39 CFR 268.1 - General principles.
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false General principles. 268.1 Section 268.1 Postal Service UNITED STATES POSTAL SERVICE ORGANIZATION AND ADMINISTRATION PRIVACY OF INFORMATION-EMPLOYEE RULES OF CONDUCT § 268.1 General principles. In order to conduct its business, the Postal Service has the...
12 CFR 268.101 - General policy for equal opportunity.
2010-01-01
... Discrimination in Employment Act (ADEA) (29 U.S.C. 621 et seq.), the Equal Pay Act (29 U.S.C. 206(d)), or the... 12 Banks and Banking 3 2010-01-01 2010-01-01 false General policy for equal opportunity. 268.101... RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal Opportunity § 268.101...
DEFF Research Database (Denmark)
Strange, Mette; Bräuner-Osborne, Hans; Jensen, Anders A.
2006-01-01
We have constructed stable HEK293 cell lines expressing the rat ionotropic glutamate receptor subtypes GluR1(i), GluR2Q(i), GluR3(i), GluR4(i), GluR5Q and GluR6Q and characterised the pharmacological profiles of the six homomeric receptors in a fluorescence-based high throughput screening assay...... assay reported to date. We propose that high throughput screening of compound libraries at the six GluR-HEK293 cell lines could be helpful in the search for structurally and pharmacologically novel ligands acting at the receptors....
12 CFR 268.105 - Individual complaints.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Individual complaints. 268.105 Section 268.105... RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal Opportunity § 268.105 Individual... individual and the Board and to describe generally the action(s) or practice(s) that form the basis of the...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH268 (Link to dictyBase) - - - - SLH268Z (Link to Original site) - - SLH2...68Z 640 - - - - Show SLH268 Library SL (Link to library) Clone ID SLH268 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...68Q.Seq.d/ Representative seq. ID SLH268Z (Link to Original site) R...epresentative DNA sequence >SLH268 (SLH268Q) /CSM/SL/SLH2-C/SLH268Q.Seq.d/ XXXXXXXXXXCTGGTGGTTATATTTCTCGTACT
12 CFR 268.601 - EEO group statistics.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false EEO group statistics. 268.601 Section 268.601... RULES REGARDING EQUAL OPPORTUNITY Matters of General Applicability § 268.601 EEO group statistics. (a... solely statistical purpose for which the data is being collected, the need for accuracy, the Board's...
International Nuclear Information System (INIS)
Minasov, George; Wang, Xiaojun; Shoichet, Brian K.
2002-01-01
Although TEM-1 β-lactamase is among the best studied enzymes, its acylation mechanism remains controversial. To investigate this problem, the structure of TEM-1 in complex with an acylation transition-state analogue was determined at ultrahigh resolution (0.85 (angstrom)) by X-ray crystallography. The quality of the data was such as to allow for refinement to an R-factor of 9.1% and an R free of 11.2%. In the resulting structure, the electron density features were clear enough to differentiate between single and double bonds in carboxylate groups, to identify multiple conformations that are occupied by residues and loops, and to assign 70% of the protons in the protein. Unexpectedly, even at pH 8.0 where the protein was crystallized, the active site residue Glu166 is clearly protonated. This supports the hypothesis that Glu166 is the general base in the acylation half of the reaction cycle. This structure suggests that Glu166 acts through the catalytic water to activate Ser70 for nucleophilic attack on the β-lactam ring of the substrate. The hydrolytic mechanism of class A β-lactamases, such as TEM-1, appears to be symmetrical, as are the serine proteases. Apart from its mechanistic implications, this atomic resolution structure affords an unusually detailed view of the structure, dynamics, and hydrogen-bonding networks of TEM-1, which may be useful for the design of inhibitors against this key antibiotic resistance target.
Ionotropic glutamate receptors (iGluRs of the delta family (GluD1 and GluD2 and synaptogenesis
Directory of Open Access Journals (Sweden)
Muhammad Zahid Khan
2017-08-01
Full Text Available Glutamate delta-1 (GluD1 and glutamate delta-2 (GluD2 form the delta family of ionotropic glutamate receptors (iGluRs and are distinct from other (iGluRs in that they do not exhibit typical agonist-induced ion channel currents. Recent studies have demonstrated a crucial role of the delta receptors in synapse formation by interacting with presynaptic proteins such as Neurexin1. This review presents current knowledge regarding the expression, structure and function of Glu delta receptors (GluD1, GluD2 in brain, focusing on synapse formation, function and dysfunction.
DEFF Research Database (Denmark)
Mølck, Christina; Harpsøe, Kasper; Gloriam, David E
2014-01-01
Since its discovery in 1992, mGluR5 has attracted significant attention and been linked to several neurological and psychiatric diseases. Ligand development was initially focused on the orthosteric binding pocket, but lack of subtype selective ligands changed the focus to the transmembrane...... allosteric binding pocket. This strategy has resulted in several drug candidates in clinical testing. In the present article we explore the orthosteric and allosteric binding pockets in terms of structure and ligand recognition across the mGluR subtypes and groups, and discuss the clinical potential...... of ligands targeting these pockets. We have performed binding mode analyses of non- and group-selective orthosteric ligands based on molecular docking in mGluR crystal structures and models. For the analysis of the allosteric binding pocket we have combined data from all mGluR5-mutagenesis studies...
Ionotropic glutamate receptors (iGluRs) of the delta family (GluD1 ...
African Journals Online (AJOL)
... such as Neurexin1. This review presents current knowledge regarding the expression, structure and function of Glu delta receptors (GluD1, GluD2) in brain, focusing on synapse formation, function and dysfunction. Keywords: iGluRs; GluD1; GluD2; Synaptogenesis; Autism spectrum disorder (ASD); Schizophrenia (SCZ) ...
Directory of Open Access Journals (Sweden)
Tetsuya Haruyama
2012-01-01
Full Text Available Cell-based biosensing is a “smart” way to obtain efficacy-information on the effect of applied chemical on cellular biological cascade. We have proposed an engineered post-synapse model cell-based biosensors to investigate the effects of chemicals on ionotropic glutamate receptor (GluR, which is a focus of attention as a molecular target for clinical neural drug discovery. The engineered model cell has several advantages over native cells, including improved ease of handling and better reproducibility in the application of cell-based biosensors. However, in general, cell-based biosensors often have low signal-to-noise (S/N ratios due to the low level of cellular responses. In order to obtain a higher S/N ratio in model cells, we have attempted to design a tactic model cell with elevated cellular response. We have revealed that the increase GluR expression level is not directly connected to the amplification of cellular responses because the saturation of surface expression of GluR, leading to a limit on the total ion influx. Furthermore, coexpression of GluR with a voltage-gated potassium channel increased Ca2+ ion influx beyond levels obtained with saturating amounts of GluR alone. The construction of model cells based on strategy of amplifying ion flux per individual receptors can be used to perform smart cell-based biosensing with an improved S/N ratio.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Employment. 268.705 Section 268.705 Banks and... Physical or Mental Disability § 268.705 Employment. No qualified individual with a disability shall, on the basis of a disability, be subjected to discrimination in employment under any program or activity...
Russell C. Moody; Jen Y. Liu
1999-01-01
Glued structural members are manufactured in a variety of configurations. Structural composite lumber (SCL) products consist of small pieces of wood glued together into sizes common for solid-sawn lumber. Glued-laminated timber (glulam) is an engineered stress-rated product that consists of two or more layers of lumber in which the grain of all layers is oriented...
Huckleberry, Kylie A.; Kane, Gary A.; Mathis, Rita J.; Cook, Sarah G.; Clutton, Jonathan E.; Drew, Michael R.
2015-01-01
Thousands of neurons are born each day in the dentate gyrus (DG), but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in the DG. The immediate-early gene (IEG) zif268 appears to be an important mediator of these effects, as its expression can be induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Richardson et al., 1992; Veyrac et al., 2013). Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs). We first quantified zif268 expression in doublecortin-positive (DCX+) immature neurons and in the general granule cell population after brief exposure to a novel environment (NE). In the general granule cell population, zif268 expression peaked 1 h after NE exposure and returned to baseline by 8 h post-exposure. However, in the DCX+ cells, zif268 expression was suppressed relative to home cage for at least 8 h post-exposure. We next asked whether suppression of zif268 in DCX+ immature cells occurs in other behavioral paradigms that recruit the hippocampus. Exposure to Morris water maze (MWM) training, an enriched environment, or a NE caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 expression among the general granule cell population. The same behavioral procedures activated zif268 expression in 6-week-old BrdU-labeled adult-born neurons, indicating that zif268 suppression is specific to immature neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. NE exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly
40 CFR 268.4 - Treatment surface impoundment exemption.
2010-07-01
... residues may not be placed in any other surface impoundment for subsequent management. (iv) Recordkeeping... exemption. 268.4 Section 268.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID...), the residues from treatment are analyzed, as specified in § 268.7 or § 268.32, to determine if they...
12 CFR 268.202 - Equal Pay Act.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Equal Pay Act. 268.202 Section 268.202 Banks... REGARDING EQUAL OPPORTUNITY Provisions Applicable to Particular Complaints § 268.202 Equal Pay Act. Complaints alleging violations of the Equal Pay Act shall be processed under this part. ...
Yim, Yeong Shin; Lee, Jinu; Kim, Gun-Tae; Song, Teresa; Kim, Chul Hoon; Kim, Dong Goo
2012-06-21
An individual's behavior is generally based on genetic blueprint and previous experiences. A coping strategy, affected by personal interpretation of past events, can be determined by behavioral controllability of stress. In this study, we examined the relationship between the hippocampal mGluR5 expression and coping strategies to stress. Rats were exposed to stress via inescapable and unpredictable footshocks on PNDs 14 and 90. Coping strategies to stress were also measured. Hippocampal mGluR5 was found to be linked to the behavioral coping strategy, as it increased in rats that showed helplessness behavior (HL (+) group) and decreased in those that did not (HL (-) group). Also, the HL (+) group showed a lack of adaptation in a novel environment but the HL (-) group did not. The results suggest that mGluR5 has a pivotal role in the controllability-based coping strategy. Hippocampal mGluR5 could be a target molecule in the manipulation of neuropsychiatric conditions for which maladaptation is a part of behavioral consequences. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Musante, Veronica; Neri, Elisa; Feligioni, Marco; Puliti, Aldamaria; Pedrazzi, Marco; Conti, Valerio; Usai, Cesare; Diaspro, Alberto; Ravazzolo, Roberto; Henley, Jeremy M; Battaglia, Giuseppe; Pittaluga, Anna
2008-09-01
The effects of mGlu1 and mGlu5 receptor activation on the depolarization-evoked release of [3H]d-aspartate ([3H]D-ASP) from mouse cortical synaptosomes were investigated. The mGlu1/5 receptor agonist 3,5-DHPG (0.1-100microM) potentiated the K+(12mM)-evoked [3H]D-ASP overflow. The potentiation occurred in a concentration-dependent manner showing a biphasic pattern. The agonist potentiated [3H]D-ASP exocytosis when applied at 0.3microM; the efficacy of 3,5-DHPG then rapidly declined and reappeared at 30-100microM. The fall of efficacy of agonist at intermediate concentration may be consistent with 3,5-DHPG-induced receptor desensitization. Facilitation of [3H]D-ASP exocytosis caused by 0.3microM 3,5-DHPG was prevented by the selective mGlu5 receptor antagonist MPEP, but was insensitive to the selective mGlu1 receptor antagonist CPCCOEt. In contrast, CPCCOEt prevented the potentiation by 50microM 3,5-DHPG, while MPEP had minimal effect. Unexpectedly, LY 367385 antagonized both the 3,5-DHPG-induced effects. A total of 0.3microM 3,5-DHPG failed to facilitate the K+-evoked [3H]D-ASP overflow from mGlu5 receptor knockout (mGlu5-/-) cortical synaptosomes, but not from nerve terminals prepared from the cortex of animals lacking the mGlu1 receptors, the crv4/crv4 mice. On the contrary, 50microM 3,5-DHPG failed to affect the [3H]D-ASP exocytosis from cortical synaptosomes obtained from crv4/crv4 and mGlu5-/-mice. Western blot analyses in subsynaptic fractions support the existence of both mGlu1 and mGlu5 autoreceptors located presynaptically, while immunocytochemistry revealed their presence at glutamatergic terminals. We propose that mGlu1 and mGlu5 autoreceptors exist on mouse glutamatergic cortical terminals; mGlu5 receptors may represent the "high affinity" binding sites for 3,5-DHPG, while mGlu1 autoreceptors represent the "low affinity" binding sites.
Krystkowiak, Karolina; Langner, Monika; Adamski, Tadeusz; Salmanowicz, Bolesław P; Kaczmarek, Zygmunt; Krajewski, Paweł; Surma, Maria
2017-02-01
The quality of wheat depends on a large complex of genes and environmental factors. The objective of this study was to identify quantitative trait loci controlling technological quality traits and their stability across environments, and to assess the impact of interaction between alleles at loci Glu-1 and Glu-3 on grain quality. DH lines were evaluated in field experiments over a period of 4 years, and genotyped using simple sequence repeat markers. Lines were analysed for grain yield (GY), thousand grain weight (TGW), protein content (PC), starch content (SC), wet gluten content (WG), Zeleny sedimentation value (ZS), alveograph parameter W (APW), hectolitre weight (HW), and grain hardness (GH). A number of QTLs for these traits were identified in all chromosome groups. The Glu-D1 locus influenced TGW, PC, SC, WG, ZS, APW, GH, while locus Glu-B1 affected only PC, ZS, and WG. Most important marker-trait associations were found on chromosomes 1D and 5D. Significant effects of interaction between Glu-1 and Glu-3 loci on technological properties were recorded, and in all types of this interaction positive effects of Glu-D1 locus on grain quality were observed, whereas effects of Glu-B1 locus depended on alleles at Glu-3 loci. Effects of Glu-A3 and Glu-D3 loci per se were not significant, while their interaction with alleles present at other loci encoding HMW and LMW were important. These results indicate that selection of wheat genotypes with predicted good bread-making properties should be based on the allelic composition both in Glu-1 and Glu-3 loci, and confirm the predominant effect of Glu-D1d allele on technological properties of wheat grains.
12 CFR 268.302 - Mixed case complaints.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Mixed case complaints. 268.302 Section 268.302... RULES REGARDING EQUAL OPPORTUNITY Related Processes § 268.302 Mixed case complaints. A mixed case... discrimination or it may contain additional allegations that the MSPB has jurisdiction to address. A mixed case...
Directory of Open Access Journals (Sweden)
Kylie A. Huckleberry
2015-08-01
Full Text Available Thousands of neurons are born each day in the dentate gyrus (DG, but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in DG. The immediate-early gene (IEG zif268 is an important mediator of these effects, as its expression is induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Veyrac et al., 2013. Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs. In the general granule cell population, zif268 expression peaked 1 hour after novel environment exposure and returned to baseline by 8 hours post-exposure. However, in the doublecortin-positive (DCX+ immature neurons, zif268 expression was suppressed relative to home cage for at least 8 hours post-exposure. We next determined that exposure to water maze training, an enriched environment, or a novel environment caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 in the general DGC population and in 6-week-old adult-born neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. Novel environment exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly suppressed zif268 expression in 3-week-old neurons. In summary, behavioral experience transiently activated expression of zif268 in mature DGCs but caused a more long-lasting suppression of zif268 expression in immature, adult-born DGCs. We hypothesize that zif268 suppression inhibits memory-related synaptic plasticity in immature DGCs or mediates learning-induced apoptosis of immature adult
Qiao, Liansheng; Chen, Yankun; Zhao, Bowen; Gu, Yu; Huo, Xiaoqian; Zhang, Yanling; Li, Gongyu
2018-01-01
The metabotropic glutamate receptors (mGluRs) are known as both synaptic receptors and taste receptors. This feature is highly similar to the Property and Flavor theory of Traditional Chinese medicine (TCM), which has the pharmacological effect and flavor. In this study, six ligand based pharmacophore (LBP) models, seven homology modeling models, and fourteen molecular docking models of mGluRs were built based on orthosteric and allosteric sites to screening potential compounds from Traditional Chinese Medicine Database (TCMD). Based on the Pharmacopoeia of the People’s Republic of China, TCMs of compounds and their flavors were traced and listed. According to the tracing result, we found that the TCMs of the compounds which bound to orthosteric sites of mGluRs are highly correlated to a sweet flavor, while the allosteric site corresponds to a bitter flavor. Meanwhile, the pharmacological effects of TCMs with highly frequent flavors were further analyzed. We found that those TCMs play a neuroprotective role through the efficiencies of detumescence, promoting blood circulation, analgesic effect, and so on. This study provides a guide for developing new neuroprotective drugs from TCMs which target mGluRs. Moreover, it is the first study to present a novel approach to discuss the association relationship between flavor and the neuroprotective mechanism of TCM based on mGluRs. PMID:29320397
12 CFR 268.710 - Compliance procedures.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Compliance procedures. 268.710 Section 268.710 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM... Women's Program Manager, the Hispanic Employment Program Coordinator, or the People with Disabilities...
Ionotropic glutamate receptors (iGluRs) of the delta family (GluD1 ...
African Journals Online (AJOL)
Muhammad Zahid Khan
2016-10-20
Oct 20, 2016 ... GluD1 knockout mice (GluD1 KO) have normal learning in the Morris water maze .... could bind and activate the receptor.5,6 D-Ser and glycine have now been identified as .... English editing of this manuscript. References. 1.
