Análisis económico del activismo judicial: el caso de la Corte Constitucional colombiana

Directory of Open Access Journals (Sweden)

Jairo Andrés Castaño Peña

2014-01-01

Full Text Available Este escrito presenta una aproximación al fenómeno del activismo judicial desde la perspectiva del Análisis Económico del Derecho (AED. Como cometido, pretende mostrar que existen una serie de incentivos y de circunstancias que hacen que las decisiones de la Corte Constitucional colombiana se puedan calificar como activistas. Para tal fin, en primer lugar, se establecen unos derroteros básicos para la comprensión de la actividad judicial, específicamente de las funciones de control de constitucionalidad y de revisión de acción de tutela de la Corte Constitucional de Colombia; en segundo lugar, se realiza un acercamiento al concepto de activismo judicial, para, a continuación, presentar la formulación de políticas públicas y la creación de leyes como productos dentro de un modelo de mercado, esto con el fin de explicar y mostrar, desde el Análisis Económico del Derecho, las razones que explican la existencia del fenómeno del activismo judicial en el caso colombiano. En último lugar, se presentan dos casos de activismo judicial por parte de la Corte Constitucional colombiana: en primer término, el caso de la protección del derecho a la vivienda digna, o caso del UPAC, y en segundo término, el caso de la protección de los derechos de los recicladores de oficio; casos, uno y otro, donde se puede ver que existen incentivos que provocan decisiones activistas.

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Enfermedad de creutzfeldt-jakob en el Perú: reporte de once casos

Directory of Open Access Journals (Sweden)

Luis Torres-Ramírez

Full Text Available La enfermedad de Creutzfeldt-Jakob (ECJ es una enfermedad neurológica fatal producida por la isoforma patológica de la proteína priónica humana. Se reporta las características clínicas de seis casos de la forma esporádica de ECJ con diagnóstico definitivo por histopatología, y cinco casos con diagnóstico probable, en pacientes atendidos en el Instituto Nacional de Ciencias Neurológicas del Perú. La edad de inicio en los casos definitivos fue de 55,8 años y, en los probables, de 59,6 años, con predominio del sexo masculino. El tiempo de enfermedad fue de 8,8 meses. Se encontró un EEG típico en 50% de los casos definitivos y 80% de los probables. La proteína 14-3-3 en líquido cefalorraquídeo fue positiva en un caso probable y los hallazgos típicos en resonancia magnética se observaron en dos casos probables. Todos los casos cursaron con una evolución clínica típica de la enfermedad, y se considera el primer reporte de ECJ en el Perú

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Hipertiroidismo congénito, Reporte de dos casos

Directory of Open Access Journals (Sweden)

Víctor Clemente Mendoza Rojas

2014-04-01

Full Text Available Introducción: El hipertiroidismo es una patología tiroidea poco frecuente en neonatos, relacionada con el antecedente materno de enfermedad de Graves, y por lo tanto con el paso transplacentario de inmunoglobulinas estimulantes del receptor de TSH. Presentación de casos: Reportamos dos casos de sexo femenino, que se presentaron en el Hospital Universitario de Santander. El primero de los casos se manifestó en la primera semana; el segundo caso se presentó tardíamente después del primer mes de vida. Los síntomas que presentaron en común fueron taquicardia persistente e hiperactividad. En uno de los casos la presentación clínica fue confundida con una infección bacteriana, debido a la presencia de fiebre. Se confirma el diagnóstico con los niveles de TSH muy suprimidos y T4 libre elevada, al menos al doble del límite superior. Los dos casos observaron medicamentos antitiroideos y propanolol con buena evolución clínica y de laboratorios; no se observamos complicaciones a corto o largo plazo como arritmias o craneosinostosis. Discusión: El hipertiroidismo congénito es una patología poco frecuente y siempre debe ser sospechado en recién nacidos de madres con antecedente de enfermedad de Graves, sus manifestaciones pueden presentarse prenatalmente o postnatalmente, y su diagnóstico y tratamiento deben ser oportunos para evitar secuelas a largo plazo o incluso la muerte

Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

Directory of Open Access Journals (Sweden)

Harold Castañeda-Peña

2010-01-01

Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

Ludopatía y epilepsia en demencia frontotemporal: Reporte de dos casos

Directory of Open Access Journals (Sweden)

Sheila Castro-Suarez

Full Text Available RESUMEN La demencia frontotemporal es un trastorno neurodegenerativo cuyo subtipo más común es la variante conductual. Es considerada la causa de demencia más frecuente en menores de 60 años. Se presentan dos casos no emparentados cuyos síntomas típicos fueron: deterioro progresivo de la cognición, del comportamiento, alteraciones psiquiátricas como desinhibición, actos impulsivos, apatía, falta de empatía, estereotipias y cambios en los hábitos de alimentación. La resonancia magnética cerebral, en ambos casos, mostró atrofia frontotemporal a predominio izquierdo; en la evaluación neuropsicológica se evidenció alteraciones de las funciones ejecutivas. El primer caso cursó con ludopatía como síntoma inicial, motivo por el cual permaneció por un año en un centro psiquiátrico, siendo el segundo en Latinoamérica y uno de los pocos casos reportados en el mundo. El segundo caso presentó crisis epilépticas en su evolución.

Primer reporte de alcaptonuria en el Perú

Directory of Open Access Journals (Sweden)

Daniel Guillén-Mendoza

Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Primer reporte de parasitismo de una garrapata blanda del género Ornithodoros (Ixodida: Argasidae sobre Rhinella arenarum (Anura: Bufonidae en el departamento de Valle Fértil, San Juan, Argentina

Directory of Open Access Journals (Sweden)

Acosta, Juan Carlos

2012-08-01

Full Text Available El objetivo de la presente comunicación es reportar por primera vez un caso de parasitismo en Rhinella arenarum y a la vez mencionar el primer registro del género Ornithodoros en el departamento de Valle Fértil, San Juan, Argentina. Siendo el primer registro de parasitismo de anfibios por Ornithodoros en la Argentina y el segundo para el neotrópico.

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

Celulitis por Acinetobacter junii-johnsonii adquirida en la comunidad: una presentación de caso

Directory of Open Access Journals (Sweden)

Andrés F. Henao-Martínez

2012-06-01

Full Text Available La infección de piel y tejidos blandos por Acinetobacter no relacionada con trauma es una presentación inusual. La mayoría de los casos descritos presentan enfermedades concomitantes y son causados por Acinetobacter baumanii. Se describe un caso de celulitis no traumática por A. junii-johnsonii con bacteriemia, de inicio en la comunidad y asociado con el tratamiento médico. De acuerdo con nuestro conocimiento, éste sería el primer caso reportado de infección de tejidos blandos y piel por A. juniijohnsonii.La vesícula hemorrágica podría ser una característica clínica de celulitis por Acinetobacter.   doi: http://dx.doi.org/10.7705/biomedica.v32i2.652

Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

OpenAIRE

Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera

2010-01-01

Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

Directory of Open Access Journals (Sweden)

Inês Moital

2014-11-01

Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

MÉTODO DE CASOS. UNA METODOLOGÍA ACTIVA PARA ADQUIRIR APRENDIZAJES SIGNIFICATIVOS EN QUÍMICA

Directory of Open Access Journals (Sweden)

Clotilde Pizarro

2015-01-01

Full Text Available En este trabajo se aplica lametodología de casos en estudiantes de primer año de la carrera de Ingeniería en Prevención de Riesgos y Medioambiente. Para lo cual se presenta un caso real de contaminación, ocurrido en una escuela de la región de Valparaíso llamada “La Greda”. Se inicia la aplicación del caso entregando un extracto de la información recolectada de los medios de información y se les realiza una breve inducción acerca de la metodología a aplicar. Luego se realiza un plenario, en el que se debate acercade las posibles soluciones al problema y estableciendo una relación entre el caso y las unidades del programa de química.Se concluye que la aplicación del método de casos, fue una herramienta fructífera en los rendimientos obtenidos por los estudiantes, ya que el porcentaje de aprobación en promedio fue de un 75%, el cual es considerablemente mayor que años anteriores.

Leucemia viral felina simultánea con otras patologías en tres casos clínicos diferentes

OpenAIRE

Ortiz A, José F

2011-01-01

La leucemia viral felina (ViLeF) es una patología, que se asocia con la presentación de varias enfermedades; el artículo presenta tres casos de pacientes cada uno con patologías diferentes que a su vez fueron positivos a ViLeF; no se descarta que esta enfermedad esté relacionada o sea la causa de las tres patologías, en el primer caso se encontró una anemia arregenerativa, en el otro, un carcinoma mamario y en el último, un proceso compatible con una peritonitis felina. Se describen la sintom...

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

ANÁLISIS DE LA CALIDAD DEL REGISTRO DE PARO CARDÍACO EN CASOS DE RESPONSABILIDAD MÉDICO LEGAL EN MÉDICOS GENERALES, 1999-2007

Directory of Open Access Journals (Sweden)

Gabriel Barragán

2009-01-01

Full Text Available Antecedentes. El registro del paro cardíaco es una actividad que se debe acompañar en la reanimación cerebro cardio pulmonar. En Colombia no existe un formato de registro oficial de paro cardiorrespiratorio, lo que dificulta la investigación en reanimación y la conducción de los procesos de responsabilidad médica que se deriven de esta atención. Objetivo. Analizar la calidad del registro de paro cardíaco en casos de responsabilidad médico legal iniciada a médicos generales que tuvieron asesoría científica del Fondo para Auxilio de Demandas de la Sociedad Colombiana de Anestesiología y Reanimación (SCARE-FEPASDE, 1999-2007. Material y métodos. Se realizó una investigación tipo serie de casos, en donde se incluyeron los casos de paro cardiorrespiratorio que tuvieron demanda médico legal y que fueron atendidos por médicos generales, entre 1999 y 2007, y que requirieron asesoría jurídica por SCARE-FEPASDE. La información se registró en tablas de Excel®, según las recomendaciones Utstein. La calificación de calidad se hizo por tres médicos expertos en responsabilidad médica de manera independiente. Se utilizó un formato de calificación sobre la proporción de registros realizados sobre 25 ítem posibles. La calidad se consideró alta (mayor de 95% ítem, media (70-94% ítem y baja (menor de 70%. En los casos de desacuerdo se realizó consenso. Resultados. Se incluyeron en total 83 casos. La calidad del registro del paro fue media en 49 casos (59%, baja en 32 casos (39% y alta en dos casos. Conclusión. El registro de paro cardiorrespiratorio en casos de responsabilidad médica es de mediana calidad, por lo que no se alcanza a cumplir con los estándares internacionales y las guías al estilo Utstein.

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae) reproducidas en cautiverio

OpenAIRE

Adán Villagarcia Olmeño; Enrique Cuevas

2014-01-01

En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772). La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

Síndrome biopercular: presentación de dos casos y revisión de la literatura

Directory of Open Access Journals (Sweden)

Carlos Santiago Uribe

2008-06-01

Las pacientes presentan diplejía facio-faringo-gloso-masticatoria y parálisis volitiva selectiva de músculos oro-faciales. La evaluación neuropsicológica evidenció compromiso cognitivo, emocional y de la interacción social como parte de un síndrome de la convexidad frontal en el primer caso y, de retardo mental, en el segundo caso. La fonoaudiología demostró que las dos pacientes tenían dificultades en el proceso de masticación y deglución, y dificultades graves en el lenguaje verbal. El pronóstico de recuperación del lenguaje verbal es pobre, pero muchos pacientes pueden recuperar la deglución.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae reproducidas en cautiverio

Directory of Open Access Journals (Sweden)

Adán Villagarcia Olmeño

2014-12-01

Full Text Available En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772. La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae reproducidas en cautiverio

Directory of Open Access Journals (Sweden)

Adan Villagarcía Olmeño

2015-01-01

Full Text Available En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772. La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

EEES, COMPETENCIAS Y APRENDIZAJE DEL DERECHO ROMANO MEDIANTE EL MÉTODO DEL CASO (I: EL DOBLE MATRIMONIO

Directory of Open Access Journals (Sweden)

Elisa Muñoz Catalan

2013-01-01

Full Text Available Con la realización del presente trabajo pretendemos investigar sobre la importancia actual de aplicar el método del caso en la enseñanza del Derecho Romano, frente a las tradicionales clases teóricas y magistrales. Reparando, muy especialmente, en el alcance de las exigencias metodológicas surgidas con los nuevos planes del estudio Grado en Derecho en el marco del EEES; así como en el desarrollo de una serie de competencias generales y específicas en los estudiantes, que les van a ser muy útiles una vez que finalicen el Grado y se enfrenten a las dificultades del mercado actual, ya que se consideran como los verdaderos protagonistas del proceso de enseñanza-aprendizaje. Por tanto, con la puesta en práctica de este primer caso sobre doble matrimonio romano, ausencia de testamento y herederos legítimos, intentamos acercar al alumnado al casuismo jurisprudencial romano; de este modo, comprenderán que lo importante no es dar la solución al supuesto planteado, sino razonar jurídicamente consiguiendo, a través de debates en grupos, un conocimiento más profundo de las reglas e instituciones aplicables.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Endocarditis por Brucella canis: primer caso documentado en un paciente adulto en Argentina Brucella canis endocarditis: first documented case in Argentina

Directory of Open Access Journals (Sweden)

Valeria Manias

2013-03-01

Full Text Available Se describe el primer caso documentado de endocarditis por Brucella canis en Argentina. El paciente fue un varón adulto que consultó por edemas en miembros inferiores, registros febriles aislados de 2 meses de evolución y dolor precordial opresivo que irradiaba a brazo izquierdo. Negaba contacto con animales de cría o consumo de productos sin pasteurización. Estudios cardiológicos constataron endocarditis infecciosa. Se resuelve cirugía de recambio valvular ante fracaso terapéutico empírico con cefalotina, ampicilina y gentamicina. Los hemocultivos fueron positivos (4 de 4 muestras con bacilos gram negativos. Se realizó la identificación con técnica API 20 NE (bioMérieux, el método automatizado Phoenix (BD y las pruebas bioquímicas convencionales, sin concluir género ni especie. Se derivó la cepa al departamento de Bacteriología Especial INEI-ANLIS "Dr. Carlos G. Malbrán" donde se identificó al aislamiento como Brucella canis. Se rotó el esquema terapéutico a doxiciclina, rifampicina y trimetoprima-sulfametoxazol con buena evolución. La importancia del caso radica en la posible falla del tratamiento antimicrobiano empírico administrado para endocarditis, ya que B. canis no responde a los antimicrobianos convencionales para esta patología.We herein present the case of an adult male patient who consulted for lower extremity edema, a 2- month history of fever and oppressive chest pain radiating to the left arm. He referred neither contact with breeding animals nor consumption of unpasteurized dairy products. A diagnosis of endocarditis was confirmed by cardiac studies. Since the empirical treatment with cephalotin, ampicillin and gentamicin failed, the patient underwent aortic valve replacement. A total of four blood cultures were positive with a gram-negative rod. Bacterial identification was performed using the API 20 NE technique (bioMerieux, the Phoenix automated method (BD and conventional biochemical tests which were

Chikungunya: enfermedad vírica emergente: irrupción en el ámbito laboral: primer caso declarado en España como accidente de trabajo

Directory of Open Access Journals (Sweden)

Marta Cerrillo Arranz

Full Text Available La enfermedad del Chikungunya es una infección causada por el virus Chikungunya y transmitida al hombre por la picadura de mosquitos vectores del género Aedes. Aun siendo endémica de otros países, la elevada movilidad actual de la población por motivos lúdicos, laborales, comerciales y migratorios junto a la presencia del vector competente (Aedes albopictus en numerosas zonas geográficas de España, hace que haya irrumpido en nuestro territorio en los últimos años. La palabra Chikungunya deriva del idioma Makonde (Mozambique. Significa "el que se encorva" en referencia a la postura frecuentemente adoptada por dolor articular. A pesar de su escasa mortalidad, la morbilidad puede ser elevada, afectando de forma significativa a la actividad de vida diaria y capacidad laboral del paciente, reflejado en el consecuente absentismo laboral y repercusión económica. En España, tanto desde el Servicio Sanitario Público como desde los Servicios Médicos de Salud Laboral y Servicios de Prevención, se debe estar preparado para el diagnóstico, seguimiento, tratamiento y prevención de enfermedades hasta ahora desconocidas en nuestro ámbito de trabajo. Este artículo describe el primer caso laboral en España por enfermedad del Chikungunya importada por contagio en Haití.

Consideraciones generales sobre población, desarrollo y medio ambiente, el caso de Tijuana, Baja California

OpenAIRE

Margarita Barajas Tinoco; Elizabeth Méndez Mungaray

1992-01-01

A partir de las relaciones que se pueden encontrar entre la sociedad y el medio ambiente natural, en este trabajo se destacan los elementos que dentro de la planeación general se orientan a la población y el desarrollo. El concepto de "calidad de vida", en sentido amplio, es tomado como indicador de desarrollo para problematizar contradicciones manifiestas entre un crecimiento urbano particular y su déficit de infraestructura social y problemas de medio ambiente. Como estudio de caso ilustrat...

La influencia del crimen organizado transnacional en el proceso de formulación de políticas públicas. Estudio de caso: Argentina 2001-2013

OpenAIRE

Marín Osorio, Iván Felipe

2016-01-01

Este estudio de caso analiza la influencia del Crimen Organizado Transnacional en la formulación de Políticas Públicas de seguridad en Argentina entre 2001 y 2013. En contraste con otros estudios, se considera que la relación de estos dos fenómenos debe recoger aspectos fundamentales de un enfoque de seguridad integral y multidimensional. En el caso de Argentina, durante 2001 el Crimen Organizado Transnacional ocupó el primer lugar en la agenda pública, lo cual derivó en una serie de acciones...

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Algunas enseñanzas de las crisis bancarias recientes: el caso uruguayo

OpenAIRE

José Manuel Quijano

2005-01-01

El trabajo indaga en algunas de las características de las crisis bancarias del presente así como en el desenlace que las mismas han tenido en los últimos años. Se analiza el caso de Uruguay y se hace referencia al de Argentina, quienes transitaron por una importante crisis cambiaria y bancaria en 1982 y veinte años después, en 2002, volvieron a tropezar con una nueva crisis de dimensión más amplia que la anterior y de graves consecuencias económicas y sociales. El primer apart...

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Porfirias poco frecuentes: Casos detectados en la población argentina Non frequent porphyrias in the argentinean population

Directory of Open Access Journals (Sweden)

V A Melito

2006-12-01

Full Text Available Las porfirias son consecuencia de fallas en el metabolismo del hemo. Se clasifican según el tipo de sintomatología clínica prevalente o el órgano donde se expresa preferencialmente la falla metabólica. En general la deficiencia enzimática está asociada a mutaciones en los genes que codifican para cada una de las enzimas. Están descritos 7 tipos de porfiria diferentes. Se transmiten por carácter autosómico dominante a excepción de la PCE, la PHE y la NPA que son recesivas. Sin embargo, están reportadas variantes homocigotas para el resto de las porfirias de pronóstico y evolución mucho más grave que la forma heterocigota. La descripción de estos casos poco frecuentes, sus tratamientos y evolución, facilitarían tanto el diagnóstico diferencial de la porfiria como el conocimiento de las posibilidades terapéuticas en cada caso. Asimismo para las porfirias heterocigotas con manifestación infantil, su identificación temprana y tratamiento aseguraría una mejor evolución minimizando los riesgos asociados. Se han diagnosticado 5 casos de porfirias agudas en niñas: 2 de PAI, 2 de PV y 1 de CPH. Entre las porfirias cutáneas se presentan 25 casos de PCT infantil, el primer caso de PHE en Argentina, 4 casos de PCE infantil y 1 en un adulto y 2 casos de PPE con compromiso hepatobiliar.The Porphyrias are a group of diseases resulting from partial deficiencies in one of the heme biosynthetic enzymes. These disorders can be classified on the basis of their clinical manifestations or according the organ where the metabolic deficiency is mainly expressed. In general this enzyme deficiency is associated with mutations in the genes which codify each enzyme. There are 7 types of Porphyrias. They are autosomal dominant disorders with the exception of PCE, PHE and NPA which are recessive. However, some rare and severe cases with recessive inheritance have also been reported. The description of these infrequent cases and their treatments and

Un caso de hernia diafragmatica (Agenesia parcial del hemídiafragma izquierdo plastia del díafragma con pulmón atelectásico

Directory of Open Access Journals (Sweden)

Alfonso Bonilla Naar

1951-06-01

Full Text Available Hospital de la Misericordia. Servicio del doctor Martínez. Sala Rosa. C. J. P. E. 10 años. N. El Charquito (Soacha. F. de L .Septi~tnbre 12 de 1950. F. de S. Noviembre 5 de 1950. D. Preliminar, neumonía. C. de ingreso. Consulta porque desde hace dos días tiene dolor abdominal difuso, vómito, estreñimiento, anorexia y fiebre (vomitó un Ascaris. Se trata del primer caso operado en nuestro medio de una hernia diafragmática (por agenesia y vale anotar que según Meyer (1 quien cita a Sagal, hasta 1.933 sólo se conocian doce casos. Harrington (2 cita 12 casos en la Mayo Clinic. Hasta ahora, el defecto del diafragma se había cerrado con faciaperirrenal o con músculo (gran dorsal. En este caso se ensayó con éxito una plastia con un lóbulo pulmonar atelectásico. (Original.

Infección pulmonar por Mycobacterium avium en paciente VIH/SIDA: Primer reporte en Perú

Directory of Open Access Journals (Sweden)

Juan Carrasco

Full Text Available El complejo Mycobacterium avium (MAC es un patógeno que se encuentra en el medioambiente y causa infecciones tanto en pacientes inmunocompetentes como inmunocomprometidos. Se presenta el caso de un paciente VIH positivo varón de 38 años infectado por P. jirovecii y aparentemente infectado por Mycobacterium tuberculosis desde el año 2009, el cual fue tratado con antibioticoterapia para pneumocistosis y terapia antituberculosis (TB logrando mejoría parcial. En el año 2012 se le realizó nuevamente examen de cultivo y un nuevo tratamiento anti TB, frente a la sospecha de estar en presencia de una cepa de TB multidrogorresistente se recomienda realizar la identificación micobacteriana. El examen de cultivo fue positivo y el resultado genotípico resultó positivo para MAC. Se reporta el primer caso de un paciente VIH/SIDA con infección pulmonar por MAC en el Perú, así como una breve revisión de los aspectos epidemiológicos, clínicos y de tratamiento

Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.

Energy Technology Data Exchange (ETDEWEB)

Linebarger, John Michael; Maffitt, S. Louise (New Mexico Institute of Mining and Technology, Albuquerque, NM); Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy

2011-10-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.

Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.

Energy Technology Data Exchange (ETDEWEB)

Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael

2011-08-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.

Cáncer de mama bilateral sincrónico. Revisión de la literatura y presentación de un caso

Directory of Open Access Journals (Sweden)

Lidia Torres Ajá

2012-05-01

Full Text Available Se conoce como cáncer bilateral sincrónico a los tumores primarios en ambas mamas, que son diagnosticados simultáneamente. Su aparición es poco frecuente, y se presenta aproximadamente en el 1- 2,5 % de todos los pacientes. Se informa el caso de una paciente de 57 años, que acudió a consulta por presentar nódulos mamarios bilaterales, diagnosticados, mediante biopsia por parafina, como cánceres mamarios histológicamente diferentes. Es el primer caso de cáncer mamario bilateral sincrónico diagnosticado en la provincia de Cienfuegos, por lo cual consideramos de interés su publicación y divulgación.

Presentación del primer caso humano de parasitismo por Macracanthorhynchus hirudinaceus en el Perú y breve revisión

Directory of Open Access Journals (Sweden)

María Beltrán F. de Estrada

1997-07-01

Full Text Available Se reporta un caso humano portador de Macracanthorhynchus hirudinaceus. Se trata de un varón de 45 años de edad, natural de la provincia de Chota, departamento de Cajamarca, Perú; con molestias digestivas. El diagnóstico se hizo por el hallazgo de huevos de Macracanthorhynchus hirudinaceus en las heces. Además se encontró Trichuris trichiura, Ancylostoma duodenale, Trichostrongylus sp, Blastocystis hominis y Entamoeba coli. Esta es la primera comunicación de un caso humano de M. hirudinaceus para el Perú.

SÍNDROME NEUROTÓXICO POR MORDEDURA DE Latrodectus mactans: REPORTE DE UN CASO PEDIÁTRICO Y REVISIÓN DE LITERATURA.

