação concentrou-se em variáveis sócio-econômicas e demográficas da população local e sua articulação com variáveis estruturais da rede básica de saúde disponíveis; além de dados sobre infra-estrutura da instituição selecionada e relatórios da organização social de saúde no período entre 2004 e 2007. RESULTADOS: A região apresenta déficit de unidades básicas de saúde, que gera sobrecarga de atendimentos de baixa complexidade no hospital. Os resultados da avaliação comparativa entre oferta e demanda por serviços públicos de saúde, a partir do perfil populacional da região e características de atendimentos realizados pela organização social, indicam que a unidade buscou adaptar-se às necessidades prioritárias da região. No entanto, verificou-se, também, que a implantação de um único hospital em uma região de alta vulnerabilidade social é insuficiente para suprir as necessidades da população, sendo necessária uma rede de unidades básicas de saúde para auxiliar na realização de atendimentos de baixa complexidade, permitindo focalização do atendimento hospitalar sobre atendimentos de média e alta complexidade.OBJECTIVES: Since the 1990s, in light of a scenario of limited government resources to finance essential public services to address population needs, new public administration models have been

  11. Determinación de enfermedades parasitarias en población infantil de primer a cuarto grado de educación primaria en un ejido del sur de sonora

    Directory of Open Access Journals (Sweden)

    Gabriela de Los Ángeles Díaz Reyes

    2014-06-01

    Full Text Available La parasitosis intestinal constituye un problema de salud pública en México, siendo la población infantil la más afectada (9. En el estado de Sonora, se han realizado estudios que ubican la prevalencia de infecciones por microorganismos como Giardia lamblia, Endolimax nana y Entamoeba coli en 20, 10 y 19% respectivamente, con una situación de poliparasitismo en 18% de los casos (6. El hacinamiento, la escasez del agua potable y la carencia de drenaje, constituyen los mayores factores de riesgo para contraer este tipo de enfermedad (1. Como parte de un proyecto de Servicio Social de la Carrera de Químico Biólogo de la Universidad de Sonora, Unidad Regional Sur, se realizó un muestreo coproparasitoscópico en 52 niños de entre Primer y Cuarto grado de educación Primaria, en una población ejidal del sur del estado, con el fin de detectar casos positivos y canalizarlos para su atención. Se registraron 40 casos positivos para parasitosis, representando un 76.9% de la muestra, los principales microorganismos detectados durante el estudio fueron G. lamblia, E. histolityca, E. coli y E. nana, encontrándolos de manera aislada o en algunas muestras en asociaciones multiparasitarias.

  12. General general game AI

    OpenAIRE

    Togelius, Julian; Yannakakis, Georgios N.; 2016 IEEE Conference on Computational Intelligence and Games (CIG)

    2016-01-01

    Arguably the grand goal of artificial intelligence research is to produce machines with general intelligence: the capacity to solve multiple problems, not just one. Artificial intelligence (AI) has investigated the general intelligence capacity of machines within the domain of games more than any other domain given the ideal properties of games for that purpose: controlled yet interesting and computationally hard problems. This line of research, however, has so far focuse...

  13. Paralisia periodica tireotoxica: registro de um caso

    Directory of Open Access Journals (Sweden)

    Athos Scherer Torres

    1979-06-01

    Full Text Available É relatado um caso de paralisia periódica tireotóxica. Os autores chamam a atenção para o fato de não haver registro de publicações semelhantes na literatura brasileira nos 10 últimos anos. São abordados diversos aspectos do diagnóstico diferencial com outros tipos de paralisia periódica.

  14. Micetoma por Nocardia brasiliensis: reporte de caso

    Directory of Open Access Journals (Sweden)

    Miriam Guevara R

    2003-07-01

    Full Text Available Se presenta el caso de un paciente peruano, agricultor, con una infección cutánea de origen traumático causada por Nocardia brasiliensis, que evolucionó hacia la amputación del miembro inferior afectado. El diagnóstico se realizó por examen directo y cultivo del espécimen.

  15. Distrofia neuroaxonal infantil: relato de dois casos

    Directory of Open Access Journals (Sweden)

    SCOLA ROSANA HERMINIA

    1999-01-01

    Full Text Available Descrevemos dois casos de distrofia neuroaxonal infantil ou doença de Seitelberger, que é doença rara, neurodegenerativa, com herança autossômica recessiva. O primeiro caso, sexo masculino, com 8 anos de idade, apresentava atraso do desenvolvimento psicomotor, ataxia e fraqueza muscular. Ao exame físico foi encontrado nistagmo horizontal e vertical com palidez do disco óptico, hipotonia e arreflexia profunda. O segundo caso, sexo masculino, com 1 ano e 6 meses de idade, apresentava atraso do desenvolvimento psicomotor e convulsões. No exame físico, apresentava atrofia de nervo óptico, hipertonia e hiperreflexia. A biópsia de nervo sural de ambos os pacientes mostrou aumento dos axônios, compatível com distrofia neuroaxonal. As características clínicas pleomórficas, bem como os achados neurofisiológicos variáveis tornam difícil firmar o diagnóstico, o qual é ajudado pela confirmação anatomopatológica dos esferóides neuroaxonais.

  16. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  17. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  18. Titulación académica y posibilidades de acceso al primer empleo

    Directory of Open Access Journals (Sweden)

    ET. OTROS

    2009-11-01

    Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job

  19. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  20. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  1. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  2. El caso México

    Directory of Open Access Journals (Sweden)

    José Manuel Zorrilla Ríos

    2014-01-01

    Full Text Available Se describe al país bajo un enfoque socio-económico tanto de la población en general como de la rural y, en particular, de las características zootécnicas de las Unidades Productivas bovinos carne. Aunado a la proyección en al aumento de la población humana y su demanda alimenticia, se enfatiza un escenario cuestionable sobre el deterioro en la calidad de vida rural, acentuado por un impacto negativo en el ambiente. En contraste, se cuestiona la adopción de políticas públicas del sector, enfocadas en atender la seguridad alimentaria con base en importaciones, su impacto negativo en la producción nacional y el menoscabo en la soberanía alimentaria. En contraste con la visión y objetivos oficiales de la SAGARPA, para el 2030, se señalan proyecciones tentativas de producción-consumo del sector como resultado del ejercicio llevado a cabo en el presente taller; incluyendo escenarios de consumo privativo a sectores de la población con ingresos económicos altos, como una de las consecuencias originadas de la bursatilización de los alimentos, bajo un marco económico capitalista dominado por el libre mercado.