Structure-based discovery of antagonists for GluN3-containing N-methyl-D-aspartate receptors
DEFF Research Database (Denmark)
Kvist, Trine; Greenwood, Jeremy R; Hansen, Kasper B
2013-01-01
. In the subsequent pharmacological evaluation of 99 selected compounds, we identified 6-hydroxy-[1,2,5]oxadiazolo[3,4-b]pyrazin-5(4H)-one (TK80) a novel competitive antagonist with preference for the GluN3B subunit. Serendipitously, we also identified [2-hydroxy-5-((4-(pyridin-3-yl)thiazol-2-yl)amino]benzoic acid...... (TK13) and 4-(2,4-dichlorobenzoyl)-1H-pyrrole-2-carboxylic acid (TK30), two novel non-competitive GluN3 antagonists. These findings demonstrate that structural differences between the orthosteric binding site of GluN3 and GluN1 can be exploited to generate selective ligands....
Yamasaki, Tomoteru; Fujinaga, Masayuki; Kawamura, Kazunori; Furutsuka, Kenji; Nengaki, Nobuki; Shimoda, Yoko; Shiomi, Satoshi; Takei, Makoto; Hashimoto, Hiroki; Yui, Joji; Wakizaka, Hidekatsu; Hatori, Akiko; Xie, Lin; Kumata, Katsushi; Zhang, Ming-Rong
2016-01-13
Parkinson's disease (PD) is a prevalent degenerative disorder affecting the CNS that is primarily characterized by resting tremor and movement deficits. Group I metabotropic glutamate receptor subtypes 1 and 5 (mGluR1 and mGluR5, respectively) are important targets for investigation in several CNS disorders. In the present study, we investigated the in vivo roles of mGluR1 and mGluR5 in chronic PD pathology by performing longitudinal positron emission tomography (PET) imaging in A53T transgenic (A53T-Tg) rats expressing an abnormal human α-synuclein (ASN) gene. A53T-Tg rats showed a dramatic decline in general motor activities with age, along with abnormal ASN aggregation and striatal neuron degeneration. In longitudinal PET imaging, striatal nondisplaceable binding potential (BPND) values for [(11)C]ITDM (N-[4-[6-(isopropylamino) pyrimidin-4-yl]-1,3-thiazol-2-yl]-N-methyl-4-[(11)C]methylbenzamide), a selective PET ligand for mGluR1, temporarily increased before PD symptom onset and dramatically decreased afterward with age. However, striatal BPND values for (E)-[(11)C]ABP688 [3-(6-methylpyridin-2-ylethynyl)-cyclohex-2-enone-(E)-O-[(11)C]methyloxime], a specific PET ligand for mGluR5, remained constant during experimental terms. The dynamic changes in striatal mGluR1 BPND values also showed a high correlation in pathological decreases in general motor activities. Furthermore, declines in mGluR1 BPND values were correlated with decreases in BPND values for [(18)F]FE-PE2I [(E)-N-(3-iodoprop-2E-enyl)-2β-carbo-[(18)F]fluoroethoxy-3β-(4-methylphenyl) nortropane], a specific PET ligand for the dopamine transporter, a biomarker for dopaminergic neurons. In conclusion, our results have demonstrated for the first time that dynamic changes occur in mGluR1, but not mGluR5, that accompany pathological progression in a PD animal model. Synaptic signaling by glutamate, the principal excitatory neurotransmitter in the brain, is modulated by group I metabotropic glutamate
12 CFR 268.203 - Rehabilitation Act.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Rehabilitation Act. 268.203 Section 268.203... Rehabilitation Act. (a) Model employer. The Board shall be a model employer of individuals with disabilities. The... Rehabilitation Act of 1973, as amended (29 U.S.C. 791), has been violated in a complaint alleging nonaffirmative...
DEFF Research Database (Denmark)
Venskutonyte, Raminta; Butini, Stefania; Coccone, Salvatore Sanna
2011-01-01
The physiological function of kainate receptors (GluK1- GluK5) in the central nervous system is not fully understood yet. With the aim of developing potent and selective GluK1 ligands, we have synthesized a series of new thiophene-based GluK1 agonists (6a-c) and antagonists (7a-d). Pharmacologica...
Energy Technology Data Exchange (ETDEWEB)
Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea; Hansen, Kasper B. (JHU); (Milan); (Montana)
2017-07-31
NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.
The role of GluN2B-containing NMDA receptors in short- and long-term fear recall.
Mikics, Eva; Toth, Mate; Biro, Laszlo; Bruzsik, Biborka; Nagy, Boglarka; Haller, Jozsef
2017-08-01
N-methyl-d-aspartate (NMDA) receptors are crucial synaptic elements in long-term memory formation, including the associative learning of fearful events. Although NMDA blockers were consistently shown to inhibit fear memory acquisition and recall, the clinical use of general NMDA blockers is hampered by their side effects. Recent studies revealed significant heterogeneity in the distribution and neurophysiological characteristics of NMDA receptors with different GluN2 (NR2) subunit composition, which may have differential role in fear learning and recall. To investigate the specific role of NMDA receptor subpopulations with different GluN2 subunit compositions in the formation of lasting traumatic memories, we contrasted the effects of general NMDA receptor blockade with GluN2A-, GluN2B-, and GluN2C/D subunit selective antagonists (MK-801, PEAQX, Ro25-6981, PPDA, respectively). To investigate acute and lasting consequences, behavioral responses were investigated 1 and 28days after fear conditioning. We found that MK-801 (0.05 and 0.1mg/kg) decreased fear recall at both time points. GluN2B receptor subunit blockade produced highly similar effects, albeit efficacy was somewhat smaller 28days after fear conditioning. Unlike MK-801, Ro25-6981 (3 and 10mg/kg) did not affect locomotor activity in the open-field. In contrast, GluN2A and GluN2C/D blockers (6 and 20mg/kg PEAQX; 3 and 10mg/kg PPDA, respectively) had no effect on conditioned fear recall at any time point and dose. This sharp contrast between GluN2B- and other subunit-containing NMDA receptor function indicates that GluN2B receptor subunits are intimately involved in fear memory formation, and may provide a novel pharmacological target in post-traumatic stress disorder or other fear-related disorders. Copyright © 2017 Elsevier Inc. All rights reserved.
Langner, Monika; Krystkowiak, Karolina; Salmanowicz, Bolesław P; Adamski, Tadeusz; Krajewski, Paweł; Kaczmarek, Zygmunt; Surma, Maria
2017-12-01
The major determinants of wheat quality are Glu-1 and Glu-3 glutenin loci and environmental factors. Additive effects of alleles at the Glu-1 and Glu-3 loci, as well as their interactions, were evaluated for dough rheology and baking properties in four groups of wheat doubled haploid lines differing in high- and low-molecular-weight glutenin composition. Flour quality, Reomixer (Reologica Instruments, Lund, Sweden), dough extension, Farinograph (Brabender GmbH, Duisburg, Germany) and baking parameters were determined. Groups of lines with the alleles Glu-A3b and Glu-B3d were characterized by higher values of dough and baking parameters compared to those with the Glu-A3e and Glu-B3a alleles. Effects of interactions between allelic variants at the Glu-1 and Glu-3 loci on Reomixer parameters, dough extension tests and baking parameters were significant, although additive effects of individual alleles were not always significant. The allelic variants at Glu-B3 had a much greater effect on dough rheological parameters than the variants at Glu-A3 or Glu-D3 loci. The effect of allelic variations at the Glu-D3 loci on rheological parameters and bread-making quality was non-significant, whereas their interactions with a majority of alleles at the other Glu-1 × Glu-3 loci were significant. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Yang, Juan; Sun-Waterhouse, Dongxiao; Xie, Jin; Wang, Lan; Chen, Hong-Zhang; Cui, Chun; Zhao, Mouming
2018-05-01
A series of γ-[Glu] (n=2,3,4) -Val or γ-[Glu] (n=2,3,4) -Met were synthesized in the presence of donor (Gln) and corresponding acceptor (Val or Met) through transpeptidation catalyzed by the glutaminase from Bacillus amyloliquefaciens. Gln in excess significantly (p n>1) -Val/Met except for γ-Glu-Val/Met. The K m values for transpeptidase activity to yield γ-[Glu] (n=0,1,2,3) -Val increased with an elevated n, but remained essentially the same irrespective of n value for γ-[Glu] (n=0,1,2) -Met (which were 31-44% of that for γ-[Glu] 3 -Met). The highest K m value appearing when n = 3 (γ-[Glu] 3 -Val or γ-[Glu] 3 -Met) suggested the rising difficulty for synthesis when the number of donor increases. All the γ-[Glu] n -Val/Met substances exhibited kokumi properties and enhanced the continuity and umami taste of soy sauce as well as the thickness, mouthfulness and umaminess of model chicken broth. These results indicate the potential of the γ-[Glu] n -Val and γ-[Glu] n -Met as food flavor enhancers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kyungjoon Park
Full Text Available Fear renewal, the context-specific relapse of fear following fear extinction, is a leading animal model of post-traumatic stress disorders (PTSD and fear-related disorders. Although fear extinction can diminish fear responses, this effect is restricted to the context where the extinction is carried out, and the extinguished fear strongly relapses when assessed in the original acquisition context (ABA renewal or in a context distinct from the conditioning and extinction contexts (ABC renewal. We have previously identified Ser831 phosphorylation of GluA1 subunit in the lateral amygdala (LA as a key molecular mechanism for ABC renewal. However, molecular mechanisms underlying ABA renewal remain to be elucidated. Here, we found that both the excitatory synaptic efficacy and GluA2-lacking AMPAR activity at thalamic input synapses onto the LA (T-LA synapses were enhanced upon ABA renewal. GluA2-lacking AMPAR activity was also increased during low-threshold potentiation, a potential cellular substrate of renewal, at T-LA synapses. The microinjection of 1-naphtylacetyl-spermine (NASPM, a selective blocker of GluA2-lacking AMPARs, into the LA attenuated ABA renewal, suggesting a critical role of GluA2-lacking AMPARs in ABA renewal. We also found that Ser831 phosphorylation of GluA1 in the LA was increased upon ABA renewal. We developed a short peptide mimicking the Ser831-containing C-tail region of GluA1, which can be phosphorylated upon renewal (GluA1S; thus, the phosphorylated GluA1S may compete with Ser831-phosphorylated GluA1. This GluA1S peptide blocked the low-threshold potentiation when dialyzed into a recorded neuron. The microinjection of a cell-permeable form of GluA1S peptide into the LA attenuated ABA renewal. In support of the GluA1S experiments, a GluA1D peptide (in which the serine at 831 is replaced with a phosphomimetic amino acid, aspartate attenuated ABA renewal when microinjected into the LA. These findings suggest that enhancements
Park, Kyungjoon; Song, Beomjong; Kim, Jeongyeon; Hong, Ingie; Song, Sangho; Lee, Junuk; Park, Sungmo; Kim, Jihye; An, Bobae; Lee, Hyun Woo; Lee, Seungbok; Kim, Hyun; Lee, Justin C; Lee, Sukwon; Choi, Sukwoo
2014-01-01
Fear renewal, the context-specific relapse of fear following fear extinction, is a leading animal model of post-traumatic stress disorders (PTSD) and fear-related disorders. Although fear extinction can diminish fear responses, this effect is restricted to the context where the extinction is carried out, and the extinguished fear strongly relapses when assessed in the original acquisition context (ABA renewal) or in a context distinct from the conditioning and extinction contexts (ABC renewal). We have previously identified Ser831 phosphorylation of GluA1 subunit in the lateral amygdala (LA) as a key molecular mechanism for ABC renewal. However, molecular mechanisms underlying ABA renewal remain to be elucidated. Here, we found that both the excitatory synaptic efficacy and GluA2-lacking AMPAR activity at thalamic input synapses onto the LA (T-LA synapses) were enhanced upon ABA renewal. GluA2-lacking AMPAR activity was also increased during low-threshold potentiation, a potential cellular substrate of renewal, at T-LA synapses. The microinjection of 1-naphtylacetyl-spermine (NASPM), a selective blocker of GluA2-lacking AMPARs, into the LA attenuated ABA renewal, suggesting a critical role of GluA2-lacking AMPARs in ABA renewal. We also found that Ser831 phosphorylation of GluA1 in the LA was increased upon ABA renewal. We developed a short peptide mimicking the Ser831-containing C-tail region of GluA1, which can be phosphorylated upon renewal (GluA1S); thus, the phosphorylated GluA1S may compete with Ser831-phosphorylated GluA1. This GluA1S peptide blocked the low-threshold potentiation when dialyzed into a recorded neuron. The microinjection of a cell-permeable form of GluA1S peptide into the LA attenuated ABA renewal. In support of the GluA1S experiments, a GluA1D peptide (in which the serine at 831 is replaced with a phosphomimetic amino acid, aspartate) attenuated ABA renewal when microinjected into the LA. These findings suggest that enhancements in both the
Migues, Paola Virginia; Liu, Lidong; Archbold, Georgina E B; Einarsson, Einar Ö; Wong, Jacinda; Bonasia, Kyra; Ko, Seung Hyun; Wang, Yu Tian; Hardt, Oliver
2016-03-23
The neurobiological processes underpinning the natural forgetting of long-term memories are poorly understood. Based on the critical role of GluA2-containing AMPA receptors (GluA2/AMPARs) in long-term memory persistence, we tested in rats whether their synaptic removal underpins time-dependent memory loss. We found that blocking GluA2/AMPAR removal with the interference peptides GluA23Y or G2CT in the dorsal hippocampus during a memory retention interval prevented the normal forgetting of established, long-term object location memories, but did not affect their acquisition. The same intervention also preserved associative memories of food-reward conditioned place preference that would otherwise be lost over time. We then explored whether this forgetting process could play a part in behavioral phenomena involving time-dependent memory change. We found that infusing GluA23Y into the dorsal hippocampus during a 2 week retention interval blocked generalization of contextual fear expression, whereas infusing it into the infralimbic cortex after extinction of auditory fear prevented spontaneous recovery of the conditioned response. Exploring possible physiological mechanisms that could be involved in this form of memory decay, we found that bath application of GluA23Y prevented depotentiation, but not induction of long-term potentiation, in a hippocampal slice preparation. Together, these findings suggest that a decay-like forgetting process that involves the synaptic removal of GluA2/AMPARs erases consolidated long-term memories in the hippocampus and other brain structures over time. This well regulated forgetting process may critically contribute to establishing adaptive behavior, whereas its dysregulation could promote the decline of memory and cognition in neuropathological disorders. The neurobiological mechanisms involved in the natural forgetting of long-term memory and its possible functions are not fully understood. Based on our previous work describing the
International Nuclear Information System (INIS)
Choi, Jae-Sik; Lee, Jea-Young; Jeon, Chang-Jin
2009-01-01
We investigated the distributions of AMPA glutamate receptor subtypes GluR1 and GluR4 in the hamster superior colliculus (SC) with antibody immunocytochemistry and the effect of enucleation on these distributions. We compared these labelings to those of GluR2/3 in our previous report (Park et al., 2004, Neurosci Res., 49:139–155) and calcium-binding proteins calbindin D28K, calretinin, parvalbumin, and GABA. Anti-GluR1-immunoreactive (IR) cells were scattered throughout the SC. By contrast, anti-GluR4-IR cells formed distinct clusters within the lower lateral stratum griseum intermediale (SGI) and lateral stratum album intermediale (SAI). The GluR1- and GluR4-IR neurons varied in size and morphology. The average diameter of the GluR1-IR cells was 13.00 µm, while the GluR4-IR cells was 20.00 µm. The large majority of IR neurons were round or oval cells, but they also included stellate, vertical fusiform and horizontal cells. Monocular enucleation appeared to have no effect on the GluR1 and GluR4 immunoreactivity. Some GluR1-IR cells expressed calbindin D28K (9.50%), calretinin (6.59%), parvalbumin (2.53%), and GABA (20.54%). By contrast, no GluR4-IR cells expressed calcium-binding proteins or GABA. Although the function of the AMPA receptor subunits in SC is not yet clear, the distinct segregation of the GluR subunits, its differential colocalization with calcium-binding proteins and GABA, and differential responses to enucleation suggest the functional diversity of the receptor subunits in visuo-motor integration in the SC
40 CFR 268.9 - Special rules regarding wastes that exhibit a characteristic.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Special rules regarding wastes that... (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS General § 268.9 Special rules regarding wastes that exhibit a characteristic. (a) The initial generator of a solid waste must determine each EPA...
PICK1 uncoupling from mGluR7a causes absence-like seizures
Bertaso, Federica; Zhang, Chuansheng; Scheschonka, Astrid; de Bock, Frédéric; Fontanaud, Pierre; Marin, Philippe; Huganir, Richard L; Betz, Heinrich; Bockaert, Joël; Fagni, Laurent; Lerner-Natoli, Mireille
2008-01-01
Absence epilepsy is a neurological disorder that causes a recurrent loss of consciousness and generalized spike-and-wave discharges on an electroencephalogram (EEG). The role of metabotropic glutamate receptors (mGluRs) and associated scaffolding proteins in absence epilepsy has been unclear to date. We investigated a possible role for these proteins in absence epilepsy, focusing on the mGluR7a receptor and its PDZ-interacting protein, protein interacting with C kinase 1 (PICK1), in rats and ...