Directory of Open Access Journals (Sweden)

Oscar Alberto Castejón Cruz

2015-06-01

Full Text Available Lactrodectismo es un síndrome producido por mordedura de araña del género Latrodectus, el agente conocido como “Viuda Negra”. La incidencia es de 400 casos por año y su mortalidad de 1%. Siendo este el primer caso pediátrico reportado en Honduras. Caso Clínico: Escolar de 9 años, visita el área de Emergencia con 6 horas de evolución de mordedura de araña en mano derecha, ardor, dolor, enrojecimiento en sitio de la lesión, mialgias, artralgias, temblor fino y debilidad a la deambulación con disminución notable de la fuerza. Al evaluarlo taquicárdico, hipertenso con signos de agitación psicomotriz, diaforesis, edema bipalpebral, distensión abdominal y priapismo. Manejándose como un caso grave y egresado sin complicación alguna. Conclusiones: Este caso debe servir como guía para lograr un diagnóstico rápido, de tal manera que el diagnóstico de lactrodectismo sea considerado en los hospitales de manera oportuna. Palabras Clave: Araña viuda negra, picadura de araña, pediatría.

Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

Directory of Open Access Journals (Sweden)

Gabriel Natalio Castillo

2015-05-01

Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Glucogenosis tipo I: reporte de dos casos en dos hermanos de Cartagena de Indias-Colombia

OpenAIRE

Alvear-Sedán Ciro; Barboza-Ubarnes, Miryam; Bonillas-Fierro Miguel [q.e.p.d

2011-01-01

CASO CLÍNICO: # 1. Producto del primer embarazo de padres no consanguíneos, con lactancia hasta los dos años. A los 18 meses deedad presentó distensión abdominal, hepatomegalia difusa no dolorosa, diarrea de mes y medio, debilidad generalizada, edemaprogresivo en cara y pies, anasarca y anemia. Vesícula, bazo y riñones normales y examen neurológico sin alteraciones. Nopresentó hipoglucemia, ácido láctico normal. Pruebas hepáticas alteradas; colesterol, triglicéridos y ácido úrico en el límite...

Escuela Inclusiva: estudio de caso sobre la inclusión del Trastorno de Espectro Autista

OpenAIRE

Ortuñez Vegas, Sonia

2016-01-01

La educación inclusiva sigue siendo hoy una asignatura pendiente. Este trabajo plantea, un estudio de casos en dos colegios de Zaragoza, respecto a las dificultades y las necesidades que tienen los docentes a la hora de trabajar con niños autistas y de qué manera podría ser posible la inclusión de este alumnado en centros ordinarios. En primer lugar realizamos un breve resumen del trastorno del espectro autista y la evolución de la educación inclusiva. En segundo lugar, se pres...

Agenda pública local. Los casos de los municipios de El Carmen de Viboral y Turbo, Antioquia-Colombia

Directory of Open Access Journals (Sweden)

Olga Lucía Zapata Cortés

2016-01-01

Full Text Available La conformación de la agenda gubernamental en los municipios de El Carmen de Viboral y Turbo recorrió caminos diferentes. En el primer caso, se propuso una Asamblea Municipal como espacio de participación en el marco de la formulación del Plan de Desarrollo; en el segundo caso, se prefirió la contratación de un consultor externo para la elaboración del Plan de Desarrollo y hubo escasa participación ciudadana. Mediante un estudio de caso, apoyado en el análisis documental y el enfoque de corrientes múltiples para el estudio de la agenda pública, se observan formas diferenciadas de conformar la agenda, así como de aprovechar la participación de las comunidades en este proceso. También se observa que a pesar de las capacidades y fortalezas que trae consigo la presencia de la universidad pública en estos municipios, la incidencia de la Universidad de Antioquia en la configuración de la agenda local es escasa.

Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

Energy Technology Data Exchange (ETDEWEB)

Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy

2012-01-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS

Anestesia general para cesárea. Papel del sugammadex en la calidad y la seguridad del acto anestésico. Reporte de caso

OpenAIRE

Tafur B, Luis Alberto; Lema Flórez, Eduardo

2012-01-01

La cesárea es una de las intervenciones quirúrgicas más realizadas en el planeta. En el 5% de los casos se practica bajo anestesia general (7,5 millones de anestesias generales para cesárea cada año). Debido a sus requerimientos particulares (paciente con estómago lleno, necesidad de relajación neuromuscular, bienestar del binomio madre-hijo, expectativas de pronta atención del recién nacido por parte de la madre y relativa corta duración del procedimiento) la anestesia general representa un ...

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

Consideraciones generales sobre población, desarrollo y medio ambiente, el caso de Tijuana, Baja California

Directory of Open Access Journals (Sweden)

Margarita Barajas Tinoco

1992-09-01

Full Text Available A partir de las relaciones que se pueden encontrar entre la sociedad y el medio ambiente natural, en este trabajo se destacan los elementos que dentro de la planeación general se orientan a la población y el desarrollo. El concepto de "calidad de vida", en sentido amplio, es tomado como indicador de desarrollo para problematizar contradicciones manifiestas entre un crecimiento urbano particular y su déficit de infraestructura social y problemas de medio ambiente. Como estudio de caso ilustrativo se toma a la ciudad de Tijuana, espacio territorial que enfrenta una problemática urbana, manifiesta entre otros escenarios, en su medio ambiente natural y social.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

DIVERTÍCULO RECTAL. REPORTE DE UN CASO

OpenAIRE

Ángel-P, Alberto; Cardona-R, Danilo

2017-01-01

RESUMEN Introducción: La enfermedad diverticular del colon es frecuente en la población general, afectando al 50% de las personas mayores de 50 años, sin embargo, los divertículos ubicados en el recto son excepcionalmente raros. El objetivo de este estudio es informar el caso de un hombre de 67 años con enfermedad diverticular de colon sigmoides y colon transverso, con un divertículo rectal que se diagnosticó durante una colonoscopia ambulatoria. Caso clínico: Hombre de 67 años quien cons...

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Bloqueo aurículo-ventricular de primer grado en tirotoxicosis aguda First degree atrio-ventricular block in acute thyrotoxicosis

Directory of Open Access Journals (Sweden)

Antonio R. Vilches

2004-02-01

Full Text Available El cuadro clínico de la tirotoxicosis incluye síntomas cardiovasculares variados. La taquicardia sinusal es el trastorno electrocardiográfico más frecuente y los trastornos de conducción son extremadamente raros como modo de presentación. Comunicamos un caso de bloqueo aurículo-ventricular de primer grado en una paciente con hipertiroidismo recién diagnosticado y que comenzó días antes de la consulta con un cuadro general inespecífico. Su evaluación ulterior demostró que se trataba de una tirotoxicosis aguda autoinmune, y su tratamiento con metimazol corrigió el trastorno totalmente. Se discuten los mecanismos fisiopatológicos involucrados y las implicancias clínicas desde el punto de vista del internista.Thyrotoxicosis may present with a variety of cardiovascular symptoms. Sinus tachycardia is the most frequently encountered electrocardiographic abnormality and conduction disturbances are extremely uncommon. We present a case of first degree atrio-ventricular block in a patient with newly diagnosed hyperthyroidism and discuss the underlying pathophysiological mechanisms and the clinical implications from the internist’s standpoint.

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Capital social y desarrollo económico. Los casos de Silicon Valley y Villa El Salvador

Directory of Open Access Journals (Sweden)

Pablo Galaso Reca

2005-01-01

Full Text Available Este artículo se refiere a las relaciones existentes entre el capital social y el desarrollo económico. Para ello, en primer lugar presenta un marco teórico que muestra la evolución del concepto de capital social, su clasificación, medición y algunas aplicaciones prácticas. Posteriormente, explica teóricamente los efectos del capital social en el desarrollo económico. Finalmente, analiza dos experiencias de desarrollo económico altamente vinculadas con el concepto de capital social: los casos de Silicon Valley y Villa El Salvador.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

Al encuentro del lugar: caso de La parada del tonto en Concepción, Chile

Directory of Open Access Journals (Sweden)

Hugo Capellà

2014-09-01

Full Text Available Los lugares de encuentro se establecen en torno a nodos que terminan por convertirse en hitos colectivos, más allá de su forma. En el caso de La parada del tonto en la ciudad de Concepción, nos encontramos con un curioso ejemplo de un céntrico punto de encuentro que ha terminado por convertirse en un lugar con nombre propio. En el presente artículo nos centraremos, en primer lugar, en la construcción de lugares desde su dimensión no solo espacial, sino también temporal, incidiendo en la importancia histórica que han tenido los relojes como hito temporal. En segundo lugar, nos adentraremos en el caso de estudio específico de La parada del tonto, de su transformación de nodo hasta convertirse en hito de referencia colectiva. Finalmente, concluiremos con una teorización sobre la dimensión universal del hito temporal, como sentido del lugar o topoi, cohesionador de un legado colectivo.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

OpenAIRE

Héctor Armando Durán Peralta; Luis Fernando Córdoba C

2007-01-01

Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando...

Análisis de estabilidad del reactor pftr para una reacción con cinética de primer orden utilizando la funcional de lyapunov

OpenAIRE

Durán Peralta, Héctor Armando; Córdoba C, Luis Fernando

2010-01-01

Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizand...

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Incremento de la competencia comunicativa en dos adultos con Parálisis Cerebral mediante el dispositivo Makey-Makey. Un estudio de caso

OpenAIRE

Calleja, Marina; Luque, María Luisa; Rodríguez, José Miguel; Liranzo, Ana

2015-01-01

En este trabajo se presentan dos casos de parálisis cerebral (PC) de componente espástico y con graves problemas de comunicación como resultado de una fuerte disartria. Esta disartria les produce una baja inteligibilidad de habla, lo que les crea grandes dificultades en los procesos de interacción comunicativa y social. El objetivo de este estudio fue doble. En primer lugar, comprobar si era posible convertir el dispositivo conocido como Makey-Makey (Mk-Mk), inicialmente concebido...

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

Caso e caos

CERN Document Server

Ruelle, David

1992-01-01

Caso e caos – Il caso ha la sua ragione. Ma quale? E cos’è in realtà il caso? Da dove viene e come può fare irruzione nella nostra descrizione dell’universo? A tutte queste domande, in una chiara e lucida esposizione, cerca di dare risposta David Ruelle. Curiosando tra i risultati scientifici del XX secolo e soffermandosi anche su fenomeni e problemi estranei alla scienza tradizionale – le lotterie, gli oroscopi, la teoria dei giochi, la genesi della turbolenza – Ruelle ci guida a conoscere il caso avendo la matematica, la fisica e tutte le scienze naturali come compagne. Ancora oggi il modo in cui il caso irrompe nelle nostre vite e nel mondo può essere un mistero, ma grazie ai progressi della scienza, qui raccontati, riusciamo a saperne un poco di più.

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Espasmos epilépticos de inicio tardío: presentación de un caso clínico

OpenAIRE

Capote, Gabriela; Cerisola, Alfredo; Scavone, Cristina

2009-01-01

Introducción: los espasmos epilépticos son un tipo específico de crisis epiléptica caracterizada por una contracción muscular breve y brusca que abarca predominantemente el tronco y las extremidades. Cuando aparecen durante el primer año de vida, se presentan en salvas y se asocian al patrón electroencefalográfico típico de hipsarritmia, constituyen el síndrome de West. Es interesante discutir la clasificación nosológica de los casos que se presentan con espasmos epilépticos en salvas de inic...

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

El tamaño del Poder Legislativo como modulador del sistema electoral en la democracia representativa, el caso costarricense

Directory of Open Access Journals (Sweden)

Diego González Fernández

2014-07-01

Full Text Available El tamaño de los poderes legislativos es, dentro de las democracias representativas contemporáneas, un modulador fundamental del sistema electoral. Más aún, en sistemas donde lo que prima son las fórmulas electorales de carácter proporcional –fórmula Hare, Hare Modificado, D’Hondt, entre otras- en la elección de los legisladores, como es el caso costarricense, y en general, en toda América Latina. Siendo así, se parte de dos premisas básicas: en primer término, un parlamento con mayor número de integrantes se traduce en que el sistema electoral realizará una repartición más adecuada de diputaciones por partido político; y, en segundo lugar, esta proposición se complementa defendiendo que en los poderes legislativos donde la relación de proporcionalidad entre representante-representado, es decir, el número de habitantes que representa un legislador muestre mayor proximidad, expresará una tendencia a una mayor calidad en la democracia. A partir de estas premisas, se vislumbra el fin de este artículo el cual estudia primeramente la perspectiva teórica del tema, para después profundizar en el abordaje contemporáneo con detalle en el caso costarricense. Ello mediante un estudio al artículo 106 de la Constitución Política y un abordaje comparativo con la región latinoamericana.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

La práctica del reciclaje. Estudio de caso de La Asociación Colombiana de Recicladores Independientes, UPZ Engativá-Bogotá D.C.

OpenAIRE

Meléndez Álvarez, Nicolás

2014-01-01

El interés de este estudio de caso es analizar los procesos de reciclaje que lideran la Asociación Colombiana de Recicladores Independientes (ACOREIN) en la Unidad de Planeamiento Zonal (UPZ) 74- Engativá, relacionándolos con las perspectivas de ciudad sostenible. Por tal motivo en el primer apartado, se describe y analiza el concepto de sostenibilidad, desarrollo sostenible, y ciudad sostenible, la cual se encuentra ejemplificada. En el segundo capítulo se describe la labor de reciclaje gest...

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

El desarrollo de la identidad profesional del profesorado: el caso del especialista de música

Directory of Open Access Journals (Sweden)

José Luis Aróstegui Plaza

2013-01-01

Full Text Available En este artículo me propongo hacer una revisión del concepto de identidad social y de sus implicaciones para la formación del profesorado de música. Para ello hablaré, en primer lugar, de los conceptos de «identidad social» y de su variante, las «identidades sonoras», que forma parte de él. En segundo, se verá su implicación para la formación de la «identidad profesional» del profesorado de música. Finalmente, haré una reflexión de las consecuencias que pueden sacarse para toda la formación del profesorado. El caso del profesorado de música puede ser ilustrativo de cómo una concentración en contenidos o en competencias, las mismas para todo el mundo, nos lleva a un modelo de profesorado muy distinto a otro centrado en la comprensión del significado de las interacciones que se producen en el aula. Me propongo, pues, ofrecer datos que puedan ser interesantes para quienes estén interesados en la formación del profesorado de música, al tiempo que se aborda una cuestión relevante para la formación del profesorado en general.

Paragonimiasis Humana Primera Descripción de un caso colombiano

Directory of Open Access Journals (Sweden)

Bernardo Buitrago

1981-09-01

Full Text Available Se describe el primer caso colombiano de Paragonimiasis humana, comprobado histopatológicamente, que afectó principalmente la base del pulmón derecho, comprometiendo por vecindad al hemidiafragma derecho y al hígado. La enfermedad del paciente fue, muy probablemente, adquirida en Mesetas, Meta y tuvo una evolución aproximada de 4 años; el paciente falleció durante el post-operatorio inmediato a la resección de las lesiones pleuro-pulmonares y hepáticas. La sintomatología fue la de una neumopatía crónica con tos hemoptoica y hemoptisis. A pesar de múltiples baciloscopías, iterativamente negativas para bacilo tuberculoso, al paciente se le diagnosticó y trató para Tuberculosis Pulmonar. En nuestro medio, la Paragonimiasis debe ser incluída dentro del diagnóstico diferencial de las neumopatías crónicas con tos hemoptoica y hemoptisis.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

Directory of Open Access Journals (Sweden)

Héctor Armando Durán Peralta

2007-01-01

Full Text Available Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR, en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando la funcional de Lyapunov. Se trabaja con una cinética de primer orden pues un objetivo de este artículo es mostrar cómo se aplica la funcional de Lyapunov al análisis de un reactor de parámetros distribuidos, dado que es casi inexistente la literatura sobre el método de la funcional de Lyapunov aplicada a la estabilidad de reactores (técnica usada en el análisis de estabilidad de sistemas en ingeniería eléctrica. El análisis de estabilidad dio como resultado perfiles de temperatura y concentración asintóticamente estables para los casos PFTR isotérmico, no isotérmico con constante cinética independiente de la temperatura y PFTR no isotérmico adiabático. Para el PFTR con retiro de calor el análisis condujo a una región de estabilidad asintótica y a una región incierta donde puede o no haber oscilaciones.

Síndrome de carcinoma de células basales nevoides (Síndrome Gorlin: reporte de dos casos y revisión de la literatura

Directory of Open Access Journals (Sweden)

María del Carmen Castro-Mujica

Full Text Available RESUMEN El síndrome Gorlin (SG es una condición genética, con patrón de herencia autosómico dominante, con penetrancia completa y expresividad variable, debida a mutaciones germinales en los genes PTCH1 o SUFU, los cuales son componentes de la vía molecular Sonic hedgehog. El SG se caracteriza por la presencia de múltiples carcinomas de células basales nevoides, quistes odontogénicos, calcificación de la hoz del cerebro y lesiones en sacabocado en palmas y plantas. Este es el primer reporte de casos en el Perú sobre pacientes con SG, que cuentan con evaluación y asesoría genética. Presentamos dos casos de SG que cumplen criterios clínicos del síndrome y una revisión de la literatura.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Complex Adaptive Systems of Systems (CASOS) engineering environment.

Energy Technology Data Exchange (ETDEWEB)

Detry, Richard Joseph; Linebarger, John Michael; Finley, Patrick D.; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Ames, Arlo Leroy

2012-02-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex physical-socio-technical systems which we must understand to design a secure future for the nation. The Phoenix initiative implements CASoS Engineering principles combining the bottom up Complex Systems and Complex Adaptive Systems view with the top down Systems Engineering and System-of-Systems view. CASoS Engineering theory and practice must be conducted together to develop a discipline that is grounded in reality, extends our understanding of how CASoS behave and allows us to better control the outcomes. The pull of applications (real world problems) is critical to this effort, as is the articulation of a CASoS Engineering Framework that grounds an engineering approach in the theory of complex adaptive systems of systems. Successful application of the CASoS Engineering Framework requires modeling, simulation and analysis (MS and A) capabilities and the cultivation of a CASoS Engineering Community of Practice through knowledge sharing and facilitation. The CASoS Engineering Environment, itself a complex adaptive system of systems, constitutes the two platforms that provide these capabilities.

Osteomalacia oncogénica: Presentación de dos casos

Directory of Open Access Journals (Sweden)

Fernando Jerkovich

2015-02-01

Full Text Available La osteomalacia oncogénica es una enfermedad rara. Existen descriptos alrededor de 337 casos. Es ocasionada por un tumor productor del factor de crecimiento fibroblástico 23 (FGF-23, hormona que disminuye la reabsorción tubular de fosfatos y altera la hidroxilación renal de la vitamina D, con hipofosfatemia, hiperfosfaturia y niveles bajos de calcitriol. Se presentan dos pacientes de 44 y 70 años, que consultaron por dolores óseos generalizados de aproximadamente un año de evolución en los que se hallaron alteraciones bioquímicas compatibles con osteomalacia hipofosfatémica. En el primer caso se realizó la resección de una tumoración en tejido celular subcutáneo del pie derecho, un año después del diagnóstico clínico. Luego de la exéresis, se disminuyó el aporte de fosfatos que recibía el paciente, pero reaparecieron los dolores al intentar suspenderlos. Ocho años más tarde, hubo recidiva local de la tumoración por lo que se efectuó resección completa. Después de la misma, se logró suspender el aporte de fosfatos. En el segundo caso, el paciente se estudió con tomografía por emisión de positrones con 18F-fluorodesoxiglucosa, hallando formación nodular hipermetabólica en partes blandas de antepie derecho, de 2.26 cm de diámetro. Luego de su escisión se pudo suspender el aporte de fosfatos. Ambos pacientes se encuentran asintomáticos con indicadores de metabolismo fosfocálcico normales. El diagnóstico anatomopatológico en ambos fue un tumor mesenquimático fosfatúrico, variante mixta del tejido conectivo, la entidad más frecuentemente asociada a la osteomalacia oncogénica.

Determinación de enfermedades parasitarias en población infantil de primer a cuarto grado de educación primaria en un ejido del sur de sonora

Directory of Open Access Journals (Sweden)

Gabriela de Los Ángeles Díaz Reyes

2014-06-01

Full Text Available La parasitosis intestinal constituye un problema de salud pública en México, siendo la población infantil la más afectada (9. En el estado de Sonora, se han realizado estudios que ubican la prevalencia de infecciones por microorganismos como Giardia lamblia, Endolimax nana y Entamoeba coli en 20, 10 y 19% respectivamente, con una situación de poliparasitismo en 18% de los casos (6. El hacinamiento, la escasez del agua potable y la carencia de drenaje, constituyen los mayores factores de riesgo para contraer este tipo de enfermedad (1. Como parte de un proyecto de Servicio Social de la Carrera de Químico Biólogo de la Universidad de Sonora, Unidad Regional Sur, se realizó un muestreo coproparasitoscópico en 52 niños de entre Primer y Cuarto grado de educación Primaria, en una población ejidal del sur del estado, con el fin de detectar casos positivos y canalizarlos para su atención. Se registraron 40 casos positivos para parasitosis, representando un 76.9% de la muestra, los principales microorganismos detectados durante el estudio fueron G. lamblia, E. histolityca, E. coli y E. nana, encontrándolos de manera aislada o en algunas muestras en asociaciones multiparasitarias.

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Validez de constructo y fiabilidad del «Cuestionario de ansiedad social para adultos» (CASO) en Colombia

OpenAIRE

Salazar, Isabel C; Caballo, Vicente E; Arias, Benito

2016-01-01

El «Cuestionario de ansiedad social para adultos» (CASO) es una medida de autoinforme desarrollada para los países de habla española y portuguesa. El objetivo de este estudio fue analizar la validez de constructo y la fiabilidad del CASO en Colombia. Participaron 5477 personas de la población general contestando el CASO y la «Escala de ansiedad social de Liebowitz-versión de autoinforme» (LSAS-SR). El análisis paralelo y el análisis factorial exploratorio del CASO arrojaron una solución de ci...

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Coriocarcinoma metastásico a yeyuno. Reporte de tres casos

Directory of Open Access Journals (Sweden)

J.L. Martínez-Ordaz

2012-07-01

Full Text Available El 5,0% de los pacientes con coriocarcinoma desarrollan metástasis a intestino delgado. Los tumores de intestino delgado son raros, y generalmente las metástasis son de carcinomas de pulmón, mama o melanoma. La sintomatología es vaga y la mayoría son hallazgos de autopsia. Los síntomas principales están relacionados con la presencia de tumor abdominal o hemorragia, oclusión o perforación intestinal. Presentamos los casos de 3 pacientes con metástasis de coriocarcinoma a intestino delgado. Una mujer de 24 años con oclusión intestinal secundaria a intususcepción originada en un pólipo de coriocarcinoma metastásico, y dos hombres de 18 y 24 años con historia de tumor testicular, que presentaron 2 y 10 meses posterior a orquiectomía, hemorragia de tubo digestivo por metástasis de coriocarcinoma a intestino delgado. El manejo fue endoscópico en un caso y quirúrgico en los restantes. Dos pacientes fallecieron en el postoperatorio mediato y el restante durante el primer año de seguimiento. Las metástasis de coriocarcinoma son muy raras. Las manifestaciones clínicas principales son hemorragia u oclusión intestinal. El manejo puede ser médico o quirúrgico para su resolución. La mayoría de los pacientes con coriocarcinoma responden a quimioterapia, pero el pronóstico es peor para aquellos con metástasis a intestino delgado.

Reintegro y permanencia universitaria en Bogotá : el caso de la Facultad de Ingeniería de la Universidad Distrital, 2000-2009

OpenAIRE

Díaz Franco, María Camila

2012-01-01

El presente trabajo de investigación, estudia a través del caso de la cohorte del 2000 de la Facultad de Ingeniería de la Universidad Distrital, el tipo de coyuntura que le permitió a este grupo de jóvenes reingresar a la Universidad y culminar la carrera al haber tenido que abandonarla en un primer momento, por problemas socio-económicos y/o académicos. Por medio del estudio del reintegro universitario, este trabajo se enmarca en el campo, poco explorado, de la existencia y efectividad de m...

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

El outsourcing de sistemas de información de recursos humanos en España: el caso de Roche Diagnostics

OpenAIRE

Claver Cortés, Enrique; González Ramírez, María Reyes; Gascó Gascó, José Luis

1999-01-01

No existen muchos estudios españoles acerca del outsourcing de Sistemas de Información; Norteamérica y Reino Unido son los países dónde más ha proliferado la investigación en este ámbito. Proponemos el uso del método del caso para analizar el outsourcing de Sistemas de Información en nuestro país por dos motivos fundamentalmente: en primer lugar, porque muchos estudios sobre outsourcing han usado este mismo método; en segundo, ya que esta metodología es adecuada cuando el área que va a ser in...