  3. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  4. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  5. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  6. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  7. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  8. Coriocarcinoma metastásico a yeyuno. Reporte de tres casos

    Directory of Open Access Journals (Sweden)

    J.L. Martínez-Ordaz

    2012-07-01

    Full Text Available El 5,0% de los pacientes con coriocarcinoma desarrollan metástasis a intestino delgado. Los tumores de intestino delgado son raros, y generalmente las metástasis son de carcinomas de pulmón, mama o melanoma. La sintomatología es vaga y la mayoría son hallazgos de autopsia. Los síntomas principales están relacionados con la presencia de tumor abdominal o hemorragia, oclusión o perforación intestinal. Presentamos los casos de 3 pacientes con metástasis de coriocarcinoma a intestino delgado. Una mujer de 24 años con oclusión intestinal secundaria a intususcepción originada en un pólipo de coriocarcinoma metastásico, y dos hombres de 18 y 24 años con historia de tumor testicular, que presentaron 2 y 10 meses posterior a orquiectomía, hemorragia de tubo digestivo por metástasis de coriocarcinoma a intestino delgado. El manejo fue endoscópico en un caso y quirúrgico en los restantes. Dos pacientes fallecieron en el postoperatorio mediato y el restante durante el primer año de seguimiento. Las metástasis de coriocarcinoma son muy raras. Las manifestaciones clínicas principales son hemorragia u oclusión intestinal. El manejo puede ser médico o quirúrgico para su resolución. La mayoría de los pacientes con coriocarcinoma responden a quimioterapia, pero el pronóstico es peor para aquellos con metástasis a intestino delgado.

  9. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  10. El turismo oscuro. Estudio de caso: Budapest

    OpenAIRE

    Rodríguez Cifuentes, Sara

    2016-01-01

    Este trabajo fin de grado trata de explicar que es el turismo oscuro y que engloba. Para ello, en primer lugar, se da una definición de turismo cultural y una razón de porqué el turismo oscuro pertenece al turismo cultural. Después, se centra en un periodo de la historia muy significativo: la segunda guerra mundial. A partir de ahí, se relaciona el turismo oscuro con el holocausto. Para finalizar el trabajo, se investigan todos los incentivos turísticos acerca del tema principal en Budapest (...

  11. Presentación de caso de un Lipoma Calcificado

    Directory of Open Access Journals (Sweden)

    Pedro Rafael Casado Méndez

    2015-12-01

    Full Text Available El adipoma o lipoma es el tumor de partes blandas más frecuente en la población, pero sus complicaciones resultan ser de tal rareza que apenas el dos porciento de ellos las sufre. Se presentó el caso de un paciente masculino, de 53 años de edad, con antecedentes de una masa tumoral en la región mamilar derecha de más o menos seis años de evolución, que se mostró asintomático, pero que le preocupaba el tumor que le ha estado creciendo. Se le realizó examen físico completo y radiografía de tórax en dos vistas, resultando sugestivo de proceso tumoral de carácter neoplásico. El caso fue  remitido a la consulta de cirugía general, donde se le practicó Tomografía Axial Computarizada, no conclusiva, pero que sugirió proceso oncoproliferativo del tipo rabdomiosarcoma. El paciente fue intervenido quirúrgicamente mediante incisión losángica y se logró la exéresis total del tumor, que se envió para estudio anatomopatológico. Se envió pieza quirúrgica que, al ser seccionada a la mitad, se mostró de color blanco-nácar y consistencia dura y firme. El estudio reveló un lipoma calcificado. El pacientes fue dado de alta con reconsulta al mes, donde se le dio alta definitiva.

  12. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  13. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  14. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  15. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  16. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  17. CASO DE PRIMARIA: REZAGO EDUCATIVO POR FALTA DE DESARROLLO DE COMPETENCIAS

    OpenAIRE

    Saucedo, Gerardo

    2012-01-01

    Párrafo de inicio, explicación del caso, explicación de un ejercicio tanto individual como grupal para un debate referente al caso,los objetivos del caso, soluciones propuestas por el autor y conclusiones

  18. Autogestión en educación física. Un estudio de caso en secundaria

    Directory of Open Access Journals (Sweden)

    Eloísa Lorente Catalán

    2006-06-01

    Full Text Available El objeto de estudio de la tesis es la autogestión, una propuesta para la práctica pedagógica y el aprendizaje de la Educación Física que intenta implicar al máximo al alumnado en el proceso de enseñanza-aprendizaje. Los alumnos eligen, diseñan y llevan a cabo las sesiones adoptando el rol de profesor de sus propios compañeros. Esta tarea forma parte de un planteamiento más global que busca la autonomía del alumno en la gestión de su propio aprendizaje. El propósito del estudio es extraer conocimiento acerca de cómo se lleva a cabo la autogestión de la clase por parte del alumnado y de cómo perciben la experiencia los participantes, así como conocer qué aprenden y que utilidad le proporcionan para su vida cotidiana. La tesis está estructurada en dos partes. La primera trata de la fundamentación y del diseño del estudio, intentando, por una parte, ubicar la autogestión en el marco general de la enseñanza de la EF y por otra justificar el diseño de la investigación partiendo de la idea de que toda situación educativa es única y que por tanto, debe estudiarse en el lugar que ocurre. Por ello, la fundamentación epistemológica de la investigación se basa en el paradigma naturalista y la metodología que mejor se adecua a las pretensiones del estudio es la etnografía educativa interaccionista. La estrategia de diseño de la investigación es el estudio de caso, de modo que la segunda parte de la tesis se ha destinado a la reconstrucción del mismo. El caso estudiado está configurado por dos grupos de estudiantes de 8º de la antigua Educación General Básica y un profesor de EF con una ideología muy próxima a la pedagogía crítica. El estudio se centra especialmente en el primer año de la experiencia pero se continuó en contacto con el mismo grupo durante toda la secundaria, recogiendo información de los cuatro años, lo que permitió hacer una triangulación temporal. Posteriormente y después de tres a

  19. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  20. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  1. Crisis de las hegemonías en América latina: los casos de Bolivia y Chile

    Directory of Open Access Journals (Sweden)

    Luis Albero Vivero Arriagada

    2014-01-01

    Full Text Available El objetivo de este trabajo es comprender y distinguir cómo se manifiesta, la ruptura o crisis de la hegemonía de las clases dominantes, cómo se presentan los procesos y posibilidades de reconfiguración de las clases sociales y las correlaciones de las fuerzas políticas entre las élites dominantes y los sectores excluidos. Se toma como referencia los casos de Bolivia y Chile en el período comprendido entre los años 2006 y 2012 ya que permite tener como referencia los triunfos electorales de Evo Morales en Bolivia y en el caso de Chile el primer gobierno de Michelle Bachelet y el triunfo de Sebastián Piñera. Desde una perspectiva hermenéutica crítica se realiza una revisión y análisis interpretativo de las obras de Antonio Gramsci y de otros referentes del pensamiento crítico latinoamericano que nos aporta un marco teórico que ilumina el análisis interpretativo. Se concluye que los conflictos y las contradicciones presentes en estos países dan cuenta de la posibilidad de construcción de nuevas relaciones sociales y políticas a partir de las luchas contra hegemónicas que han venido protagonizando las clases excluidas.