Pharmacological properties of homomeric and heteromeric GluR1o and GluR3o receptors
DEFF Research Database (Denmark)
Nielsen, B S; Banke, T G; Schousboe, A
1998-01-01
Homomeric and heteromeric alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor subunits GluR1o and GluR3o were expressed in Spodoptera frugiperda (Sf9) insect cells. Membranes containing the recombinant receptors showed a doublet of bands of the expected size (99-109 kDa) after...
Neuroprotective activity of selective mGlu1 and mGlu5 antagonists in vitro and in vivo.
Szydlowska, Kinga; Kaminska, Bozena; Baude, Andrea; Parsons, Chris G; Danysz, Wojciech
2007-01-05
The neuroprotective potential of allosteric mGlu5 and mGlu1 antagonists such as 6-methyl-2-(phenylethynyl)-pyridin (MPEP)/[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) and (3-ethyl-2-methyl-quinolin-6-yl)-(4-methoxy-cyclohexyl)-methanone methanesulfonate (EMQMCM), was tested in vitro in organotypic hippocampal cultures and in the middle cerebral artery occlusion model of stroke in vivo. Both classes of agent have high selectivity toward mGlu sub-types and are active in animal models of various diseases indicating satisfactory CNS penetration. In organotypic hippocampal cultures MPEP showed high neuroprotective potency against sub-chronic (12 days) insult produced by 3-NP with an IC50 of c.a. 70 nM. In contrast, although the mGlu1 antagonist EMQMCM was also protective, it seems to be weaker yielding an IC50 of c.a. 1 microM. Similarly, in the transient (90 min) middle cerebral artery occlusion model of ischaemia in rats, MTEP seems to be more effective than EMQMCM. MTEP, at 2.5 mg/kg and at 5 mg/kg provided 50 and 70% neuroprotection if injected 2 h after the onset of ischaemia. At a dose of 5 mg/kg, significant (50%) neuroprotection was also seen if the treatment was delayed by 4 h. EMQMCM was not protective at 5 mg/kg (given 2 h after occlusion) but at 10 mg/kg 50% of neuroprotection was observed. The present data support stronger neuroprotective potential of mGlu5 than mGlu1 antagonists.
Pyrimidine and nucleoside gamma-esters of L-Glu-Sar
DEFF Research Database (Denmark)
Eriksson, André H; Elm, Peter L; Begtrup, Mikael
2005-01-01
-tetrahydrofuran-3-yl ester)-Sar (I), l-Glu(thymine-1-yl-methyl ester)-Sar (II) and l-Glu(acyclothymidine)-Sar (III) were synthesised and in vitro stability was studied in various aqueous and biological media. Affinity to and translocation via hPEPT1 was investigated in mature Caco-2 cell monolayers, grown......The aim of the present study was to improve the synthetic pathway of bioreversible dipeptide derivatives as well as evaluate the potential of using l-Glu-Sar as a pro-moiety for delivering three newly synthesised nucleoside and pyrimidine l-Glu-Sar derivatives. l-Glu(trans-2-thymine-1-yl...
40 CFR 268.49 - Alternative LDR treatment standards for contaminated soil.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Alternative LDR treatment standards for contaminated soil. 268.49 Section 268.49 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Treatment Standards § 268.49 Alternative LDR treatment standards for contaminated...
SKLUST device for high-precision gluing of MWPC
International Nuclear Information System (INIS)
Amaglobeli, N.S.; Burov, R.V.; Sakandelidze, R.M.; Sakhelashvili, T.M.; Chiladze, B.G.; Glonti, G.L.; Glonti, L.N.
2005-01-01
The SKLUST device has been created for gluing precision plane-parallel anode, cathode of spacer bars and integral anode and cathode frames of the MWPCs or flat surfaces of the large-area cathode planes for them in the case that thin copper clad stesalit or glass-cloth-base laminate is used as the cathode, for example, for the CSC chambers. In contrast to usual gluing, in this device the glued components are not pressed to each other. SKLUST allows making high-precision products in laboratory conditions without preliminarily machining its components and receiving a precision article practically for any area at the plane parallelism from ±0.030 up to ±0.006 mm using a non-calibrated sheet of the foiled (or unfoiled) stesalit, glass-cloth-base laminate or other flexible materials to a tolerance for the thickness ±0.2-0.5 mm or worse. On the biggest of the existing devices it is possible to fabricate an article with the maximal sizes 2400x250 mm 2 at the thickness accuracy (6±0.015) mm (maximum deviation). Whereas in the technological cycle machining of blanks to the thickness or application of exact blanks is completely excluded, the manufacturing process becomes simpler, and the price of the articles essentially reduces, especially for mass production
Directory of Open Access Journals (Sweden)
Makiko Miyamoto
Full Text Available To evaluate the involvement of trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR GluR2 and GluR3 subunits in an acute inflammatory orofacial pain, we analyzed nocifensive behavior, phosphorylated extracellular signal-regulated kinase (pERK and Fos expression in Vi/Vc, Vc and C1/C2 in GluR2 delta7 knock-in (KI, GluR3 delta7 KI mice and wild-type mice. We also studied Vc neuronal activity to address the hypothesis that trafficking of GluR2 and GluR3 subunits plays an important role in Vi/Vc, Vc and C1/C2 neuronal activity associated with orofacial inflammation in these mice. Late nocifensive behavior was significantly depressed in GluR2 delta7 KI and GluR3 delta7 KI mice. In addition, the number of pERK-immunoreactive (IR cells was significantly decreased bilaterally in the Vi/Vc, Vc and C1/C2 in GluR2 delta7 KI and GluR3 delta7 KI mice compared to wild-type mice at 40 min after formalin injection, and was also significantly smaller in GluR3 delta7 KI compared to GluR2 delta7 KI mice. The number of Fos protein-IR cells in the ipsilateral Vi/Vc, Vc and C1/C2 was also significantly smaller in GluR2 delta7 KI and GluR3 delta7 KI mice compared to wild-type mice 40 min after formalin injection. Nociceptive neurons functionally identified as wide dynamic range neurons in the Vc, where pERK- and Fos protein-IR cell expression was prominent, showed significantly lower spontaneous activity in GluR2 delta7 KI and GluR3 delta7 KI mice than wild-type mice following formalin injection. These findings suggest that GluR2 and GluR3 trafficking is involved in the enhancement of Vi/Vc, Vc and C1/C2 nociceptive neuronal excitabilities at 16-60 min following formalin injection, resulting in orofacial inflammatory pain.
Energy Technology Data Exchange (ETDEWEB)
Jensen, Matthew R.; Goblirsch, Brandon R.; Christenson, James K.; Esler, Morgan A.; Mohamed, Fatuma A.; Wackett, Lawrence P.; Wilmot, Carrie M. (UMM)
2017-10-12
In the interest of decreasing dependence on fossil fuels, microbial hydrocarbon biosynthesis pathways are being studied for renewable, tailored production of specialty chemicals and biofuels. One candidate is long-chain olefin biosynthesis, a widespread bacterial pathway that produces waxy hydrocarbons. Found in three- and four-gene clusters, oleABCD encodes the enzymes necessary to produce cis-olefins that differ by alkyl chain length, degree of unsaturation, and alkyl chain branching. The first enzyme in the pathway, OleA, catalyzes the Claisen condensation of two fatty acyl-coenzyme A (CoA) molecules to form a β-keto acid. In this report, the mechanistic role of Xanthomonas campestris OleA Glu117 is investigated through mutant enzymes. Crystal structures were determined for each mutant as well as their complex with the inhibitor cerulenin. Complemented by substrate modeling, these structures suggest that Glu117 aids in substrate positioning for productive carbon–carbon bond formation. Analysis of acyl-CoA substrate hydrolysis shows diminished activity in all mutants. When the active site lacks an acidic residue in the 117 position, OleA cannot form condensed product, demonstrating that Glu117 has a critical role upstream of the essential condensation reaction. Profiling of pH dependence shows that the apparent pKa for Glu117 is affected by mutagenesis. Taken together, we propose that Glu117 is the general base needed to prime condensation via deprotonation of the second, non-covalently bound substrate during turnover. This is the first example of a member of the thiolase superfamily of condensing enzymes to contain an active site base originating from the second monomer of the dimer.
Tyrosine dephosphorylation regulates AMPAR internalisation in mGluR-LTD.
Gladding, Clare M; Collett, Valerie J; Jia, Zhengping; Bashir, Zafar I; Collingridge, Graham L; Molnár, Elek
2009-02-01
Long-term depression (LTD) can be induced at hippocampal CA1 synapses by activation of either NMDA receptors (NMDARs) or group I metabotropic glutamate receptors (mGluRs), using their selective agonists NMDA and (RS)-3,5-dihydroxyphenylglycine (DHPG), respectively. Recent studies revealed that DHPG-LTD is dependent on activation of postsynaptic protein tyrosine phosphatases (PTPs), which transiently dephosphorylate tyrosine residues in AMPA receptors (AMPARs). Here we show that while both endogenous GluR2 and GluR3 AMPAR subunits are tyrosine phosphorylated at basal activity, only GluR2 is dephosphorylated in DHPG-LTD. The tyrosine dephosphorylation of GluR2 does not occur in NMDA-LTD. Conversely, while NMDA-LTD is associated with the dephosphorylation of GluR1-serine-845, DHPG-LTD does not alter the phosphorylation of this site. The increased AMPAR endocytosis in DHPG-LTD is PTP-dependent and involves tyrosine dephosphorylation of cell surface AMPARs. Together, these results indicate that the subunit selective tyrosine dephosphorylation of surface GluR2 regulates AMPAR internalisation in DHPG-LTD but not in NMDA-LTD in the hippocampus.
2010-10-01
... TRANSPORTATION MAGNETIC LEVITATION TRANSPORTATION TECHNOLOGY DEPLOYMENT PROGRAM Overview § 268.1 Definitions. As used in this part— CMAQ means Congestion Mitigation and Air Quality Improvement Program (23 U.S.C. 149... Stat. 1978). Under that usage any corridor exhibiting Partnership Potential must at least meet the...
Inhibition of spontaneous recovery of fear by mGluR5 after prolonged extinction training.
Directory of Open Access Journals (Sweden)
Sheng-Chun Mao
Full Text Available Fear behavior is vital for survival and involves learning contingent associations of non-threatening cues with aversive stimuli. In contrast, excessive levels of fear can be maladaptive and lead to anxiety disorders. Generally, extensive sessions of extinction training correlates with reduced spontaneous recovery. The molecular mechanisms underlying the long-term inhibition of fear recovery following repeated extinction training are not fully understood. Here we show that in rats, prolonged extinction training causes greater reduction in both fear-potentiated startle and spontaneous recovery. This effect was specifically blocked by metabotropic glutamate receptor 5 (mGluR5, but not by mGluR1 antagonists and by a protein synthesis inhibitor. Similar inhibition of memory recovery following prolonged extinction training was also observed in mice. In agreement with the instrumental role of mGluR5 in the prolonged inhibition of fear recovery, we found that FMR1-/- mice which exhibit enhanced mGluR5-mediated signaling exhibit lower spontaneous recovery of fear after extinction training than wild-type littermates. At the molecular level, we discovered that prolonged extinction training reversed the fear conditioning-induced increase in surface expression of GluR1, AMPA/NMDA ratio, postsynaptic density-95 (PSD-95 and synapse-associated protein-97 (SAP97. Accordingly, delivery of Tat-GluR2(3Y, a synthetic peptide that blocks AMPA receptor endocytosis, inhibited prolonged extinction training-induced inhibition of fear recovery. Together, our results demonstrate that prolonged extinction training results in the mGluR5-dependent long-term inhibition of fear recovery. This effect may involve the degradation of original memory and may explain the beneficial effects of prolonged exposure therapy for the treatment of phobias.
Inhibition of spontaneous recovery of fear by mGluR5 after prolonged extinction training.
Mao, Sheng-Chun; Chang, Chih-Hua; Wu, Chia-Chen; Orejarena, M Juliana; Orejanera, Maria Juliana; Manzoni, Olivier J; Gean, Po-Wu
2013-01-01
Fear behavior is vital for survival and involves learning contingent associations of non-threatening cues with aversive stimuli. In contrast, excessive levels of fear can be maladaptive and lead to anxiety disorders. Generally, extensive sessions of extinction training correlates with reduced spontaneous recovery. The molecular mechanisms underlying the long-term inhibition of fear recovery following repeated extinction training are not fully understood. Here we show that in rats, prolonged extinction training causes greater reduction in both fear-potentiated startle and spontaneous recovery. This effect was specifically blocked by metabotropic glutamate receptor 5 (mGluR5), but not by mGluR1 antagonists and by a protein synthesis inhibitor. Similar inhibition of memory recovery following prolonged extinction training was also observed in mice. In agreement with the instrumental role of mGluR5 in the prolonged inhibition of fear recovery, we found that FMR1-/- mice which exhibit enhanced mGluR5-mediated signaling exhibit lower spontaneous recovery of fear after extinction training than wild-type littermates. At the molecular level, we discovered that prolonged extinction training reversed the fear conditioning-induced increase in surface expression of GluR1, AMPA/NMDA ratio, postsynaptic density-95 (PSD-95) and synapse-associated protein-97 (SAP97). Accordingly, delivery of Tat-GluR2(3Y), a synthetic peptide that blocks AMPA receptor endocytosis, inhibited prolonged extinction training-induced inhibition of fear recovery. Together, our results demonstrate that prolonged extinction training results in the mGluR5-dependent long-term inhibition of fear recovery. This effect may involve the degradation of original memory and may explain the beneficial effects of prolonged exposure therapy for the treatment of phobias.
40 CFR 268.35 - Waste specific prohibitions-petroleum refining wastes.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-petroleum refining wastes. 268.35 Section 268.35 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... generator may use knowledge of the waste. If the waste contains constituents in excess of the applicable...
40 CFR 268.36 - Waste specific prohibitions-inorganic chemical wastes
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-inorganic chemical wastes 268.36 Section 268.36 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... generator may use knowledge of the waste. If the waste contains regulated constituents in excess of the...
Üner, Aykut; Gonçalves, Gabriel H M; Li, Wenjing; Porceban, Matheus; Caron, Nicole; Schönke, Milena; Delpire, Eric; Sakimura, Kenji; Bjørbæk, Christian
2015-10-01
Hypothalamic agouti-related peptide (AgRP) and pro-opiomelanocortin (POMC) expressing neurons play critical roles in control of energy balance. Glutamatergic input via n-methyl-d-aspartate receptors (NMDARs) is pivotal for regulation of neuronal activity and is required in AgRP neurons for normal body weight homeostasis. NMDARs typically consist of the obligatory GluN1 subunit and different GluN2 subunits, the latter exerting crucial differential effects on channel activity and neuronal function. Currently, the role of specific GluN2 subunits in AgRP and POMC neurons on whole body energy and glucose balance is unknown. We used the cre-lox system to genetically delete GluN2A or GluN2B only from AgRP or POMC neurons in mice. Mice were then subjected to metabolic analyses and assessment of AgRP and POMC neuronal function through morphological studies. We show that loss of GluN2B from AgRP neurons reduces body weight, fat mass, and food intake, whereas GluN2B in POMC neurons is not required for normal energy balance control. GluN2A subunits in either AgRP or POMC neurons are not required for regulation of body weight. Deletion of GluN2B reduces the number of AgRP neurons and decreases their dendritic length. In addition, loss of GluN2B in AgRP neurons of the morbidly obese and severely diabetic leptin-deficient Lep (ob/ob) mice does not affect body weight and food intake but, remarkably, leads to full correction of hyperglycemia. Lep (ob/ob) mice lacking GluN2B in AgRP neurons are also more sensitive to leptin's anti-obesity actions. GluN2B-containing NMDA receptors in AgRP neurons play a critical role in central control of body weight homeostasis and blood glucose balance via mechanisms that likely involve regulation of AgRP neuronal survival and structure, and modulation of hypothalamic leptin action.
49 CFR 268.3 - Different phases of the Maglev Deployment Program.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Different phases of the Maglev Deployment Program... DEPLOYMENT PROGRAM Overview § 268.3 Different phases of the Maglev Deployment Program. (a) The Maglev... deadlines—based on the progress of the Maglev Deployment Program; grantees will be notified accordingly. (b...
40 CFR 268.20 - Waste specific prohibitions-Dyes and/or pigments production wastes.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-Dyes and/or pigments production wastes. 268.20 Section 268.20 Protection of Environment ENVIRONMENTAL... Disposal § 268.20 Waste specific prohibitions—Dyes and/or pigments production wastes. (a) Effective August...
Paroxetine prevented the down-regulation of astrocytic L-Glu transporters in neuroinflammation
Directory of Open Access Journals (Sweden)
Koki Fujimori
2015-01-01
Full Text Available The extracellular L-glutamate (L-Glu concentration is elevated in neuroinflammation, thereby causing excitotoxicity. One of the mechanisms is down-regulation of astrocyte L-Glu transporters. Some antidepressants have anti-inflammatory effects. We therefore investigated effects of various antidepressants on the down-regulation of astrocyte L-Glu transporters in the in vitro neuroinflammation model. Among these antidepressants, only paroxetine was effective. We previously demonstrated that the down-regulation of astrocyte L-Glu transporters was caused by L-Glu released from activated microglia. We here clarified that only paroxetine inhibited L-Glu release from microglia. This is the novel action of paroxetine, which may bring advantages on the therapy of neuroinflammation.