¿Pueden los niños adquirir y aplicar conocimientos de emprendimiento?. El caso del subprograma, mi primer empresa: “emprender jugando”

Directory of Open Access Journals (Sweden)

Javier Damián Simón

2015-01-01

Full Text Available En México el tema de la Educación en Emprendimiento (EE en escuelas primarias es una línea emergente en la investigación educativa. El objetivo principal de la investigación fue evaluar la estructura y puesta en marcha de los planes de negocio elaborados por niños en el marco del subprograma Mi Primer Empresa: “emprender jugando”. La investigación fue descriptiva y exploratoria. Participaron 26 alumnos, 15 varones y 11 mujeres que cursaban el quinto y sexto grado en la Escuela Primaria Rural Benito Juárez ubicada en la localidad del Edén del municipio de San Juan Bautista Tuxtepec, Oaxaca. Se estudiaron tres variables: plan de negocio, conocimientos teóricos de emprendimiento y, habilidades de emprendimiento infantil. Se aplicó un cuestionario y un documento base de la estructura del plan de negocios que proporcionó la Fundación Educación Superior Empresa (FESE y, el análisis de la información fue hecha mediante el software estadístico SPSS V.19. En términos generales los resultados muestran que los participantes sí adquirieron y aplicaron conocimientos teóricos de emprendimiento pues fueron capaces de desarrollar el plan de negocio correspondiente a su mini empresa.

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Primer aislamiento en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina

Directory of Open Access Journals (Sweden)

Laura Errecalde

Full Text Available Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a la meticilina adquirido en la comunidad. Durante el tratamiento con vancomicina y daptomicina, se observó un aumento gradual de la CIM de vancomicina de 1 µg/ml (VSSA a 2 µg/ml (h-VISA y a 4 µg/ml (VISA, y la emergencia de no sensibilidad a daptomicina (CIM = 4 µg/ml. Al suspender la vancomicina y la daptomicina, la cepa revirtió al fenotipo de sensibilidad a ambas drogas. Es mandatorio evaluar por CIM la sensibilidad a vancomicina y a daptomicina intratratamiento cuando estas drogas se usan como terapia.

Actuación de un servicio de prevención de riesgos laborales para la atención a casos sospechosos de enfermedad respiratoria por coronavirus (MERS-CoV: A propósito de un caso

Directory of Open Access Journals (Sweden)

María Ascensión Maestre Naranjo

Full Text Available Resumen Tras el primer caso importado en España de infección humana por el coronavirus (MERS-CoV, ingresado en el Hospital Universitario Puerta de Hierro Majadahonda (HUPHM, se procede a la elaboración de un procedimiento de actuación para la atención a casos sospechosos de enfermedad respiratoria de alerta internacional. Este procedimiento se activa en el momento en el que se establece la sospecha de esta enfermedad en el hospital. Se describen las medidas de actuación ante el ingreso de un paciente con estas características, garantizando la calidad asistencial así como la protección de la salud de los trabajadores. Desde el Servicio de Prevención de Riesgos Laborales (SPPRL se procede al registro de los trabajadores implicados, se realiza el estudio de contactos y el seguimiento de los mismos, facilitándose la información y formación a los trabajadores sobre los riesgos ante el nuevo agente causal y la utilización de los equipos de protección adecuados, y la valoración de los trabajadores especialmente sensibles, explicando la activación y puesta en marcha del protocolo en las distintas situaciones en que ha sido necesario.

Neuroblastomicose: registro de três casos

Directory of Open Access Journals (Sweden)

Ehrenfried O. Wittig

1968-03-01

Full Text Available São relatados três casos de neuroblastomicose de sintomatologia variada (urna forma tumoral cerebelar, urna forma abscedante troncular e cerebral e urna forma granulomatosa difusa. No caso da forma tumoral cerebelar havia associação com cisticercose cerebral. Alterações medulares não foram evidenciadas no único caso em que foi possível examinar êste setor do sistema nervoso central (caso 2.

Brain MRI lesions in neuromyelitis optica: clinical case; Lesiones cerebrales de resonancia magnetica en neuromielitis optica: caso clinico

Energy Technology Data Exchange (ETDEWEB)

Rosales Bravo, Luis Guillermo; Heyden Cordero, Marvin; Chinchilla Weinstok, Dennis; Mendelewicz Goldwaig, Isaias, E-mail: neurologia.cima@gmail.com [Caja Costarricense del Seguro Social, Hospital Mexico, Div. de Neurologia, San Jose (Costa Rica)

2011-10-15

Many cases of patients with neuromyelitis optica have submitted without demyelinating lesions in the cerebral white matter, it has documented that this entity can cause from the onset of illness or through its natural evolution. Diagnostic methods currently as Magnetic Resonance Imaging (MRI) and specific antibodies in plasma (such as antiaquaporin-4) have been diagnosed of neuromyelitis optica cases that were initially confused with multiple sclerosis. Disease in Costa Rica has been little prevalent and is not exactly known what the prevalence and incidence. The degree of disorder is illustrated through a case study, both in the cerebral white matter as spinal cord, in a patient with neuromyelitis optica during a follow-up period of 4 years. This is the first case that has been reported in the scientific literature of Costa Rica. (author) [Spanish] Muchos casos de pacientes con neuromielitis optica se han presentado sin lesiones desmielinizantes en la sustancia blanca cerebral, se ha documentado que esta entidad puede causarlas desde el inicio de la enfermedad o a traves de su evolucion natural. Los metodos de diagnostico en la actualidad como la Imagen por Resonancia Magnetica (IRM) y la determinacion de anticuerpos especificos en plasma (como la antiaquaporina-4) han logrado diagnosticar algunos casos de neuromielitis optica que inicialmente fueron confundidos con esclerosis multiple. La enfermedad en Costa Rica ha sido poco prevalente y no se ha conocido con exactitud cual es la prevalencia e incidencia. El grado de afeccion ha sido ilustrado a traves de un caso clinico, tanto en la sustancia blanca cerebral como espinal, en un paciente con neuromielitis optica durante un periodo de seguimiento de 4 anos. Este es el primer caso que ha sido reportado en la literatura cientifica de Costa Rica. (autor)

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Servicio civil en Chile, análisis de los directivos de primer nivel jerárquico (2003-13

Directory of Open Access Journals (Sweden)

Bastián González-Bustamante

2016-02-01

Full Text Available Resumen Este artículo analiza los principales factores que condicionan la selección de un directivo público de primer nivel jerárquico en Chile con base en una perspectiva de corte sociológico y el uso del concepto especies de capital. El trabajo realiza un recorrido teórico y descriptivo sobre la modernización del Estado y la profesionalización de la gestión pública en Chile. Posteriormente con una muestra de 45 casos correspondientes a altos directivos nombrados durante el período 2003-13, se trabaja con modelos de regresión logística para determinar los factores que condicionan la selección de estos funcionarios. Se llega a la conclusión que el capital político no es un factor que favorece la selección del actor.

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

GENERACIÓN DE CASOS DE PRUEBA A PARTIR DE CASOS DE USO EN LAS PRUEBAS DE SOFTWARE

Directory of Open Access Journals (Sweden)

Orelvis Vázquez Ruiz

2006-04-01

Full Text Available

Los casos de uso son utilizados para expresar la funcionalidad requerida en un sistema. Los casos de prueba derivados directamente de casos de uso aprovechan la ventaja que constituye contar con la especificación existente de estos últimos, para garantizar un basamento sólido para las pruebas a realizar sobre el sistema. La capacidad para crear casos de prueba a partir de los casos de uso, y hacer la traza de unos a otros, es una habilidad vital para asegurar un producto de calidad.

Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

DEFF Research Database (Denmark)

Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

2015-01-01

the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

Directory of Open Access Journals (Sweden)

José Cardona Á.

2011-12-01

Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Análisis de los efectos de intervenciones públicas en la recuperación de centros urbanos : caso de estudio barrio las Cruces, Bogotá 2002-2014

OpenAIRE

Rosillo Herrera, María Daniela

2015-01-01

En el presente estudio de caso se hace un análisis de los principales efectos socio-espaciales y económicos que tuvieron intervenciones públicas dirigidas a recuperar el centro de Bogotá, en el territorio específico del Barrio Las Cruces, durante los años 2002-2014. Para lograrlo, en un primer momento se hace un análisis conceptual de las relaciones existentes entre intervenciones urbanas y los efectos que estas producen en lo urbano y lo local; en un segundo se identifican los antecedentes q...

¿Qué explica la evolución del rendimiento académico universitario? Un estudio de caso en la Universidad del Pacífico

OpenAIRE

Arlette Beltrán; Karlos La Serna

2009-01-01

"Utilizando un modelo de “panel data” para el caso de los alumnos de la Universidad del Pacífico que ingresaron en el año 2006, el presente trabajo busca determinar si el rendimiento escolar y las características académicas del colegio de procedencia explican el desempeño en la universidad, más allá del primer año de estudios universitarios. Además, se identifican otros factores dan cuenta de dicho desempeño. Los resultados indican que el rendimiento académico en el colegio es uno de los prin...

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Dermatomiositis: a propósito de 3 casos interesantes

Directory of Open Access Journals (Sweden)

Zianna Almanza Liranza

2010-12-01

Full Text Available Se presentan los casos de 3 pacientes atendidos en el Hospital Pediátrico «Juan Manuel Márquez», 2 de las cuales presentaron como primeras manifestaciones debilidad en los miembros inferiores y artritis que dificultaba la marcha de forma progresiva. El tercer paciente presentaba lesiones escamosas en la piel, hipopigmentadas en la cara y los miembros, acompañadas de astenia y artritis de las rodillas. Se realizaron estudios para concluir el diagnóstico, incluida la biopsia de músculo. Se aplicaron los criterios para confirmar el diagnóstico de dermatomiositis y se excluyeron otras enfermedades según el cuadro clínico y los exámenes complementarios realizados. A los 2 primeros pacientes se les indicó tratamiento inmunomodulador con prednisona y metotrexato, y al tercer paciente se le indicó prednisona y azathioprina. Se observó una buena respuesta al tratamiento y control de la enfermedad. El primer paciente falleció a los 4 meses de tratamiento a causa de complicaciones (vasculitis intestinal y sepsis asociada al tratamiento quirúrgico. Los restantes pacientes se siguen actualmente por consulta.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Herramientas para la investigación en Tecnologías de la Información y la Comunicación. Casos de estudio

Directory of Open Access Journals (Sweden)

Julio Ruiz Palmero

2011-01-01

Full Text Available En este artículo se pretende mostrar las posibilidades de algunas herramientas de recogida de información para el estudio cualitativo y cuantitativo en casos concretos de investigación y evaluación del impacto de las TIC en la enseñanza. Se mostrarán las técnicas seguidas en diferentes casos así como su metodología seguida. Los casos de estudio se corresponden con investigaciones desarrolladas dentro del Grupo de Investigación de Nuevas Tecnologías (Gtea de la Universidad de Málaga. En primer lugar abordaremos dos investigaciones sobre la evaluación de e-portafolios y análisis de diarios del Practicum desarrolladas durante 5 cursos académicos, en tercer lugar nos centraremos en la investigación que se está llevando a cabo dentro del Proyecto Estudio comparativo sobre la utilización y opinión del alumnado universitario sobre las TIC contrastando competencias requeridas como futuros profesionales (Ref. A/023024/09, financiado por la Agencia Española de Cooperación Internacional y en el que participan universidades de 5 países (España, México, Argentina, Perú y Chile y que se encuentra en su última fase de desarrollo.

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

Science.gov (United States)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

Neurosindrome minimo en la tripanosomiasis cruzi crónica: (Estudio de dos casos de encefalopatia chagástica crónica

Directory of Open Access Journals (Sweden)

Miguel Eduardo Jörg

1967-01-01

Full Text Available Se presenta el estudio clínico, y anatomopatológico parcial, de dos enfermos con encefalopatía crónica por Trypanosoma cruzi, cuyo síntoma inicial aislado fue la cefalea, a la cual se agregaron progresivamente otros síntomas de enfermedad del sistema nervioso central, llegando tras años a configurarse un cuadro de enfermedad cerebral definida, en el primer caso con sintomatologia cerebral difusa y compromiso de la actividad psíquica, en el segundo caso con síndrome seudotumoral. En ambos casos coexistían signos de cardiopatía, pero sin el conjunto de elementos semiológicos prevalentes en la cardiopatía chagásica. El estudio anatomopatológico del cerebro (el primer caso muere por accidente, el segundo en coma encefalopática, posiblemente agravado por hipermedicación mostró en ambos casos una meningo-córtico encefalitis multimicrofocal, de predomínio superficial, con caracter nodular en torno a vasos sanguíneos alterados (vasculitis primária?. A la encefalitis inflamatoria se agregan en el 2º caso lesiones trombóticas arteriolares (microembolia de trombos murales provenientes de la cardiopatía?. Se hallaron igualmente, areas irregulares de desmielinización, neuronolisis y satelitosis. En el caso 2 se encontraron leishmanioides de T. cruzi en reducido número, en focos de lesión inflamatoria necrotizante típica. Como el síntoma inicial y aislado fuera la cefalea en ambos enfermos, se considera haber confirmado y ampliado las observaciones clínicas de uno de los autores, quien señala a la cefalea (en asociación a reacciones suerológicas positivas como neurosíndrome mínimo en la tripanosomiasis cruzi crónica. Se analisan los posibles mecanismos patogénicos, se exponen los síntomas concomitantes y la evolución de la encefalopatía crónica por T. cruzi, considerando los casos estudiados a la luz de los conocimientos previos sobre las formas neurales de la tripanosomiasis cruzi.The clinical and

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

Directory of Open Access Journals (Sweden)

Stephen Larson

2014-03-01

Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

Science.gov (United States)

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

2010-01-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

Territorio, desarrollo tecnológico y gestión de recursos naturales renovables: El caso de la pesca

Directory of Open Access Journals (Sweden)

Ignacio Carciofi

2012-01-01

Full Text Available La gestión eficiente de ciertos recursos renovables caracterizados por la propiedad común y el libre acceso ha estado mediatizada por la denominada «Tragedia de los Comunes». La literatura pionera en este campo enfatizaba la necesidad de un marco regulatorio que superara esta tendencia hacia la sobreexplotación y agotamiento del recurso. Elinor Ostrom, sin embargo, en un trabajo seminal, se apartaba de esta línea y reivindicaba, paradójicamente, soluciones basadas en la propiedad y gestión comunal, que parecían estar en el origen del problema. El presente trabajo tiene, en este sentido, un doble objetivo. En primer lugar, realizar una revisión de la literatura económica sobre la explotación de recursos naturales en los espacios comunales y de libre acceso, con especial referencia al caso de la pesca. En segundo, y trascendiendo lo anterior, llamar la atención sobre el hecho de que la solución de Ostrom, que devuelve a la gestión del recurso su componente territorial y local, queda en el caso de la pesca fuertemente comprometida por un progreso tecnológico que está acabando con las pesquerías locales.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Opciones reales, valuación financiera de proyectos y estrategias de negocios. Aplicaciones al caso mexicano

Directory of Open Access Journals (Sweden)

Francisco Venegas Martínez

2006-01-01

Full Text Available En este trabajo la metodología de opciones reales se presenta como un instrumento indispensable para que los consejos de administración de las empresas tomen decisiones respecto a proyectos de inversión o estrategias de negocios cuando existe la flexibilidad (opcionalidad de tomar en el futuro nuevas decisiones relacionadas con extender, contraer, posponer, enmendar o abandonar un proyecto o estrategia. Al respecto, el presente trabajo realiza una revisión de las diferentes fórmulas analíticas que aparecen en la bibliografía para valuar la opcionalidad de estrategias en el supuesto de que el valor presente de los flujos de efectivo esperados sigue una distribución log normal o bien mediante el uso de métodos de árboles binomiales. En particular, se trata el caso de la toma de decisiones de venta o cierre de una empresa cuando el valor de mercado de sus títulos (de capital y deuda excede el valor presente de los flujos de efectivo esperados o el valor presente de estos flujos es menor que cierto valor de recuperación. En este contexto se analiza el caso de una empresa mexicana de servicios satelitales de comunicación. Asimismo, se aplica la metodología de opciones reales a proyectos carreteros de inversión; específicamente se examina el caso del proyecto de construcción del primer tramo de la autopista Toluca-Atlacomulco según los supuestos de volatilidad constante y estocástica. Es también importante destacar que esta investigación se centra en: i la valuación de opciones reales americanas de abandono; ii valuación de opciones reales compuestas; iii valuación de opciones reales con volatilidad extendiendo el modelo de Hull y White (1987.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Filosofia naturale della causalità e del caso

CERN Document Server

Born, Max

1962-01-01

Introduzione ; causalità e determinismo ; esemplificazione : l'astronomia e la meccanica delle particelle ; contiguità ; principio di antecedenza e termodinamica ; caso ; caso e antecedenza ; materia ; caso ; conclusioni metafisiche.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Abdomen agudo ocasionado por apendicitis aguda de probable origen tuberculoso. Informe de un caso

OpenAIRE

Montiel-Jarquín, Álvaro José; Alvarado-Ortega, Iván; Romero-Figueroa, María del Socorro; Rodríguez-Pérez, Fabiola; Rodríguez-Lima, Felipe; Loria-Castellanos, Jorge

2017-01-01

RESUMEN Antecedentes: la apendicitis aguda tuberculosa es una enfermedad rara, constituye de 0,001 % a 0,01 % de las formas clínicas de tuberculosis. Se presenta un caso de apendicitis aguda probablemente tuberculosa como causa de abdomen agudo quirúrgico. Caso clínico: hombre de 29 años con cuadro de dolor abdominal leve a moderado que se intensificó y localizó en el hemiabdomen derecho, claudicación, febrícula, vómito, mal estado general, leucocitosis de 11 300/µL y neutrofilia de 91 %....

Química general II

OpenAIRE

Olba Torrent, Amparo

2018-01-01

El document forma part dels materials docents programats mitjançant l'ajut del Servei de Política Lingüística de la Universitat de València Temes de l'assignatura: Química general II del primer curs del Grau de Química Topics of the course: General Chemistry II in the first year of the Degree in Chemistry

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

Caracterización de la fibrosis quística en el primer año de vida

Directory of Open Access Journals (Sweden)

Gladys Fuentes Fernández

Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

Crisis de las hegemonías en América latina: los casos de Bolivia y Chile

Directory of Open Access Journals (Sweden)

Luis Albero Vivero Arriagada

2014-01-01

Full Text Available El objetivo de este trabajo es comprender y distinguir cómo se manifiesta, la ruptura o crisis de la hegemonía de las clases dominantes, cómo se presentan los procesos y posibilidades de reconfiguración de las clases sociales y las correlaciones de las fuerzas políticas entre las élites dominantes y los sectores excluidos. Se toma como referencia los casos de Bolivia y Chile en el período comprendido entre los años 2006 y 2012 ya que permite tener como referencia los triunfos electorales de Evo Morales en Bolivia y en el caso de Chile el primer gobierno de Michelle Bachelet y el triunfo de Sebastián Piñera. Desde una perspectiva hermenéutica crítica se realiza una revisión y análisis interpretativo de las obras de Antonio Gramsci y de otros referentes del pensamiento crítico latinoamericano que nos aporta un marco teórico que ilumina el análisis interpretativo. Se concluye que los conflictos y las contradicciones presentes en estos países dan cuenta de la posibilidad de construcción de nuevas relaciones sociales y políticas a partir de las luchas contra hegemónicas que han venido protagonizando las clases excluidas.

Síndrome de Allgrove. Informe de casos.

OpenAIRE

Alejandro Román; Catalina Montoya; Juliana Zapata; Juan Manuel Alfaro; Vital Balthazar

2009-01-01

El síndrome de Allgrove fue descrito en 1978 por Allgrove et al. como una entidad familiar de origen desconocido caracterizada por deficiencia aislada de glucorticoides, acalasia esofágica y producción defectuosa de lágrimas, por lo que ha sido denominado síndrome triple AAA (adrenal insufficiency, achalasia, alacrima); por lo general aparece durante la primera década de la vida con disfagia o con crisis suprarrenal severa; son pocos los casos diagnosticados de novo en los adultos en quienes...

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

Science.gov (United States)

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

2010-03-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

Estudio de caso y aprendizaje cooperativo en la universidad

Directory of Open Access Journals (Sweden)

Pedro Aramendi Jauregui

2014-01-01

Full Text Available Diseñar los planes de estudio en función del desarrollo de competencias demanda cambios metodológicos importantes. El método de caso es una de las estrategias de enseñanza y aprendizaje más adecuadas para desarrollar las competencias orientadas al trabajo en equipo y al fomento de la colaboración. El artículo que se presenta es un resumen del proyecto de innovación “El estudio de caso y el aprendizaje cooperativo en la universidad” (PIE-2010-2012 financiado por la Universidad del País Vasco. El objetivo general del proyecto es implementar el método de caso en las asignaturas de Organización de Centros (SocioEducativos (titulaciones de Pedagogía y Educación Social. MÉTODO: Se han seleccionado dos grupos de segundo curso de la titulación de Educación Social (uno en euskera y otro en castellano y otros dos del mismo curso de Pedagogía en ambos idiomas. En uno de los grupos de cada titulación se trabajaron técnicas de dinámica de grupo y en otro se desarrolló la estrategia del método de caso sin la ayuda de ellas. El alumnado evaluó la experiencia mediante un diario de grupo. RESULTADOS: Los datos indican que el alumnado está satisfecho con las actividades de aprendizaje realizadas en clase, las competencias de la titulación se desarrollan de manera satisfactoria y el funcionamiento de los grupos experimentales, en general, es mejor que el de los grupos control. La eficacia del trabajo grupal está estrechamente vinculada con variables de tipo relacional. DISCUSIÓN: La cooperación, la ayuda y la supervisión de tareas entre los miembros del grupo fomentan la interacción y el sentimiento de seguridad entre los estudiantes que tienen dificultades para lograr los objetivos de aprendizaje. Un alumno o alumna que se siente respaldado por su grupo a nivel académico, afectivo y relacional probablemente va a percibir un contexto de trabajo más seguro, inclusivo y acogedor.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

CASO AlbAm S.A.

Directory of Open Access Journals (Sweden)

Ricardo Goulart Serra

2015-12-01

Full Text Available RESUMO Os analistas financeiros da AlbAm, uma empresa do setor de autopeças, devem avaliar duas opções de aquisições (Cardblue e Garciadores. O objetivo do caso é servir de oportunidade para os alunos vivenciarem uma decisão de investimentos por meio do lucro econômico. Uma análise superficial certamente levará a decisão equivocada. Levando-se todos os aspectos do caso em consideração, chegar-se-á a uma solução que pode surpreender alguns alunos, uma vez que a empresa melhor gerida não será a melhor oportunidade de investimento. Também se pode aproveitar o caso para discutir a superficialidade da adoção do EBITDA como métrica de gestão comparativamente a uma métrica de valor agregado (lucro econômico - a melhor solução também não é aquela que gera o maior aumento em EBITDA. O caso pode ser usado em disciplinas de finanças (finanças corporativas ou avaliação de empresas em cursos de graduação, pós-graduação ou especialização. Todas as empresas e pessoas relatadas neste caso são fictícias.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Vasculitis inducida por metimazol: Reporte de caso

Directory of Open Access Journals (Sweden)

Miguel Pinto

2011-07-01

Full Text Available Se reporta el caso de una paciente con enfermedad de Graves, que presentó vasculitis asociada al uso de metimazol. Mujer de 14 años, que acudió a consulta por presentar intolerancia al calor, tremor distal y palpitaciones. El examen físico mostró bocio difuso, y el perfil tiroideo, TSH suprimida y hormonas tiroideas elevadas. Los anticuerpos antiperoxidasa tiroidea fueron positivos. Se inició tratamiento con metimazol y beta bloqueadores. Después de 20 días, la paciente regresó por presentar malestar general, fiebre, poliartralgia, lesiones cutáneas maculopapulares y edema de miembros inferiores. Los anticuerpos antinucleares fueron negativos y los anticuerpos anticitoplasma de los neutrófilos (ANCA, positivos. Se suspendió el metimazol y se inició prednisona. Después de 10 días de tratamiento, las molestias desaparecieron y la paciente recibió I 131.Las vasculitis asociadas al uso de tionamidas son poco frecuentes, no dependen de la dosis y están asociadas a la presencia de anticuerpos tipo ANCA. Clásicamente, afectan a los vasos pequeños de la piel; sin embargo, también pueden afectar los riñones y pulmones. El cuadro clínico se caracteriza por artralgias y mialgias. En algunos casos puede ocurrir insuficiencia renal de grado variable. En la mayoría de casos, el cuadro remite con la suspensión de la droga; pero, en algunos se requiere el uso de glucocorticoides o inmunosupresores.(Rev Med Hered 2011;22:147-150.