  2. Cuando la comunidad entra en la escuela: un estudio de casos sobre los grupos interactivos, valorados por sus protagonistas

    Directory of Open Access Journals (Sweden)

    Carmen Álvarez Álvarez

    2014-01-01

    Full Text Available El artículo analiza el efecto de los grupos interactivos en los procesos de enseñanza y aprendizaje de alumnos y alumnas de educación primaria, analizados a través del grado de satisfacción de las personas implicadas en esta forma de trabajo. Se trata de una de las prácticas de organización del aula más destacadas en los centros educativos que se transforman en Comunidades de Aprendizaje. El artículo sintetiza un estudio de casos llevado a cabo en una escuela española de un entorno urbano, dando voz a los protagonistas de los grupos interactivos: alumnado, profesorado y voluntariado, que incluye las familias que participan en dichos grupos. Se utilizó una encuesta para los estudiantes de tercer ciclo y una entrevista grupal en el caso de los de primer ciclo. Con dichos procedimientos se recogieron las valoraciones realizadas por 148 estudiantes, 24 voluntarios/as y 6 profesores/as. Los resultados permiten constatar que los grupos interactivos constituyen una práctica muy bien acogida por toda la comunidad educativa. Además promueven tanto el éxito escolar como el desarrollo de valores que van más allá de lo instrumental, al implicar directamente a la comunidad en la actividad docente. Todo ello se somete a discusión.

  3. Territorio, desarrollo tecnológico y gestión de recursos naturales renovables: El caso de la pesca

    Directory of Open Access Journals (Sweden)

    Ignacio Carciofi

    2012-01-01

    Full Text Available La gestión eficiente de ciertos recursos renovables caracterizados por la propiedad común y el libre acceso ha estado mediatizada por la denominada «Tragedia de los Comunes». La literatura pionera en este campo enfatizaba la necesidad de un marco regulatorio que superara esta tendencia hacia la sobreexplotación y agotamiento del recurso. Elinor Ostrom, sin embargo, en un trabajo seminal, se apartaba de esta línea y reivindicaba, paradójicamente, soluciones basadas en la propiedad y gestión comunal, que parecían estar en el origen del problema. El presente trabajo tiene, en este sentido, un doble objetivo. En primer lugar, realizar una revisión de la literatura económica sobre la explotación de recursos naturales en los espacios comunales y de libre acceso, con especial referencia al caso de la pesca. En segundo, y trascendiendo lo anterior, llamar la atención sobre el hecho de que la solución de Ostrom, que devuelve a la gestión del recurso su componente territorial y local, queda en el caso de la pesca fuertemente comprometida por un progreso tecnológico que está acabando con las pesquerías locales.

  4. Babesiose cerebral em bovinos: 20 casos

    Directory of Open Access Journals (Sweden)

    Rodrigues Aline

    2005-01-01

    Full Text Available Num estudo retrospectivo de 1.071 necropsias de bovinos, foram encontrados 20 casos de babesiose cerebral confirmados pelo exame de esfregaços do córtex telencefálico. A maioria desses casos ocorreu no verão, em bovinos adultos de raças européias ou suas cruzas. Além dos sinais clínicos neurológicos, observou-se hemoglobinúria, anorexia, febre, taquicardia, taquipnéia e queda na produção de leite. O hemograma realizado em cinco bovinos afetados revelou acentuada anemia regenerativa; em média, 20% dos eritrócitos estavam parasitados por Babesia bovis. Na necropsia de todos os casos, a substância cinzenta dos córtices telencefálico e cerebelar e dos núcleos da base era consistente e caracteristicamente róseo-cereja. Essa coloração devia-se ao seqüestro de eritrócitos nos capilares encefálicos. Nesses eritrócitos, podiam-se observar, tanto em esfregaços do córtex como em preparações histológicas do encéfalo, microorganismos com morfologia compatível com B. bovis. Outros achados de necropsia incluíam hemoglobinúria, rins vermelho-escuros, hepatoesplenomegalia, fígado vermelho-alaranjado, icterícia, hemorragias epicárdicas e endocárdicas e edema e congestão dos linfonodos mesentéricos.

  5. Leiomioma perianal. Reporte de un caso

    Directory of Open Access Journals (Sweden)

    Yorlenis C Uzcátegui R

    2014-09-01

    Full Text Available Los leiomiomas perianales son tumoraciones derivadas de células mesenquimales distribuidas por todo el cuerpo. Histológicamente se han clasificado en tres subtipos: vascular, no vascular y epiteloide. El subtipo vascular puede ser sólido, cavernoso o venoso. Los leiomiomas son raros en adultos, con incidencia de 0,1 %, generalmente se presentan entre la cuarta a sexta década de la vida con predominio en mujeres en caso de ser benignos. La forma de presentación más frecuente es un nódulo palpable, próximo al ano e indoloro. El diagnóstico se realiza según criterios histológicos e inmunohistoquímicos, además son útiles la ecografía endoanal y RMN. La exéresis es la primera opción terapéutica. Se presenta caso de paciente femenino de 41 años de edad, quien consulta por presentar nódulo palpable perianal derecho, con dolor a la palpación, de ocho meses de evolución, con valores normales de marcadores tumorales, el ultrasonido revela a nivel perianal derecho imagen sólida, hipocrómica (con tejido lineal fibroso, mide 4.82x 6.7x 6.87cm, la RMN muestra lesión ocupante de espacio en la misma ubicación, Doppler Color sin vascularización. Se efectuó exéresis de leiomioma en fosa isquiorectal derecha de 4x6 cm. El estudio anatomopatológico reportó leiomioma perianal subtipo epitelial. En el presente estudio se reporta un caso muy poco frecuente de leiomioma perianal doloroso, exponiendo las características clínicas e histológicas del mismo

  6. estadounidense: el caso de la berenjena mexicana

    Directory of Open Access Journals (Sweden)

    Carlos Javier Maya Ambía

    2004-01-01

    Full Text Available El mercado hortÌcola de Estados Uni- dos es el escenario de una din·mica competencia en la que se enfrentan empresas productoras-distribuidoras de naciones con muy dispares grados de desarrollo. Este artÌculo se enfoca al caso de la berenjena mexicana exportada hacia dicho paÌs, consi- derando que, a partir de su estudio, es posible repensar una serie de conceptos empleados en la inves- tigaciÛn sobre el tema. En particular, se propone, si- guiendo una idea expuesta por Van Sickle y otros autores, tomar el segmento del mercado como indi- cador de la competitividad de los oferentes. De acuerdo con este indi- cador, se trata de ubicar el posicio- namiento actual de las hortalizas mexicanas en el mercado de los Estados Unidos, comparando la berenjena con las otras hortalizas m·s importantes exportadas por MÈxico. Se busca explicar esta participaciÛn a partir de una serie de elementos, como son innovaciones tecnolÛgicas, rendimientos, costos, estrategias de comercializaciÛn y, de especial im- portancia, la atenciÛn a las normas para preservar la inocuidad alimen- taria. El caso estudiado viene a con- firmar la hipÛtesis de autores como Friedland y Bonanno, quienes sos- tienen el car·cter global de la com- petencia en los mercados hortÌcolas. El artÌculo concluye con algunas reflexiones derivadas del estudio de caso, mismas que apuntan hacia el cuestionamiento del concepto de divisiÛn internacional del trabajo.