Rubio, María E; Matsui, Ko; Fukazawa, Yugo; Kamasawa, Naomi; Harada, Harumi; Itakura, Makoto; Molnár, Elek; Abe, Manabu; Sakimura, Kenji; Shigemoto, Ryuichi
2017-11-01
The neurotransmitter receptor subtype, number, density, and distribution relative to the location of transmitter release sites are key determinants of signal transmission. AMPA-type ionotropic glutamate receptors (AMPARs) containing GluA3 and GluA4 subunits are prominently expressed in subsets of neurons capable of firing action potentials at high frequencies, such as auditory relay neurons. The auditory nerve (AN) forms glutamatergic synapses on two types of relay neurons, bushy cells (BCs) and fusiform cells (FCs) of the cochlear nucleus. AN-BC and AN-FC synapses have distinct kinetics; thus, we investigated whether the number, density, and localization of GluA3 and GluA4 subunits in these synapses are differentially organized using quantitative freeze-fracture replica immunogold labeling. We identify a positive correlation between the number of AMPARs and the size of AN-BC and AN-FC synapses. Both types of AN synapses have similar numbers of AMPARs; however, the AN-BC have a higher density of AMPARs than AN-FC synapses, because the AN-BC synapses are smaller. A higher number and density of GluA3 subunits are observed at AN-BC synapses, whereas a higher number and density of GluA4 subunits are observed at AN-FC synapses. The intrasynaptic distribution of immunogold labeling revealed that AMPAR subunits, particularly GluA3, are concentrated at the center of the AN-BC synapses. The central distribution of AMPARs is absent in GluA3-knockout mice, and gold particles are evenly distributed along the postsynaptic density. GluA4 gold labeling was homogenously distributed along both synapse types. Thus, GluA3 and GluA4 subunits are distributed at AN synapses in a target-cell-dependent manner.
Suryavanshi, P S; Ugale, R R; Yilmazer-Hanke, D; Stairs, D J; Dravid, S M
2014-01-01
Background and Purpose Despite ample evidence supporting the N-methyl-d-aspartate receptor (NMDAR) hypofunction hypothesis of schizophrenia, progress in the development of effective therapeutics based on this hypothesis has been limited. Facilitation of NMDA receptor function by co-agonists (d-serine or glycine) only partially alleviates the symptoms in schizophrenia; other means to facilitate NMDA receptors are required. NMDA receptor sub-types differ in their subunit composition, with varied GluN2 subunits (GluN2A-GluN2D) imparting different physiological, biochemical and pharmacological properties. CIQ is a positive allosteric modulator that is selective for GluN2C/GluN2D-containing NMDA receptors (Mullasseril et al.). Experimental Approach The effect of systemic administration of CIQ was tested on impairment in prepulse inhibition (PPI), hyperlocomotion and stereotypy induced by i.p. administration of MK-801 and methamphetamine. The effect of CIQ was also tested on MK-801-induced impairment in working memory in Y-maze spontaneous alternation test. Key Results We found that systemic administration of CIQ (20 mg·kg−1, i.p.) in mice reversed MK-801 (0.15 mg·kg−1, i.p.)-induced, but not methamphetamine (3 mg·kg−1, i.p.)-induced, deficit in PPI. MK-801 increased the startle amplitude to pulse alone, which was not reversed by CIQ. In contrast, methamphetamine reduced the startle amplitude to pulse alone, which was reversed by CIQ. CIQ also partially attenuated MK-801- and methamphetamine-induced hyperlocomotion and stereotyped behaviours. Additionally, CIQ reversed the MK-801-induced working memory deficit in spontaneous alternation in a Y-maze. Conclusion and Implications Together, these results suggest that facilitation of GluN2C/GluN2D-containing receptors may serve as an important therapeutic strategy for treating positive and cognitive symptoms in schizophrenia. PMID:24236947
Directory of Open Access Journals (Sweden)
Manuela eMellone
2015-07-01
Full Text Available Levodopa-induced dyskinesias (LIDs are major complications in the pharmacological management of Parkinson’s disease (PD. Abnormal glutamatergic transmission in the striatum is considered a key factor in the development of LIDs. This work aims at i. characterizing NMDA receptor GluN2A/GluN2B subunit ratio as a common synaptic trait in rat and primate models of LIDs and in dyskinetic PD patients, and ii. validating the potential therapeutic effect of a cell-permeable peptide interfering with GluN2A synaptic localization on the dyskinetic behavior of these experimental models of LIDs. Here we demonstrate an altered ratio of synaptic GluN2A/GluN2B-containing NMDA receptors in the striatum of levodopa-treated dyskinetic rats and monkeys as well as in post-mortem tissue from dyskinetic PD patients. The modulation of synaptic NMDA receptor composition by a cell-permeable peptide interfering with GluN2A subunit interaction with the scaffolding protein PSD-95 leads to a reduction in the dyskinetic motor behavior in the two animal models of LIDs. Our results indicate that targeting synaptic NMDA receptor subunit composition may represent an intriguing therapeutic approach aimed at ameliorating levodopa motor side effects.
Laser-based gluing of diamond-tipped saw blades
Hennigs, Christian; Lahdo, Rabi; Springer, André; Kaierle, Stefan; Hustedt, Michael; Brand, Helmut; Wloka, Richard; Zobel, Frank; Dültgen, Peter
2016-03-01
To process natural stone such as marble or granite, saw blades equipped with wear-resistant diamond grinding segments are used, typically joined to the blade by brazing. In case of damage or wear, they must be exchanged. Due to the large energy input during thermal loosening and subsequent brazing, the repair causes extended heat-affected zones with serious microstructure changes, resulting in shape distortions and disadvantageous stress distributions. Consequently, axial run-out deviations and cutting losses increase. In this work, a new near-infrared laser-based process chain is presented to overcome the deficits of conventional brazing-based repair of diamond-tipped steel saw blades. Thus, additional tensioning and straightening steps can be avoided. The process chain starts with thermal debonding of the worn grinding segments, using a continuous-wave laser to heat the segments gently and to exceed the adhesive's decomposition temperature. Afterwards, short-pulsed laser radiation removes remaining adhesive from the blade in order to achieve clean joining surfaces. The third step is roughening and activation of the joining surfaces, again using short-pulsed laser radiation. Finally, the grinding segments are glued onto the blade with a defined adhesive layer, using continuous-wave laser radiation. Here, the adhesive is heated to its curing temperature by irradiating the respective grinding segment, ensuring minimal thermal influence on the blade. For demonstration, a prototype unit was constructed to perform the different steps of the process chain on-site at the saw-blade user's facilities. This unit was used to re-equip a saw blade with a complete set of grinding segments. This saw blade was used successfully to cut different materials, amongst others granite.
Experimental studies of glued Aluminum-glass joints
Ligaj, B.; Wirwicki, M.; Karolewska, K.; Jasińska, A.
2018-04-01
Glued steel-glass or aluminum-glass joints are to be found, among other things, in vehicles (cars, buses, trains, trams) as windscreen assembly pieces for the supporting structure. For the purposes of the experiments, samples were made in which the top beam was made of the AW-2017A aluminum alloy and the bottom beam was made of thermally reinforced soda-lime glass whereas the glued joints were made of one-component polyurethane glue Körapur 175. The tests were performed under four-point bending conditions at monotonic incremental bending moment values on the Instron 5965 durability machine. The experimental study of the durability of glued joints under four-point bending conditions with the monotonic incremental bending moment allows to determine the values of stresses, whose value is related to initiation of damage of the tested joint.
Combined surgical management of capsular and iris deficiency with glued intraocular lens technique.
Kumar, Dhivya Ashok; Agarwal, Amar; Jacob, Soosan; Lamba, Mandeep; Packialakshmi, Sathiya; Meduri, Alessandro
2013-05-01
To determine the outcome after glued aniridia intraocular lens (IOL) and glued IOL with iridoplasty in eyes with combined lens capsular and iris deficiency. Twenty-seven eyes of 25 patients (6 had congenital aniridia with subluxated cataract and 19 had acquired lens/iris defects) were included. Glued IOL with aniridia IOL (Intra Ocular Care, Gujarat, India) was performed in eyes with total aniridia and iridoplasty with glued IOL with a three-piece foldable IOL (Sofport; Bausch & Lomb, Rochester, NY) was performed in eyes with partial aniridia. The postoperative outcomes were analyzed at follow-up examination (range: 6 to 48 months). Eleven eyes underwent glued aniridia IOL and 16 eyes underwent glued IOL with iridoplasty. There was significant improvement in (spectacle) corrected distance visual acuity (CDVA) (P = .002). Postoperatively, pigment dispersion on the IOL (n = 1) and raised intraocular pressure was seen in the glued aniridia IOL group and chronic uveitis (n = 1), cystoid macular edema (n = 1), and hyphema (n = 1) in the glued IOL with iridoplasty group. The CDVA remained unchanged in 14 eyes (51.8%) and improved in 13 eyes (48.1%). There was a difference in postoperative CDVA (P = .001) between eyes with glued aniridia IOL and glued IOL with iridoplasty. There was no IOL decentration, retinal detachment, corneal decompensation, or endophthalmitis. There was reduction in glare and photophobia. Both glued aniridia IOL and glued IOL/iridoplasty showed good functional and anatomical results with fewer complications in eyes with lens capsule and iris deficiency. However, long-term follow-up is required.[J Refract Surg. 2013;29(5):342-347.]. Copyright 2013, SLACK Incorporated.
Szabó, György; Túrós, György I; Kolok, Sándor; Vastag, Mónika; Sánta, Zsuzsanna; Dékány, Miklós; Lévay, György I; Greiner, István; Natsumi, Minami; Tatsuya, Watanabe; Keserű, György M
2018-03-14
Metabotropic glutamate receptor 2 (mGluR2) positive allosteric modulators (PAMs) have been implicated as potential pharmacotherapy for psychiatric conditions. Screening our corporate compound deck, we identified a benzotriazole fragment (4) that was rapidly optimized to a potent and metabolically stable early lead (16). The highly lipophilic character of 16, together with its limited solubility, permeability, and high protein binding, however, did not allow reaching of the proof of concept in vivo. Since further attempts on the optimization of druglike properties were unsuccessful, the original hit 4 has been revisited and was optimized following the principles of fragment based drug discovery (FBDD). Lacking structural information on the receptor-ligand complex, we implemented a group efficiency (GE) based strategy and identified a new fragment like lead (60) with more balanced profile. Significant improvement achieved on the druglike properties nominated the compound for in vivo proof of concept studies that revealed the chemotype being a promising PAM lead targeting mGluR2 receptors.
Lateral testing of glued laminated timber tudor arch
Douglas R. Rammer; Philip Line
2016-01-01
Glued laminated timber Tudor arches have been in wide use in the United States since the 1930s, but detailed knowledge related to seismic design in modern U.S. building codes is lacking. FEMA P-695 (P-695) is a methodology to determine seismic performance factors for a seismic force resisting system. A limited P-695 study for glued laminated timber arch structures...
Time-Dependent Expression of Arc and Zif268 after Acquisition of Fear Conditioning
Directory of Open Access Journals (Sweden)
Mary E. Lonergan
2010-01-01
Full Text Available Memory consolidation requires transcription and translation of new protein. Arc, an effector immediate early gene, and zif268, a regulatory transcription factor, have been implicated in synaptic plasticity underlying learning and memory. This study explored the temporal expression profiles of these proteins in the rat hippocampus following fear conditioning. We observed a time-dependent increase of Arc protein in the dorsal hippocampus 30-to-90-minute post training, returning to basal levels at 4 h. Zif268 protein levels, however, gradually increased at 30-minute post training before peaking in expression at 60 minute. The timing of hippocampal Arc and zif268 expression coincides with the critical period for protein synthesis-dependent memory consolidation following fear conditioning. However, the expression of Arc protein appears to be driven by context exploration, whereas, zif268 expression may be more specifically related to associative learning. These findings suggest that altered Arc and zif268 expression are related to neural plasticity during the formation of fear memory.
Adhesion quality of glued joints from different commercial wood species
Directory of Open Access Journals (Sweden)
Alexandre Miguel do Nascimento
2013-12-01
Full Text Available The objective of this study was to determine the effect of wood density, adhesive type and gluing pressure on the shear strength of glued joints of fourteen commercial wood species. Wood pieces were classified in three density classes (Class 1: less than 0.55 g cm-3; Class 2: from 0.55 to 0.75 g cm-3; and Class 3: greater than 0.75 g cm-3 and joints bonded with two adhesives: polyvinyl acetate (PVA and urea-formaldehyde (UF, under two different pressures: 6 and 12 kgf cm-2. Glued joints bonded with PVA adhesive presented higher shear strength than those bonded with UF adhesive. For percentage of wood failure, the PVA adhesive had the best performance, however, only Classes 1 and 2 reached the values required by ASTM 3110 standard. Glued joints from Class 3, bonded with UF adhesive, did not reach the values of solid wood. The gluing pressure of 12 kgf cm-2 was more efficient for Class 3, for both shear strength and percentage of wood failure.
DEFF Research Database (Denmark)
Jessen, Maja; Frederiksen, Kristen; Yi, Feng
2017-01-01
N-methyl-d-aspartate (NMDA)-type ionotropic glutamate receptors mediate excitatory neurotransmission in the central nervous system and are critically involved in brain function. NMDA receptors are also implicated in psychiatric and neurological disorders and have received considerable attention....../2A-D), in which DCS is a superagonist at GluN2C-containing receptors compared with glycine and a partial agonist at GluN2B-containing receptors. Here, we identify (R)-2-amino-3-(4-(2-ethylphenyl)-1H-indole-2-carboxamido)propanoic acid (AICP) as a glycine site agonist with unique GluN2-dependent...
The Drosophila DmGluRA is required for social interaction and memory
Directory of Open Access Journals (Sweden)
Brian P. Schoenfeld
2013-05-01
Full Text Available Metabotropic glutamate receptors (mGluRs have well established roles in cognition andsocial behavior in mammals. Whether or not these roles have been conserved throughoutevolution from invertebrate species is less clear. Mammals have 8 mGluRs whereasDrosophila have a single DmGluRA, which has both Gi and Gq coupled signalingactivity. We have utilized Drosophila to examine the role of DmGluRA in social behaviorand various phases of memory. We have found that flies that are homozygous orheterozygous for loss of function mutations of DmGluRA have impaired social behaviorin male Drosophila. Futhermore, flies that are homozygous or heterozygous for loss offunction mutations of DmGluRA have impaired learning during training, immediate recallmemory, short-term memory and long-term memory as young adults. This workdemonstrates a role for metabotropic glutamate receptor activity in both social behaviorand memory in Drosophila.
mGlu5 Receptor Functional Interactions and Addiction
Directory of Open Access Journals (Sweden)
Robyn eBrown
2012-05-01
Full Text Available The idea of ‘receptor mosaics’ suggests that proteins can form complex and dynamic networks, with respect to time and protein make up, which has the potential to make significant contributions to the diversity and specificity of GPCR signalling, particularly in neuropharmacology, where a few key receptors have been implicated in multiple neurological and psychiatric disorders such as addiction. Metabotropic glutamate type 5 receptors (mGlu5 have been shown to heterodimerise and form complexes with other GPCRs including adenosine A2A and dopamine D2 receptors. mGlu5-containing complexes are found in the striatum, a region of the brain known to be critical for mediating the rewarding and incentive motivational properties of drugs of abuse. Indeed, initial studies indicate a role for mGlu5-containing complexes in rewarding and conditioned effects of drugs, as well as drug-seeking behaviour. This is consistent with the substantial influence that mGlu5 complexes appear to have on striatal function, regulating both GABAergic output of striatopallidal neurons and glutamatergic input from corticostriatal afferents. Given their discrete localization, mGlu5-containing complexes represent a novel way in which to minimize the off-target effects and therefore provide us with an exciting therapeutic avenue for drug discovery efforts. Indeed, the therapeutic targeting of receptor mosaics in a tissue specific or temporal manner (for example, a sub-population of receptors in a ‘pathological state’ has the potential to dramatically reduce detrimental side effects that may otherwise impair vital brain function.
Craftsmen say "we want edge-glued, standard-size panels"
Philip A. Araman; Hugh W. Reynolds
1983-01-01
Wood craftsmen would like an alternative to hardwood lumber and plywood and softwood products. They are very interested in edge-glued, standard-size panels. These conclusions are based on interviews with craftsmen at two trade shows, and the results are included in this report along with our recommendations for optimum acceptance by craftsmen of this new product.
Directory of Open Access Journals (Sweden)
Douglas Bledsoe
2017-05-01
Full Text Available N-methyl D-aspartate receptors (NMDAR play crucial role in normal brain function and pathogenesis of neurodegenerative and psychiatric disorders. Functional tetra-heteromeric NMDAR contains two obligatory GluN1 subunits and two identical or different non-GluN1 subunits that include six different gene products; four GluN2 (A–D and two GluN3 (A–B subunits. The heterogeneity of subunit combination facilities the distinct function of NMDARs. All GluN subunits contain an extracellular N-terminal Domain (NTD and ligand binding domain (LBD, transmembrane domain (TMD and an intracellular C-terminal domain (CTD. Interaction between the GluN1 and co-assembling GluN2/3 subunits through the LBD has been proven crucial for defining receptor deactivation mechanisms that are unique for each combination of NMDAR. Modulating the LBD interactions has great therapeutic potential. In the present work, by amino acid point mutations and electrophysiology techniques, we have studied the role of LBD interactions in determining the effect of well-characterized pharmacological agents including agonists, competitive antagonists, and allosteric modulators. The results reveal that agonists (glycine and glutamate potency was altered based on mutant amino acid sidechain chemistry and/or mutation site. Most antagonists inhibited mutant receptors with higher potency; interestingly, clinically used NMDAR channel blocker memantine was about three-fold more potent on mutated receptors (N521A, N521D, and K531A than wild type receptors. These results provide novel insights on the clinical pharmacology of memantine, which is used for the treatment of mild to moderate Alzheimer's disease. In addition, these findings demonstrate the central role of LBD interactions that can be exploited to develop novel NMDAR based therapeutics.