Aspectos epidemiológicos relacionados con la lactancia materna durante el primer año de vida

Directory of Open Access Journals (Sweden)

Orlando Díaz Tabares

2002-06-01

Full Text Available Se realizó un estudio transversal para determinar el comportamiento de algunas variables epidemiológicas relacionadas con la lactancia materna durante el primer año de vida, y se tomaron como muestra las 24 madres que viven en el área del Consejo Popular número 2 de San Cristóbal, que parieron en los meses de enero, febrero y marzo del año 2000, las cuales fueron encuestadas al cumplir el año de parida. Se encontró una duración media de la lactancia materna exclusiva equivalente a 77 días, y de la lactancia materna en general de 137. Se comprobó riesgo relativo para el destete antes del cuarto mes de parida los casos de uso de tetes y biberones y exposición al estrés. Predominó la infección del tracto urinario, seguida por la enfermedad diarreica aguda (EDA entre los niños que enfermaron, y la mayor protección de la lactancia materna exclusiva se observó para la EDA.A crosswise study was carried out to determine the performance of some epidemiological variables related to breast feeding during the first year of life of the newborn and the sample was composed by 24 mothers who live in an area of People´s council No. 2 of San Cristobal, gave birth in January, February and March, 2000 and were surveyed one year after their deliveries. . The average length of exclusive breast-feeding was 77 days and of general breast feeding was 137 days. Relative risks were demonstrated for weaning before the fourth month of life in cases using pacifiers and feeding bottles and exposed to stress. Urinary tract infection prevailed, followed by acute diarrhea among sick infants and the greatest protection of the exclusive breast feeding was provided for acute diarrhea.

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Espondilodiscitis en posible relación con acupuntura. A proposito de un caso

Directory of Open Access Journals (Sweden)

VICTOR MANUEL LOPEZ MOURIÑO

2017-03-01

Full Text Available Presentamos el caso de un paciente varón de 59 años que acudió a nuestras consultas por un síndrome general, y tras completar el estudio fue diagnosticado de Espondilodiscitis Piógena (EP .El paciente se había sometido a sesiones de acupuntura por un dolor de espalda de evolución tórpida, no evidenciándose ningún otro causa que pudiera justificarla. La acupuntura es una técnica cada vez más utilizada, realizamos una revisión de casos similares recogidos en la literatura publicada hasta la fecha.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

Science.gov (United States)

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Disección traumática de la arteria carótida interna y embolismo cerebral en un jugador de fútbol: Reporte del primer caso

Directory of Open Access Journals (Sweden)

Luisa S. Talledo Paredes

2012-03-01

Full Text Available Reportamos el caso de un varón de 18 años quien sufrió contusión cervical por impacto con balón de fútbol. Tres días después fue hospitalizado con hemiplejia derecha directa y afasia de expresión. La resonancia magnética cerebral mostró lesión isquémica izquierda en ganglios basales. El doppler carotideo evidenció trombo desde el origen de la arteria carótida común izquierda extendida a la arteria carótida interna izquierda (CII y la angiotomografía documentó disección de CII (lesión traumática carotídea tipo IV. Se optó por anticoagulación con warfarina y fisioterapia de rehabilitación; con evolución favorable. La incidencia de la injuria traumática carotídea es muy rara, más aún en futbolistas; el tratamiento es aún controversial, por lo que consideramos de interés el reporte de este caso.

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Relativistic Astrophysics and Cosmology: A Primer

International Nuclear Information System (INIS)

Abramowicz, Marek A

2007-01-01

'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Consecuencias de la legislación en el consumo alimentario de lagartos. El caso del fardacho

Directory of Open Access Journals (Sweden)

Cantarero, Luis

2001-12-01

Full Text Available The fardacho is a variety of lizard that people in the area of Peñalba (province of Huesca, Spain used to hunt and eat. The author describes the food culture to which the eating of fardacho belonged and the reasons that caused a decrease in the number of these animals in the area. In addition, the author discusses the effects of wildlife-protecting legislation on the eating of this lizard in Peñalba.

En este artículo se analiza el caso del fardacho, una variedad de lagarto que se cazaba y consumía en la zona de Peñalba (Huesca. En primer lugar, se describe la cultura alimentaria del fardacho y las razones que motivaron un descenso en el número de ejemplares de este animal. En segundo lugar, se analizan las consecuencias de la legislación sobre especies protegidas en el consumo de fardachos en Peñalba.

Best Practices marketing relacional. Caso práctico

OpenAIRE

Cardama Otero, Maria

2016-01-01

el proyecto quiere servir de guía de buenas prácticas para el marketing digital de un comercio. Se desarrolla un caso práctico referido a una tienda de ropa infantil. This Project studies how a firm should develop a digital marketing strategy. We aim to propose ways to establish collaborative relationships to deliver value to customers and stakeholders, and see how they should be integrated in the overall value proposition. A general framework of best practices is described and applied to ...

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Cuando la comunidad entra en la escuela: un estudio de casos sobre los grupos interactivos, valorados por sus protagonistas

Directory of Open Access Journals (Sweden)

Carmen Álvarez Álvarez

2014-01-01

Full Text Available El artículo analiza el efecto de los grupos interactivos en los procesos de enseñanza y aprendizaje de alumnos y alumnas de educación primaria, analizados a través del grado de satisfacción de las personas implicadas en esta forma de trabajo. Se trata de una de las prácticas de organización del aula más destacadas en los centros educativos que se transforman en Comunidades de Aprendizaje. El artículo sintetiza un estudio de casos llevado a cabo en una escuela española de un entorno urbano, dando voz a los protagonistas de los grupos interactivos: alumnado, profesorado y voluntariado, que incluye las familias que participan en dichos grupos. Se utilizó una encuesta para los estudiantes de tercer ciclo y una entrevista grupal en el caso de los de primer ciclo. Con dichos procedimientos se recogieron las valoraciones realizadas por 148 estudiantes, 24 voluntarios/as y 6 profesores/as. Los resultados permiten constatar que los grupos interactivos constituyen una práctica muy bien acogida por toda la comunidad educativa. Además promueven tanto el éxito escolar como el desarrollo de valores que van más allá de lo instrumental, al implicar directamente a la comunidad en la actividad docente. Todo ello se somete a discusión.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Dengue neonatal en el Perú: Reporte de un caso Neonatal dengue in Peru: a case report

Directory of Open Access Journals (Sweden)

Hermann Silva Delgado

2011-03-01

Full Text Available Se presenta el caso de un neonato de sexo femenino, a término, producto de madre fallecida al séptimo día de su puerperio, por falla multiorgánica debido a dengue grave confirmado por detección de antígeno NS1 e IgM. La recién nacida (RN no tuvo complicaciones, pero a partir del cuarto día de vida desarrolló fiebre, ictericia, manifestaciones de extravasación de plasma, hepatomegalia, ascitis, plaquetopenia y otros signos de síndrome de respuesta inflamatoria sistémica. Su evolución final fue favorable con tratamiento instaurado. Se demuestra con PCR en tiempo real, la presencia del virus dengue serotipo 2 en sangre de la RN, confirmándose el primer caso de dengue neonatal reportado en el Perú.We present the case of a full-term female newborn, whose mother died seven days postpartum from multi-organ failure due to severe dengue confirmed by NS1 antigen detection and positive IgM. The newborn did not have any complication, but at the fourth day of life she developed fever, jaundice, signs of plasma leakage, thrombocytopenia, hepatomegaly, ascitis, and others signs of systemic inflammation response syndrome. She fully recovered with supportive treatment. The RT-PCR test of a peripheral blood sample revealed a positive result for the dengue virus serotype 2, confirming the first case of neonatal dengue reported in Peru.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

Science.gov (United States)

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Los intercambios virtuales lingüísticos y culturales en educación superior: un estudio de caso

Directory of Open Access Journals (Sweden)

María Victoria Guadamillas Gómez

2017-03-01

Full Text Available El estudio describe una intervención docente llevada a cabo en el campo de la telecolaboración interinstitucional y con el doble objetivo de incrementar el tiempo de práctica oral para la mejora lingüística (inglés/español y favorecer la toma de conciencia intercultural entre estudiantes universitarios en los contextos español y británico. La metodología aplicada da cuenta de las percepciones de estos participantes de manera cualitativa y del grado de implicación y participación de los discentes. En primer lugar, en este estudio de caso abordamos el término telecolaboración y recogemos aportaciones recientes en este ámbito; en segundo lugar, presentamos el proyecto y sus tres fases principales: toma de decisiones, desarrollo y evaluación. A continuación, analizamos los resultados de participación y los comentarios positivos y negativos obtenidos de los universitarios, según se refieran a los aspectos lingüísticos o culturales o a otros más generales relacionados con la experiencia de participación. Por último, en la discusión y las conclusiones hablamos del éxito de esta experiencia, el cual reside en la planificación y el diseño de tareas que han originado una alta participación.

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Tratamiento mediante dilatación con balón de un paciente con estenosis subaórtica por membrana: a propósito de un caso

Directory of Open Access Journals (Sweden)

Carlos Mariño

2013-10-01

Full Text Available La estenosis subaórtica es una lesión cardiaca poco frecuente, en el cual el tracto de salida del ventrículo izquierdo está estrechado por la presencia de un anillo fibroso o fibromuscular. Constituye 8 a 20% de todas las formas de obstrucción al tracto de salida del ventrículo izquierdo. La cirugía ha sido considerada el tratamiento de elección cuando el gradiente pico es mayor de 50 mmHg o en pacientes que, con gradientes menores, presentan progresión de la insuficiencia aórtica o dilatación de los diámetros ventriculares, disfunción ventricular o síntomas. Presentamos el caso de un paciente menor de edad, portador de estenosis subaórtica por membrana, con síntomas de insuficiencia cardiaca y función ventricular izquierda muy comprometida, en la que se realizó el tratamiento percutáneo, alternativo al quirúrgico, con resultado exitoso. Constituye el primer caso reportado en el país de tratamiento percutáneo con balón y con evolución favorable.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Análisis del Cambio en un Problema de Adicción al Alcohol. Estudio de Caso

Directory of Open Access Journals (Sweden)

Gala Almazán Antón

2012-01-01

Full Text Available Se analiza el caso de C., una mujer que acude a consulta por problemas con el consumo de alcohol y un bajo estado de ánimo. El objetivo de este artículo es exponer un caso abordado con éxito desde la terapia de conducta justificando los progresos obtenidos a través de la operativización de las medidas de cambio. Los resultados obtenidos muestran una tendencia general positiva en las medidas de cambio establecidas (consumo de alcohol, interacciones sociales, estado de ánimo, nivel de actividad, dificultades para dormir, etc., a pesar de las dificultades que presentaba el caso por ser varias las áreas problemáticas asociadas y por la reticencia al cambio de la cliente. Estos dos factores están muy presentes en este tipo de problemática y los clínicos deben permanecer en alerta ante posibles caídas o recaídas, tan frecuentes en los casos de abuso o dependencia al alcohol.

Detecção de Treponema denticola em casos de abscesso perirradicular agudo Detection of Treponema denticola in cases of acute periradicular abscesses

Directory of Open Access Journals (Sweden)

Isabela das Neves RÔÇAS

2000-09-01

Full Text Available Nosso objetivo foi detectar Treponema denticola em casos de abscesso perirradicular agudo. O DNA extraído das amostras de pus foi examinado pelo método da "Polymerase Chain Reaction" direcionada para o gene do RNAr (fração 16S. A amplificação usando o "primer" da espécie Treponema denticola permitiu detectá-la em 5 dos 6 casos de abscessos examinados. Apenas uma banda de tamanho esperado foi observada para as amostras positivas para esta bactéria, o que foi confirmado pela comparação com o DNA de referência do Treponema denticola (controle positivo. Até o momento, este é o primeiro relato da presença desta espiroqueta, considerada um importante patógeno periodontal em infecções endodônticas. Os resultados sugerem que Treponema denticola também pode ser um importante patógeno endodôntico.The purpose of this study was to report the detection of Treponema denticola in five out of six cases of acute periradicular abscesses. The 16S rRNA gene directed Polymerase Chain Reaction was the method utilized. This is probably the first report hitherto of the occurrence of this spirochete in acute periradicular abscesses.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Desarrollo de un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de educación general básica

OpenAIRE

Chaglla Cholota, Kléber Fabián

2016-01-01

1. Introducción. --2. Plantemiento de la Propuesta de Trabajo. --3. Marco Teórico. --4. Metodología. --5. Resultados. --6. Conclusiones y Recomendaciones. El presente proyecto de investigación propone desarrollar un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de Educación General Básica en la Unidad Educativa Intercultural Bilingüe “Huayna Capac”. Con el uso de este sitio web los docentes podrán generar material e...

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

CaSO4: Dy + Teflon thermoluminescent dosemeters

International Nuclear Information System (INIS)

Campos, L.L.

1986-01-01

A pellet dosemeter of CaSO 4 : Dy + Teflon was developed at IPEN. CaSO 4 : Dy thermoluminescent phosphor, grown in the Dosimetric Materials Production Laboratory was chosen, due to its high sensitivity, ease of preparation and comparatively low cost. Pellets were produced by cold pressing and sintering a mixture of CaSO 4 : Dy and Teflon powders. Extensive work was done to study in detail all CaSO 4 : Dy pellets characteristics from the point of view of dosimetry with the purpose of introducing it in the routine use. A filter combination providing an energy independent response from 20 KeV to 1,25 MeV was obtained. The dosemeter consists of three pellets sealed between two thin plastic sheets and placed under plastic and lead filters. The combination of these tree filters allows the exposure as well as the energy determination of an unknown source. (Author) [pt

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Prerrequisitos generales para la formulación de políticas sociales de inclusión: Caso Venezuela

Directory of Open Access Journals (Sweden)

Isabel Rodríguez Colmenares

2012-01-01

Full Text Available En este trabajo se realiza un acercamiento a las políticas públicas sociales, para lo cual se consideran algunos prerrequisitos generales con el propósito de organizar una propuesta sobre los procesos de formulación de la política social de inclusión, tomando como referencia específica el caso venezolano. La investigación fue soportada por una revisión y análisis biblio-hemerográfico. Los hallazgos indican que la identificación de estos prerrequisitos conforma una matriz integradora de variables que permite atender la complejidad de la política social de inclusión, desde una racionalidad y lógica distinta a la tradicional de corte reduccionista-economicista. Se concluye que, para alcanzar una interpretación integral de la política social de inclusión, en la perspectiva del enfoque de derechos sociales, hay que considerar la dinámica espacial; el entramado cultural; el ámbito demográfico– intergeneracional; el comportamiento del sistema político, el Estado y la administración pública; la relación sociedad-Estado-economía; y la articulación modelo de desarrollo y política social

INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

Directory of Open Access Journals (Sweden)

Orzuza, Gloria Beatriz

2013-01-01

Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

Woolly hair generalizado: caso clínico e revisão da literatura Generalized woolly hair: case report and literature review

Directory of Open Access Journals (Sweden)

Tiago Torres

2010-02-01

Full Text Available O termo woolly hair, ou cabelo lanoso, refere-se a uma variante anormal de cabelo, que pode ser parcial ou generalizado. As variantes de woolly hair generalizado são raras e podem ocorrer isoladamente ou associadas a outras alterações cutâneas e extracutâneas. Desta forma, nestes doentes, é necessário a exclusão de certos síndromes, como o de Noonan e cardiofaciocutâneo (CFC, que cursam com importante morbilidade e mortalidade. É descrito o caso clínico de uma criança com woolly hair generalizado e queratose pilar, mas que, após avaliação dos vários órgãos e sistemas, não foi encontrada qualquer alteração ou característica associada a esses síndromes.The term woolly hair, or tightly curled hair, refers to a structural anomaly of scalp hair, which can be partial or generalized. Generalized woolly hair variants are rare and can occur in isolation or in association with other cutaneous and extra-cutaneous abnormalities. Thus, it is important to dismiss in these patients the diagnosis of syndromes such as the Noonan syndrome and Cardiofaciocutaneous syndrome, which have high morbidity and mortality rates. We report the clinical case of a 7 year-old boy with generalized woolly hair and keratosis pilaris. After an evaluation of organs and systems, no alteration or characteristics associated with these syndromes were found.

Perfil de ingreso de alumnos con buen desempeño académico en el primer año de estudios. El caso de la Escuela de Diseño de la Universidad De La Salle Bajío

Directory of Open Access Journals (Sweden)

María Daniela Esparza Olmos

2011-01-01

Full Text Available Introducción: El sistema educativo universitario se ha enfrentado a varios retos en los últimos tiempos, lo que ha implicado establecer políticas de admisión que permitan seleccionar a los estudiantes que cumplan con el perfil de ingreso, permitiendo generar estrategias para mejorar su desempeño académico a lo largo de sus estudios, y con ello elevar las cifras de la eficiencia terminal. Es así como el objetivo de esta investigación fue caracterizar el perfil de ingreso de los alumnos que mostraron un buen desempeño académico en el primer año de la licenciatura de diseño industrial, diseño de modas y calzado, diseño gráfico y diseño ambiental de la Universidad De La Salle Bajío. Método: La distribución final de la muestra estuvo formada por 256 alumnos de ambos sexos al analizarse estadísticamente los resultados de sus pruebas en el proceso de admisión de las cohortes del 2005 al 2008, para posteriormente correlacionarlas con el promedio del primer año de sus estudios. Resultados: Los resultados permitieron observar las semejanzas y diferencias entre las cuatro licenciaturas con respecto al perfil general de ingreso en la Escuela de Diseño. Asimismo, se encontró que los alumnos que presentaron en periodo de excelencia, obtuvieron mejor desempeño académico en el primer año de estudios. Conclusión: Conocer el perfil de ingreso servirá de parámetro en los siguientes procesos de admisión, además permitirá diseñar estrategias que fortalezcan las capacidades y habilidades de los alumnos al ingresar a la educación superior, de tal manera que se eleven los índices de eficiencia terminal y con ello mejorar la calidad en los programas académicos de licenciatura en la Escuela de Diseño.

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Infección por Polyoma virus en un paciente con transplante renal: A propósito de un caso

Directory of Open Access Journals (Sweden)

Reyner Loza Munarriz

2008-07-01

Full Text Available La nefropatia por polyoma virus (NVBK esta siendo reconocida como causa importante de falla del injerto, usualmente confundido con rechazo agudo. A la fecha, no se han reportado casos en el Perú. Se presenta el caso de un niño trasplantado, 17 años de edad, quien presentó elevación persistente de la creatinina sérica en el primer mes postrasplante. Fue tratado como rechazo agudo. Al no presentar mejoría se realizó biopsia renal que mostró marcado daño del epitelio tubular con necrosis parcial y desprendimiento hacia la luz tubular y la presencia de células atípicas con escaso citoplasma e inclusiones intranucleares basofilicas, hallazgos compatibles con infección por virus BK. No se evidenció signos de rechazo. Además, en el papanicolao de orina, se encontró Decoy cells. La carga viral de virus BK fue elevada en sangre y en orina. Se suspendió el tratamiento con mofetil micofenolato, se redujo la dosis de tacrolimus y se inició el tratamiento con leflunomide 40 mg/dia. Seis meses después la función renal del paciente se estabilizó, pero sin mejoría completa quedando con una depuración de creatinina de 30 ml/min/1,73 m² SC. (Rev Med Hered 2008;19:123-127

Guías de abordaje de problemas de conducta de los niños y niñas del Primer Año de Educación General Básica Jaime Burbano Alomía.

OpenAIRE

Dávila Tena, Hiparía Magdalena

2011-01-01

Diseñar guías de orientación metodológica para paliar los problemas de conducta que afectan a los niños /as, del Primer Año de Educación General Básica ‘’Jaime Burbano Alomía ‘’ En el presente año lectivo 2110-2011 Los problemas de conducta existentes en el entorno educativo de la ciudad de Otavalo, constituyen el motivo más elocuente para el desarrollo del presente trabajo, ello nos da la oportunidad idónea para emprender cambios sustanciales en las formas de diagnóstico para enfrenta...

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Industria electrónica, investigación y desarrollo (I+D y competencias profesionales. Estrategias para el escalamiento industrial. Estudio de caso en Mérida, Yucatán

Directory of Open Access Journals (Sweden)

René Ileana Velázquez-Pompeyo

2015-09-01

Full Text Available El propósito fundamental de esta investigación es conocer cuáles son las estrategias que facilitan el escalamiento industrial en un estudio de caso de la industria electrónica en el municipio de Mérida, Yucatán. El primer apartado, el marco teórico referencial, describe el escalamiento industrial, las competencias profesionales y la recopilación de otras experiencias de las empresas multinacionales (MNCs en México. El segundo apartado, la propuesta metodológica, tiene como base herramientas cualitativas, como el estudio de caso, la entrevista a profundidad y la revisión de fuentes documentales. El tercer apartado contiene las evidencias obtenidas del escalamiento industrial y las competencias profesionales se obtienen mediante el análisis de indicadores cualitativos, como las características de la empresa, la situación laboral (política de contratación, salarios y ascensos, rotación laboral, perfil ocupacional y capacitación y la caracterización de la cadena de valor productiva. Por último, las conclusiones destacan, en el caso seleccionado, que el escalamiento de producto, proceso y funciones es el resultado del desarrollo de las competencias profesionales de los trabajadores y la implementación de estrategias, como la adquisición de capacidades tecnológicas, la capacitación de la mano de obra y la reorganización del sistema de producción, las colaboraciones interdepartamentales y los vínculos académicos, entre otras. El caso seleccionado evidencia la posibilidad del desarrollo de actividades económicas que demanden actividades de mayor complejidad en el municipio de Mérida, Yucatán para obtener resultados favorables en el desarrollo de la región.

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Primer reporte de un caso importado de Malaria por Plasmodium ovale curtisi en Paraguay, confirmado por diagnóstico molecular

Directory of Open Access Journals (Sweden)

Florencia del Puerto

2015-04-01

Full Text Available En países donde el Plasmodium ovale no es común, los microscopistas tienden a identificarlo de manera errónea como Plasmodium vivax. En este trabajo reportamos la identificación de la especie P. ovale curtisi por el método de PCR múltiple semianidada (SnM-PCR y la secuenciación de la subunidad pequeña del gen del ARN 18S, en un paciente paraguayo de 44 años de edad que vino en el 2.013 de Guinea Ecuatorial, África Occidental, a quien se le diagnosticó una infección por P. vivax por microscopía convencional. El empleo de métodos moleculares para la identificación de casos importados de infección con especies del género Plasmodium es uno de los objetivos principales en el control y la prevención de la malaria en Paraguay, teniendo en cuenta que el país se encuentra en fase de pre-eliminación de la enfermedad.

Factores asociados al hallazgo de lesiones preneoplásicas detectadas en citología vaginal: estudio de casos y controles

Directory of Open Access Journals (Sweden)

Lida Yoana Cifuentes

2014-01-01

Full Text Available Objetivo: Identificar factores socioculturales asociados a la presencia de lesiones preneoplásicas en mujeres residentes en un municipio de predominio rural en Boyacá, Colombia. Materiales y Métodos: Estudio observacional analítico, retrospectivo de casos y controles. De un registro institucional, mediante muestreo aleatorio secuencial, se seleccionó una muestra de 168 mujeres: 42 casos y 126 controles, apareadas por edad y estrato socioeconómico, a quienes mediante encuesta se evaluaron los antecedentes y los factores familiares y culturales, posiblemente asociados a la presencia de lesiones preneoplásicas en la citología vaginal. Resultados: Rango de edad entre 16 y 71 años; promedio de edad 42,2 años (SD = 14,57 años; el 79,2% se encontraba con pareja estable; el 90,0% cursó educación primaria o menos; el 11,3% fumaba; la edad promedio de menarquia fue de 13,8 años (SD = 1,38 y el 17,9% la presentó a los 12 años o antes. Todas las mujeres encuestadas han tenido al menos una gestación y el 66,1% ha tenido 3 o más. La edad media de la primera gestación es de 19,7 años (SD = 3,45 y el rango de edad de la primera gestación oscila entre los 15 y 29 años. En el 35,7% de los casos el primer embarazo ocurrió antes de los 18 años. El 31,5% de las mujeres estudiadas tiene antecedente familiar de cáncer. Los siguientes factores se encontraron significativamente asociados con la presencia de lesión preneoplásica en la citología vaginal: historia de dos o más parejas sexuales (OR = 85,0; primer embarazo antes de los 18 años (OR = 40,0; antecedente familiar de cáncer (OR = 23,9; consumo de cigarrillo (OR = 12,1; inicio sexual antes de los 17 años (OR = 11,8; consumo de bebidas alcohólicas (OR = 10,8; antecedente de infecciones vaginales (OR = 10,1; 3 o más gestaciones (OR = 5,2; ningún grado de escolaridad (OR = 3,49; antecedente de aborto (OR = 2,87. Conclusión: Se encontaron factores de riesgo susceptibles de

Intervención cognitivo conductual en un caso de fobia social

Directory of Open Access Journals (Sweden)

JOSÉ ANTONIO ORTEGA FERNÁNDEZ

2004-01-01

Full Text Available La fobia social se define como un temor acusado y persistente a una o más situaciones sociales o actuaciones en público por la posibilidad de una evaluación negativa de los demás. Es un trastorno que suele provocar notable sufrimiento a la persona que lo padece, generándole importante interferencia en su funcionamiento general, especialmente por las numerosas conductas de evitación que implica. En el presente artículo se presenta el tratamiento de un caso de de fobia social (DSM-IV, APA, 1994, llevado a cabo en 16 sesiones. Las técnicas empleadas fueron la exposición gradual, el entrenamiento en relajación y el entrenamiento en autoinstrucciones. Los resultados muestran diferencias en las medidas empleadas: HAD, SAD, STAI, FNE, EA y CHS. El caso que se expone resulta de interés por el detalle en la exposición de la intervención realizada.