  7. Espondilodiscitis en posible relación con acupuntura. A proposito de un caso

    Directory of Open Access Journals (Sweden)

    VICTOR MANUEL LOPEZ MOURIÑO

    2017-03-01

    Full Text Available Presentamos el caso de un paciente varón de 59 años que acudió a nuestras consultas por un síndrome general, y tras completar el estudio fue diagnosticado de Espondilodiscitis Piógena (EP .El paciente se había sometido a sesiones de acupuntura por un dolor de espalda de evolución tórpida, no evidenciándose ningún otro causa que pudiera justificarla. La acupuntura es una técnica cada vez más utilizada, realizamos una revisión de casos similares recogidos en la literatura publicada hasta la fecha.

  8. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  9. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  10. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  11. Herramientas para la investigación en Tecnologías de la Información y la Comunicación. Casos de estudio

    Directory of Open Access Journals (Sweden)

    Julio Ruiz Palmero

    2011-01-01

    Full Text Available En este artículo se pretende mostrar las posibilidades de algunas herramientas de recogida de información para el estudio cualitativo y cuantitativo en casos concretos de investigación y evaluación del impacto de las TIC en la enseñanza. Se mostrarán las técnicas seguidas en diferentes casos así como su metodología seguida. Los casos de estudio se corresponden con investigaciones desarrolladas dentro del Grupo de Investigación de Nuevas Tecnologías (Gtea de la Universidad de Málaga. En primer lugar abordaremos dos investigaciones sobre la evaluación de e-portafolios y análisis de diarios del Practicum desarrolladas durante 5 cursos académicos, en tercer lugar nos centraremos en la investigación que se está llevando a cabo dentro del Proyecto Estudio comparativo sobre la utilización y opinión del alumnado universitario sobre las TIC contrastando competencias requeridas como futuros profesionales (Ref. A/023024/09, financiado por la Agencia Española de Cooperación Internacional y en el que participan universidades de 5 países (España, México, Argentina, Perú y Chile y que se encuentra en su última fase de desarrollo.

  12. Hidrocefalia multiloculada: relato de dois casos

    Directory of Open Access Journals (Sweden)

    Marilisa M. Guerreiro

    1988-09-01

    Full Text Available Hidrocefalia multiloculada é conceituada como quadro clínico-patológico que consiste de ventrículos aumentados e loculados e de cavidades porencefálicas paraventriculares. Apresentamos dois casos de hidrocefalia multiloculada, um provavelmente conseqüente a processo infeccioso do sistema nervoso central e outro em decorrência de malformação congênita. Aspectos tomográficos compatíveis ao diagnóstico são ressaltados. A etiopatogenia, o tratamento e o prognóstico são discutidos em face da literatura compulsada.

  13. Estrabismo sensorial: estudo de 191 casos

    OpenAIRE

    Oliveira,Bráulio Folco Telles de; Bigolin,Silvane; Souza,Murilo Barreto; Polati,Mariza

    2006-01-01

    OBJETIVO: Avaliar os prontuários dos pacientes com estrabismo sensorial em aspectos variados, como etiologia, tipo e medida do desvio, correlação do tipo do desvio com a idade de aparecimento da doença de base, e resultado cirúrgico dos casos operados. MÉTODOS: Avaliação dos prontuários médicos dos pacientes com estrabismo sensorial atendidos no Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo - USP - no setor de Motilidade Ocular Extrínseca, no período de setembro ...

  14. Anartria Pura: Estudo de Dois Casos

    OpenAIRE

    Lecours,André Roch; Parente,Maria Alice de Mattos Pimenta; Feijó,Adriana Vélez; Maia,Alberto

    2001-01-01

    O marco do nascimento da neurolingüística é considerado a publicação do livro A síndrome de Desintegração Fonética, em 1939, que teve como autores: um neurologista, um psicólogo e uma lingüista. Dez anos mais tarde foi publicado, pela mesma equipe de pesquisadores franceses, o distúrbio de fala do paciente portador de anartria pura. No presente artigo, situaremos as polêmicas históricas a respeito de um distúrbio seletivo de fala de origem telencefálica, apresentaremos o primeiro caso descrit...

  15. Hiperekplexia: Um Caso Raro de Hipertonia Neonatal

    OpenAIRE

    Alegria, Artur; Santos, Manuela; Coelho, Elisabete; Cardoso, Maria Luís

    2014-01-01

    A hiperekplexia ou «doença do sobressalto» é um síndroma clínico muito raro caracterizado por uma resposta de sobressalto exagerada a estímulos sensoriais inesperados e hipertonia generalizada neonatal transitória, resultante de um defeito genético dos receptores da glicina. Descrevemos um novo caso clínico desta doença, num recém-nascido cuja história familiar era negativa. Após o nascimento apresentou-se com hipertonia e rigidez muscular generalizadas, agravadas em resposta a estímulos táct...

  16. Enanismo pituitario canino: reporte de dos casos

    OpenAIRE

    Corrada, Yanina; Humbert Lan, Analia; Dragonetti, Ana; Goya, Rodolfo; Gobello, Cristina

    2009-01-01

    El enanismo pituitario es una endocrinopatía ocasionada por la deficiencia de hormona de crecimiento. La imposibilidad de medir esta hormona en los caninos ha ocasionado que, muchas veces, no se considere al enanismo pituitario entre los diagnósticos diferenciales de retraso del crecimiento y dermatopatía en el cachorro. En el presente trabajo se describen dos casos clínicos de esta enfermedad en caninos, los cuales una vez referidos a la Facultad de Ciencias Veterinarias de La Plata, Argenti...

  17. Histiocitosis maligna: Reporte de un caso

    Directory of Open Access Journals (Sweden)

    Oscar Ruiz

    2004-12-01

    Full Text Available Paciente varón de 14 años, procedente de Huancayo, que presenta un mes antes de su hospitalización intolerancia gástrica, ictericia, fiebre y síndrome linfoproliferativo. Se encontró en los exámenes de laboratorio pancitopenia severa por hemofagocitosis. El diagnóstico hematológico y anatomopatológico fue histiocitosis maligna. Se presenta este caso por ser una entidad infrecuente y una emergencia médica.

  18. Larva migrans visceral: relato de caso

    OpenAIRE

    Machado Alexandre Bortoli; El Achkar Marice Emanuela

    2003-01-01

    Larva migrans visceral é doença infecciosa, adquirida por ingestão de ovos provenientes dos vermes Toxocara canis e/ou Toxocara cati que infestam cães e gatos; as larvas penetram a parede intestinal e migram através dos tecidos levando a alterações diversas, conseqüentes a uma resposta inflamatória imune.¹ Os autores descrevem um caso clínico de larva migrans visceral com apresentação clínica atípica.