25 CFR 26.8 - Where do I go to apply for Job Placement and Training assistance?
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Where do I go to apply for Job Placement and Training... PLACEMENT AND TRAINING PROGRAM General Applicability § 26.8 Where do I go to apply for Job Placement and Training assistance? You may apply for Job Placement and Training assistance at the servicing office...
Energy Technology Data Exchange (ETDEWEB)
Schkeryantz, Jeffery M.; Chen, Qi; Ho, Joseph D.; Atwell, Shane; Zhang, Aiping; Vargas, Michelle C.; Wang, Jing; Monn, James A.; Hao, Junliang (Lilly)
2018-02-01
Here, L-2-Amino-4-phosphonobutyric acid (L-AP4) is a known potent and selective agonist for the Group III mGlu receptors. However, it does not show any selectivity among the individual group III mGlu subtypes. In order to understand the molecular basis for this group selectivity, we solved the first human mGlu8 amino terminal domain (ATD) crystal structures in complex with L-glu and L-AP4. In comparison with other published L-glu-bound mGlu ATD structures, we have observed L-glu binds in a significantly different manner in mGlu1. Furthermore, these new structures provided evidence that both the electronic and steric nature of the distal phosphate of L-AP4 contribute to its exquisite Group III functional agonist potency and selectivity.
Dou, Weiqiang; Kaufmann, Jörn; Li, Meng; Zhong, Kai; Walter, Martin; Speck, Oliver
2015-08-01
This study aimed to determine the optimal echo time (TE) and mixing time (TM) for in vivo glutamine (Gln) and glutamate (Glu) separation in stimulated-echo acquisition mode at 3 and 7 T. We applied a short TE/TM (20/10 ms) for a high signal-to-noise-ratio and a field-specific long TE/TM (3 T: 72/6 ms; 7 T: 74/68 ms) for optimal Gln and Glu separation of the Carbon-4 proton resonances. Corresponding Gln and Glu spectra were simulated using VeSPA software, and measured in a phantom and human brains at 3 and 7 T. Higher spectral separation for Gln and Glu was achieved at 7 than 3 T. At 7 T, short TE/TM provided comparable spectral separation and in vitro Gln and Glu quantification compared to long TE/TM. Moreover, it showed greater reliability in in vivo Gln and Glu detection and separation than long TE/TM, with significantly lower Cramer-Rao lower bounds (Gln: 14.9 vs. 75.8; Glu: 3.8 vs. 6.5) and correlation between Gln and Glu (p = 0.004). Based on the optimal separation for Gln and Glu, a short TE/TM at 7 T is proposed for future in vivo Gln and Glu acquisition.
43 CFR 30.268 - May I demand a hearing regarding the tribal purchase option decision?
2010-10-01
... tribal purchase option decision? 30.268 Section 30.268 Public Lands: Interior Office of the Secretary of the Interior INDIAN PROBATE HEARINGS PROCEDURES Tribal Purchase of Interests Under Special Statutes § 30.268 May I demand a hearing regarding the tribal purchase option decision? Yes. You may file with...
A pharmacological profile of the high-affinity GluK5 kainate receptor
DEFF Research Database (Denmark)
Møllerud, Stine; Kastrup, Jette Sandholm Jensen; Pickering, Darryl S
2016-01-01
-hydroxyisoxazol-4-yl)propionate (ATPA), dihydrokainate and (2 S,4 R)−4-methyl-glutamate (SYM2081) have higher affinity at GluK3 compared to GluK5. Since some studies have indicated that GluK5 is associated with various diseases in the central nervous system (e.g. schizophrenia, temporal lobe epilepsy, bipolar...
International Nuclear Information System (INIS)
Liu, Qingbo; Li, Defeng; Hu, Yonglin; Wang, Da-Cheng
2013-01-01
GluB, a substrate-binding protein from C. glutamicum, was expressed, purified and crystallized, followed by X-ray diffraction data collection and preliminary crystallographic analysis. GluB is a substrate-binding protein (SBP) which participates in the uptake of glutamic acid in Corynebacterium glutamicum, a Gram-positive bacterium. It is part of an ATP-binding cassette (ABC) transporter system. Together with the transmembrane proteins GluC and GluD and the cytoplasmic protein GluA, which couples the hydrolysis of ATP to the translocation of glutamate, they form a highly active glutamate-uptake system. As part of efforts to study the amino-acid metabolism, especially the metabolism of glutamic acid by C. glutamicum, a bacterium that is widely used in the industrial production of glutamic acid, the GluB protein was expressed, purified and crystallized, an X-ray diffraction data set was collected to a resolution of 1.9 Å and preliminary crystallographic analysis was performed. The crystal belonged to space group P3 1 21 or P3 2 21, with unit-cell parameters a = b = 82.50, c = 72.69 Å
DEFF Research Database (Denmark)
Kwaaitaal, Mark Adrianus Cornelis J; Maintz, Jens; Cavdar, Meltem
2012-01-01
in the putative agonist binding profile and potential mode of desensitization of MAMP-activated plant iGluRs. Based on results from pharmacological inhibition and desensitization experiments, we propose that plant iGluR complexes responsible for the MAMP-triggered Ca ( 2+) signature have a binding profile...... that combines the specificities of mammalian NMDA-and non-NMDA types of iGluRs, possibly reflecting the evolutionary history of plant and animal iGluRs. We further hypothesize that, analogous to the mammalian NMDA-NR1 receptor, desensitization of plant iGluR-like channels might involve binding of the ubiquitous...
Two Unique Cases with Anti-GluR Antibody-Positive Encephalitis
Directory of Open Access Journals (Sweden)
Kosuke Matsuzono
2013-01-01
Full Text Available We report two cases of anti-glutamic acid receptor (anti-GluR antibody-positive encephalitis in males with symptoms such as Parkinsonism, urinary retention, and paralytic ileus. Although non-herpetic encephalitis typically shows magnetic resonance imaging (MRI lesions in the limbic system during early stages, the present cases showed MRI lesions during later stages in the bilateral claustrum and pons. In both cases, anti-GluRε2 and δ2 antibodies were later shown to be positive in the cerebrospinal fluid but negative in the serum. Although early detection of anti-GluR antibodies is essential, early treatment may be significantly more important.
mGluR5 ablation in cortical glutamatergic neurons increases novelty-induced locomotion.
Directory of Open Access Journals (Sweden)
Chris P Jew
Full Text Available The group I metabotropic glutamate receptor 5 (mGluR5 has been implicated in the pathology of various neurological disorders including schizophrenia, ADHD, and autism. mGluR5-dependent synaptic plasticity has been described at a variety of neural connections and its signaling has been implicated in several behaviors. These behaviors include locomotor reactivity to novel environment, sensorimotor gating, anxiety, and cognition. mGluR5 is expressed in glutamatergic neurons, inhibitory neurons, and glia in various brain regions. In this study, we show that deleting mGluR5 expression only in principal cortical neurons leads to defective cannabinoid receptor 1 (CB1R dependent synaptic plasticity in the prefrontal cortex. These cortical glutamatergic mGluR5 knockout mice exhibit increased novelty-induced locomotion, and their locomotion can be further enhanced by treatment with the psychostimulant methylphenidate. Despite a modest reduction in repetitive behaviors, cortical glutamatergic mGluR5 knockout mice are normal in sensorimotor gating, anxiety, motor balance/learning and fear conditioning behaviors. These results show that mGluR5 signaling in cortical glutamatergic neurons is required for precisely modulating locomotor reactivity to a novel environment but not for sensorimotor gating, anxiety, motor coordination, several forms of learning or social interactions.
Abe, Masahito; Seto, Mabel; Gogliotti, Rocco G; Loch, Matthew T; Bollinger, Katrina A; Chang, Sichen; Engelberg, Eileen M; Luscombe, Vincent B; Harp, Joel M; Bubser, Michael; Engers, Darren W; Jones, Carrie K; Rodriguez, Alice L; Blobaum, Anna L; Conn, P Jeffrey; Niswender, Colleen M; Lindsley, Craig W
2017-10-12
Herein, we report the structure-activity relationships within a series of mGlu 7 PAMs based on a pyrazolo[1,5- a ]pyrimidine core with excellent CNS penetration ( K p s > 1 and K p,uu s > 1). Analogues in this series proved to display a range of Group III mGlu receptor selectivity, but VU6005649 emerged as the first dual mGlu 7/8 PAM, filling a void in the Group III mGlu receptor PAM toolbox and demonstrating in vivo efficacy in a mouse contextual fear conditioning model.
Directory of Open Access Journals (Sweden)
B. O. Chekh
2017-08-01
Full Text Available The aim of our work was to study biological properties of the polymer based on pseudo-polyamino acids GluLa-DPG-PEG600, its ability to bind albumin, as well as its localization in rat body and influence on physiological and functional state of rat kidneys and liver. We have found the ability of GluLa-DPG-PEG600 to bind bovine serum albumin (BSA using electrophoresis in 5% polyacrylamide gel. Structural and functional state of the liver and kidneys of rats after injections of polymer were investigated by histological analysis of organs and determination the activities of alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, gamma-glutamyltransferase and content of cholesterol and creatinine in blood. Our results showed little toxic effect of GluLa-DPG-PEG600 on rat body. Using fluorescent microscopy we have studied polymer in complex with BSA distribution in rat body: after intravenous injection polymer are localized in kidneys and spleen, and after intramuscular – in liver and brain. It has been shown that polymer passed through the blood-brain barrier and are localized in the immune organ – spleen, indicating GluLa-DPG-PEG600 as a potential drug transporter.
Evidence of intralocus recombination at the Glu-3 loci in bread wheat (Triticum aestivum L.)
The low-molecular weight glutenin subunits (LMW-GSs) are a class of wheat seed storage proteins that play a critical role in the determination of wheat flour bread-making quality. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3 and Glu-D3), on t...
Penke, Zsuzsa; Morice, Elise; Veyrac, Alexandra; Gros, Alexandra; Chagneau, Carine; LeBlanc, Pascale; Samson, Nathalie; Baumgärtel, Karsten; Mansuy, Isabelle M; Davis, Sabrina; Laroche, Serge
2014-01-05
It is well established that Zif268/Egr1, a member of the Egr family of transcription factors, is critical for the consolidation of several forms of memory; however, it is as yet uncertain whether increasing expression of Zif268 in neurons can facilitate memory formation. Here, we used an inducible transgenic mouse model to specifically induce Zif268 overexpression in forebrain neurons and examined the effect on recognition memory and hippocampal synaptic transmission and plasticity. We found that Zif268 overexpression during the establishment of memory for objects did not change the ability to form a long-term memory of objects, but enhanced the capacity to form a long-term memory of the spatial location of objects. This enhancement was paralleled by increased long-term potentiation in the dentate gyrus of the hippocampus and by increased activity-dependent expression of Zif268 and selected Zif268 target genes. These results provide novel evidence that transcriptional mechanisms engaging Zif268 contribute to determining the strength of newly encoded memories.
Cui, Wen; Darby-King, Andrea; Grimes, Matthew T; Howland, John G; Wang, Yu Tian; McLean, John H; Harley, Carolyn W
2011-01-01
An increase in synaptic AMPA receptors is hypothesized to mediate learning and memory. AMPA receptor increases have been reported in aversive learning models, although it is not clear if they are seen with memory maintenance. Here we examine AMPA receptor changes in a cAMP/PKA/CREB-dependent appetitive learning model: odor preference learning in the neonate rat. Rat pups were given a single pairing of peppermint and 2 mg/kg isoproterenol, which produces a 24-h, but not a 48-h, peppermint preference in the 7-d-old rat pup. GluA1 PKA-dependent phosphorylation peaked 10 min after the 10-min training trial and returned to baseline within 90 min. At 24 h, GluA1 subunits did not change overall but were significantly increased in synaptoneurosomes, consistent with increased membrane insertion. Immunohistochemistry revealed a significant increase in GluA1 subunits in olfactory bulb glomeruli, the targets of olfactory nerve axons. Glomerular increases were seen at 3 and 24 h after odor exposure in trained pups, but not in control pups. GluA1 increases were not seen as early as 10 min after training and were no longer observed 48 h after training when odor preference is no longer expressed behaviorally. Thus, the pattern of increased GluA1 membrane expression closely follows the memory timeline. Further, blocking GluA1 insertion using an interference peptide derived from the carboxyl tail of the GluA1 subunit inhibited 24 h odor preference memory providing causative support for our hypothesis. PKA-mediated GluA1 phosphorylation and later GluA1 insertion could, conjointly, provide increased AMPA function to support both short-term and long-term appetitive memory.
Heat Resistance of Glued Finger Joints in Spruce Wood Constructions
Directory of Open Access Journals (Sweden)
Martin Sviták
2014-10-01
Full Text Available The heat resistance of glued spruce wood was evaluated for different joint types and adhesives. Bending strength, modulus of elasticity, and also fracture evaluation were investigated on glued spruce samples made by the finger-jointed principle. Finger-jointed samples were glued with polyurethane (PUR and melamine-urea-formaldehyde (MUF adhesives. Heat loading was realized at temperatures 60, 80, and 110 °C and compared with wood with 20 °C. A static bending test with four-point flexural test was used. Elevated temperature and adhesive type had an important influence on the bending strength. On the other hand, adhesive type had a significant influence on the modulus of elasticity, but elevated temperature had no substantial influence.
Differential trafficking of AMPA receptors following activation of NMDA receptors and mGluRs
Directory of Open Access Journals (Sweden)
Sanderson Thomas M
2011-07-01
Full Text Available Abstract The removal of AMPA receptors from synapses is a major component of long-term depression (LTD. How this occurs, however, is still only partially understood. To investigate the trafficking of AMPA receptors in real-time we previously tagged the GluA2 subunit of AMPA receptors with ecliptic pHluorin and studied the effects of NMDA receptor activation. In the present study we have compared the effect of NMDA receptor and group I mGluR activation, using GluA2 tagged with super ecliptic pHluorin (SEP-GluA2 expressed in cultured hippocampal neurons. Surprisingly, agonists of the two receptors, which are both able to induce chemical forms of LTD, had clearly distinct effects on AMPA receptor trafficking. In agreement with our previous work we found that transient NMDA receptor activation results in an initial decrease in surface GluA2 from extrasynaptic sites followed by a delayed reduction in GluA2 from puncta (putative synapses. In contrast, transient activation of group I mGluRs, using DHPG, led to a pronounced but more delayed decrease in GluA2 from the dendritic shafts. Surprisingly, there was no average change in the fluorescence of the puncta. Examination of fluorescence at individual puncta, however, indicated that alterations did take place, with some puncta showing an increase and others a decrease in fluorescence. The effects of DHPG were, like DHPG-induced LTD, prevented by treatment with a protein tyrosine phosphatase (PTP inhibitor. The electrophysiological correlate of the effects of DHPG in the SEP-GluA2 infected cultures was a reduction in mEPSC frequency with no change in amplitude. The implications of these findings for the initial mechanisms of expression of both NMDA receptor- and mGluR-induced LTD are discussed.
The essential role of AMPA receptor GluR2 subunit RNA editing in the normal and diseased brain
Directory of Open Access Journals (Sweden)
Amanda Lorraine Wright
2012-04-01
Full Text Available AMPA receptors are comprised of different combinations of GluR1-GluR4 (also known as GluA1-GluA4 and GluR-A to GluR-D subunits. The GluR2 subunit is subject to Q/R site RNA editing by the ADAR2 enzyme, which converts a codon for glutamine (Q, present in the GluR2 gene, to a codon for arginine (R found in the mRNA. AMPA receptors are calcium (Ca2+-permeable if they contain the unedited GluR2(Q subunit or if they lack the GluR2 subunit. While most AMPA receptors in the brain contain the edited GluR2(R subunit and are therefore Ca2+-impermeable, recent evidence suggests that Ca2+-permeable GluR2-lacking AMPA receptors are important in synaptic plasticity and learning. However, the presence of Ca2+-permeable AMPA receptors containing unedited GluR2 leads to excitotoxic cell loss. Recent studies have indicated that RNA editing of GluR2 is deregulated in diseases, such as amyotrophic lateral sclerosis (ALS, as well in acute neurodegenerative conditions, such as ischemia. More recently, studies have investigated the regulation of RNA editing and possible causes for its deregulation during disease. In this review, we will explore the role of GluR2 RNA editing in the healthy and diseased brain and outline new insights into the mechanisms that control this process.
The research of glued frame-mounted wooden constructions
Directory of Open Access Journals (Sweden)
Muselemov Kh.M.
2016-11-01
Full Text Available the authors of this article note that the fast pace and modern construction make qualitatively new demands on building materials and structures. While great attention is paid to the production of glued wooden structures. Such designs on a number of technical and economic indicators are superior to metal and concrete have low component weight, relatively high strength and stiffness with sufficient reliability and durability. At the same time, negative characteristics of the wood (the dependence of the properties from its structure, defects, need for and considerable expense of quality timber, excessive massiveness of the cross-sections, creep under sustained loading, etc. restrict the scope and impair the indicators of glued wooden structures. One of the ways to address these shortcomings and increase techno-economic efficiency – reinforcement of sections of glued wooden structures and elements of steel or fiberglass reinforcement. This can significantly reduce the consumption of wood, reduce Assembly mass, to improve the quality and reliability of wooden structures, working mainly in bending and compression with bending.
Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.
Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo
2007-09-25
Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.
Wang, Ting-Ting; Si, Feng-Ling; He, Zheng-Bo; Chen, Bin
2018-01-15
Ionotropic glutamate receptors (iGluRs) are conserved ligand-gated ion channel receptors, and ionotropic receptors (IRs) were revealed as a new family of iGluRs. Their subdivision was unsettled, and their characteristics are little known. Anopheles sinensis is a major malaria vector in eastern Asia, and its genome was recently well sequenced and annotated. We identified iGluR genes in the An. sinensis genome, analyzed their characteristics including gene structure, genome distribution, domains and specific sites by bioinformatic methods, and deduced phylogenetic relationships of all iGluRs in An. sinensis, Anopheles gambiae and Drosophila melanogaster. Based on the characteristics and phylogenetics, we generated the classification of iGluRs, and comparatively analyzed the intron number and selective pressure of three iGluRs subdivisions, iGluR group, Antenna IR and Divergent IR subfamily. A total of 56 iGluR genes were identified and named in the whole-genome of An. sinensis. These genes were located on 18 scaffolds, and 31 of them (29 being IRs) are distributed into 10 clusters that are suggested to form mainly from recent gene duplication. These iGluRs can be divided into four groups: NMDA, non-NMDA, Antenna IR and Divergent IR based on feature comparison and phylogenetic analysis. IR8a and IR25a were suggested to be monophyletic, named as Putative in the study, and moved from the Antenna subfamily in the IR family to the non-NMDA group as a sister of traditional non-NMDA. The generated iGluRs of genes (including NMDA and regenerated non-NMDA) are relatively conserved, and have a more complicated gene structure, smaller ω values and some specific functional sites. The iGluR genes in An. sinensis, An. gambiae and D. melanogaster have amino-terminal domain (ATD), ligand binding domain (LBD) and Lig_Chan domains, except for IR8a that only has the LBD and Lig_Chan domains. However, the new concept IR family of genes (including regenerated Antenna IR, and Divergent
Lum, Jeremy S; Fernandez, Francesca; Matosin, Natalie; Andrews, Jessica L; Huang, Xu-Feng; Ooi, Lezanne; Newell, Kelly A
2016-10-10
Group 1 metabotropic glutamate receptors (mGluR1/mGluR5) play an integral role in neurodevelopment and are implicated in psychiatric disorders, such as schizophrenia. mGluR1 and mGluR5 are expressed as homodimers, which is important for their functionality and pharmacology. We examined the protein expression of dimeric and monomeric mGluR1α and mGluR5 in the prefrontal cortex (PFC) and hippocampus throughout development (juvenile/adolescence/adulthood) and in the perinatal phencyclidine (PCP) model of schizophrenia. Under control conditions, mGluR1α dimer expression increased between juvenile and adolescence (209-328%), while monomeric levels remained consistent. Dimeric mGluR5 was steadily expressed across all time points; monomeric mGluR5 was present in juveniles, dramatically declining at adolescence and adulthood (-97-99%). The mGluR regulators, Homer 1b/c and Norbin, significantly increased with age in the PFC and hippocampus. Perinatal PCP treatment significantly increased juvenile dimeric mGluR5 levels in the PFC and hippocampus (37-50%) but decreased hippocampal mGluR1α (-50-56%). Perinatal PCP treatment also reduced mGluR1α dimer levels in the PFC at adulthood (-31%). These results suggest that Group 1 mGluRs have distinct dimeric and monomeric neurodevelopmental patterns, which may impact their pharmacological profiles at specific ages. Perinatal PCP treatment disrupted the early expression of Group 1 mGluRs which may underlie neurodevelopmental alterations observed in this model.
Directory of Open Access Journals (Sweden)
Yusuke Takeuchi
Full Text Available The AMPA-type glutamate receptor (AMPAR, which is a tetrameric complex composed of four subunits (GluA1-4 with several combinations, mediates the majority of rapid excitatory synaptic transmissions in the nervous system. Cell surface expression levels of AMPAR modulate synaptic plasticity, which is considered one of the molecular bases for learning and memory formation. To date, a unique trisaccharide (HSO3-3GlcAβ1-3Galβ1-4GlcNAc, human natural killer-1 (HNK-1 carbohydrate, was found expressed specifically on N-linked glycans of GluA2 and regulated the cell surface expression of AMPAR and the spine maturation process. However, evidence that the HNK-1 epitope on N-glycans of GluA2 directly affects these phenomena is lacking. Moreover, it is thought that other N-glycans on GluA2 also have potential roles in the regulation of AMPAR functions. In the present study, using a series of mutants lacking potential N-glycosylation sites (N256, N370, N406, and N413 within GluA2, we demonstrated that the mutant lacking the N-glycan at N370 strongly suppressed the intracellular trafficking of GluA2 from the endoplasmic reticulum (ER in HEK293 cells. Cell surface expression of GluA1, which is a major subunit of AMPAR in neurons, was also suppressed by co-expression of the GluA2 N370S mutant. The N370S mutant and wild-type GluA2 were co-immunoprecipitated with GluA1, suggesting that N370S was properly associated with GluA1. Moreover, we found that N413 was the main potential site of the HNK-1 epitope that promoted the interaction of GluA2 with N-cadherin, resulting in enhanced cell surface expression of GluA2. The HNK-1 epitope on N-glycan at the N413 of GluA2 was also involved in the cell surface expression of GluA1. Thus, our data suggested that site-specific N-glycans on GluA2 regulate the intracellular trafficking and cell surface expression of AMPAR.
Deletion of the GluA1 AMPA receptor subunit impairs recency-dependent object recognition memory
Sanderson, David J.; Hindley, Emma; Smeaton, Emily; Denny, Nick; Taylor, Amy; Barkus, Chris; Sprengel, Rolf; Seeburg, Peter H.; Bannerman, David M.
2011-01-01
Deletion of the GluA1 AMPA receptor subunit impairs short-term spatial recognition memory. It has been suggested that short-term recognition depends upon memory caused by the recent presentation of a stimulus that is independent of contextual–retrieval processes. The aim of the present set of experiments was to test whether the role of GluA1 extends to nonspatial recognition memory. Wild-type and GluA1 knockout mice were tested on the standard object recognition task and a context-independent recognition task that required recency-dependent memory. In a first set of experiments it was found that GluA1 deletion failed to impair performance on either of the object recognition or recency-dependent tasks. However, GluA1 knockout mice displayed increased levels of exploration of the objects in both the sample and test phases compared to controls. In contrast, when the time that GluA1 knockout mice spent exploring the objects was yoked to control mice during the sample phase, it was found that GluA1 deletion now impaired performance on both the object recognition and the recency-dependent tasks. GluA1 deletion failed to impair performance on a context-dependent recognition task regardless of whether object exposure in knockout mice was yoked to controls or not. These results demonstrate that GluA1 is necessary for nonspatial as well as spatial recognition memory and plays an important role in recency-dependent memory processes. PMID:21378100
Prenatal Exposure to Tributyltin Decreases GluR2 Expression in the Mouse Brain.
Ishida, Keishi; Saiki, Takashi; Umeda, Kanae; Miyara, Masatsugu; Sanoh, Seigo; Ohta, Shigeru; Kotake, Yaichiro
2017-01-01
Tributyltin (TBT), a common environmental contaminant, is widely used as an antifouling agent in paint. We previously reported that exposure of primary cortical neurons to TBT in vitro decreased the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 2 (GluR2) expression and subsequently increased neuronal vulnerability to glutamate. Therefore, to identify whether GluR2 expression also decreases after TBT exposure in vivo, we evaluated the changes in GluR2 expression in the mouse brain after prenatal or postnatal exposure to 10 and 25 ppm TBT through pellet diets. Although the mean feed intake and body weight did not decrease in TBT-exposed mice compared with that in control mice, GluR2 expression in the cerebral cortex and hippocampus decreased after TBT exposure during the prenatal period. These results indicate that a decrease in neuronal GluR2 may be involved in TBT-induced neurotoxicity, especially during the fetal period.
Potentiating mGluR5 Function with a Positive Allosteric Modulator Enhances Adaptive Learning
Xu, Jian; Zhu, Yongling; Kraniotis, Stephen; He, Qionger; Marshall, John J.; Nomura, Toshihiro; Stauffer, Shaun R.; Lindsley, Craig W.; Conn, P. Jeffrey; Contractor, Anis
2013-01-01
Metabotropic glutamate receptor 5 (mGluR5) plays important roles in modulating neural activity and plasticity and has been associated with several neuropathological disorders. Previous work has shown that genetic ablation or pharmacological inhibition of mGluR5 disrupts fear extinction and spatial reversal learning, suggesting that mGluR5…
Gas‒phase reactions of NO+ with Glu and γ‒Glu–Met
Wincel, H.; Fokkens, R. H.; Nibbering, N. M. M.
2000-01-01
The reactivity of the nitrosonium ion, NO+, with the amino acid Glu and the dipeptide γ‒Glu–Met in the gas phase has been investigated using the combination of chemical ionisation mass spectrometry and MS/MS. It is shown that NO+ reacts efficiently with both Glu and Glu–Met leading to the formation of the nitroso‒group containing ions at m/z 159 and 288.The formation of m/z 159, (GluNO‒18)+, is rationalized by a mechanism involving an electrophilic attack of NO+ upon the carbonyl oxygen atom ...
Directory of Open Access Journals (Sweden)
Hongqi Si
2013-01-01
Full Text Available Sodium dodecyl sulfate (SDS sedimentation volume has long been used to characterize wheat flours and meals with the aim of predicting processing and end-product qualities. In order to survey the influence of low-molecular-weight glutenin subunits (LMW-GSs at Glu-B3 locus on wheat SDS sedimentation volume, a total of 283 wheat (Triticum aestivum L. varieties including landraces and improved and introduced cultivars were analyzed using 10 allele-specific PCR markers at the Glu-B3 locus. The highest allele frequency observed in the tested varieties was Glu-B3i with 21.9% in all varieties, 21.1% in landraces, 25.5% in improved cultivars, and 12% in introduced cultivars. Glu-B3 locus represented 8.6% of the variance in wheat SDS sedimentation volume, and Glu-B3b, Glu-B3g, and Glu-B3h significantly heightened the SDS sedimentation volume, but Glu-B3a, Glu-B3c, and Glu-B3j significantly lowered the SDS sedimentation volume. For the bread-making quality, the most desirable alleles Glu-B3b and Glu-B3g become more and more popular and the least desirable alleles Glu-B3a and Glu-B3c got less and less in modern improved cultivars, suggesting that wheat grain quality in China has been significantly improved through breeding effort.
BEHAVIOR OF GLUED JOINTS OF EUCALYPTUS sp. SAWN WOOD
Directory of Open Access Journals (Sweden)
Octávio Barbosa Plaster
2008-09-01
Full Text Available This research evaluated eucalypt wood adhesion capacity. The material evaluated was a commercial sawn wood composed by a blend of species of the genus Eucalyptus. The adhesives used were resorcinol-formaldehyde and polyvinila acetate (PVAc. The wood was segregated in three density with 0% of moisture content: class 1; 2 and 3 that, when combined (class1 x class1; 2x2; 3x3; 1x2; 1x3; 2x3 resulted in six treatments. The performance of the adhesion was evaluated by the shear strength to parallel compression and by wood failure in the glue line. The obtained results allowed to conclude that the adhesion of the combinations of wood/adhesive presented satisfactory performance. The average shear strength of the joints were shown equivalent to the shear strength of the solid wood with similar performance of adhesion in the two adhesives. In general, resorcinol-formaldheyde adhesive presented higher values (74.41% for wood failure in the joints, but similar to all treatments. The adhesion of samples of higher density presented lower performance probably when only the values of wood failure are considered. The values for the strength of glued joints, in general, were similar when analyzed the results achieved with the resorcinol-formaldehyde adhesive- base 140,56 Kgf/cm2. To polyvinila acetate the values of wood failure decrease when the density increase (65.94%, but the resistance in the glue line was positively affected (140.25 Kgf/cm2. In general, the density influenced the adhesion of the joints for the employed adhesives.
Ito, Miwako; Maruyama-Funatsuki, Wakako; Ikeda, Tatsuya M; Nishio, Zenta; Nagasawa, Koichi; Tabiki, Tadashi
2015-06-01
We investigated the relationships of three allelic variations in Glu-B3 (ab, g, and h) with dough properties and bread-making quality-related characteristics using near-isogenic lines (NILs) of 'Yumechikara' that commonly carry Glu-A1a, Glu-B1b, Glu-D1d, Glu-A3f, Glu-B3ab and Glu-D3a. Measurement of peak time (PT) in a 2-g mixograph indicated that Glu-B3g was the most effective for a strong dough property, followed by Glu-B3ab, with Glu-B3h being the least effective. The results of measurement of mixing time during bread-making were similar to those for PTs, i.e., the lines carrying Glu-B3g showed the longest mixing time, followed by those of Glu-B3ab, and those of Glu-B3h showed the shortest mixing time. Since two parameters of bread-making quality, loaf volume (LV) and specific loaf volume (SLV), were affected by flour protein contents in all groups of the Glu-B3 genotype, we compared the effects of the three Glu-B3 alleles on those parameters using analysis of covariance (ANCOVA) to remove the effect of protein content. The results indicated that the Glu-B3h group showed the largest SLV, followed by the Glu-B3ab group, and the Glu-B3g group showed the smallest SLV. These results suggest that the introduction of Glu-B3h into 'Yumechikara' makes it possible to breed varieties with good bread-making quality-related characteristics.
Chen, Weiping P.; Wang, Dongning N.; Xu, Ben; Wang, Zhaokun K.; Zhao, Chun-Liu
2017-05-01
We demonstrate an optical Fabry-Perot interferometer fiber tip sensor based on a glass microsphere glued at the etched end of a multimode fiber. The fiber device is miniature and robust, with a convenient reflection mode of operation, a high temperature sensitivity of 202.6 pm/°C within the range from 5°C to 90°C, a good refractive index sensitivity of ˜119 nm/RIU within the range from 1.331 to 1.38, and a gas pressure sensitivity of 0.19 dB/MPa.
Photolabeling of Glu-129 of the S-1 subunit of pertussis toxin with NAD
Energy Technology Data Exchange (ETDEWEB)
Barbieri, J.T.; Mende-Mueller, L.M.; Rappuoli, R.; Collier, R.J. (Medical College of Wisconsin, Milwaukee (USA))
1989-11-01
UV irradiation was shown to induce efficient transfer of radiolabel from nicotinamide-labeled NAD to a recombinant protein (C180 peptide) containing the catalytic region of the S-1 subunit of pertussis toxin. Incorporation of label from (3H-nicotinamide)NAD was efficient (0.5 to 0.6 mol/mol of protein) relative to incorporation from (32P-adenylate)NAD (0.2 mol/mol of protein). Label from (3H-nicotinamide)NAD was specifically associated with Glu-129. Replacement of Glu-129 with glycine or aspartic acid made the protein refractory to photolabeling with (3H-nicotinamide)NAD, whereas replacement of a nearby glutamic acid, Glu-139, with serine did not. Photolabeling of the C180 peptide with NAD is similar to that observed with diphtheria toxin and exotoxin A of Pseudomonas aeruginosa, in which the nicotinamide portion of NAD is transferred to Glu-148 and Glu-553, respectively, in the two toxins. These results implicate Glu-129 of the S-1 subunit as an active-site residue and a potentially important site for genetic modification of pertussis toxin for development of an acellular vaccine against Bordetella pertussis.
Photolabeling of Glu-129 of the S-1 subunit of pertussis toxin with NAD
International Nuclear Information System (INIS)
Barbieri, J.T.; Mende-Mueller, L.M.; Rappuoli, R.; Collier, R.J.
1989-01-01
UV irradiation was shown to induce efficient transfer of radiolabel from nicotinamide-labeled NAD to a recombinant protein (C180 peptide) containing the catalytic region of the S-1 subunit of pertussis toxin. Incorporation of label from [3H-nicotinamide]NAD was efficient (0.5 to 0.6 mol/mol of protein) relative to incorporation from [32P-adenylate]NAD (0.2 mol/mol of protein). Label from [3H-nicotinamide]NAD was specifically associated with Glu-129. Replacement of Glu-129 with glycine or aspartic acid made the protein refractory to photolabeling with [3H-nicotinamide]NAD, whereas replacement of a nearby glutamic acid, Glu-139, with serine did not. Photolabeling of the C180 peptide with NAD is similar to that observed with diphtheria toxin and exotoxin A of Pseudomonas aeruginosa, in which the nicotinamide portion of NAD is transferred to Glu-148 and Glu-553, respectively, in the two toxins. These results implicate Glu-129 of the S-1 subunit as an active-site residue and a potentially important site for genetic modification of pertussis toxin for development of an acellular vaccine against Bordetella pertussis
DEFF Research Database (Denmark)
Clausen, Rasmus P; Mohr, Andreas Ø; Riise, Erik
2016-01-01
A method for development of murine Fab fragments towards extracellular domains of a surface receptor is presented. The GluA4 ionotropic glutamate receptor is used as a model system. Recombinant GluA4 ectodomain comprising both the N-terminal domain (NTD) and the ligand-binding domain (LBD) in one...... molecule was used for immunization. A Fab-phage library was constructed and a parallel panning approach enabled selection of murine Fab fragments towards either intact ectodomain or the isolated LBD of the GluA4 receptor. One LBD-Fab (FabL9) showed exclusive selectivity for the GluA4 LBD, over a panel...... of LBDs from GluA2, GluK1, GluK2 and GluD2. Soluble FabL9 was produced in amounts suitable for characterization. Competitive ELISA and rat-brain immunoprecipitation experiments confirmed that the FabL9 epitope is conserved in the LBD and in the intact native receptor. By an alignment of GluA2 and GluA4...