Measurement of thermal neutron fluence with CaSO4 thermoluminescent phosphors

International Nuclear Information System (INIS)

Liu Jinhua; Su Jingling; Wei Zemin

1984-01-01

During neutron irradiation, some TL phosphors were activated. After leaving the irradiation field the TL phosphor produced self-irradiation. The TL output of self-dose was only related to the original neutron fluence and independent of the γ-radiation. Several CaSO 4 TL phosphors were made. They were CaSO 4 :Dy, CaSO 4 :Dy-Teflon, CaSO 4 :Dy mixed with Dy 2 O 3 , CaSO 4 :Mn mixed with Dy 2 O 3 . The linearity, and lower detection limits of these TL phosphors were measured. The thermal neutron response of CaSO 4 :Mn mixed with Dy 2 O 3 was 64 R/(10 10 cm -2 ) and the lower detection limit was 1.3x10 5 cm -2

Filariosis humana en la selva peruana: reporte de tres casos

Directory of Open Access Journals (Sweden)

María Beltrán

2008-04-01

Full Text Available Se presenta tres casos de filariosis de pacientes varones procedentes de la selva peruana (Junín, San Martín y Pucallpa. Un caso presentó filarias en el globo ocular y frotís sanguíneo, que según morfología, serología y biología molecular se determinó como un posible caso de filariosis zoonótica por Onchocerca spp. Los otros dos casos fueron causados por Dirofilaria spp. uno presentó un nódulo en el pómulo y sensación de movilidad en la zona y fue diagnosticado por serología y el último caso se le extrajo una filaria del dedo pulgar de la mano y fue identificado como tal por morfología y biología molecular. Estos casos son los primeros reportes en el Perú por Dirofilaria spp. y Onchocerca spp.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

DEFF Research Database (Denmark)

Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

2005-01-01

Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

First report of a human case of polycystic echinococcosis due to Echinococcus vogeli from neotropical area of Peru, South America Primer reporte de un caso humano de echinococcosis poliquística causada por E. vogeli procedente del área neotropical del Perú, America del Sur

Directory of Open Access Journals (Sweden)

José R. Somocurcio

2004-02-01

Full Text Available We report a human case of polycystic hidatidosis due to Echinococcus vogeli from Contamana (Department of Loreto village located in the central jungle of Peru. The patient is a 44 year-old lady, teacher, who carried a painless liver mass since a year ago. She was submitted to abdominal surgery and the liver mass was removed and showed multiple cysts containing colorless liquid as is showed in the polycystic hidatidosis. The morphology and measure of the hooks obtained from the liquid contained in the cysts are from Echinococcus vogeli. It is the first report of this parasitism in Perú.Reportamos un caso humano de hidatidosis poliquística debido a Echinococcus vogeli procedente de Contamana (Departamento de Loreto, localidad ubicada en la selva central del Perú. La paciente es una mujer de 44 años de edad, profesora, quien portaba una hepatomegalia no dolorosa de un año de evolución. Sometida a intervención quirúrgica, se removió la masa hepática que macroscópicamente mostró múltiples quistes conteniendo líquido incoloro. El examen microscópico correspondió a una hidatidosis poliquística. El examen y medida de los ganchos obtenidos del contenido de los quistes correspondieron a Echinococcus vogeli. Es el primer reporte de este parasitismo en el Perú.

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Parálisis diafragmática bilateral. Presentación de un caso Bilateral diaphragmatic paralysis

Directory of Open Access Journals (Sweden)

Jorge Carnot Pereira

2012-04-01

Full Text Available La parálisis diafragmática bilateral es una entidad muy infrecuente en la clínica, debido a diferentes entidades con capacidad de lesionar el nervio frénico. El compromiso respiratorio que produce requiere cuidado especializado. Este es el primer caso reportado en nuestra literatura a consecuencia de hernias cervicales múltiples. Se presenta un caso de un paciente de 43 años, con antecedentes de salud, exatleta de alto rendimiento, que ingresó en nuestro servicio, con disnea de 5 meses de evolución, que aumentó progresivamente en intensidad hasta mantenerlo en ortopnea constante, fue estudiado exhaustivamente hasta llegar a diagnostico definido y derivarlo al servicio de Neurocirugía para su solución definitiva. La importancia del tema que se presenta es que se describe una presentación rara de parálisis diafragmática bilateral, a consecuencia de hernias discales cervicales múltiples.Bilateral diaphragmatic paralysis is a rare condition in clinical practice due to different entities that can damage phrenic nerve. The resulting respiratory compromise requires medical special care. This is the first case reported in our medical literature caused by multiple cervical hernias. A 43 year-old patient having health history, high performance ex-athlete, admitted in the service with 5-month evolution of dyspnea which progressively increased in intensity up to maintain him in permanent orthopnea, thorough studies were conducted to the definite diagnosis and he was transferred to Neurosurgery Service to a definite solution. A rare presentation of a bilateral diaphragmatic paralysis resulting from multiple cervical hernias gives importance to the topic.

CASO DE PRIMARIA: REZAGO EDUCATIVO POR FALTA DE DESARROLLO DE COMPETENCIAS

OpenAIRE

Saucedo, Gerardo

2012-01-01

Párrafo de inicio, explicación del caso, explicación de un ejercicio tanto individual como grupal para un debate referente al caso,los objetivos del caso, soluciones propuestas por el autor y conclusiones

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Cuartos molares supernumerarios: relato de caso clínico

Directory of Open Access Journals (Sweden)

Daniela Nascimento Silva

2006-04-01

Full Text Available Los dientes supernumerarios se diagnostican mediante exámenes radiográficos de rutina, pues generalmente son asintomáticos. Los cuartos molares representan el segundo grupo de dientes supernumerarios con más frecuencias; ocurren en posición distal a los terceros molares, especialmente en el maxilar superior, y en la mayoría de casos, estos están incluidos. El objetivo de este artículo es realizar la presentación de un caso, de una mujer de 30 anos con los cuartos molares incluidos en el maxilar inferior y describir la técnica para su remoción.Supernumerary teeth are generally asymptomatic and are diagnosed by routine X-ray tests. The fourth molar teeth represent the second group of the most frequent supernumerary teeth, occur in distal position to the third molar teeth, specially in the superior maxilla and, in most of the cases, they are included. The aim of this paper is to comment on the case of a 30-year-old woman with the fourth molar teeth included in the inferior maxilla and to describe the technique used for their removal.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Raquitismo carencial: relato de caso

OpenAIRE

Porto, Juliana Antola et al.

2005-01-01

Introdução: O raquitismo é uma doença do tecido ósseo em formação, onde há falha na calcificação e conseguinte acúmulo de tecido osteóide. O raquitismo carencial é decorrente da deficiência dos precursores da vitamina D, sendo a causa de raquitismo mais facilmente evitável e tratável. Objetivo: Relatar um caso, revisar a etiopatogenia e o tratamento do raquitismo carencial. Relato de caso: Paciente masculino com 2 anos de idade, previamente hígido, consulta com dificuldade de deambular progre...

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

Science.gov (United States)

Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

2017-07-01

Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Diabetes tipo 2 en niños: Serie de casos

Directory of Open Access Journals (Sweden)

Helard Manrique-Hurtado

2015-01-01

Full Text Available Objetivos: Describir las características clínicas y bioquímicas de un grupo de niños y adolescentes con diagnóstico reciente de diabetes tipo 2. Material y métodos: Estudio descriptivo, retrospectivo, tipo de serie de casos. Se definió caso al niño o adolescente con glucosa plasmática en ayunas mayor a 126 mg/dl, ausencia de antiGAD y péptido C mayor a 1,5 ng/dl. Se excluyeron a los pacientes con diagnóstico previo de diabetes mellitus tipo 1, diabetes tipo MODY o diabetes secundaria a uso de fármacos. Resultados: La edad media fue 14,3 años, 59% fueron mujeres y 43% tenía por lo menos un padre con diabetes tipo 2. Al momento del diagnóstico, el índice de masa corporal fue 32,8 kg/m2, 85% tenía acantosis nigricans y 68% estaba en estadio Tanner IV y V. El tratamiento inicial incluyó el uso de hipoglicemiantes orales en 75% de los casos, siendo más frecuente el uso de metformina (64,3%. Solamente el 41% de los pacientes recibía algún tipo de insulina. Conclusiones: Los niños y adolescentes con diabetes tipo 2, tienen una frecuencia aumentada de obesidad/sobrepeso, acantosis nigricans y antecedente familiar de DM2. En general, tienen mal control metabólico y reciben metformina como tratamiento inicial.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Tratamiento endovascular del aneurisma de aorta descendente en el adolescente con síndrome de Marfan. Reporte de un caso

Directory of Open Access Journals (Sweden)

Juan G. Barrera, MD

2012-01-01

Full Text Available Se expone el caso de un adolescente de 14 años de edad, con síndrome de Marfan y antecedente de tres cirugías cardiovasculares previas: valvuloplastia aórtica y mitral a los cinco años y valvuloplastia aórtica y reconstrucción de la aorta torácica con tubo de pericardio bovino a sus diez años. En primer tiempo quirúrgico se realizó reemplazo valvular aórtico por válvula mecánica y valvuloplastia mitral y tricuspidea, y en segundo tiempo quirúrgico, durante la misma hospitalización, exclusión endovascular de aneurisma de aorta descendente asintomático sin complicaciones. Antes del egreso se diagnosticó una endofuga tipo II que se manejó con observación clínica. Luego de un año del procedimiento, los controles clínico y tomográfico son satisfactorios.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

Directory of Open Access Journals (Sweden)

Indhu Kanakaraj

Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Persistencia del conducto onfalomesenterico. Presentación de un caso

OpenAIRE

Sánchez Portela, Carlos A; Díaz Martínez, Jesús; Ampudia Lizano, Manuel; Sosa Hernández, Roberto; Rodríguez Ramos, William

2005-01-01

Se presentó el caso de un paciente de 42 años de edad, operado en el Hospital General Universitario «Abel Santamaría Cuadrado» de Pinar del Río, que presentaba una fístula entero cutánea, por persistencia del conducto onfalomesentérico. El tratamiento consistió en la resección intestinal y anastomosis terminoterminal. La evolución postoperatoria fue satisfactoria. A 42 year old male patient underwent an operation at "Abel Santamaria" University Hospital, Pinar del Rio. The patient presente...

Uveomeningencefalites: registro de dois casos

Directory of Open Access Journals (Sweden)

Wilson Luiz Sanvito

1982-03-01

Full Text Available Após considerações a propósito das manifestações clínicas das uveomeningencefalites, são relatados dois casos com características clínicas ligeiramente diferentes. No caso 1 tratava-se da doença de Harada, tendo o paciente apresentado quadro meningítico agudo acompanhado de confusão mental. O exame do líquido cefalorraquidiano evidenciou um quadro inflamatório do tipo linfo-monocitário e o paciente evoluiu com distúrbios acentuados da memória e uveíte bilateral. Após alguns meses de evolução, a doença deixou como seqüelas uma síndrome de Korsakoff e ambliopia acentuada no olho esquerdo. No caso 2 tratava-se de doença de Behcet, tendo o paciente apresentado dois surtos de meningite do tipo linfomonocitário, lesões herpetiformes na genitalia e uveíte no olho direito que evoluiu para amaurose. São feitas considerações sobre os aspectos etiopatogênicos destas afecções e sobre o controvertido uso dos corticosteróides em seu tratamento.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

As leis da natureza e os casos de Tooley

Directory of Open Access Journals (Sweden)

Rodrigo Reis Lastra Cid

2013-06-01

Full Text Available Os objetivos deste artigo são: (1 apresentar quatro teorias com relação à natureza das leis naturais, (2 mostrar que apenas uma delas é capaz de responder satisfatoriamente aos Casos de Tooley e (3 indicar por que tais casos são relevantes para a nossa ontologia. Estes objetivos são importantes, pois o conceito de "lei natural" é utilizado em muitos, se não todos, os domínios das ciências e em muitos domínios da filosofia; e, se tais casos forem possíveis, eles serão situações que precisariam ser adequadamente descritas. Se uma e apenas uma teoria puder descrever tais casos adequadamente, haverá fortes razões para preferir tal teoria frente às outras.

Secuestro pulmonar una infrecuente causa de hipertension pulmonar persistente en el recién nacido reporte de un caso

Directory of Open Access Journals (Sweden)

Lupo Méndez

2017-01-01

Full Text Available La hipertensión pulmonar persistente del recién nacido ( HPPRN es una entidad frecuente en las unidades de cuidados intensivos neonatales ( UCIN , sin embargo, algunas de sus causas pasan desapercibidas, debido a su baja frecuencia y poca asociación con esta patología. A propósito de un caso en nuestra UCIN , en un neonato a término que presentó HPPRN secundario a una malformación pulmonar, raramente asociada con esta patología en este grupo etareo, ya que se encontró mayor disposición a factores propios del nacimiento, y noxas maternas. El paciente presentó dificultad respiratoria horas después de su nacimiento, con evolución y persistencia de su sintomatología, por lo que se necesitó de diversos medios diagnósticos para establecer su etiología. Es importante destacar que el primer ecocardiograma doppler no mostró ninguna alteración anatómica o funcional, reportado normal; con posterior empeoramiento clínico del neonato, por lo que se ordenó un control ecocardiografico, y se evidenció una presión pulmonar estimada de 71 mmHg; se continuó el estudio etiológico con imágenes complemen - tarias, en esta caso una tomografía de tórax contrastada, y finalmente fue corroborado con un cateterismo cardiaco, lo cual permitió a su vez, manejo terapéutico y corrección de anomalía estructural de vasos pulmonares.

The ternary system K2SO4MgSO4CaSO4

Science.gov (United States)

Rowe, J.J.; Morey, G.W.; Silber, C.C.

1967-01-01

Melting and subsolidus relations in the system K2SO4MgSO4CaSO4 were studied using heating-cooling curves, differential thermal analysis, optics, X-ray diffraction at room and high temperatures and by quenching techniques. Previous investigators were unable to study the binary MgSO4CaSO4 system and the adjacent area in the ternary system because of the decomposition of MgSO4 and CaSO4 at high temperatures. This problem was partly overcome by a novel sealed-tube quenching method, by hydrothermal synthesis, and by long-time heating in the solidus. As a result of this study, we found: (1) a new compound, CaSO4??3MgSO4 (m.p. 1201??C) with a field extending into the ternary system; (2) a high temperature form of MgSO4 with a sluggishly reversible inversion. An X-ray diffraction pattern for this polymorphic form is given; (3) the inversion of ??-CaSO4 (anhydrite) to ??-CaSO4 at 1195??C, in agreement with grahmann; (1) (4) the melting point of MgSO4 is 1136??C and that of CaSO4 is 1462??C (using sealed tube methods to prevent decomposition of the sulphates); (5) calcium langbeinite (K2SO4??2CaSO4) is the only compound in the K2SO4CaSO4 binary system. This resolved discrepancies in the results of previous investigators; (6) a continuous solid solution series between congruently melting K2SOP4??2MgSO4 (langbeinite) and incongruently melting K2SO4??2CaSO4 (calcium langbeinite); (7) the liquidus in the ternary system consists of primary phase fields of K2SO4, MgSO4, CaSO4, langbeinite-calcium langbeinite solid solution, and CaSO4??3MgSO4. The CaSO4 field extends over a large portion of the system. Previously reported fields for the compounds (K2SO4??MgSO4??nCaSO4), K2SO4??3CaSO4 and K2SO4??CaSO4 were not found; (8) a minimum in the ternary system at: 740??C, 25% MgSO4, 6% CaSO4, 69% K2SO4; and ternary eutectics at 882??C, 49% MgSO4, 19% CaSO4, 32% K2SO4; and 880??, 67??5% MgSO4, 5% CaSO4, 27??5% K2SO4. ?? 1967.

Caso Ouro Fino Saúde Animal Caso Ouro Fino Saúde Animal Ouro Fino Saúde Animal case

Directory of Open Access Journals (Sweden)

Bernardo Hauch Ribeiro de Castro

2012-04-01

Full Text Available O Caso Ouro Fino Saúde Animal ilustra uma tomada de decisão, pelos executivos da empresa, sobre a entrada em um novo mercado, de vacinas para bovinos. Diante da necessidade de dar um passo maior em direção ao crescimento sustentável, a empresa não poderia deixar de entrar nesse segmento, que representava mais de metade do mercado brasileiro de produtos veterinários. No entanto, era um passo arriscado. A principal questão do caso é avaliar as alternativas de comprar vacinas de terceiros ou produzir internamente suas próprias vacinas. A empresa do caso é a Ouro Fino Saúde Animal, empresa brasileira de produtos veterinários, instalada no Estado de São Paulo, com faturamento de mais de R$ 100 milhões anuais. Os dois principais personagens deste caso são os diretores financeiro e industrial da empresa. A situação passa-se em 2005. Como instrumento de ensino, o caso foi concebido para o ensino de estratégia em cursos de pós-graduação em administração, levando os alunos a avaliar vantagens e desvantagens de cada uma das alternativas. Como objetivo secundário, o caso propicia alguns elementos para uma estimativa da viabilidade financeira da opção de implantar uma nova unidade produtiva e a possibilidade de refletir sobre uma decisão já tomada, de entrada no novo mercado. Por fim, o caso traz uma série de informações sobre o mercado brasileiro e sobre o mercado mundial de produtos veterinários. É possível, com base nestes dados, trabalhar questões ligadas à segmentação e posicionamento da empresa no setor, ficando a critério do professor este tipo de uso.El Caso Ouro Fino Saúde Animal ilustra una toma de decisiones por los ejecutivos de la empresa, a la entrada en un nuevo mercado de las vacunas para el ganado. Ante la necesidad de dar un paso importante hacia el crecimiento sostenible, Ouro Fino Saúde Animal no podía dejar de entrar, ya que representaba más de la mitad del mercado de productos veterinarios

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

Xeroderma pigmentoso. Síndrome de Sanctis Cacchione: Presentación de 1 caso

Directory of Open Access Journals (Sweden)

Leopoldina Falcón Lincheta

1998-06-01

Full Text Available El xeroderma pigmentoso es una afección genética poco frecuente que traduce la hipersensibilidad celular a la radiación ultravioleta en asociación con una anormal reparación del ácido dexosirribonucleico, y que produce pecosidades, fotofobia y subsecuentemente cambios neoplásicos en zonas expuestas al sol. En este trabajo se presenta el primer caso reportado en Cuba en un niño de 5 años de edad, con la entidad clínica en su forma más severa de manifestarse, el síndrome de Sactis Cacchione, que involucra las manifestaciones cutáneas y oculares con trastornos neurológicos y somáticos graves, y provoca daños letales.Xeroderma pigmentosum is a rare genetic affection that transforms cellular hypersensitivity to ultraviolet radiation in association with an abnormal repairing of the desoxyribonucleic acid, and that produces freckles, photophobia and, subsequently, neoplasitc changes in zones exposed to sunlight. In this paper it is reported the first case detected in Cuba in a five-year-old child suffering from the most severe manifestation of this disease, the Sanctis Cacchione´s syndrome, which involves skin and ocular manifestations with serious somatic and neurological disorders and provokes lethal damages.

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Las polémicas inaugurales de la transición a la democracia: los casos argentino y paraguayo

Directory of Open Access Journals (Sweden)

Carla Daniela Benisz

2017-01-01

Full Text Available Tras la caída de las dictaduras del Cono Sur, el cambio político generó también cambios de paradigmas estéticos y éticos en el campo intelectual, que se expresaron en polémicas en distintos países de la región. Los casos, por lo general, han sido estudiados individualmente para cada país, pero las similitudes justifican un abordaje en conjunto. Este artículo presenta, como primera instancia, un estudio comparado de los casos argentino y paraguayo, con especial énfasis en este último, puesto que ha sido menos trabajado por la crítica literaria latinoamericana. De estos casos, a su vez, se enfoca en dos cruces polémicos concretos: por un lado, una famosa polémica entre Julio Cortázar y Liliana Heker y, por otro, las polémicas de Augusto Roa Bastos con Carlos Villagra Marsal y Guido Rodríguez-Alcalá.

Alterações de neuroimagem no parkinsonismo: estudo de cinco casos

Directory of Open Access Journals (Sweden)

Costa Maria do Desterro Leiros da

2003-01-01

Full Text Available Apresentamos 5 casos de parkinsonismo nos quais as imagens de ressonância magnética (RM mostram alterações em estruturas do circuito dos núcleos da base (NB. Foram estudados 5 pacientes: 3 do sexo masculino e 2 do feminino nos quais as manifestações clínicas tiveram início nas faixas estárias de 5 a 52 anos. Os exames de RM foram realizados com equipamento de 1.5T. As imagens nas sequências em T2 evidenciaram hipersinal bilateral e simétrico nas seguintes topografias: exclusivamente na substância negra (3 casos, exclusivamente no globo pálido (1 caso e envolvendo simultaneamente a substância negra, o globo pálido e as conexões nigro-estriatais (1 caso. Em três casos havia dados sugestivos de parkinsonismo secundário: um pelo herbicida glifosato; outro após vacinação anti-sarampo; outro após período de coma por encefalite. Nos dois casos restantes, o diagnóstico clínico era de doença de Parkinson (DP. Entretanto, nesses dois casos, os dados da RM permitiram excluir o diagnóstico inicial de DP. A RN foi fundamental para identificar casos de parkinsonismo secundário, embora em alguns destes pacientes não tenha sido possível determinar os agentes etiológicos.

Streptococcus gallolyticus subsp. pasteurianus en líquido cefalorraquídeo de un paciente pediátrico

Directory of Open Access Journals (Sweden)

Liz M Vélez Balestro

Full Text Available Hasta la fecha se han descrito casos de meningitis por Streptococcus gallolyticus subsp. pasteurianus en adultos, y de los pocos casos pediátricos, el mayor número se presentó en neonatos. En este trabajo presentamos un caso de meningitis y bacteriemia por este estreptococo en un paciente de 9 meses, con reiteradas hospitalizaciones por enfermedades respiratorias; este constituye el primer aislamiento documentado del citado microorganismo en Santa Fe.

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Libertad de expresión y el caso del lenguaje del odio. Una aproximación desde la perspectiva norteamericana y la perspectiva alemana

Directory of Open Access Journals (Sweden)

Oscar Pérez de la Fuente

2010-12-01

Full Text Available Resumen Este artículo analiza las concepciones sobre la libertad de expresión en el caso del lenguaje del odio, centrándose en algunos aspectos de la perspectiva norteamericana y en algunos aspectos de la perspectiva alemana. El primer modelo está basado en la libertad negativa y se corresponde con la visión del mercado de las ideas que ha elaborado la jurisprudencia de la Corte Suprema norteamericana. Este Tribunal ha otorgado una papel prioritario a la libertad de expresión, que debería limitarse sólo en casos de un peligro claro y presente o amenaza de desordenes públicos. El segundo modelo, centrado en la libertad positiva, otorga un papel prioritario a la dignidad humana frente a la libertad de expresión. El Tribunal Constitucional Federal alemán ha considerado que en el conflicto de derechos fundamentales debe establecerse una ponderación según las circunstancias de caso concreto. Abstract This article analyzes the conceptions on freedom of expression in the case of hate speech, focusing in some aspects of the North American perspective and in some aspects of the German perspective. The first model is based on negative freedom and it corresponds with the vision of marketplace of ideas that has elaborated the jurisprudence of the North American Supreme Court. This Court has given a priority role to the free speech that only must be limited in cases of clear and present danger or a threat of the breach of the peace. The second model is focused in the positive freedom, it gives a priority role to the human dignity in front of free speech. The Federal Constitutional Court has established that the conflict between fundamental rights must be considered according to the circumstances of the specific case. 

The Taxation of Royalties in E-commerce

OpenAIRE

García Heredia, Alejandro

2014-01-01

El presente trabajo analiza en qué casos los pagos derivados del comercio electrónico se califican como cánones a efectos de la aplicación de los convenios para eliminar la doble imposición internacional. En primer lugar, se analizan las características generales y los problemas de calificación que plantean los cánones en la fiscalidad internacional para comprender la relevancia que dichas rentas tienen en el ámbito del comercio electrónico. ...