  19. Hemangioma de úvula: relato de um caso

    Directory of Open Access Journals (Sweden)

    G. Sobrinho Fernando P.

    2003-01-01

    Full Text Available O hemangioma é o mais comum tumor de origem vascular, benigno, freqüentemente diagnosticado em crianças, e com predileção pela cabeça e pescoço, mas que raramente tem origem na úvula. Neste órgão, apresenta risco de traumatismo local e sangramento. Este artigo relato um caso de hemangioma de úvula num adulto jovem com disfagia orofaríngea progressiva e sensação de corpo estranho na garganta, tratado com sucesso por ressecção cirúrgica do tumor com bisturi de radiofreqüência.

  20. Funciones sociales del consumo: un caso extremo

    OpenAIRE

    JOSÉ CASTILLO CASTILLO

    1994-01-01

    El consumo religioso de reliquías de santos durante la edad media cumple semejantes funciones sociales para su época que el consumo economico de objetos para la nuestra: El de reforzar real y simbólicamente las estructuras de prestigio, riqueza y poder de sus respectivas sociedades. El ámbito de la sociología del consumo no se circunscribe a los estrechos límites de las llamadas sociedades de consumo de masas. en el presente caso, el estudio del pasado ilumina procesos sociales propios de nue...

  1. Funciones sociales del consumo: un caso extremo

    Directory of Open Access Journals (Sweden)

    JOSÉ CASTILLO CASTILLO

    1994-01-01

    Full Text Available El consumo religioso de reliquías de santos durante la edad media cumple semejantes funciones sociales para su época que el consumo economico de objetos para la nuestra: El de reforzar real y simbólicamente las estructuras de prestigio, riqueza y poder de sus respectivas sociedades. El ámbito de la sociología del consumo no se circunscribe a los estrechos límites de las llamadas sociedades de consumo de masas. en el presente caso, el estudio del pasado ilumina procesos sociales propios de nuestros días.

  2. Enfermedad de Pompe: reporte de caso

    OpenAIRE

    Arias, Sara; G?mez, Mariana; Fern?ndez, Isabel; Celis, Luis Gustavo

    2016-01-01

    Se describe el caso de un paciente masculino de siete meses de edad, evaluado por cardiolog?a a los quince d?as de vida por antecedente de muerte s?bita card?aca de hermana a los cuatro meses, no se sospech? nada pese a consanguinidad de padres y diagn?stico temprano del paciente de cardiomiopat?a. Evoluciona con un cuadro cl?nico de infecciones respiratorias a repetici?n desde los tres meses (bronquiolitis recurrente), falla de medro y cuadro de neumon?a reciente y fallece a los ocho d?as de...

  3. Anorexia nervosa: un estudio de casos

    OpenAIRE

    Zusman, Lillyana

    2013-01-01

    La Anorexia Nervosa es un trastorno de alimentación que se define (etimológicamente) como una "pérdida nerviosa del apetito". Se caracteriza por la actitud consciente, voluntaria y rotunda de los sujetos  de tener un exceso de peso que intentan modificar por vía de la inanición. A partir del estudio de casos, se propone la distinción entre una Anorexia Nervosa Estructural -aquella en la que predomina el conflicto intrapsíquico primario y arcaico, y que manifiesta una conducta aislada y retraí...

  4. Hepatocarcinoma fibrolamelar: relato de um caso

    Directory of Open Access Journals (Sweden)

    Martins Rogéria de Castro

    2001-01-01

    Full Text Available O hepatocarcinoma fibrolamelar é neoplasia hepatocelular rara, diagnosticada por tomografia computadorizada e confirmada pelo exame anatomopatológico. O caso relatado foi atendido no Hospital Mater Dei de Belo Horizonte, MG. Os aspectos clínicos, radiológicos e patológicos discutidos reforçam a importância das imagens radiológicas na detecção e caracterização das neoplasias focais hepáticas.

  5. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  6. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  7. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  8. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  9. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  10. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  11. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  12. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  13. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  14. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  15. Opciones reales, valuación financiera de proyectos y estrategias de negocios. Aplicaciones al caso mexicano

    Directory of Open Access Journals (Sweden)

    Francisco Venegas Martínez

    2006-01-01

    Full Text Available En este trabajo la metodología de opciones reales se presenta como un instrumento indispensable para que los consejos de administración de las empresas tomen decisiones respecto a proyectos de inversión o estrategias de negocios cuando existe la flexibilidad (opcionalidad de tomar en el futuro nuevas decisiones relacionadas con extender, contraer, posponer, enmendar o abandonar un proyecto o estrategia. Al respecto, el presente trabajo realiza una revisión de las diferentes fórmulas analíticas que aparecen en la bibliografía para valuar la opcionalidad de estrategias en el supuesto de que el valor presente de los flujos de efectivo esperados sigue una distribución log normal o bien mediante el uso de métodos de árboles binomiales. En particular, se trata el caso de la toma de decisiones de venta o cierre de una empresa cuando el valor de mercado de sus títulos (de capital y deuda excede el valor presente de los flujos de efectivo esperados o el valor presente de estos flujos es menor que cierto valor de recuperación. En este contexto se analiza el caso de una empresa mexicana de servicios satelitales de comunicación. Asimismo, se aplica la metodología de opciones reales a proyectos carreteros de inversión; específicamente se examina el caso del proyecto de construcción del primer tramo de la autopista Toluca-Atlacomulco según los supuestos de volatilidad constante y estocástica. Es también importante destacar que esta investigación se centra en: i la valuación de opciones reales americanas de abandono; ii valuación de opciones reales compuestas; iii valuación de opciones reales con volatilidad extendiendo el modelo de Hull y White (1987.

  16. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  17. Osteomalacia oncogénica: Presentación de dos casos

    Directory of Open Access Journals (Sweden)

    Fernando Jerkovich

    2015-02-01

    Full Text Available La osteomalacia oncogénica es una enfermedad rara. Existen descriptos alrededor de 337 casos. Es ocasionada por un tumor productor del factor de crecimiento fibroblástico 23 (FGF-23, hormona que disminuye la reabsorción tubular de fosfatos y altera la hidroxilación renal de la vitamina D, con hipofosfatemia, hiperfosfaturia y niveles bajos de calcitriol. Se presentan dos pacientes de 44 y 70 años, que consultaron por dolores óseos generalizados de aproximadamente un año de evolución en los que se hallaron alteraciones bioquímicas compatibles con osteomalacia hipofosfatémica. En el primer caso se realizó la resección de una tumoración en tejido celular subcutáneo del pie derecho, un año después del diagnóstico clínico. Luego de la exéresis, se disminuyó el aporte de fosfatos que recibía el paciente, pero reaparecieron los dolores al intentar suspenderlos. Ocho años más tarde, hubo recidiva local de la tumoración por lo que se efectuó resección completa. Después de la misma, se logró suspender el aporte de fosfatos. En el segundo caso, el paciente se estudió con tomografía por emisión de positrones con 18F-fluorodesoxiglucosa, hallando formación nodular hipermetabólica en partes blandas de antepie derecho, de 2.26 cm de diámetro. Luego de su escisión se pudo suspender el aporte de fosfatos. Ambos pacientes se encuentran asintomáticos con indicadores de metabolismo fosfocálcico normales. El diagnóstico anatomopatológico en ambos fue un tumor mesenquimático fosfatúrico, variante mixta del tejido conectivo, la entidad más frecuentemente asociada a la osteomalacia oncogénica.