Identification of a novel signaling pathway and its relevance for GluA1 recycling.
Directory of Open Access Journals (Sweden)
Guiscard Seebohm
Full Text Available We previously showed that the serum- and glucocorticoid-inducible kinase 3 (SGK3 increases the AMPA-type glutamate receptor GluA1 protein in the plasma membrane. The activation of AMPA receptors by NMDA-type glutamate receptors eventually leads to postsynaptic neuronal plasticity. Here, we show that SGK3 mRNA is upregulated in the hippocampus of new-born wild type Wistar rats after NMDA receptor activation. We further demonstrate in the Xenopus oocyte expression system that delivery of GluA1 protein to the plasma membrane depends on the small GTPase RAB11. This RAB-dependent GluA1 trafficking requires phosphorylation and activation of phosphoinositol-3-phosphate-5-kinase (PIKfyve and the generation of PI(3,5P(2. In line with this mechanism we could show PIKfyve mRNA expression in the hippocampus of wild type C57/BL6 mice and phosphorylation of PIKfyve by SGK3. Incubation of hippocampal slices with the PIKfyve inhibitor YM201636 revealed reduced CA1 basal synaptic activity. Furthermore, treatment of primary hippocampal neurons with YM201636 altered the GluA1 expression pattern towards reduced synaptic expression of GluA1. Our findings demonstrate for the first time an involvement of PIKfyve and PI(3,5P(2 in NMDA receptor-triggered synaptic GluA1 trafficking. This new regulatory pathway of GluA1 may contribute to synaptic plasticity and memory.
Convergent evidence for mGluR5 in synaptic and neuroinflammatory pathways implicated in ASD.
Zantomio, Daniela; Chana, Gursharan; Laskaris, Liliana; Testa, Renee; Everall, Ian; Pantelis, Christos; Skafidas, Efstratios
2015-05-01
The pathogenesis of Autism Spectrum Disorder (ASD), a serious neurodevelopmental disorder, is poorly understood. We review evidence for alterations in glutamatergic signalling in the aetiology of ASD, with a focus on the metabotropic glutamate receptor-5 (mGluR5). mGluR5 signalling is important for synapse formation, neuroplasticity and long term potentiation as well as neuroprotection and has been shown to have a regulatory role in neuroinflammation. Evidence for neuroinflammation in ASD is supported by increase in pro-inflammatory cytokines in the blood and cerebrospinal fluid (CSF) and increased number and activation of microglia in postmortem dorsolateral prefrontal cortex (DLPFC). mGlur5 signalling has also been shown to downregulate microglial activation. Therefore, we focus on mGluR5 as a potential unifying explanation for synapse alteration and neuroinflammation seen in ASD. Data from mGluR5 knockout mouse models, and syndromic and non syndromic forms of ASD are discussed in relation to how alterations in mGluR5 are associated with ASD symptoms. This review supports altered mGluR5 functioning as a convergent point in ASD pathogenesis and indicates more research is warranted into mGluR5 as a potential therapeutic target. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Regulation of GluN2A by Endogenous and Exogenous Regulators in the Central Nervous System.
Sun, Yongjun; Zhan, Liying; Cheng, Xiaokun; Zhang, Linan; Hu, Jie; Gao, Zibin
2017-04-01
The NMDA receptor is the most widely studied ionotropic glutamate receptor, and it is central to many physiological and pathophysiological processes in the central nervous system. GluN2A is one of the two main types of GluN2 NMDA receptor subunits in the forebrain. The proper activity of GluN2A is important to brain function, as the abnormal regulation of GluN2A may induce some neuropsychiatric disorders. This review will examine the regulation of GluN2A by endogenous and exogenous regulators in the central nervous system.
Subspace preservation, subspace locality, and gluing of completely positive maps
International Nuclear Information System (INIS)
Aaberg, Johan
2004-01-01
Three concepts concerning completely positive maps (CPMs) and trace preserving CPMs (channels) are introduced and investigated. These are named subspace preserving (SP) CPMs, subspace local (SL) channels, and gluing of CPMs. SP CPMs has, in the case of trace preserving CPMs, a simple interpretation as those which preserve probability weights on a given orthogonal sum decomposition of the Hilbert space of a quantum system. The proposed definition of subspace locality of quantum channels is an attempt to answer the question of what kind of restriction should be put on a channel, if it is to act 'locally' with respect to two 'locations', when these naturally correspond to a separation of the total Hilbert space in an orthogonal sum of subspaces, rather than a tensor product decomposition. As a description of the concept of gluings of quantum channels, consider a pair of 'evolution machines', each with the ability to evolve the internal state of a 'particle' inserted into its input. Each of these machines is characterized by a channel describing the operation the internal state has experienced when the particle is returned at the output. Suppose a particle is put in a superposition between the input of the first and the second machine. Here it is shown that the total evolution caused by a pair of such devices is not uniquely determined by the channels of the two machines. Such 'global' channels describing the machine pair are examples of gluings of the two single machine channels. Various expressions to generate the set of SP and SL channels, as well as expressions to generate the set of gluings of given channels, are deduced. We discuss conceptual aspects of the nature of these channels and the nature of the non-uniqueness of gluings
Glued intrascleral fixation of posterior chamber intraocular lens in children.
Kumar, Dhivya Ashok; Agarwal, Amar; Prakash, Dimple; Prakash, Gaurav; Jacob, Soosan; Agarwal, Athiya
2012-04-01
To evaluate the short-term results of glued intrascleral fixation of posterior chamber intraocular lens (glued IOL) in children without adequate capsular support. Noncomparative retrospective observational case series. Institutional practice. Forty-one eyes of 33 children who underwent glued IOL implantation were retrospectively evaluated. The indications were postsurgical aphakia, subluxated cataract, ectopia lentis, traumatic subluxation, and decentered IOL. Visual acuity (VA), endothelial cell changes, intraoperative and postoperative complications. The mean age at the time of glued IOL was 10.7±3.6 years (range 5-15). The mean duration of follow-up after surgery was 17.5±8.5 months (range 12-36). The mean postoperative best spectacle-corrected visual acuity (BCVA in decimal equivalent) was 0.43±0.33 and there was significant change noted (P20/60 BCVA was obtained in 17.1% and 46.3% of eyes respectively. BCVA improvement more than 1 line was seen in 22 eyes (53.6%). The mean postoperative refraction was myopic (-1.19±0.7 diopters [D]) in 19 eyes and hyperopic (+1.02±0.7 D) in 22 eyes. The mean endothelial loss was 4.13% (range 1.3%-5.94%). The 3 causes of reduced BCVA were the preexisting corneal, retinal pathology, and amblyopia. Postoperative complications included optic capture in 1 eye (2.4%), macular edema in 2 eyes (4.8%), and clinical decentration in 2 eyes (4.8%). There was no postoperative retinal detachment, IOL dislocation, endophthalmitis, or glaucoma. Short-term results in children after glued IOL were favorable, with a low rate of complications. However, regular follow-ups are required since long-term risks are unknown. Copyright © 2012 Elsevier Inc. All rights reserved.
When does ALS start? ADAR2-GluA2 hypothesis for the etiology of sporadic ALS
Directory of Open Access Journals (Sweden)
Takuto eHideyama
2011-11-01
Full Text Available Amyotrophic lateral sclerosis (ALS is the most common adult-onset motor neuron disease. More than 90% of ALS cases are sporadic, and the majority of sporadic ALS patients do not carry mutations in genes causative of familial ALS; therefore, investigation specifically targeting sporadic ALS is needed to discover the pathogenesis. The motor neurons of sporadic ALS patients express unedited GluA2 mRNA at the Q/R site in a disease-specific and motor neuron-selective manner. GluA2 is a subunit of the AMPA receptor, and it has a regulatory role in the Ca2+-permeability of the AMPA receptor after the genomic Q codon is replaced with the R codon in mRNA by adenosine-inosine conversion, which is mediated by adenosine deaminase acting on RNA 2 (ADAR2. Therefore, ADAR2 activity may not be sufficient to edit all GluA2 mRNA expressed in the motor neurons of ALS patients. To investigate whether deficient ADAR2 activity plays pathogenic roles in sporadic ALS, we generated genetically modified mice (AR2 in which the ADAR2 gene was conditionally knocked out in the motor neurons. AR2 mice showed an ALS-like phenotype with the death of ADAR2-lacking motor neurons. Notably, the motor neurons deficient in ADAR2 survived when they expressed only edited GluA2 in AR2/GluR-BR/R (AR2res mice, in which the endogenous GluA2 alleles were replaced by the GluR-BR allele that encoded edited GluA2. In heterozygous AR2 mice with only one ADAR2 allele, approximately 20% of the spinal motor neurons expressed unedited GluA2 and underwent degeneration, indicating that half-normal ADAR2 activity is not sufficient to edit all GluA2 expressed in motor neurons. It is likely therefore that the expression of unedited GluA2 causes the death of motor neurons in sporadic ALS. We hypothesize that a progressive downregulation of ADAR2 activity plays a critical role in the pathogenesis of sporadic ALS and that the pathological process commences when motor neurons express unedited GluA2.
Age-dependent effects on social interaction of NMDA GluN2A receptor subtype-selective antagonism.
Green, Torrian L; Burket, Jessica A; Deutsch, Stephen I
2016-07-01
NMDA receptor-mediated neurotransmission is implicated in the regulation of normal sociability in mice. The heterotetrameric NMDA receptor is composed of two obligatory GluN1 and either two "modulatory" GluN2A or GluN2B receptor subunits. GluN2A and GluN2B-containing receptors differ in terms of their developmental expression, distribution between synaptic and extrasynaptic locations, and channel kinetic properties, among other differences. Because age-dependent differences in disruptive effects of GluN2A and GluN2B subtype-selective antagonists on sociability and locomotor activity have been reported in rats, the current investigation explored age-dependent effects of PEAQX, a GluN2A subtype-selective antagonist, on sociability, stereotypic behaviors emerging during social interaction, and spatial working memory in 4- and 8-week old male Swiss Webster mice. The data implicate an age-dependent contribution of GluN2A-containing NMDA receptors to the regulation of normal social interaction in mice. Specifically, at a dose of PEAQX devoid of any effect on locomotor activity and mouse rotarod performance, the social interaction of 8-week old mice was disrupted without any effect on the social salience of a stimulus mouse. Moreover, PEAQX attenuated stereotypic behavior emerging during social interaction in 4- and 8-week old mice. However, PEAQX had no effect on spontaneous alternations, a measure of spatial working memory, suggesting that neural circuits mediating sociability and spatial working memory may be discrete and dissociable from each other. Also, the data suggest that the regulation of stereotypic behaviors and sociability may occur independently of each other. Because expression of GluN2A-containing NMDA receptors occurs at a later developmental stage, they may be more involved in mediating the pathogenesis of ASDs in patients with histories of "regression" after a period of normal development than GluN2B receptors. Copyright © 2016 Elsevier Inc. All rights
40 CFR Appendix Viii to Part 268 - LDR Effective Dates of Injected Prohibited Hazardous Wastes
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false LDR Effective Dates of Injected Prohibited Hazardous Wastes VIII Appendix VIII to Part 268 Protection of Environment ENVIRONMENTAL PROTECTION... to Part 268—LDR Effective Dates of Injected Prohibited Hazardous Wastes National Capacity LDR...
(S)-homo-AMPA, a specific agonist at the mGlu6 subtype of metabotropic glutamic acid receptors
DEFF Research Database (Denmark)
Ahmadian, H; Nielsen, B; Bräuner-Osborne, Hans
1997-01-01
of the spectroscopic configurational assignments. The activities of 6 and 7 at ionotropic EAA (iGlu) receptors and at mGlu1-7 were studied. (S)-Homo-AMPA (6) was shown to be a specific agonist at mGlu6 (EC50 = 58 +/- 11 microM) comparable in potency with the endogenous mGlu agonist (S)-glutamic acid (EC50 = 20 +/- 3......Our previous publication (J. Med. Chem. 1996, 39, 3188-3194) described (RS)-2-amino-4-(3-hydroxy-5-methylisoxazol-4-yl)butyric acid (Homo-AMPA) as a highly selective agonist at the mGlu6 subtype of metabotropic excitatory amino acid (EAA) receptors. Homo-AMPA has already become a standard agonist...... microM). Although Homo-AMPA did not show significant effects at iGlu receptors, (R)-Homo-AMPA (7), which was inactive at mGlu1-7, turned out to be a weak N-methyl-D-aspartic acid (NMDA) receptor antagonist (IC50 = 131 +/- 18 microM)....
Alaska birch for edge-glued panel production—considerations for wood products manufacturers
David. Nicholls
2010-01-01
Edge-glued panels could become a natural extension for the birch (Betula papyrifera Marsh.) lumber industry in Alaska, resulting in greater utilization of the birch resource while allowing producers to explore a wider variety of products and markets. Key advantages of edge-glued panel production include the relatively low cost of equipment, the...
Reliability formulation for the strength and fire endurance of glued-laminated beams
D. A. Bender
A model was developed for predicting the statistical distribution of glued-laminated beam strength and stiffness under normal temperature conditions using available long span modulus of elasticity data, end joint tension test data, and tensile strength data for laminating-grade lumber. The beam strength model predictions compared favorably with test data for glued-...
DEFF Research Database (Denmark)
Kristensen, Anders S; Hansen, Kasper B; Naur, Peter
2016-01-01
-term depression. Here, we investigate the pharmacology of the orthosteric binding site in GluD2 by examining the activity of analogs of D-Ser and GluN1 glycine site competitive antagonists at GluD2 receptors containing the lurcher mutation (GluD2(LC)), which promotes spontaneous channel activation. We identify...
Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia
2014-04-01
Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.
Institute of Scientific and Technical Information of China (English)
纵艳艳; 裴冬生; 孙亚峰; 张光毅
2005-01-01
目的研究TAT-GluR6-9c-dansyl荧光小肽是否可以进入细胞内部.方法在培养的海马神经元中加入TAT-GluR6-9c-dansyl荧光小肽和对照肽TAT38-48-dansyl.结果用10 μmol/L TAT-GluR6-9c-dansyl处理的海马神经元在荧光显微镜下可以观到绿色荧光的出现,而对照肽TAT38-48-dansyl无荧光出现.结论 TAT-GluR6-9c-dansyl荧光小肽可以进入细胞.
Cortical GluN2B deletion attenuates punished suppression of food reward-seeking.
Radke, Anna K; Nakazawa, Kazu; Holmes, Andrew
2015-10-01
Compulsive behavior, which is a hallmark of psychiatric disorders such as addiction and obsessive-compulsive disorder, engages corticostriatal circuits. Previous studies indicate a role for corticostriatal N-methyl-D-aspartate receptors (NMDARs) in mediating compulsive-like responding for drugs of abuse, but the specific receptor subunits controlling reward-seeking in the face of punishment remain unclear. The current study assessed the involvement of corticostriatal GluN2B-containing NMDARs in measures of persistent and punished food reward-seeking. Mice with genetic deletion of GluN2B in one of three distinct neuronal populations, cortical principal neurons, forebrain interneurons, or striatal medium spiny neurons, were tested for (1) sustained food reward-seeking when reward was absent, (2) reward-seeking under a progressive ratio schedule of reinforcement, and (3) persistent reward-seeking after a footshock punishment. Mutant mice with genetic deletion of GluN2B in cortical principal neurons demonstrated attenuated suppression of reward-seeking during punishment. These mice performed normally on other behavioral measures, including an assay for pain sensitivity. Mutants with interneuronal or striatal GluN2B deletions were normal on all behavioral assays. Current findings offer novel evidence that loss of GluN2B-containing NMDARs expressed on principal neurons in the cortex results in reduced punished food reward-seeking. These data support the involvement of GluN2B subunit in cortical circuits regulating cognitive flexibility in a variety of settings, with implications for understanding the basis of inflexible behavior in neuropsychiatric disorders including obsessive-compulsive disorders (OCD) and addictions.
Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro
2017-08-11
Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 ( GluR2 ) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2 . This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT.
Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition
Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro
2017-01-01
Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 (GluR2) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2. This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT. PMID:28800112
Directory of Open Access Journals (Sweden)
D. D. Zhernossekov
2017-04-01
Full Text Available Plasminogen/plasmin system is known for its ability to support hemostatic balance of blood. However, plasminogen may be considered as an adhesive ligand and in this way could affect the functioning of blood cells. We showed that exogenous Lys-plasminogen, but not its Glu-form, inhibited platelet aggregation and suppressed platelet α-granule secretion. The aim of this work was to investigate the influence of Glu- and Lys-form of plasminogen on the formation of platelet procoagulant surface using phosphatidylserine exposure as a marker. Human platelets were obtained from human platelet-rich plasma (donors were healthy volunteers, men aged 30-40 years by gel-filtration on Sepharose 2B. Phosphatidylserine exposure on the platelet surface was evaluated by flow cytometry with FITC-conjugated annexin A5. Glu- and Lys-plasminogen have different impact on the platelet functioning. Exogenous Lys-plasminogen has no significant effect on phosphatidylserine exposure, while Glu-plasminogen increases phosphatidylserine exposure on the surface of thrombin- and collagen-activated human platelets. Glu-plasminogen can be considered as a co-stimulator of agonist-induced platelet secretion and procoagulant surface formation. Meanwhile effects of Lys-plasminogen are probably directed at platelet-platelet interactions and not related to agonist-stimulated pro-apoptotic changes. The observed different effects of Glu- and Lys-plasminogen on phosphatidylserine exposure can be explained by their structural peculiarities.