Crianza Artificial de Aves Rapaces Nocturnas en Cautiverio

OpenAIRE

Carolina Sastre-Corredor

2009-01-01

El objetivo de este trabajo, fue realizar el seguimiento a dos casos de aves rapaces neonatos que ingresaron al Centro de Recepción y Rehabilitación de Fauna Silvestre (CRRFS) de la Secretaria Distrital de Ambiente (SDA), con el fin de registrar, conocer e informar el manejo general de los mismos. Al momento de ingresar el primer grupo de ejemplares al CRRFS, se detectaron varias limitaciones de tipo físico, por ejemplo insumos alimentarios en mal estado o inexistencia de los mismos, y de...

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

Teratocarcinosarcoma rinosinusal: Reporte de un caso

OpenAIRE

González G,Claudia; Iñiguez,Rodrigo; Aranís Jiménez,Carolina; Castiblanco Galvis,Adriana

2008-01-01

Teratocarcinosarcoma rinosinusal es una neoplasia maligna infrecuente y rara, que combina elementos de teratoma y carcinosarcoma. Se compone de epitelio benigno o maligno (fibroblastos), mesénquima (cartílago, hueso o músculo liso) y elementos neurales. Hasta el año 2008 se han reportado un total de 63 casos de ubicación rinosinusal. Presentamos el caso de un teratocarcinosarcoma de fosa nasal, en un hombre de 67 años de edad, que consultó por obstrucción nasal rápidamente progresiva. La lesi...

ANÁLISIS DE LOS PROCESOS DE PARTICIPACIÓN PÚBLICA, CASO DE ESTUDIO: “FACULTAD DE CIENCIAS INFORMÁTICAS-ULEAM”

Directory of Open Access Journals (Sweden)

Alex Santamaría Philco

2015-12-01

Full Text Available Esta contribución sintetiza un análisis realizado a la aplicación de un proceso de participación pública por medio de un prototipo informático en un experimento realizado con estudiantes y docentes de la Universidad Laica Eloy Alfaro de Manabí, con el propósito de obtener datos para el futuro diseño de un método estándar adaptable a cualquier dominio de aplicación incorporando a las Tecnologías de Información y Comunicación “TIC’s”. En primer lugar, con una base teórica, se hace uso de un modelo de proceso que representa el ciclo de vida de un proceso de participación pública. En segundo lugar se diseña el prototipo de soporte, utilizando la metodología de desarrollo Rational Unified Process “RUP”, que permite la automatización del modelo, el cual consta de dos herramientas: una orientada al usuario experto en participación pública desarrollada en Visual Studio .Net; y una segunda orientada al participante o ciudadano en general creada para un entorno web en lenguaje PHP. Posteriormente, la integración de ambas herramientas y su correcto funcionamiento se evalúan con pruebas funcionales, no funcionales y la aplicación a un caso de estudio con estudiantes y docentes universitarios permitiendo obtener resultados favorables que demuestran la aplicabilidad del trabajo propuesto.

Dos estudios de casos

Directory of Open Access Journals (Sweden)

Hernán Guillermo Salazar Morales

1989-04-01

Full Text Available RESUMEN A continuación se presenta dos casos de estudio en donde se puede apreciar a la forma  como se establecen  las relaciones en una organización y lo que una DECISION  puede llegar a incidir en el desarrollo de las operaciones de una empresa. Decisiones basadas en la intuición, o en corazonadas, frecuentemente conducen en dirección equivocada, ocasionando pérdidas en tiempo, personal y dinero. El proceso de toma de decisiones deben ser TAREAS ESTRUCTURADAS que se sustenten con hechos. Su ejecución debe hacerse secuencialmente y cumplir con cada uno de sus pasos. El diseño de los  casos está orientado para que  sirvan como material de aplicación en la asignatura de  taller de planeación.

Casos autoctones de esquistossomose mansonica em criancas de Recife, PE

Directory of Open Access Journals (Sweden)

Constanca Simoes Barbosa

2013-08-01

Full Text Available OBJETIVO : Investigar criadouros com moluscos hospedeiros e casos humanos autóctones para esquistossomose. MÉTODOS : Entre julho de 2010 e setembro de 2012 foram realizados: (1 levantamento malacológico para busca ativa de criadouros, coleta e identificação de caramujos Biomphalaria positivos para Schistosoma mansoni em Recife, PE; (2 inquérito de prevalência com 2.718 escolares, de sete a 14 anos, para diagnóstico de casos de esquistossomose; (3 exame clínico e ultrassonografia nos casos positivos para S. mansoni. Os casos foram investigados quanto à sua autoctonia e avaliados clinicamente. Os casos e criadouros foram georreferenciados e espacializados. RESULTADOS : Foram identificados 30 criadouros de B. straminea , quatro deles potenciais focos de transmissão, uma vez que os testes moleculares identificaram DNA de S. mansoni nos caramujos coletados. Foram diagnosticadas 14 crianças com esquistossomose; entre elas, cinco foram consideradas casos autóctones da doença. CONCLUSÕES : Ações emergenciais pela vigilância em saúde são necessárias para evitar que a esquistossomose se endemize em Recife, como acontece em localidades litorâneas do estado de Pernambuco.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Mujer de 52 años con shock cardiogénico secundario a síndrome de takotsubo tras reparación quirúrgica de la válvula mitral

Directory of Open Access Journals (Sweden)

Francisco J. Rodríguez Rodrigo

2014-01-01

Full Text Available Presentamos un caso de miocardiopatía de takotsubo en una paciente con insuficiencia valvular mitral severa (por prolapso severo del velo posterior, acaecida después de la reparación quirúrgica de dicha válvula. Hasta donde conocemos, este es el primer caso descrito en la literatura.

A young woman with first-trimester metrorrhagia, fever and skin lesions Mujer joven con metrorragia del primer trimestre, fiebre y lesiones cutáneas

Directory of Open Access Journals (Sweden)

A. Lalueza Blanco

2006-03-01

Full Text Available Inflammatory bowel disease commonly affects women with child-bearing potential, and clinical activity extent is most relevant at the time of conception. Below, we report on the case of a 19-year-old woman who was admitted for first-trimester metrorrhagia and fever, with various extraintestinal manifestations, mainly including erythema nodosum and episcleritis during the course of disease. The differential diagnosis of these manifestations led to the diagnosis of Crohn's disease, which involved the whole colon.La enfermedad inflamatoria intestinal afecta frecuentemente a mujeres en edad fértil, siendo fundamental el grado de actividad clínica en el momento de la concepción. A continuación se presenta el caso de una mujer de 19 años que ingresa por metrorragia del primer trimestre y fiebre; destacando durante su evolución la aparición de diferentes manifestaciones extraintestinales, fundamentalmente eritema nodoso y epiescleritis. A través del diagnóstico diferencial de estas manifestaciones se llegó al diagnóstico de una enfermedad de Crohn que afectaba a todo el colon.

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

La religión en las decisiones sobre aborto no punible en la Argentina

Directory of Open Access Journals (Sweden)

María Gabriela Irrazábal

2015-11-01

Full Text Available En este artículo trabajaremos sobre la presencia de agentes religiosos expertos en bioética en comités de hospitales públicos y su intervención en casos de solicitud de acceso al aborto legal. En primer lugar realizaremos una descripción general del contexto de los casos de aborto no punible en la Argentina, resaltando que en la mayoría de los casos las creencias religiosas de los expertos suelen influir y condicionar las decisiones de las mujeres. Luego, pondremos el foco en la discusión dentro de un comité sobre un caso particular, el de una joven discapacitada que solicitó un aborto luego de un abuso sexual y que luego de atravesar un largo camino de judicialización y evaluaciones de comités de expertos, no logró interrumpir su embarazo. Este caso ilustra cómo las creencias religiosas influencian la toma de decisiones en el área de la salud pública y cómo se consolida la presencia de agentes religiosos expertos en bioética como una estrategia para influenciar los espacios públicos de la Iglesia Católica en la Argentina.

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Displasia tanatofórica: Relato de dois casos com estudo neuropatológico Thanatophoric dysplasia: neuropathological findings of two cases

Directory of Open Access Journals (Sweden)

Lúcia Noronha

2002-03-01

Full Text Available O relato tem como objetivo apresentar dois casos de displasia tanatofórica (DT, um caso do tipo I e outro do tipo II, com especial atenção ao sistema nervoso central. No caso compatível com DT tipo I foram observados macrocefalia, tórax estreito, hipoplasia pulmonar acentuada, abdome protuberante. Exames radiológicos revelaram platispondilia e ossos curtos encurvados com achatamento e fusão metafisária. No caso compatível com DT tipo II foram observados megaencefalia, fenda palatina, membros curtos e crânio em "folha de trevo". Os achados radiológicos ósseos foram platispondilia, alargamento dos espaços intervertebrais, ossos do esqueleto apendicular mais retilíneos que o primeiro caso e macrocefalia. Ao exame microscópico de ambos os casos foram encontrados polimicrogiria, principalmente temporal; agenesia hipocampal e heterotopia neuroglial no espaço subaracnoideo. As alterações eram mais intensas no segundo caso.We report two cases of thanatophoric dysplasia (TD with detailed neuropathologic evaluation. One case was representative of TD type I and the other TD type II. The case with TD type I showed macrocephaly, narrow thoracic cage, pulmonary hypoplasia and bowed limbs. Radiological study showed flat vertebral bodies, short curved appendicular skeleton and flaring of metaphyses. The other case (TD type 2 showed macrocephaly, cleft palate, short limbs and cloverleaf skull. Radiological findings were generalized platyspondy with excessive intervertebral disc space heights and a large head. Microscopic examination of both cases revealed temporal lobe polymicrogyria, abnormalities of the hippocampus and heterotopic neuroglial tissue within the meninges. There were no noticeable differences in CNS abnormalities between TD type I and II.

Análisis del clima familiar y resiliencia en una muestra de estudiantes universitarios de primer curso

OpenAIRE

Caamaño Fandiño, Alba María

2016-01-01

Traballo Fin de Grao en Educación Social. Curso 2015-2016 [ES] La modalidad elegida para desarrollar este Trabajo de Fin de Grado es la de iniciación a la investigación de campo. Así, este estudio se plantea con el objetivo general de analizar la resiliencia y el clima familiar en una muestra del alumnado universitario de primer año, en esta ocasión, perteneciente a la Universidad de Santiago de Compostela. La sociedad cambia constantemente y, con ella, las necesidades de los individuos...

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Síndrome de Isaacs: relato de três casos

Directory of Open Access Journals (Sweden)

SCOLA ROSANA HERMÍNIA

1999-01-01

Full Text Available Relatamos três casos de síndrome de Isaacs, que apresentavam mioquímia clínica, cãibras, dificuldades para o relaxamento muscular, hipertrofia muscular e aumento da sudorese. A eletromiografia de agulha mostrou atividade muscular contínua involuntária, caracterizada como descargas mioquímicas. Os estudos da condução nervosa foram normais. Biópsia de músculo, realizado nos três casos, mostrou atrofia de fibras do tipo 2. Dois casos apresentaram melhora clínica com a utilização de carbamazepina e um com prednisona.

Queratitis por Acanthamoeba sp.: primer caso confirmado por aislamiento y tipificación molecular en Bahía Blanca, provincia de Buenos Aires, Argentina Acanthamoeba sp. keratitis: first case confirmed by isolation and molecular typification in Bahía Blanca, Buenos Aires Province, Argentina

Directory of Open Access Journals (Sweden)

M. L. Gertiser

2010-06-01

Full Text Available Algunas especies del género Acanthamoeba provocan queratitis amebiana (QA, una infección de la córnea muy dolorosa, generalmente unilateral, con compromiso importante de la visión. Se presenta el caso de una mujer de 31 años usuaria de lentes de contacto con hábitos inadecuados de higiene y conservación de las lentes. La paciente consultó por enrojecimiento y dolor intenso en el ojo derecho, de dos meses de evolución. Luego del examen oftalmológico y ante la sospecha de una etiología parasitaria se realizó una biopsia de la zona lesionada, que se destinó al análisis bacteriológico y parasitológico en el laboratorio. También se remitieron los líquidos de lavado y el estuche de las lentes. No se detectó crecimiento bacteriano en las muestras. Los cultivos para la búsqueda de Acanthamoeba resultaron positivos en todos los especímenes analizados. Las amebas aisladas fueron clasificadas morfológica y molecularmente como pertenecientes al género Acanthamoeba. El presente trabajo muestra el primer caso de queratitis por Acanthamoeba de la ciudad de Bahía Blanca identificado por el laboratorio mediante procedimientos de alto valor diagnóstico.Some species of the Acanthamoeba genus cause keratitis, a very painful, most likely unilateral corneal infection , associated with eye and vision impairment. We here present a case of a 31-year-old female patient, a regular user of soft contact lenses without good practices of lens hygiene and handling. The patient attended medical consultation after two months of inflammation and pain in her right eye. After ophthalmological studies, and due to suspicion of a parasitic infection, a biopsy was performed and the sample submitted for bacteriological and parasitological analyses. Moreover, contact lens holders and lens cleaning solutions were studied. The samples yielded negative results for bacterial infection. However, cultivation of all samples showed the presence of amoeboid parasites

EVALUACIÓN DE LA PRESENTACIÓN DE CASO, CLÍNICA DE ODONTOLOGÍA DE RESTAURATIVAS: PROPUESTA DE UNA METODOLOGÍA CON RÚBRICA

Directory of Open Access Journals (Sweden)

Orlando Maroto Marín

2010-01-01

Full Text Available La evaluación de la clínica de restaurativa representa todo un reto para cualquier docente odontólogo, ya que debe de evaluar el desempeño o la técnica de los estudiantes en representaciones numéricas, que demuestran si un estudiante es capaz de aprobar el curso o en caso contrario repetirlo. En este artículo se expone una experiencia sobre el uso de una guía de evaluación con rúbricas para la presentación de caso, primer procedimiento que se debe evaluar en la clínica dental de docencia. La guía se aplicó a manera de prueba en la Clínica de Restaurativas de V año, de la Facultad de Odontología de la Universidad de Costa Rica. Para la elaboración del instrumento de evaluación, se realizó un inventario sobre los procedimientos que se llevan a cabo durante el desarrollo de la clínica y cuyo conocimiento por parte del estudiante es necesario. Los procedimientos se agruparon de acuerdo con los dominios: cognitivos, psicomotores y afectivos. Al aplicar la rúbrica se obtuvieron resultados positivos, tanto por parte de los docentes, como por parte de los estudiantes, requiriéndose la corrección de algunos detalles para alcanzar un resultado óptimo.

Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

Directory of Open Access Journals (Sweden)

Cesar Augusto Hernández-Suarez

2016-09-01

Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

Synthesis and luminescence properties of Eu"2"+ doped CaSO_4 phosphor

International Nuclear Information System (INIS)

Aghalte, G.A.; Dhoble, S.J.; Pawar, N.R.

2016-01-01

Eu"2"+ doped CaSO_4 Phosphor were synthesized by precipitation method. PL analysis of Eu"2"+ activated CaSO_4 phosphor exhibited characteristic emission properties; CaSO_4:Eu Phosphor has received considerable attention because of its high sensitivity to X-ray and λ ray irradiation. CaSO_4:Eu phosphor powder was successfully synthesized by the wet chemical co-precipitation method. The structure morphology and luminescent properties of the phosphor were characterized by X-ray diffraction, scanning electron microscopy and photoluminescence spectroscopy

Carcinoma de pele no segmento craniofacial: Relato de 3 casos

Directory of Open Access Journals (Sweden)

Iana Lara Pereira Maia

2014-09-01

Full Text Available O câncer de pele é a neoplasia mais frequente no Brasil. O tipo histológico mais comum é o carcinoma basocelular (CBC, 70% dos casos, seguido pelo carcinoma espinocelular (CEC e pelo melanoma. Relatamos três carcinomas de pele no segmento crânio facial, evidenciando as abordagens cirúrgicas realizadas. No caso 1, apresenta-se um CBC em hemiface submetido à exérese com retalho V-Y. No caso 2, destaca-se um CEC em couro cabeludo submetido à exérese com retalhos de rotação e da vizinhança. No caso 3, relata-se um CBC na região pré-auricular e no dorso nasal submetido à exérese com retalho de Limberg e de Rieger.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

A los tuyos con razón o sin ella Redes de poder, candidaturas y recomendaciones en el estado soberano de Santander (1859-1886). El caso de la red del general Solón Wilches Calderón

OpenAIRE

Guerra, Adriano Israel

2015-01-01

Esta investigación busca primero, a manera de balance, presentar los textos realizados sobre el tema específico del General Solón Wilches Calderón en el Estado Soberano de Santander. Luego se profundiza en el concepto central que estamos utilizando: Redes de poder, sin dejar de definir otros aspectos teóricos. El primer capítulo tiene por objetivo principal dibujar el mapa político durante el Estado Soberano de Santander estableciendo sus principales actores, grupos, conflictos y sus proyecto...

La quietud del tiempo. Una reflexión pictórica de la intimidad emocional del individuo

OpenAIRE

GIL SORIANO, CLARA

2015-01-01

En la presente memoria hablo en primer lugar sobre una serie de movimientos y artistas que han influenciado, aunque indirectamente en mi trabajo. A continuación realizo una breve descripción de los aspectos generales que me interesan en cada caso y posteriormente trato de analizar mi pintura; una serie de retratos realizados al óleo en los que busco el aspecto psicológico y la introspección del individuo, también encontraremos alguna obra de carácter paisajístico. Estas pinturas muestran una ...

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Síndrome de Asperger: relato de um caso

Directory of Open Access Journals (Sweden)

Letícia Viana Pereira

2012-04-01

Full Text Available Objetivo: O presente estudo tem como real objetivo o relato de um caso de Síndrome de Asperger comprado às características descritas na literatura. Metodologia: A partir de um relato de um caso atendido na Clínica Escola de Fonoaudiologia do Centro Universitário Metodista Izabela Hendrix, determinadas características foram comparadas com o descrito na literatura pertinente. Os trabalhos foram lidos, fichados e agrupados, segundos algumas características de abordagem, para posterior análise e comparação com o caso clínico relatado. Discussão e resultados: As crianças com Síndrome de Asperger são, em geral, diferentes entre si. Freqüentemente procedimentos realizados que podem ser indicados para uma criança seriam inadequados para outra. Assim, sugestões apresentadas pela literatura devem ser consideradas para melhorar a assistência à criança, como a compreensão mais abrangente e a reflexão aprofundada em relação a cada caso em específico. Conclusão: O acompanhamento e tratamento fonoaudiológico nesses casos, é de suma importância para o desenvolvimento o mais próximo possível do considerado formal na linguagem e na comunicação destes indivíduos. Vivências clínicas mostram as estratégias que podem ser sugeridas para estas crianças, lembrando que casa criança possui suas particularidades, que devem sempre ser levadas em consideração.

UMA TEORÍA CAUSAL PARA LOS CASOS FREGE

Directory of Open Access Journals (Sweden)

ABEL WAJNERMAN PAZ

2015-06-01

Full Text Available Fodor ha argumentado a favor de un par de tesis que pueden caracterizarse como constituyendo un dilema: Por un lado, si adoptamos una teoría funcional para los conceptos explicamos semánticamente los casos Frege pero caemos en el holismo semántico. Por otro lado, si adoptamos una teoría causal/informacional evitamos el holismo pero no explicamos los casos Frege semánticamente. Fodor (por ej, 1994, 1998 y 2008 intenta evitar la segunda parte del dilema argumentando que los casos de Frege pueden tener una explicación sintáctica y no semántica. En este trabajo intentaré ofrecer una salida alternativa al dilema fodoriano. Propondré una explicación semántica de los casos Frege que incorpora tanto elementos de una teoría causal como de una de rol funcional. Afirmaré que el contenido cognitivo o estrecho de un concepto (el tipo de contenido aparentemente exigido por los casos Frege es el conjunto de contenidos causales/informacionales de las representaciones que figuran en su rol funcional. Considero que individuar a las representaciones en los roles por medio de sus contenidos causales permite evitar el holismo (evitando el proceso de ramsificación típicamente empleado para individuar a los roles y que identificar el contenido cognitivo con contenidos causales/informacionales de las representaciones en los roles permite evitar el referencialismo de las propuestas causales (podemos distinguir sentido de referencia en términos causales.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Performance tests of a CaSO4:Dy based thermoluminescence personal dosemeter

International Nuclear Information System (INIS)

Azorin, J.; Gutierrez, A.; Niewiadomski, T.

1986-01-01

In order to replace LiF commercial thermoluminescence dosemeters (TLDs) now used in personnel monitoring, we developed a TLD personnel monitoring badge based on pellets of CaSO 4 :Dy bound in pure KBr placed in plastic holders provided with 0.8 mm Pb filters to compensate for the energy dependence of CaSO 4 :Dy. Performance tests, based on the proposals of international standards for TLDs intended to be used as general deep tissue personal dosemeters, were done by developing the detailed test methods both for the tests required by the International Atomic Energy Agency (fading, linearity, effect of fluorescent light and sunlight and stability under standard climatic conditions) and to meet the requirements of the International Electrotechnical Commission (batch homogeneity, detection threshold, stability of zero point repeatibility and residual). Initial tests showed a high residual and an increase of inhomogeneity. However, these drawbacks were overcome by changing the annealing procedure and the readout conditions. Using these new conditions TLDs met all the requirements for personal dosemeters. (author)

Anestesia venosa total (AVT) em lactente com doença de Werdnig-Hoffmann: relato de caso Anestesia general intravenosa (AVT) en lactante con enfermedad de Werdnig-Hoffmann: relato de caso Total intravenous anesthesia (TIVA) in an infant with Werdnig-Hoffmann disease: case report

OpenAIRE

Marco Antonio Cardoso de Resende; Elizabeth Vaz da Silva; Osvaldo José Moreira Nascimento; Alberto Esteves Gemal; Giseli Quintanilha; Eliana Maria Vasconcelos

2010-01-01

JUSTIFICATIVA E OBJETIVOS: A doença de Werdnig-Hoffmann é a causa mais comum de hipotonia no lactente e quando presente logo após o nascimento tem pior prognóstico. Fraqueza muscular simétrica, arreflexia e fasciculações da língua são característicos. A maioria dos lactentes morre antes dos dois anos por insuficiência respiratória. O presente relato apresenta um caso com técnica venosa total durante anestesia. RELATO DO CASO: Paciente feminina, branca, um ano, 10 kg, estado físico ASA III, co...

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Thermoluminescent properties of CaSO4:Dy prepared by precipitation method

International Nuclear Information System (INIS)

Roman, J.; Rivera, T.; Azorin, J.