  18. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  19. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  20. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Comprometimento medular por linfoma tipo Burkitt: relato de um caso

    Directory of Open Access Journals (Sweden)

    Murillo Côrtes Drummond

    1985-06-01

    Full Text Available Registro de caso de linfoma tipo Burkitt com comprometimento intrarraqueano em criança de três anos de idade. Considerações sobre esse tipo de tumor são feitas em função do caso observado e de dados da literatura.

  2. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  3. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  4. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  5. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  6. ¿Qué explica la evolución del rendimiento académico universitario? Un estudio de caso en la Universidad del Pacífico

    OpenAIRE

    Arlette Beltrán; Karlos La Serna

    2009-01-01

    "Utilizando un modelo de “panel data” para el caso de los alumnos de la Universidad del Pacífico que ingresaron en el año 2006, el presente trabajo busca determinar si el rendimiento escolar y las características académicas del colegio de procedencia explican el desempeño en la universidad, más allá del primer año de estudios universitarios. Además, se identifican otros factores dan cuenta de dicho desempeño. Los resultados indican que el rendimiento académico en el colegio es uno de los prin...

  7. Análisis de los efectos de intervenciones públicas en la recuperación de centros urbanos : caso de estudio barrio las Cruces, Bogotá 2002-2014

    OpenAIRE

    Rosillo Herrera, María Daniela

    2015-01-01

    En el presente estudio de caso se hace un análisis de los principales efectos socio-espaciales y económicos que tuvieron intervenciones públicas dirigidas a recuperar el centro de Bogotá, en el territorio específico del Barrio Las Cruces, durante los años 2002-2014. Para lograrlo, en un primer momento se hace un análisis conceptual de las relaciones existentes entre intervenciones urbanas y los efectos que estas producen en lo urbano y lo local; en un segundo se identifican los antecedentes q...

  8. La práctica del reciclaje. Estudio de caso de La Asociación Colombiana de Recicladores Independientes, UPZ Engativá-Bogotá D.C.

    OpenAIRE

    Meléndez Álvarez, Nicolás

    2014-01-01

    El interés de este estudio de caso es analizar los procesos de reciclaje que lideran la Asociación Colombiana de Recicladores Independientes (ACOREIN) en la Unidad de Planeamiento Zonal (UPZ) 74- Engativá, relacionándolos con las perspectivas de ciudad sostenible. Por tal motivo en el primer apartado, se describe y analiza el concepto de sostenibilidad, desarrollo sostenible, y ciudad sostenible, la cual se encuentra ejemplificada. En el segundo capítulo se describe la labor de reciclaje gest...

  9. Leiomiosarcoma de mesenterio. Reporte de un caso

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Serra Valdés

    2014-11-01

    Full Text Available Los tumores sólidos primitivos son generalmente de origen mesenquimático, y dentro de estos predominan los derivados del músculo liso, constituyendo un capítulo de gran interés por su carácter excepcional y por su dificultad diagnóstica. Se presenta el caso de una paciente de 50 años de edad, con molestias en flanco derecho, donde se notaba un aumento de volumen, desde hacía algunos meses, que ya causaba dolor. Al examen físico se constató una tumoración abdominal gigante que ocupaba todo el flanco derecho y se proyectaba a mesogastrio. Se realizaron estudios imagenológicos, que incluyeron tomografía axial computarizada contrastada de abdomen, y se sometió a laparotomía exploradora con diagnóstico preoperatorio de tumor abdominal. Se realizó exéresis tumoral y estudio histológico, concluyendo un leiomiosarcoma de mesenterio. Se puso tratamiento con quimioterapia y la evolución clínica fue favorable. El objetivo de esta presentación es comunicar a la comunidad médica este caso por el insuficiente reporte encontrado en la literatura.

  10. Cistos de Tarlov: relato de quatro casos

    Directory of Open Access Journals (Sweden)

    Sá Márcia Cristina da Paixão Rodrigues Miranda de

    2004-01-01

    Full Text Available São relatados quatro casos de cistos perineurais sacrais, conhecidos por cistos de Tarlov, e é feita revisão da literatura. A partir de amostra de 88 pacientes com queixas de radiculopatia em membros inferiores, e/ ou dor lombar ou sacral que foram submetidos à ressonância magnética de coluna lombossacra quatro (4.5% tiveram o diagnóstico de cisto de Tarlov. O diagnóstico foi feito através de ressonância magnética de coluna vertebral lombossacra. Os quatro casos foram submetidos a laminectomia sacral. Todos evoluíram assintomáticos sem défices motores ou sensitivos. Os cistos de Tarlov podem apresentar manifestações clínicas semelhantes às provocadas por hérnia discal lombossacra embora, nem sempre sejam citados nos diagnósticos diferenciais. O tratamento clínico é basicamente fisioterápico. O tratamento cirúrgico visa sanar o efeito compressivo em estruturas ósseas e/ ou nervosas através de punção do cisto ou retirada dele através de laminectomia sacral.

  11. Paragonimiasis Humana Primera Descripción de un caso colombiano

    Directory of Open Access Journals (Sweden)

    Bernardo Buitrago

    1981-09-01

    Full Text Available Se describe el primer caso colombiano de Paragonimiasis humana, comprobado histopatológicamente, que afectó principalmente la base del pulmón derecho, comprometiendo por vecindad al hemidiafragma derecho y al hígado. La enfermedad del paciente fue, muy probablemente, adquirida en Mesetas, Meta y tuvo una evolución aproximada de 4 años; el paciente falleció durante el post-operatorio inmediato a la resección de las lesiones pleuro-pulmonares y hepáticas. La sintomatología fue la de una neumopatía crónica con tos hemoptoica y hemoptisis. A pesar de múltiples baciloscopías, iterativamente negativas para bacilo tuberculoso, al paciente se le diagnosticó y trató para Tuberculosis Pulmonar. En nuestro medio, la Paragonimiasis debe ser incluída dentro del diagnóstico diferencial de las neumopatías crónicas con tos hemoptoica y hemoptisis.

  12. Xeroderma pigmentoso. Síndrome de Sanctis Cacchione: Presentación de 1 caso

    Directory of Open Access Journals (Sweden)

    Leopoldina Falcón Lincheta

    1998-06-01

    Full Text Available El xeroderma pigmentoso es una afección genética poco frecuente que traduce la hipersensibilidad celular a la radiación ultravioleta en asociación con una anormal reparación del ácido dexosirribonucleico, y que produce pecosidades, fotofobia y subsecuentemente cambios neoplásicos en zonas expuestas al sol. En este trabajo se presenta el primer caso reportado en Cuba en un niño de 5 años de edad, con la entidad clínica en su forma más severa de manifestarse, el síndrome de Sactis Cacchione, que involucra las manifestaciones cutáneas y oculares con trastornos neurológicos y somáticos graves, y provoca daños letales.Xeroderma pigmentosum is a rare genetic affection that transforms cellular hypersensitivity to ultraviolet radiation in association with an abnormal repairing of the desoxyribonucleic acid, and that produces freckles, photophobia and, subsequently, neoplasitc changes in zones exposed to sunlight. In this paper it is reported the first case detected in Cuba in a five-year-old child suffering from the most severe manifestation of this disease, the Sanctis Cacchione´s syndrome, which involves skin and ocular manifestations with serious somatic and neurological disorders and provokes lethal damages.

  13. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  14. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  15. Grupos interactivos en educación infantil: Primer paso para el éxito educativo

    Directory of Open Access Journals (Sweden)

    Patricia Melgar Alcantud

    2015-09-01

    Full Text Available Objeto: La fractura educativa entre los que tienen éxito en el sistema educativo y los que fracasan puede empezar en los años previos a la escolarización obligatoria, por ello la reducción de los altos índices de fracaso escolar requiere de la intervención en las edades más tempranas. El presente artículo, siguiendo las recomendaciones de Comisión Europea así como de los resultados de diferentes investigaciones, analiza algunas de las características que debe tener esta educación infantil para contribuir a la mejora del éxito educativo. Metodología: Los resultados que aquí se presentan son fruto de la revisión de la literatura científica previa y los resultados obtenidos en la investigación europea Includ-ed (2006-2011, cuya metodología fue de orientación comunicativa. Concretamente, hemos recogido los resultados de uno de los estudios de caso realizados en España durante el período 2007 - 2010. Las técnicas de recogida de información fueron tanto cuantitativas como cualitativas: cuestionarios, relatos comunicativos, entrevistas semiestructuradas, grupos de discusión y observaciones comunicativas. Aportaciones y resultados: El fomento de la interacción y la implicación de la familia, son dos de los componentes identificados que pueden favorecer el desarrollo de una educación infantil de calidad. Una de las formas de organización de aula que contempla ambos elementos es grupos interactivos. Los resultados del estudio de caso muestran que esta actuación ha contribuido a reducir el abandono escolar y aumentar la motivación, aumentar la solidaridad y mejorar los resultados educativos de los niños y niñas. Valor añadido: La escasez de trabajos científicos en Europa que analicen las actuaciones en educación infantil que contribuyen al éxito y, específicamente, aquellos elementos organizativos que inciden, hace de especial interés este artículo para la comunidad científica, así como para el resto de

  16. GENERACIÓN DE CASOS DE PRUEBA A PARTIR DE CASOS DE USO EN LAS PRUEBAS DE SOFTWARE

    Directory of Open Access Journals (Sweden)

    Orelvis Vázquez Ruiz

    2006-04-01

    Full Text Available

    Los casos de uso son utilizados para expresar la funcionalidad requerida en un sistema. Los casos de prueba derivados directamente de casos de uso aprovechan la ventaja que constituye contar con la especificación existente de estos últimos, para garantizar un basamento sólido para las pruebas a realizar sobre el sistema. La capacidad para crear casos de prueba a partir de los casos de uso, y hacer la traza de unos a otros, es una habilidad vital para asegurar un producto de calidad.

  17. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  18. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  19. Ataxia espinocerebelar tipo 6: relato de caso

    Directory of Open Access Journals (Sweden)

    Bianca Simone Zeigelboim

    2014-10-01

    Full Text Available O objetivo deste estudo foi verificar as alterações vestibulococleares observadas em um caso de ataxia espinocerebelar tipo 6. O caso foi encaminhado do Hospital de Clínicas para o Laboratório de Otoneurologia de uma Instituição de Ensino e foi submetido aos seguintes procedimentos: anamnese, inspeção otológica, avaliações audiológica e vestibular. O caso retrata uma paciente com diagnóstico genético de ataxia espinocerebelar tipo 6, do sexo feminino, com 57 anos de idade, que referiu desequilíbrio à marcha com tendência a queda para a esquerda, disartria e disfonia. Na avaliação audiológica apresentou configuração audiométrica descendente a partir da frequência de 4kHz e curva timpanométrica do tipo "A" com presença dos reflexos estapedianos bilateralmente. No exame vestibular observou-se na pesquisa da vertigem posicional presença de nistagmo vertical inferior e oblíquo, espontâneo e semiespontâneo múltiplo com características centrais (ausência de latência, paroxismo, fatigabilidade e vertigem, nistagmooptocinético abolido e hiporreflexia à prova calórica. Constataram-se alterações labirínticas que indicaram afecção do sistema vestibular central evidenciando-se a importância dessa avaliação. A existência da possível relação entre os achados com os sintomas vestibulares apresentados pela paciente apontou a relevância do exame labiríntico neste tipo de ataxia uma vez que a presença do nistagmo vertical inferior demonstrou ser frequente neste tipo de patologia.

  20. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  1. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  2. Capacidades críticas y acríticas de los estudiantes de noveno grado de instituciones de educación media de Cúcuta, Pamplona y Villa del Rosario frente a los contenidos audiovisuales de Facebook y YouTube. Caso: Colegio Departamental Integrado General S.

    Directory of Open Access Journals (Sweden)

    Hugo Alexander Vega Riaño

    2016-12-01

    Full Text Available Resumen Al considerar la influencia e impacto de las nuevas tecnologías de la información y la comunicación (TIC en los procesos de interacción humana, se conciben estas herramientas como manifestaciones que median la forma de pensar y actuar de las personas que a diario las utilizan. Estas plataformas de comunicación deben tener destacada atención por cuanto se erigen como medios determinantes en procesos de socialización e interacción en los que se trascienden fronteras de tipo personal y geográfico. A través de sus contenidos, dichas tecnologías han modificado los modos de ser, pensar, sentir e interactuar de los seres humanos, especialmente de aquellos de más temprana generación, y que en este caso refiere a la determinación de las capacidades críticas o acríticas de los jóvenes de noveno grado de educación media de Cúcuta, Pamplona y Villa de Rosario (Colombia en presencia de redes y sitios web como Facebook y YouTube. Abstract When considering the influence and impact of new information and communications technology (ICT in the processes of human interaction , these tools as manifestations mediating way of thinking and acting of people who have daily contact conceive therewith. These communication platforms must have outstanding attention as media stand as determinants in the process of socialization and interaction in which they can transcend geographic borders and kind staff. These technologies, through its contents, have changed the ways of being, thinking, feeling and interacting with humans, especially those of younger generation, in this case aimed at determining the capabilities of critical or uncritical young ninth-grade middle school in Cúcuta, Pamplona and Villa de Rosario (Colombia, compared to networks and web sites like Facebook and YouTube.