2009-10-01

This paper reports the synthesis and thermoluminescent (Tl) characterization of CaSO 4 :Dy obtained by the precipitation method. Thermoluminescent CaSO 4 :Dy powder and Teflon (PTFE) were mixed in order to obtain samples in pellets form. Samples of CaSO 4 :Dy were exposed to a radiation gamma source of 60 Co and 90 Sr beta particles. Tl response of CaSO 4 :Dy showed a glow curve with two peaks centered at around 164 and 302 C. Tl phosphor showed a good linearity in the range from 0.5 to 30 Gy. Fading of the Tl information was 5.19 % in 37 days and presented a standard deviation of 4% for reproducibility. (Author)

Ensayo de campo de un procedimiento de investigación de casos de enfermedades de origen laboral

Directory of Open Access Journals (Sweden)

José María Roel Valdés

2013-06-01

Full Text Available Los datos de la Encuesta Nacional de Gestión de la Seguridad y Salud en las Empresas pone de manifiesto una escasa práctica en la investigación de casos de enfermedades profesionales o relacionadas con el trabajo. En este contexto se desarrolla este proyecto dirigido al desarrollo y ensayo de un procedimiento de investigación de casos de enfermedades profesionales o relacionadas con el trabajo, que permita orientar, armonizar y sistematizar la recogida de información en el transcurso de la investigación de este tipo de casos. En una primera fase un grupo investigadores del Instituto Valenciano de Seguridad y Salud en el Trabajo y de la Escuela Nacional de Medicina del Trabajo del Instituto de Salud Carlos III desarrollaron un procedimiento de investigación de casos de enfermedades laborales (profesionales o relacionadas con el trabajo, que se sometió mediante un taller al consenso con un grupo de expertos procedentes de distintos grupos de interés: Sindicatos, Servicios de Prevención Propios y Ajenos, Mutuas, Inspección de Trabajo, órganos técnicos de las CCAA, Sociedades de Medicina del Trabajo y Organismos Públicos de Investigación y Universidad. El procedimiento resultante se ensayó en 21 casos incidentes de enfermedades laborales, se evaluaron un total de 26 indicadores en tres dimensiones: necesidad, aplicabilidad y valoración general, medidos por una escala tipo Likert, evaluando el grado de acuerdo entre aplicadores mediante el procedimiento de estandarización del Instrumento AGREE. Los resultados ponen de manifiesto en 19 indicadores un grado de consenso superior al 80% y en 10 un grado de consenso superior al 90%, no existiendo disenso en ningunos de los indicadores analizados, lo que permite concluir que el procedimiento ensayado cubre las necesidades de información en la investigación de casos de enfermedades laborales.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

Miastenia gravis infantil: relato de caso diagnosticado clinicamente

Directory of Open Access Journals (Sweden)

J. Rodrigo Lopes

1985-09-01

Full Text Available Registro de caso de miastenia infantil (forma congênita, em criança com 16 meses de idade. Ênfase ao diagnóstico diferencial das várias formas de miastenia na infância é dada durante a discussão do caso. O diagnóstico baseou-se na resposta imediata a teste com Neostigmina, seguido de terapêutica satisfatória com Mestinon.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

Tres casos de odontomas

Directory of Open Access Journals (Sweden)

Salvador Javier Santos Medina

2015-03-01

Full Text Available Los odontomas son los tumores odontogénicos más comunes, casi siempre se diagnostican accidentalmente, en exámenes radiográficos; pueden sospecharse al retardar el brote dentario o producir maloclusiones. Se clasifican en odontomas compuestos y complejos, ambos constituidos por estructuras dentales como: esmalte, dentina, cemento y tejido pulpar. Su eliminación quirúrgica y la biopsia es el tratamiento de elección. El propósito de este trabajo es reportar tres casos de pacientes atendidos en el Hospital Pediátrico de Las Tunas, todos remitidos previamente por el ortodoncista. El primero, tipo compuesto, en un escolar de 9 años de edad, masculino, asociado a un 31 retenido; el segundo caso se trata de un gran odontoma complejo en una escolar de 11 años de edad, femenina, que produjo interferencia en el brote del 11 y el tercero compuesto; en un escolar de 10 años, masculino, en la línea media entre 11 y 21, con producción de diastema y brote del 12 por palatino. De ellos uno fue descubierto por un examen radiográfico de rutina y los otros dos sospechados por la maloclusión secundaria; todos se trataron quirúrgicamente. Estos casos demuestran la frecuencia de estos tumores en la cavidad bucal y la importancia de la realización de exámenes clínicos y radiográficos para su detección y tratamiento precoz, así como la importancia de la interrelación entre el ortodoncista y el maxilofacial en la resolución satisfactoria de esta entidad

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

Gestión de riesgos financieros. Experiencia en un banco latinoamericano1

Directory of Open Access Journals (Sweden)

Edmundo R. Lizarzaburu

2012-10-01

Full Text Available El presente documento busca presentar los principales conceptos de riesgos financieros presentes en la banca; en particular, se trabajará el caso de un banco peruano, considerando aspectos tales como la gestión de riesgos, Basilea III y la crisis económica internacional. El caso se desarrolla en el primer semestre del 2012 en el mercado peruano.

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

Directory of Open Access Journals (Sweden)

Jonas Binladen

2007-02-01

Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

Mayaro virus: imported cases of human infection in São Paulo State, Brazil Vírus Mayaro: casos importados de infecção humana no Estado de São Paulo, Brasil

Directory of Open Access Journals (Sweden)

Terezinha Lisieux M. Coimbra

2007-08-01

Full Text Available Mayaro virus (MAYV is an arbovirus (Togaviridae: Alphavirus enzootic in tropical South America and maintained in a sylvan cycle involving wild vertebrates and Haemagogus mosquitoes. MAYV cases occur sporadically in persons with a history of recent activities inside or around forests. This paper reports three cases of MAYV fever detected in men infected in Camapuã, MS, Brazil. Serum samples collected at four days and two months after the onset of the symptoms and examined by hemagglutination inhibition test, revealed monotypic seroconversion to MAYV. Isolation of the virus was obtained from one of the samples by inoculation of the first blood samples into newborn mice. A suspension of the infected mouse brain was inoculated into C6/36 cells culture and the virus was identified by indirect immunofluorescent assay with alphavirus polyclonal antibodies. RT-PCR, performed with RNA extracted from the supernatant of C6/36 infected cells in the presence of alphavirus generic primers as well as specific MAYV primers, confirmed these results. The reported cases illustrate the importance of laboratory confirmation in establishing a correct diagnosis. Clinical symptoms are not always indicative of a disease caused by an arbovirus. Also MAYV causes febrile illness, which may be mistaken for dengue.O vírus Mayaro (MAYV é um arbovírus do gênero Alphavirus, família Togaviridae, enzoótico na América do Sul, sendo mantido em ciclo silvestre envolvendo vertebrados e mosquitos Haemagogus. Casos de MAYV são esporádicos e ocorrem em pessoas com história de recentes atividades dentro ou próximo a florestas. Este artigo relata infecção por MAYV detectada em três pacientes, infectados em Camapuã, MS, Brasil. Amostras de sangue, coletadas no 4º dia e no 2º mês após o início dos sintomas, foram usadas para teste de inibição da hemaglutinação, que revelou soroconversão monotípica para MAYV. O isolamento do vírus foi obtido somente de uma das

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

“El perfil sociocultural de los graduados universitarios: el caso de la UNGS”

OpenAIRE

Fernández, Marcos Silvestre

2015-01-01

La presente ponencia se enmarca en un proyecto de beca de investigación otorgada por Consejo Interuniversitario Nacional (CIN) en Octubre del 2014, en la carrera de grado Lic. En Educación de La Universidad Nacional de General Sarmiento (UNGS). El trabajo tiene como objetivo presentar el análisis, las metodologías empleadas y las primeras conclusiones sobre el estudio "El perfil Sociocultural de los graduados universitario: el caso de la UNGS". El proyecto se propuso elaborar un es...

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Angioedema recorrente – caso clínico

Directory of Open Access Journals (Sweden)

Sandrina Martins

2016-02-01

Full Text Available Introdução: O Angioedema hereditário (AEH é uma causa rara de angioedema recorrente, resultante de um defeito a nível do gene que codifica o inibidor do C1 esterase (C1 -INH. O edema envolve predominantemente os tecidos da face, membros, trato gastrointestinal e área genital. O envolvimento da laringe, apesar de menos frequente, constitui a expressão clínica mais grave, sendo potencialmente fatal. Caso clínico: Descreve -se o caso clínico de uma criança do sexo feminino de oito anos de idade referenciada à consulta de pediatria por episódios recorrentes de angioedema. O estudo efetuado revelou tratar -se de um caso de AEH. Discussão: O diagnóstico, estabelecido com base no quadro clínico, estudo do complemento e história familiar, é de importância fundamental considerando que o AEH é potencialmente fatal e exige uma terapêutica específica.

Distrofia neuroaxonal infantil: relato de dois casos

Directory of Open Access Journals (Sweden)

SCOLA ROSANA HERMINIA

1999-01-01

Full Text Available Descrevemos dois casos de distrofia neuroaxonal infantil ou doença de Seitelberger, que é doença rara, neurodegenerativa, com herança autossômica recessiva. O primeiro caso, sexo masculino, com 8 anos de idade, apresentava atraso do desenvolvimento psicomotor, ataxia e fraqueza muscular. Ao exame físico foi encontrado nistagmo horizontal e vertical com palidez do disco óptico, hipotonia e arreflexia profunda. O segundo caso, sexo masculino, com 1 ano e 6 meses de idade, apresentava atraso do desenvolvimento psicomotor e convulsões. No exame físico, apresentava atrofia de nervo óptico, hipertonia e hiperreflexia. A biópsia de nervo sural de ambos os pacientes mostrou aumento dos axônios, compatível com distrofia neuroaxonal. As características clínicas pleomórficas, bem como os achados neurofisiológicos variáveis tornam difícil firmar o diagnóstico, o qual é ajudado pela confirmação anatomopatológica dos esferóides neuroaxonais.

Organización y liderazgo en la construcción de un Sistema Agroalimentario Localizado. Un estudio de caso sobre el nopal en Hidalgo, México

Directory of Open Access Journals (Sweden)

Jesús Gerardo Torres Salcido

2018-01-01

Full Text Available Objetivo: analizar el papel que juegan la organización y los liderazgos en la construcción de los Sistemas Agroalimentarios Localizados (SIAL. En este sentido, se describe el funcionamiento organizativo y el papel de los liderazgos por medio de un estudio de caso de una organización cuya actividad fundamental es la producción de nopal orgánico en la localidad de El Rincón, ubicada en el estado de Hidalgo, México. Metodología: tipo participativa. Consistió en visitas a campo, entrevistas semiestructuradas y no estructuradas, reuniones con productores y análisis FODA. Resultados: las organizaciones verticales y los liderazgos centralizados pueden impulsar un desarrollo del SIAL en un primer momento, pero son un obstáculo y una limitante en otros momentos que se distinguen por la desaparición, física o virtual, del liderazgo. Limitaciones: si bien se trata de un primer trabajo de acompañamiento para el desarrollo de un SIAL, es necesario recomponer previamente las relaciones de confianza entre la comunidad, dañadas por la inoperancia de la organización y de los actuales liderazgos. Conclusiones: adicionalmente al restablecimiento de relaciones de confianza, la organización debe ser más abierta para impulsar y valorizar el nopal como un producto diferenciado con un alto potencial para el desarrollo territorial.

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

Comprometimento medular por linfoma tipo Burkitt: relato de um caso

Directory of Open Access Journals (Sweden)

Murillo Côrtes Drummond

1985-06-01

Full Text Available Registro de caso de linfoma tipo Burkitt com comprometimento intrarraqueano em criança de três anos de idade. Considerações sobre esse tipo de tumor são feitas em função do caso observado e de dados da literatura.

La jurisdicción del Tribunal Europeo de Derechos Humanos en casos de extradición. A propósito del caso Klein c. Rusia

Directory of Open Access Journals (Sweden)

Jan Schneider

2010-12-01

Full Text Available Analizamos la decisión del Tribunal Europeo de Derechos Humanos –TEDH– en el caso Klein c. Rusia de un ciudadano israelí requerido en extradición por Colombia para la ejecución de una sentencia por entrenamiento de grupos paramilitares. La decisión es presentada en el marco más amplio de la jurisprudencia del TEDH en casos de extradición desde Estados europeos a terceros Estados donde existe el riesgo de violación de los derechos humanos. Desarrollamos los principios que el TEDH aplica en estos casos y verificamos su aplicación en el caso Klein c. Rusia, tomando en cuenta también la opinión separada de los jueces minoritarios. En las conclusiones presentamos una perspectiva sobre cómo evitar la impunidad de perpetradores de violaciones de derechos humanos que no pueden ser extraditados por razones humanitarias.

Carlo Caso (1940 - 2007)

CERN Multimedia

Leonardo Rossi

Carlo Caso (1940 - 2007) Our friend and colleague Carlo Caso passed away on July 7th, after several months of courageous fight against cancer. Carlo spent most of his scientific career at CERN, taking an active part in the experimental programme of the laboratory. His long and fruitful involvement in particle physics started in the sixties, in the Genoa group led by G. Tomasini. He then made several experiments using the CERN liquid hydrogen bubble chambers -first the 2000HBC and later BEBC- to study various facets of the production and decay of meson and baryon resonances. He later made his own group and joined the NA27 Collaboration to exploit the EHS Spectrometer with a rapid cycling bubble chamber as vertex detector. Amongst their many achievements, they were the first to measure, with excellent precision, the lifetime of the charmed D mesons. At the start of the LEP era, Carlo and his group moved to the DELPHI experiment, participating in the construction and running of the HPC electromagnetic c...

Tumor neuroendocrino de la mama. Presentación de un caso y revisión de la literatura

Directory of Open Access Journals (Sweden)

Lidia Torres Aja

2017-04-01

Full Text Available Los carcinomas neuroendocrinos primarios de mama son neoplasias raras que representan entre un 2 y un 5 % de los tumores mamarios. Para su diagnóstico se requiere que más del 50 % del tumor presente marcadores neuroendocrinos. Estos tumores que se observan principalmente en mujeres de edad avanzada se presentan como una masa bien delimitada, generalmente no acompañada de adenopatías axilares. El pronóstico de este tipo de cáncer todavía no está muy claro, aunque estudios recientes demuestran que es similar al de los carcinomas ductales infiltrantes convencionales. Se presenta el caso de una paciente de 76 años que acudió a consulta por presentar gran tumoración que ocupaba prácticamente toda la mama derecha sin adenopatías axilares y la cual fue informada mediante biopsia por parafina como un carcinoma neuroendocrino. Este es el primer tumor de esta característica histológica diagnosticado en Cienfuegos, por lo cual se considera de interés científico su publicación.

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Afasia global sem hemiparesia: relato de caso

OpenAIRE

SILVA,MARCUS TULIUS TEIXEIRA DA; CAVALCANTI,JOSÉ LUÍS DE SÁ; MOREIRA,DENISE MADEIRA

2000-01-01

Afasia global geralmente é acompanhada por hemiparesia direita devido à extensão da lesão subjacente. Recentemente têm sido registrados na literatura casos em que tal síndrome ou não se acompanha do déficit motor ou este é apenas transitório, sendo esta condição conhecida como afasia global sem hemiparesia (AGSH). Relatamos caso de AGSH devido a infarto cerebral embólico cardiogênico, corroborando a tese de que esta condição pode ter valor preditivo para o diagnóstico de infartos embólicos....

Mielopatia necrotizante e neoplasias: registro clinico-patologico de dois casos

Directory of Open Access Journals (Sweden)

Marcos R. G. de Freitas

1983-06-01

Full Text Available São relatados dois casos de mielopatia transversa subaguda associada a tumores malignos. O primeiro paciente apresentava neoplasia de células reticulares histiocitárias e o segundo, carcinoma renal. Os autores fazem revisão dos casos similares descritos na literatura. As alterações anátomo-patológicas medulares encontradas foram semelhantes às descritas nos relatos prévios, sendo que no primeiro caso havia também intenso infiltrado inflamatório perivascular e a presença de astrócitos bizarros. Tais alterações encontradas sugerem ser esta afecção de natureza viral.

Development of Thermoluminescence Dosimeter CaSO4:Dy as Personal and Environmental Dosimeters

International Nuclear Information System (INIS)

Hasnel Sofyan

2009-01-01

Development of personal and environmental dosimeters using material phosphors of CaSO 4 :Dy powder in form capillary glass and disc teflon thermoluminescence (TL) dosimeter have been done. TL dosimeter CaSO 4 :Dy powder used can record dose response less than 0.01 mGy. Fading of TL dosimeter capillary glass after 29 days is 25%. In 1 batch, making of CaSO 4 :Dy powder can obtain 2 groups of dosimeter capillaries with coefficient variance smaller than 10%. This discrepancy caused difference in powder making and reading of the TL dosimeter. TL dosimeter CaSO 4 :Dy teflon disc with dia. 5 mm and 0.8 mm thickness is homogeneous mixture between phosphor powder with dia. 80 to 150 mesh and teflon powder dia. 20 μm. The composition of CaSO 4 :Dy and teflon in TL dosimeter influence sensitivity of the dosimeter. It’ concluded that in order to obtain optimal sensitivity of TL dosimeter, the composition of CaSO 4 :Dy and teflon is 3 and 1 with pressured of disc in 700 MPa. (author).

A Primer on Concepts and Applications of Proteomics in Neuroscience

DEFF Research Database (Denmark)

Hosp, Fabian; Mann, Matthias

2017-01-01

The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Insulinoma canino: relato de caso

Directory of Open Access Journals (Sweden)

L. Padovani

Full Text Available RESUMO O insulinoma é um tumor das células β do pâncreas, que têm a função de produzir e secretar insulina e, geralmente são malignos em cães. O presente trabalho descreve o diagnóstico e o manejo terapêutico de três casos de insulinoma. Os sinais clínicos dos animais relatados variaram de acordo com a severidade e a duração da hipoglicemia. O diagnóstico presuntivo se deu através dos sinais clínicos e da dosagem de insulina sérica no momento de mais intensa hipoglicemia e, o diagnóstico definitivo foi obtido por meio de exame histopatológico nos três casos relatados. O tratamento realizado variou de acordo com a intensidade dos sinais clínicos.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

Escorpionismo: presentación de un posible caso grave ocurrido en la Ciudad Autónoma de Buenos Aires

Directory of Open Access Journals (Sweden)

Patricia C Docampo

2011-06-01

Full Text Available El escorpionismo, en su aspecto clínico es un envenenamiento de causa accidental producido por la inoculación del veneno de un alacrán o escorpión, que en Argentina ocurre predominantemente en áreas urbanas, en el ámbito domiciliario o peridomiciliario. En nuestro país son tres las especies de escorpiones de interés médico-sanitario: Tityus (T. trivittatus, T. confluens y T. bahiensis. El cuadro clínico se caracteriza por presentar dolor agudo con escaso compromiso cutáneo y manifestaciones sistémicas que, sin tratamiento pueden provocar la muerte, principalmente en niños. El objetivo de esta comunicación es dar a conocer el primer caso de escorpionismo grave, ocurrido en la Ciudad Autónoma de Buenos Aires, en una niña de 4 años de edad y describir el cuadro clínico característico y la necesidad del tratamiento precoz en los casos moderados y severos.Scorpionism in its clinical aspect is an envenoming caused by accidental sting and inoculation of venom from a scorpion, which in Argentina occurs predominantly in urban areas, in the home environment or peridomiciliary. In our country there are three species of scorpions of medical-health concern: Tityus (T. trivittatus, T. confluens and T. bahiensis. The clinical picture is characterized by severe pain with limited cutaneous and systemic manifestations, that without treatment can cause death, especially in children. The aim of this communication is to present the first case of severe scorpionism occurred in the City of Buenos Aires, in a 4 years old girl, and to describe the characteristic clinical picture and the need for early treatment in moderate and severe cases of scorpionism.

Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

Science.gov (United States)

Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

2010-03-01

Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Coinfección brucelosis-leptospirosis, Urabá, Colombia: Reporte de caso

Directory of Open Access Journals (Sweden)

Laura Jaramillo

Full Text Available Se presenta un caso clínico de una confección de leptospirosis-brucelosis, en la región del Urabá antioqueño, en un paciente masculino de 45 años de edad con factores de riesgo ocupacionales, quien consultó inicialmente por síndrome febril prolongado y síntomas generales poco específicos además de manifestaciones hemorrágicas, lo que sumado a estar en área endémica, hizo sospechar el diagnóstico de leptospirosis, por lo cual se ordenó tratamiento, además de pruebas de laboratorio específicas. Luego de 45 días, el paciente consulta nuevamente con síndrome febril y orquiepididimitis unilateral, documentándose por pruebas de laboratorio el diagnóstico de brucelosis y leptospirosis, recibiendo tratamiento triconjugado (doxiciclina, rifampicina y gentamicina con resolución de los síntomas. Este caso de coinfección obliga a tener presente la posibilidad de infecciones simultáneas en pacientes con síndromes febriles procedentes de áreas endémicas para zoonosis, particularmente en los más comprometidos clínicamente.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

Autogestión en educación física. Un estudio de caso en secundaria

Directory of Open Access Journals (Sweden)

Eloísa Lorente Catalán

2006-06-01

Full Text Available El objeto de estudio de la tesis es la autogestión, una propuesta para la práctica pedagógica y el aprendizaje de la Educación Física que intenta implicar al máximo al alumnado en el proceso de enseñanza-aprendizaje. Los alumnos eligen, diseñan y llevan a cabo las sesiones adoptando el rol de profesor de sus propios compañeros. Esta tarea forma parte de un planteamiento más global que busca la autonomía del alumno en la gestión de su propio aprendizaje. El propósito del estudio es extraer conocimiento acerca de cómo se lleva a cabo la autogestión de la clase por parte del alumnado y de cómo perciben la experiencia los participantes, así como conocer qué aprenden y que utilidad le proporcionan para su vida cotidiana. La tesis está estructurada en dos partes. La primera trata de la fundamentación y del diseño del estudio, intentando, por una parte, ubicar la autogestión en el marco general de la enseñanza de la EF y por otra justificar el diseño de la investigación partiendo de la idea de que toda situación educativa es única y que por tanto, debe estudiarse en el lugar que ocurre. Por ello, la fundamentación epistemológica de la investigación se basa en el paradigma naturalista y la metodología que mejor se adecua a las pretensiones del estudio es la etnografía educativa interaccionista. La estrategia de diseño de la investigación es el estudio de caso, de modo que la segunda parte de la tesis se ha destinado a la reconstrucción del mismo. El caso estudiado está configurado por dos grupos de estudiantes de 8º de la antigua Educación General Básica y un profesor de EF con una ideología muy próxima a la pedagogía crítica. El estudio se centra especialmente en el primer año de la experiencia pero se continuó en contacto con el mismo grupo durante toda la secundaria, recogiendo información de los cuatro años, lo que permitió hacer una triangulación temporal. Posteriormente y después de tres a

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Miopia aguda induzida por topiramato: relato de dois casos

Directory of Open Access Journals (Sweden)

Kathy Dadam Sgrott

2011-06-01

Full Text Available RESUMO A miopia aguda pode ser desencadeada pelo uso de medicações sistêmicas, dentre elas, o anticonvulsivante topiramato. Este trabalho descreve dois casos de pacientes jovens com quadro agudo bilateral de miopia induzida por terapia com topiramato para controle de síndrome depressiva, fazendo relação com casos semelhantes descritos na literatura e revisão bibliográfica pertinente.

Cuatrocientos setenta y siete casos de uretritis masculina

Directory of Open Access Journals (Sweden)

Federico Díaz González

1985-12-01

Full Text Available En el año de 1985 se estudiaron, desde el punto de vista del laboratorio, 477 casos de uretritis masculina; 49 de ellos (10.3% fueron de uretritis gonocócica (UG y 428 (89.7% de uretritis no gonocócica (UNG. Estos resultados concuerdan con los obtenidos en series previas; se discute la importancia de la UNG y se plantea la posibilidad de que muchos de los casos de esta entidad sean de la modalidad postgonocócica (UPG.

Las condiciones de vida durante el primer franquismo. El caso de las Islas Baleares

Directory of Open Access Journals (Sweden)

David Ginard i Ferón

2002-12-01

Full Text Available From 1939 to 1951 the majority of the inhabitants of the Balearic Islands suffered a sharp decline in standards of living, which seems surprising when taking into account the relative economic boom of the previous decades and the reduced impact of the 1936-1939 war on the production system. Using a varied range of sources, particularly reports from the National Institute of Statistics, the Civil Government, the regional Parliament, Chambers of Commerce, the regional Falange headquarters and a number of municipal governments, a series of variables such as the unfavourable price-income relationship, the increase in levels of economic corruption, and the decline of basic daily supplies, health provision, housing and education have been analysed. The peculiar production system of the Balearic Islands, characterized at that time by the predominance of the consumer goods industry and export of agricultural produce, is one of the main reasons explaining the far-reaching effects of the general post-war economic crisis on to the Balearic archipelago.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

Directory of Open Access Journals (Sweden)

Marco Suárez

2006-05-01

Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

Oftalmoplegia extrínseca progressiva: registro de três casos

Directory of Open Access Journals (Sweden)

Luiz Antonio Alves Duro

1982-12-01

Full Text Available São relatados 3 casos de pacientes femininos com atrofia dos músculos oculares extrínsecos, sendo 2 de início provável aos 25 anos e 1 aos 56 anos. No que se referem às intercorrencias não miogênicas, no caso 1 havia otoscle-rose, comum na família e incapacidade para engravidar. A menarca ocorreu aos 19 anos e a menopausa aos 40, o que igualmente ocorreu com o caso 2, este o único a mostrar alterações eletrocardiográficas. No caso 3 havia sinal de Romberg e hiporreflexia profunda, sendo comum a incidência de catarata congênita. Com relação à patologia muscular, apesar das queixas serem praticamente restritas aos músculos extrínsecos oculares, procedemos à biópsia de outros músculos, além dos oculares, evidenciando-se em todos acometimento do tipo miogênico, o mesmo ocorrendo na EMG. Acreditamos tratar-se de processo miogênico difuso, em que pese a dominância das manifestações oculares.

Ares, Janus, Globalization: A Primer For The Military Leader in NATO

National Research Council Canada - National Science Library

Clemons, Dean

2002-01-01

...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

Bayesian models a statistical primer for ecologists

CERN Document Server

Hobbs, N Thompson

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

The proper generalized decomposition for advanced numerical simulations a primer

CERN Document Server

Chinesta, Francisco; Leygue, Adrien

2014-01-01

Many problems in scientific computing are intractable with classical numerical techniques. These fail, for example, in the solution of high-dimensional models due to the exponential increase of the number of degrees of freedom. Recently, the authors of this book and their collaborators have developed a novel technique, called Proper Generalized Decomposition (PGD) that has proven to be a significant step forward. The PGD builds by means of a successive enrichment strategy a numerical approximation of the unknown fields in a separated form. Although first introduced and successfully demonstrated in the context of high-dimensional problems, the PGD allows for a completely new approach for addressing more standard problems in science and engineering. Indeed, many challenging problems can be efficiently cast into a multi-dimensional framework, thus opening entirely new solution strategies in the PGD framework. For instance, the material parameters and boundary conditions appearing in a particular mathematical mod...