  3. Mixed Low-Level Radioactive Waste (MLLW) Primer

    International Nuclear Information System (INIS)

    Schwinkendorf, W.E.

    1999-01-01

    This document presents a general overview of mixed low-level waste, including the regulatory definitions and drivers, the manner in which the various kinds of mixed waste are regulated, and a discussion of the waste treatment options

  4. Mixed Low-Level Radioactive Waste (MLLW) Primer

    Energy Technology Data Exchange (ETDEWEB)

    W. E. Schwinkendorf

    1999-04-01

    This document presents a general overview of mixed low-level waste, including the regulatory definitions and drivers, the manner in which the various kinds of mixed waste are regulated, and a discussion of the waste treatment options.

  5. Caso para diagnóstico

    Directory of Open Access Journals (Sweden)

    Souza Fernanda H. M. de

    2006-01-01

    Full Text Available Pseudoxantoma elástico perfurante periumbilical é distúrbio adquirido do tecido elástico, que acomete mulheres multíparas. Apresenta-se um caso dessa condição em mulher de 74 anos (G10, P10 mostrando placa amarelada de aspecto reticular com áreas constituídas por pápulas eritêmato-ceratósicas. A histologia demonstra derme reticular com fibras conjuntivas basofílicas e irregulares, além de área de hiperplasia epidérmica, com eliminação de fibras elásticas através de canal repleto de ceratina.

  6. Osteocondromatose em gato: relato de caso

    Directory of Open Access Journals (Sweden)

    S. Winter

    Full Text Available RESUMO A osteocondromatose é caracterizada por nódulos únicos ou múltiplos decorrentes de um crescimento ósseo excessivo benigno. É encontrada em cães, gatos, equinos e humanos. Em felinos, tem maior incidência dos dois aos quatro anos de idade. A etiologia em gatos está relacionada ao vírus da leucemia felina, e também já foi encontrada relação com o fibrossarcoma. A manifestação clínica depende do local acometido e do tamanho da lesão. O diagnóstico definitivo é por meio de histopatologia e o prognóstico é desfavorável, pois ocorrem muitas recidivas. Este relato de caso objetiva descrever a apresentação dessa enfermidade em um felino jovem.

  7. Lipoma vulvar: um relato de caso

    Directory of Open Access Journals (Sweden)

    Mariano Lopes da Silva Filho

    2012-04-01

    Full Text Available Os lipomas são os tumores benignos mais comuns dos tecidos moles. No entanto, lipomas localizados em vulva são extremamente raros e a literatura é incerta quanto à sua incidência mundial. O objetivo deste artigo é descrever um caso clínico de lipoma localizado em vulva em uma mulher de 35 anos. A paciente queixava-se de massa de crescimento insidioso localizada no grande lábio inferior. O ultrassom de partes moles evidenciou um nódulo subcutâneo da linhagem lipomatosa. Foi realizada a exérese do lipoma, e a análise histopatológica confirmou que se tratava de um lipoma.

  8. Cromomicose cerebral: registro de um caso

    Directory of Open Access Journals (Sweden)

    Luciano de Souza Queiroz

    1979-09-01

    Full Text Available As lesões cerebrais por fungos pigmentados são excepcionais. Os autores apresentam um caso de cromomicose do sistema nervoso central, em paciente de 59 anos. O quadro clínico iniciou-se por cefaléias e hemiparesia esquerda, seguida por meningite e síndrome de hipertensão intracraniana, totalizando uma evolução de nove meses. A neerópsia revelou abcesso encapsulado nos núcleos basais à direita e leptomeningite crônica de predomínio na base do encéfalo. Em ambas as localizações foram demonstrados numerosos fungos de cor castanha, em forma arredondada ou em hifas septadas. Discutem-se as dificuldades diagnosticas desta neuromicose.

  9. Tremor da escrita: relato de caso

    Directory of Open Access Journals (Sweden)

    Denise Hack Nicaretta

    1994-03-01

    Full Text Available O tremor da escrita é distúrbio precipitado por atividade motora específica, geralmente a escrita. Analisamos este caso sob o ponto de vista clínico e terapêutico. O paciente apresentava tremor ao escrever tomando sua letra ilegível; sem qualquer outra alteração neurológica. Não havia antecedentes familiares, metabólicos, endócrinos, iatrogênicos, tóxicos ou traumáticos. No manuseio terapêutico não ocorreu resposta satisfatória ao propranolol, sendo discreta à primidona. A introdução de anticolinérgicos (tri-hexifenidil evidenciou certa melhora na sintomatologia, com redução do tremor no momento da escrita.

  10. Equinococosis humana (quiste hidatidico: dos casos

    Directory of Open Access Journals (Sweden)

    Egon Lichtenberger

    1957-04-01

    Full Text Available Se describen dos casos de quiste indatídico hepático en pacientes colombianos, oriundos del Chocó y de la Guajira, respectivamente. La equinococosis es posiblemente más frecuente en Colombia de lo que comúnmente se supone. Se hace un corto resumen de la anatomía patológica, morfología, ciclo vital, epidemiología y medios diagnósticos de esta parasitosis. The author describes two cases of hepatic echinococcosis demonstrating again, as correa henao and bojanini have done before, that this parasitosis exists in Colombia and is probably more common than usually believed. The pathology, morphology, life cycle, epidemiology, symptomatology and diagnosis are briefly reviewed.

  11. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  12. Hipomelanose de Ito - relato de um caso

    Directory of Open Access Journals (Sweden)

    Adriana S. de Almeida

    2001-02-01

    Full Text Available Objetivo: Os autores têm como objetivo relatar um caso de hipomelanose de Ito (HI, uma síndrome neurocutânea rara, com alterações neurológicas e cromossômicas associadas ao comprometimento cutâneo e pneumonias de repetição. Relato do caso: Este relato é referente a um paciente masculino, 1 ano e 11 meses, internado no Hospital Universitário São Vicente de Paulo por broncopneumonia bilateral. Ao exame foram observadas máculas hipocrômicas na pele compatíveis com HI, além de atraso do desenvolvimento neuropsicomotor. O paciente foi submetido à biópsia incisional de pele das lesões do abdômen, eletroencefalograma, ressonância magnética e estudo citogenético. Resultados: Os exames histológico e imunoistoquímico evidenciaram ausência de melanina e diminuição de melanócitos em áreas focais da epiderme, respectivamente. O eletroencefalograma apresentou disfunção córtico-subcortical difusa. A ressonância magnética do encéfalo foi compatível com cisto aracnoídeo em região temporal. O cariótipo evidenciou mosaicismo cromossômico com uma linhagem normal (46,XY e uma linhagem celular que apresentava deleção intersticial nas bandas 22.2 - 24.2 do braço longo do cromossomo 10 (25%. Conclusões: Os autores, com o presente estudo, destacam a importância das lesões de pele na definição etiológica das desordens neuropediátricas.

  13. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  14. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  15. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  16. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  17. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  18. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  19. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.