Caso clínico: ¿qué puede existir tras una funcionalidad aparente?

Directory of Open Access Journals (Sweden)

Susana Penas-Cuesta

2013-06-01

Full Text Available El trastorno límite de la personalidad (TLP es un trastorno grave consistente en un patrón general de impulsividad e inestabilidad en las relaciones, la autoimagen y los afectos, que suele requerir tratamiento intensivo, multidisciplinar y de larga duración. Se presenta un caso clínico en el que se realiza este tipo de abordaje en una paciente de 30 años con TLP y trastorno dismórfico corporal en el que predominan comportamientos impulsivos y potencialmente dañinos.

Toracoplastia traumática: relato de caso

OpenAIRE

Addor,Gabriela; Monteiro,Andreia Salarini; Nigri,David Henrique; Judice,Luiz Felippe; Haddad,Rui; Franco,Carlos Alberto de Barros

2007-01-01

O trauma é uma doença que afeta predominantemente os jovens, sendo a principal causa de morte nas primeiras três décadas de vida. O tórax instável é observado em aproximadamente 10% dos casos de trauma de tórax, com mortalidade de 10-15%. O caso clínico apresentado refere-se a uma paciente, vítima de acidente automobilístico, com trauma de tórax, ocasionando hemopneumotórax e fratura de múltiplos arcos costais, dor de difícil controle e deformidade torácica. São discutidas as opções terapêuti...

Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

Directory of Open Access Journals (Sweden)

Rosana Hermínia Scola

2005-06-01

Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

Impacto social del arrendamiento de tierras para generar energía eléctrica en La Venta, Juchitán de Zaragoza, Oaxaca.

OpenAIRE

Racilla Manuel, Sarita

2013-01-01

La investigación analiza lo que es el impacto social del arrendamiento de tierras y los cambios producidos por la instalación de parques eólicos, como caso de estudio del Ejido de La Venta, Juchitán de Zaragoza, Oaxaca. La tesis se realizó con una metodología mixta;(cuantitativa-cualitativa), para analizar el fenómeno antes descrito; está comprendida en cuatro capítulos. El primer capítulo plantea la estructura general de la investigación. El segundo, aborda el marco teórico y distintas visio...

La escuela chilena y la definición de lo público1

OpenAIRE

Serrano, Sol

2013-01-01

El modo de concebir la escuela pública en el periodo de conformación de los Estados nacionales en Hispanoamérica en general y en Chile en particular contribuye a comprender la formación de la esfera pública al menos en dos sentidos. En primer lugar, la escuela era la encargada de expandir la cultura escrita, sobre la cual se fundaba la opinión pública, y en segundo lugar, fue, al menos en el caso chileno, un espacio que, junto al culto, gatilló la discusión de la secularización del Estado y l...

Mastocitosis sistémica: repercusión ósea

OpenAIRE

Francisco R. Spivacow; Marcelo Sarli; Rosana Nakutny

2012-01-01

La mastocitosis sistémica es una enfermedad caracterizada por acumulación de mastocitos en varios órganos, de los cuales el más afectado es la piel. La repercusión ósea de esta enfermedad es poco frecuente y en general se la asocia al desarrollo de osteoporosis secundaria con o sin fracturas óseas. Se presentan tres pacientes con lesiones características en piel de mastocitosis y diferentes manifestaciones óseas; el primer caso es una mujer de 51 años en la que se observó una variante esclero...

O CASO MOREL: UM CASO DE INVESTIGAÇÃO LITERÁRIA MOREL CASE: A CASE OF LITERARY RESEARCH

Directory of Open Access Journals (Sweden)

JOANA DARC RIBEIRO

2000-01-01

Full Text Available Este estudo tem por objetivo a leitura do romance O Caso Morel, de RubemFonseca, cujo enfoque recai sobre o problema do personagem-escritor e o dacriação ficcional tematizados no espaço romanesco. Ao lado de uma“investigação policial” o leitor depara nesse primeiro romance do autor comuma “investigação literária” problematizada em vários níveis.The aim of this paper is the reading of O Caso Morel, by Rubem Fonseca,focusing on the character-writter and fictional creation. Besides a detectiveinvestigation we can find in the author’s first novel a problematic literacyinvestigation in several levels.

Hemofilia A neonatal: reporte de un caso en Sincelejo (Colombia

Directory of Open Access Journals (Sweden)

Jorge Mendoza-Herrera

2013-01-01

Full Text Available La hemofilia es una enfermedad hemorrágica hereditaria caracterizada por la deficiencia funcional o cuantitativa del factor VIII (hemofilia A o del factor IX (hemofilia B de la coagulación. El diagnóstico de la hemofilia es eminentemente clínico; situación clave que ofrece una ventana de oportunidad para que el médico de primer nivel de atención esta - blezca un diagnóstico oportuno y eficiente. Los datos clínicos de los dos tipos de hemofilia son sustancialmente idénticos y varían solo en relación con el grado de la deficiencia. En este trabajo se describe un caso de un recién nacido que presentó un hematoma como consecuencia de una venopunción. El paciente presentó prolongación en el tiempo parcial de tromboplastina y una disminución del Factor VIII de la coagulación, confirmándose el diagnóstico de hemofilia A. Se inició tratamiento con factor VIII recombinante y el paciente presentó una gran mejoría de cuadro clínico. Este trabajo tiene como objetivo alertar al cuerpo médico sobre la importancia de conside - rar esta enfermedad dentro del diagnóstico diferencial en los síndromes hemorrágicos del recién nacido, incluso sin la existencia de antecedentes famili ares. El tratamiento apropiado generará un impacto positivo en la salud de los pacientes y su familia, reduciendo con ello las complicaciones, costos por hos pitalización y muerte.

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Radiation protection primer

International Nuclear Information System (INIS)

Aigner, R.; Melzer, E.; Seissler, H.

1986-01-01

This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

Bond strength of primer/cement systems to zirconia subjected to artificial aging.

Science.gov (United States)

Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

2016-11-01

Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

Incorporating travel-time reliability into the congestion management process : a primer.

Science.gov (United States)

2015-02-01

This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

Science.gov (United States)

Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

2016-01-01

Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

Comparison of the TL intensity of the sintered composites of CaSO4+Tm

International Nuclear Information System (INIS)

Junot, O.D.; Sousa, F.L. de; Chagas, M.A.P.; Souza, D.N.

2009-01-01

The objective of this work is to compare the thermoluminescent intensity (TL) of CaSO 4 +Tm, CaSO 4 +Tm+glass and glass+Tm composites for use as thermoluminescent dosimeter (TLD). The route used to prepare the CaSO 4 +Tm and the CaSO 4 +Tm+glass was by mixing 1 g of CaSO 4 with 0.02 g of thulium oxide (99,9% purity) and 0.3 g of commercial and colorless glass. To mixing the composites were taken to a magnetic stirrer for 30 min with 10 mL of distilled water for better homogenization. The powder mixtures were dried in a stove at 100 deg C for 24 h. After drying, it was added polyvinyl alcohol (PVA) to improve the binding material. The pellets were compacted by application of an uniaxial pressing and sintered at 700 deg C/ 6 h. The route used in the preparation of glass+Tm pellets was similar to one previously mentioned, except by the use of 1 g of glass and 0.02 of Tm. After the sintering, the pellets dimensions were 1 mm thick and 6 mm in diameter. All samples were irradiated by a beta source ( 90 Sr + 90 Y) and received doses from 1.00 Gy to 20 Gy. Each composite presented a characteristic emission curve. The dosimeter of CaSO 4 +Tm+glass presented two peaks, the first at 115 deg C, and the second, very intense, ate 150 deg C. The CaSO 4 +Tm dosimeter showed a less intense peak at 140 deg C and another, more intense, at 235 deg C. In the composites of glass+Tm, the most intense peak has a thermoluminescent signal 94,04% lower than the most intense peak of CaSO 4 +Tm+glass and 81.57% lower than the most intense peak of CaSO 4 +Tm. After the analysis of TL emission curves, we observed that the CaSO 4 +Tm+glass have the highest TL intensity and a TL response proportional to the dose absorbed. (author)

El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

Directory of Open Access Journals (Sweden)

Fernanda Martins Castro

2015-06-01

Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

Science.gov (United States)

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

Science.gov (United States)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

Sindrome peri-silviana bilateral não relacionada a malformações: relato de dois casos

OpenAIRE

Grasel, Ralf Paulo; Carvalho Neto, Arnolfo; Bruck, Isac; Antoniuk, Sérgio A.

1996-01-01

In this case report we present the neuroimaging findings and clinical features of two patients with a bilateral perisylvian syndrome not related to malformations, but probably to ischemic etiology. Evaluations including history, general and neurologic examinations, electroencephalograms, and imaging data were reviewed as recent literature about the subject.Neste relato de caso, apresentamos os achados de neuroimagem e os aspectos clínicos de dois pacientes com síndrome peri-silviana bilateral...

Síndrome de Stevens Johnson, presentación de un caso en edad pediátrica

Directory of Open Access Journals (Sweden)

Maritza Morales Solís

2015-11-01

Full Text Available El síndrome de Stevens-Johnson (SSJ es una variante severa del eritema multiforme, consistente en una reacción de hipersensibilización que afecta piel y mucosa, además de otros órganos internos, y que se manifiesta con lesiones en zonas genitales, bucales y cutáneas, es idiopático en el 50% de los casos, generalmente producido por alergia a medicamentos. La muerte sobreviene en el 5-15% de los casos sin tratar. El riesgo de recurrencia es del 37% o más.  Al Hospital Pediátrico Provincial Docente “Mártires de Las Tunas”  fue  traído un niño de seis años  de edad, que tras el uso del Sulfaprín comenzó con lesiones que afectaban la piel y  todas las mucosas, además de toma del estado general. Inmediatamente fue admitido en la Unidad de Cuidados  Intensivos Pediátricos, donde fueron tomadas medidas que incluyeron supresión del agente causal,  corticoterapia endovenosa, antibioticoterapia endovenosa, tratamiento de las lesiones, vigilancia del balance hidromineral y atención oftalmológica, respondiendo favorablemente. Se presenta el caso, por ser una enfermedad poco frecuente y de muy mal pronóstico.

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

Leptospirosis: serie de casos en un centro penitenciario de la costa de Ecuador

Directory of Open Access Journals (Sweden)

D. Valarezo-Sevilla

2014-06-01

Full Text Available Se describe los casos de dos pacientes inicialmente diagnosticados como dengue e infección urinaria. Los pacientes eran personas privadas de la libertad en la misma prisión y estuvieron en contacto con agua dulce estancada aproximadamente dos semanas antes del inicio de los síntomas durante las fiestas del carnaval, siendo el sitio probable de la contaminación. El tiempo transcurrido entre el ingreso al hospital y la sospecha de leptospirosis (y el inicio del tratamiento fue de cuatro días para el paciente del caso 1 y dos días para el caso 2; entre el ingreso y la confirmación diagnóstica por laboratorio fue de diez días para el caso 1 y cuatro días para el caso 2. Se concluye que la leptospirosis no se considera como una opción dentro del diagnóstico diferencial inicial sino luego de descartar otras patologías.

Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

Directory of Open Access Journals (Sweden)

Julio J. Masquijo

2014-10-01

Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

Directory of Open Access Journals (Sweden)

Douglas de Almeida Pereira

2015-09-01

Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

La demanda de trabajo: teoría y evidencia empírica para el caso colombiano

Directory of Open Access Journals (Sweden)

Jairo Guillermo Isaza Castro

2004-07-01

Full Text Available Este documento presenta algunos de los aspectos teóricos más importantes para el análisis de la demanda de trabajo, así como la evidencia empírica disponible para el caso colombiano. En cuanto a los aspectos teóricos, la exposición se centra en la discusión microeonómica concerniente a las propiedades de la demanda de trabajo del empresario maximizador debeneficios que enfrenta un proceso productivo con dos factores: capital y trabajo. Luego se discuten las implicaciones de los procesos de liberalización y reformas estructurales en la demanda de trabajo. La revisión de literatura efectuada para el caso colombiano muestra cómo, en general, los estimativos de elasticidades de la demanda por trabajadores frente al producto y el salario real difieren sustancialmente debido a la diversidad de especificaciones econométricas, la temporalidad de los datos y las fuentes de los mismos.

Siameses toracópagos: presentación de caso y revisión de la literatura

Directory of Open Access Journals (Sweden)

B.G.I. González Cortés

2015-07-01

Full Text Available Se presenta un caso de gemelos unidos (siameses toracópagos atendidos en el Hospital General de Ecatepec “Las Américas”. El caso fue detectado al nacimiento, que se presentó a las 33 semanas de gestación. La malformación no fue diagnosticada de forma oportuna, a pesar de haberse efectuado estudios ultrasonográficos obstétricos durante la gestación. Ante la dificultad de ofrecer una separación quirúrgica exitosa, así como por el grado de malformación, es de gran importancia el diagnóstico precoz para así ofrecer una mejor atención a los neonatos y la protección de la fertilidad futura de la madre. Se realizó una revisión en la literatura sobre los aspectos relacionados con la etiopatogenia y diagnóstico de esta malformación.

Los informes contables externos y la legitimidad organizacional con el entorno: estudio de un caso en Colombia

Directory of Open Access Journals (Sweden)

Mauricio Gómez Villegas

2009-08-01

Full Text Available Este documento es una aproximación académica a la contabilidad y a los informes contables externos. Su preocupación es la caracterización y comprensión del papel de la contabilidad en las organizaciones y en la sociedad. Por ello sintetiza la visión económica dominante y algunas de las perspectivas sociales e institucionales sobre el rol de la contabilidad y la información contable financiera. Parte de la pregunta: ¿Aporta la contabilidad al propósito de legitimidad organizacional con el entorno? Así, el objetivo del trabajo es realizar una síntesis de las visiones que explican el papel de los informes contables externos, los estados financieros particularmente, desde la visión dominante y desde una perspectiva neoinstitucional en contabilidad. Para ello el documento recoge un primer estudio de caso, que pretende aportar a la necesaria contrastación empírica para la comprensión del rol de la contabilidad en Colombia. Adoptamos la visión según la cual, ante todo, la información contable desempeña un rol institucional, como mecanismo de legitimación de la organización con su entorno

CRIPTOCOCOSE: RELATO DE CASO

Directory of Open Access Journals (Sweden)

Fernanda Alvarez GENTIL

2016-12-01

Full Text Available Criptococose, doença infecciosa fúngica, oportunista, potencialmente fatal, que acomete animais silvestres e domésticos, principalmente cachorro e gato e o homem. Causada pela levedura, Cryptococcus neoformans. Mais frequente em adultos, comumente diagnosticada em pacientes imunodeprimidos, como os soropositivos, fator predisponente mais frequente. Outros fatores são: uso prolongado de medicações imunossupressoras, doenças como diabetes, sarcoidose, doença de Hodgkin e outras neoplasias hematológicas, lúpus eritematoso, artrite reumatoide, doença de Behçet, e transplante de vísceras sólidas. Geralmente adquirida pela inalação do agente etiológico. Objetivo: este estudo objetiva relatar o caso de um paciente portador de criptococose, que esteve invernado no Hospital São José do Avaí (HSJA de Itaperuna, no mês de setembro de 2016, corroborando na literatura descrita sobre o tema, justifica-se o tema pela raridade do caso. Metodologia: inicialmente realizou-se pesquisa bibliográfica através da seleção de autores que asseguraram uma fundamentação teórico-metodológica que serviu de arcabouço para o desenvolvimento do estudo. A metodologia apresentada refere-se a um relato de caso, realizado a partir do prontuário do paciente e dos exames disponíveis. Resultados: a Radiografia de tórax evidenciou massa pulmonar em lobo inferior direito e a Tomografia de tórax também demonstrou esse acometimento; sendo realizada biópsia desse fragmento, que consolidou o diagnóstico de criptococose. A lâmina do paciente, corada com hematoxilina-eosina demonstrou aspectos característicos do acometimento por esse fungo. Conclusão: para o tratamento, pode-se utilizar antifúngicos como a anfotericina B associado com 5-flucitosina, em infecções disseminadas; ou fluconazol e itraconazol, para infecções cutâneas. 

La responsabilidad en el derecho penal internacional: una aproximación desde la filosofía de John Searle. Reflexiones a partir del caso Lubanga

Directory of Open Access Journals (Sweden)

Rodrigo A. González Fernández

2013-06-01

Full Text Available En este trabajo examinamos el tópico de la responsabilidad en el derecho penal internacional a la luz de la filosofía de John Searle, y del fallo dictado por la Corte Penal Internacional en el caso de Thomas Lubanga. En el primer acápite analizamos la declaración de responsabilidad penal en función de la teoría de actos de habla de Austin y de Searle, tratándola como un acto ilocucionario cuyo significado es dependiente de un marco institucional específico. Luego, en el segundo acápite, mostramos de qué forma tal marco puede reconstruirse como un ejemplo paradigmático de la realidad social construida descrita por Searle, especialmente en virtud del nexo entre mente, lenguaje y sociedad. A nuestro juicio, los conceptos de intencionalidad colectiva, atribución de funciones de estatus y poderes deónticos son fundamentales para entender tal nexo. En efecto, tal como argumentamos en la tercera sección, los sistemas de poderes deónticos asociados al derecho internacional no solo explican la aparición de Tribunales penales internacionales, como la Corte Penal Internacional, sino además el carácter imprescriptible de los crímenes de lesa humanidad. Los acuerdos internacionales que promueven y protegen los derechos humanos, y que tratan la imprescriptibilidad de aquellos crímenes, son objeto de análisis en la sección final, en donde exponemos algunas reflexiones finales a partir del caso Lubanga.

Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

Science.gov (United States)

Duina, Andrea A; Miller, Mary E; Keeney, Jill B

2014-05-01

The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

Fundamentos y aplicaciones del diseño de casos cruzados Case-crossover design: Basic essentials and applications

Directory of Open Access Journals (Sweden)

Eduardo Carracedo-Martínez

2009-04-01

Full Text Available El diseño de casos cruzados es un diseño epidemiológico observacional propuesto por Maclure en 1991 para valorar si alguna exposición intermitente o inusual ha desencadenado un evento agudo a muy corto plazo. En este trabajo se presentan los fundamentos de los diseños de casos cruzados, con sus aplicaciones y limitaciones. El diseño de casos cruzados se basa en seleccionar sólo sujetos caso. Para calcular el riesgo relativo se compara la exposición durante el periodo de tiempo previo al evento (periodo caso con la exposición del mismo sujeto en uno o varios periodos control. Este método únicamente es adecuado cuando las exposiciones son cambiantes en el tiempo, con efectos a corto plazo, y el efecto es agudo. Para exposiciones en que no existe tendencia, el planteamiento unidireccional es el más frecuente, y consiste en seleccionar uno o varios periodos control previos al momento caso. Cuando la exposición tiene una tendencia temporal (por ejemplo las de contaminación atmosférica, el planteamiento unidireccional proporciona estimaciones sesgadas, por lo que se utilizan diseños de casos cruzados bidireccionales, que seleccionan periodos de tiempo control anteriores y posteriores al del evento. Es un método que cuenta con una creciente utilización en amplios campos: desencadenantes de accidentes de tráfico, laborales y domésticos, o de infarto agudo de miocardio, contaminación atmosférica y salud, farmacoepidemiología, etc. Para el análisis de datos, generalmente se pueden considerar los diseños de casos cruzados como estudios de casos y controles emparejados, por lo que se aplica regresión logística condicional. Finalmente, en este trabajo se analizan ejemplos prácticos de diferentes aplicaciones del diseño de casos cruzados.Case-crossover analysis is an observational epidemiological design that was proposed by Maclure in 1991 to assess whether a given intermittent or unusual exposure may have triggered an immediate

Acomodar, ordenar y leer. La disposición de los libros en acervos novohispanos durante la segunda mitad del siglo XVIII

Directory of Open Access Journals (Sweden)

Manuel Suárez Rivera

2015-06-01

Full Text Available El articulo representa un primer acercamiento a la forma en que los novohispanos acomodaban sus libros en los estantes, tanto de bibliotecas particulares como de librerías durante la segunda mitad del siglo XVIII. A partir de una serie de inventarios levantados por el control que llevaba el Santo Oficio, estudio brevemente algunos casos concretos en donde se revela la forma en la que estaban dispuestos los volúmenes; en un primer momento me refiero a bibliotecas particulares y después algunas librerías. Luego del análisis, es claro que el tamaño de los libros fue el criterio predominante en el acomodo, seguidos de una laxa clasificación temática y, en algunos casos, el estado físico de los libros.

Babesiose cerebral em bovinos: 20 casos

Directory of Open Access Journals (Sweden)

Rodrigues Aline

2005-01-01

Full Text Available Num estudo retrospectivo de 1.071 necropsias de bovinos, foram encontrados 20 casos de babesiose cerebral confirmados pelo exame de esfregaços do córtex telencefálico. A maioria desses casos ocorreu no verão, em bovinos adultos de raças européias ou suas cruzas. Além dos sinais clínicos neurológicos, observou-se hemoglobinúria, anorexia, febre, taquicardia, taquipnéia e queda na produção de leite. O hemograma realizado em cinco bovinos afetados revelou acentuada anemia regenerativa; em média, 20% dos eritrócitos estavam parasitados por Babesia bovis. Na necropsia de todos os casos, a substância cinzenta dos córtices telencefálico e cerebelar e dos núcleos da base era consistente e caracteristicamente róseo-cereja. Essa coloração devia-se ao seqüestro de eritrócitos nos capilares encefálicos. Nesses eritrócitos, podiam-se observar, tanto em esfregaços do córtex como em preparações histológicas do encéfalo, microorganismos com morfologia compatível com B. bovis. Outros achados de necropsia incluíam hemoglobinúria, rins vermelho-escuros, hepatoesplenomegalia, fígado vermelho-alaranjado, icterícia, hemorragias epicárdicas e endocárdicas e edema e congestão dos linfonodos mesentéricos.

EL PRIMER APORTE DE LOS OBISPOS CHILENOS A LA CODIFICACIÓN DEL DERECHO CANÓNICO DE 1917: LOS POSTULATA EPISCOPORUM ACERCA DEL MATRIMONIO

Directory of Open Access Journals (Sweden)

Carlos Salinas Araneda

2008-12-01

Full Text Available La redacción del primer Código de Derecho Canónico que tuvo la Iglesia latina fue ordenado por el papa san Pío X, en 1904. La tarea codificadora, empero, no fue obra de un grupo cerrado de expertos, sino que tuvo en cuenta el parecer del episcopado, el que fue consultado en dos momentos diferentes; en ambos casos fueron requeridos los obispos chilenos. En este trabajo se estudia, a partir de la documentación guardada en el Archivo Secreto Vaticano, el aporte de los obispos chilenos en la primera consulta, realizada en 1904, en lo referido al matrimonio.The drafting of the first Código de Derecho Canónico of the Latin Church was established by Pope Pío X in 1904. The codifying task, however, was not the result of a closed group of experts. It considered the opinión of bishops around the world who were consulted in two different moments. In both cases, Chilean bishops were requested to provide their opinions. This work, which is based on documents from the Vatican Secret Archives, studies the contribution of Chilean bishops to the marriage discussion in the first round of consultation of 1904.

Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

Science.gov (United States)

Ballesteros Benavides, Maria Elvira

Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

Grúa para obras de gran altura

Directory of Open Access Journals (Sweden)

Hochtief, AG

1961-12-01

Full Text Available En las construcciones modernas donde las estructuras se extienden predominantemente en altura, caso corriente en los llamados rascacielos, entre los elementos auxiliares de obra se encuentra, en primer lugar, la grúa.

Aprender a dormir sin mam??: estudio de casos

OpenAIRE

??lvarez Lozano, Marta

2015-01-01

Dado el caso de un ni??o con un h??bito incorrecto de sue??o, con sus correspondientes consecuencias, se lleva a cabo un estudio de casos que pretende modificar este h??bito a trav??s de un programa de intervenci??n basado en la reeducaci??n del sue??o mediante la modificaci??n de conducta. Para proceder a modificarla se ha trabajado con un m??todo de desensibilizaci??n sistem??tica, que a su vez, se ayuda de un sistema de econom??a de fichas para causar motivaci??n en el sujeto, y adem??s, d...

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

Science.gov (United States)

Pitta, João; Branco, Teresa C; Portugal, Jaime

2018-05-01

Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

Directory of Open Access Journals (Sweden)

Ana Paula Morales Cobra Carvalho

2009-06-01

Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

Science.gov (United States)

Corman, Rena

This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)