Kimoto, Sohei; Bazmi, H Holly; Lewis, David A
2014-09-01
Cognitive deficits of schizophrenia may be due at least in part to lower expression of the 67-kDa isoform of glutamic acid decarboxylase (GAD67), a key enzyme for GABA synthesis, in the dorsolateral prefrontal cortex of individuals with schizophrenia. However, little is known about the molecular regulation of lower cortical GAD67 levels in schizophrenia. The GAD67 promoter region contains a conserved Zif268 binding site, and Zif268 activation is accompanied by increased GAD67 expression. Thus, altered expression of the immediate early gene Zif268 may contribute to lower levels of GAD67 mRNA in the dorsolateral prefrontal cortex in schizophrenia. The authors used polymerase chain reaction to quantify GAD67 and Zif268 mRNA levels in dorsolateral prefrontal cortex area 9 from 62 matched pairs of schizophrenia and healthy comparison subjects, and in situ hybridization to assess Zif268 expression at laminar and cellular levels of resolution. The effects of potentially confounding variables were assessed in human subjects, and the effects of antipsychotic treatments were tested in antipsychotic-exposed monkeys. The specificity of the Zif268 findings was assessed by quantifying mRNA levels for other immediate early genes. GAD67 and Zif268 mRNA levels were significantly lower and were positively correlated in the schizophrenia subjects. Both Zif268 mRNA-positive neuron density and Zif268 mRNA levels per neuron were significantly lower in the schizophrenia subjects. These findings were robust to the effects of the confounding variables examined and differed from other immediate early genes. Deficient Zif268 mRNA expression may contribute to lower cortical GAD67 levels in schizophrenia, suggesting a potential mechanistic basis for altered cortical GABA synthesis and impaired cognition in schizophrenia.
Directory of Open Access Journals (Sweden)
Chihiro Sugiyama
2015-01-01
Full Text Available In vitro estimating strategies for potential neurotoxicity are required to screen multiple substances. In a previous study, we showed that exposure to low-concentrations of some chemicals, such as organotin, decreased the expression of GluR2 protein, which is a subunit of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA-type glutamate receptors, and led to neuronal vulnerability. This result suggested that GluR2 decreases as an index of neuronal cell sensitivity and vulnerability to various toxic insults. Accordingly, we developed a versatile method that is a large scale determination of GluR2 protein expression in the presence of environmental chemicals by means of AlphaLISA technology. Various analytical conditions were optimized, and then GluR2 protein amount was measured by the method using AlphaLISA. The GluR2 amounts were strongly correlated with that of measured by western blotting, which is currently used to determine GluR2 expression. An ideal standard curve could be written with the authentic GluR2 protein from 0 ng to 100 ng. Subsequently, twenty environmental chemicals were screened and nitenpyram was identified as a chemical which lead to decrease in GluR2 protein expression. This assay may provide a tool for detecting neurotoxic chemicals according to decreases in GluR2 protein expression.
The Role of GluK4 in Synaptic Plasticity and Affective Behavior in Mice
Catches, Justin Samuel
Kainate receptors (KARs) are glutamate-gated ion channels that signal through both ionotropic and metabotropic pathways (Contractor et al., 2011). Combinations of five KAR subunits (GluK1-5) form tetrameric receptors with GluK1, GluK2, and GluK3 able to form functional homomeric channels. The high-affinity subunits, GluK4 and GluK5, do not form homomeric channels but modify the properties of heteromeric receptors. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs modulate synaptic plasticity. In this study, ablation of Grik4, which encodes GluK4, in mice reduced KAR synaptic currents and altered activation properties of postsynaptic receptors but left two forms of presynaptic short-term plasticity intact. Disruption of both Grik4 and Grik5 caused complete loss of the postsynaptic ionotropic KAR current and impaired presynaptic frequency facilitation. Additionally, KAR surface expression was altered at pre- and postsynaptic sites at the MF synapse. Despite the loss of ionotropic signaling, KAR-mediated inhibition of the slow afterhyperpolarization current, which is dependent on metabotropic signaling, was intact in CA3 neurons. Long-term potentiation at the MF-CA3 synapse was reduced, likely through a loss of KAR modulation of excitability of the presynaptic MF axons. Genetic variants in the human GRIK4 gene alter the susceptibility for affective disorders (Bloss and Hunter, 2010). We found that ablation of Grik4 in mice resulted in reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, and in two anxiogenic tests, marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim, a test of learned helplessness used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting
Bahi, Amine; Fizia, Katharina; Dietz, Monika; Gasparini, Fabrizio; Flor, Peter J
2012-03-01
Growing evidence supports a role for the central nervous system (CNS) neurotransmitter L-glutamate and its metabotropic receptors (mGluRs) in drug addiction in general and alcohol-use disorders in particular. Alcohol dependence, for instance, has a genetic component, and the recent discovery that variations in the gene coding for mGluR7 modulate alcohol consumption further validates involvement of the L-glutamate system. Consequently, increasing interest emerges in developing L-glutamatergic therapies for the treatment of alcohol abuse and dependence. To this end, we performed a detailed behavioral pharmacology study to investigate the regulation of alcohol consumption and preference following administration of the mGluR7-selective drugs N,N'-dibenzyhydryl-ethane-1,2-diamine dihydrochloride (AMN082) and 6-(4-Methoxyphenyl)-5-methyl-3-(4-pyridinyl)-isoxazolo[4,5-c]pyridin-4(5H)-one hydrochloride (MMPIP). Upon administration of the allosteric agonist AMN082 (10 mg/kg, i.p.) in rats, there was a significant decrease in ethanol consumption and preference, without affecting ethanol blood metabolism. In contrast, mGluR7 blockade with MMPIP (10 mg/kg, i.p.) showed an increase in alcohol intake and reversed AMN082's effect on ethanol consumption and preference. Both mGluR7-directed pharmacological tools had no effect on total fluid intake, taste preference, or on spontaneous locomotor activity. In conclusion, these findings support a specific regulatory role for mGluR7 on alcohol drinking and preference and provide evidence for the use of AMN082-type drugs as potential new treatments for alcohol-use disorders in man. © 2011 The Authors, Addiction Biology © 2011 Society for the Study of Addiction.
Therapeutic potential of mGluR5 targeting in Alzheimer's disease
Directory of Open Access Journals (Sweden)
Anil eKumar
2015-06-01
Full Text Available Decades of research dedicated towards Alzheimer's disease (AD has culminated in much of the current understanding of the neurodegeneration associated with disease. However, delineating the pathophysiology and finding a possible cure for the disease is still wanting. This is in part due to the lack of knowledge pertaining to the connecting link between neurodegenerative and neuroinflammatory pathways. Consequently, the inefficacy and ill-effects of the drugs currently available for AD encourage the need for alternative and safe therapeutic intervention. In this review we highlight the potential of mGluR5, a metabotropic glutamatergic receptor, in understanding the mechanism underlying the neuronal death and neuroinflammation in AD. We also discuss the role of mGlu5 receptor in mediating the neuron-glia interaction in the disease. Finally, we discuss the potential of mGluR5 as target for treating AD.
Bossi, Simone; Musante, Ilaria; Bonfiglio, Tommaso; Bonifacino, Tiziana; Emionite, Laura; Cerminara, Maria; Cervetto, Chiara; Marcoli, Manuela; Bonanno, Giambattista; Ravazzolo, Roberto; Pittaluga, Anna; Puliti, Aldamaria
2018-01-01
Deleterious mutations in the glutamate receptor metabotropic 1 gene (GRM1) cause a recessive form of cerebellar ataxia, SCAR13. GRM1 and GRM5 code for the metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, respectively. Their different expression profiles suggest they could have distinct functional roles. In a previous study, homozygous mice lacking mGlu1 receptors (Grm1 crv4/crv4 ) and exhibiting ataxia presented cerebellar overexpression of mGlu5 receptors, that was proposed to contribute to the mouse phenotype. To test this hypothesis, we here crossed Grm1 crv4 and Grm5 ko mice to generate double mutants (Grm1 crv4/crv4 Grm5 ko/ko ) lacking both mGlu1 and mGlu5 receptors. Double mutants and control mice were analyzed for spontaneous behavior and for motor activity by rotarod and footprint analyses. In the same mice, the release of glutamate from cerebellar nerve endings (synaptosomes) elicited by 12mM KCl or by α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) was also evaluated. Motor coordination resulted improved in double mutants when compared to Grm1 crv4/crv4 mice. Furthermore, in in vitro studies, glutamate release elicited by both KCl depolarization and activation of AMPA autoreceptors resulted reduced in Grm1 crv4/crv4 mice compared to wild type mice, while it presented normal levels in double mutants. Moreover, we found that Grm1 crv4/crv4 mice showed reduced expression of GluA2/3 AMPA receptor subunits in cerebellar synaptosomes, while it resulted restored to wild type level in double mutants. To conclude, blocking of mGlu5 receptor reduced the dysregulation of glutamate transmission and improved motor coordination in the Grm1 crv4 mouse model of SCAR13, thus suggesting the possible usefulness of pharmacological therapies based on modulation of mGlu5 receptor activity for the treatment of this type of ataxia. Copyright © 2017 Elsevier Inc. All rights reserved.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes VII Appendix VII to Part 268 Protection of Environment ENVIRONMENTAL... VII to Part 268—LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes Table 1—Effective...
International Nuclear Information System (INIS)
Enginar, H.
2012-01-01
In current study, ethyl-morphine (em) was synthesized from the morphine and glucuronidated via enzymatic mechanism. The conjugated glucuronide ethyl-morphine (em-glu) was radiolabeled with 131 I using iodogen method. The quality control studies of radiolabeled compound ( 131 I-em-glu) were done with Thin Layer Radio Chromatography to confirm the radiolabeling efficiency. Biodistribution studies of 131 I labeled em-glu were run on healthy male Albino Wistar rats. The distribution figures demonstrated that 131 I-em-glu was eliminated through the small intestine, large intestine and accumulated in urinary bladder both receptor blocked and unblocked biodistribution studies. A greater uptake of the radiolabeled substance was observed in the m.pons, hypothalamus and mid brain than in the other branches of the rats' brains. (author)
Structural Evaluation of the Second Oldest Glued-Laminated Structure in the United States
Douglas R. Rammer; Jorge de Melo Moura
2013-01-01
The second glued-laminated structure built in the United States was constructed at the USDA Forest Products Laboratory (FPL) in 1934 to demonstrate the performance of wooden arch buildings. After decades of use the structure was decommissioned in 2010. Shortly after construction, researchers structurally evaluated the glued-laminated arch structure for uniform loading...
M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.
Zhao, Lan-Xue; Ge, Yan-Hui; Xiong, Cai-Hong; Tang, Ling; Yan, Ying-Hui; Law, Ping-Yee; Qiu, Yu; Chen, Hong-Zhuan
2018-03-06
M1 muscarinic acetylcholine receptors (M1 mAChRs) are the most abundant muscarinic receptors in the hippocampus and have been shown to have procognitive effects. AMPA receptors (AMPARs), an important subtype of ionotropic glutamate receptors, are key components in neurocognitive networks. However, the role of AMPARs in procognitive effects of M1 mAChRs and how M1 mAChRs affect the function of AMPARs remain poorly understood. Here, we found that basal expression of GluA1, a subunit of AMPARs, and its phosphorylation at Ser845 were maintained by M1 mAChR activity. Activation of M1 mAChRs promoted membrane insertion of GluA1, especially to postsynaptic densities. Impairment of hippocampus-dependent learning and memory by antagonism of M1 mAChRs paralleled the reduction of GluA1 expression, and improvement of learning and memory by activation of M1 mAChRs was accompanied by the synaptic insertion of GluA1 and its increased phosphorylation at Ser845. Furthermore, abrogation of phosphorylation of Ser845 residue of GluA1 ablated M1 mAChR-mediated improvement of learning and memory. Taken together, these results show a functional correlation of M1 mAChRs and GluA1 and the essential role of GluA1 in M1 mAChR-mediated cognitive improvement.-Zhao, L.-X., Ge, Y.-H., Xiong, C.-H., Tang, L., Yan, Y.-H., Law, P.-Y., Qiu, Y., Chen, H.-Z. M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.
49 CFR 268.7 - Federal/State share and restrictions on the uses of Federal Maglev Funds.
2010-10-01
... of Federal Maglev Funds. 268.7 Section 268.7 Transportation Other Regulations Relating to... Federal Maglev Funds. (a) Federal share. The Federal share of Full Projects Costs shall be not more than 2...) Restrictions on the uses of Federal Maglev Funds. (1) Federal Maglev Funds may be applied only to Eligible...
Effects of microwave exposure on motor learning and GluR2 phosphorylation in rabbit cerebellum
International Nuclear Information System (INIS)
Liu Yong; Wang Denggao; Zhang Guangbin; Zhou Wen; Yang Xuesen
2007-01-01
Objective: To investigate the effects of microwave exposure on motor learning and Glutamate receptor 2(GluR2) phosphorylation in rat cerebellum. Methods: The rabbits were trained for seven days to form eye-blink conditioning, and then divided randomly into control and microwave exposure group (at hours 0,3,24 and 72 subgroups after exposure, respectively). The rabbits were accepted 90 mW/cm 2 microwave exposure for 30 minutes, and the rectal temperature were detected immediately after exposure and specific absorption rate (SAR) value were calculated. Eye-blink conditioning were detected immediately after exposure, and cerebellar GluR2 protein and GluR2 phosphorylation were detected with Western blotting. Results: Rectal temperature of rabbits were increased by 3.02 degree C after exposure, and SAR value was 8.74 W/kg. The eye-blink conditioning decreased significantly after exposure, and cerebellar GluR2 protein expression had no significant alteration but phosphorylation reduced significantly after exposure. Conclusions: 90 mW/cm 2 microwave exposure has injurious effects on cerebellar GluR2 phosphorylation and motor learning. (authors)
Structural Performance of the Second Oldest Glued-Laminated Structure in the United States
Douglas R. Rammer; Jorge de Melo Moura; Robert J. Ross
2014-01-01
The second glued-laminated structure built in the United States was constructed at the USDA Forest Products Laboratory (FPL) in 1934 to demonstrate the performance of wooden arch buildings. After 75 years of use the structure was decommissioned in 2010. Shortly after construction, researchers structurally evaluated the glued-laminated arch structure for uniform loading...
Construction of a high affinity zinc binding site in the metabotropic glutamate receptor mGluR1
DEFF Research Database (Denmark)
Jensen, Anders A.; Sheppard, P O; Jensen, L B
2001-01-01
a molecular model of the ATD of mGluR1 based on a weak amino acid sequence similarity with a bacterial periplasmic binding protein. The ATD consists of two globular lobes, which are speculated to contract from an "open" to a "closed" conformation following agonist binding. In the present study, we have...... created a Zn(2+) binding site in mGluR1b by mutating the residue Lys(260) to a histidine. Zinc acts as a noncompetitive antagonist of agonist-induced IP accumulation on the K260H mutant with an IC(50) value of 2 microm. Alanine mutations of three potential "zinc coligands" in proximity to the introduced...
Strenght of the glue line of edge glued panels of Pinus taeda made with different adhesives
Directory of Open Access Journals (Sweden)
Merielen de Carvalho Lopes
2013-12-01
Full Text Available The study compares the strength of the glue line of edge glued panels of Pinus taeda made with different industrial adhesives. Three types of adhesives (poly(vinyl acetate (PVAc, emulsion polymer isocyanate (EPI and polyurethane (PU glued in two side gluing orientation (radial and tangential and analyzed after the conditioning tests (dry and wet were analyzed. The 360 specimens were prepared for determining the shear strength of edge glued panels of Pinus taeda, and these were tested in a universal testing machine called EMIC. The shear strength of the glue line at dry condition was lower in the tangential side for the three types of adhesives analyzed. The PU adhesive showed the highest values of shear strength in the applied conditions, differing from PVAc and EPI adhesive when tested on dry condition and did not differ from the others adhesives when tested on wet condition. The highest percentage of wood failure was observed after the shear strength test at dry condition to EPI adhesive glued in the radial side. And in the wet condition, the EPI adhesive and PU adhesive glued in tangential side showed higher mean values of wood failure. Thus, it was possible to conclude that the strength of the glue line of Pinus taeda wood was influenced by the type of adhesive and side gluing orientation, and showed differently behavior according to the condition of use (wet or dry.
Role of NMDA receptor GluN2D subunit in the antidepressant effects of enantiomers of ketamine
Directory of Open Access Journals (Sweden)
Soichiro Ide
2017-11-01
Full Text Available We investigated the rapid and sustained antidepressant effects of enantiomers of ketamine in N-methyl-d-aspartate (NMDA receptor GluN2D subunit knockout (GluN2D-KO mice. Intraperitoneal administration of ketamine or its enantiomers 10 min before the tail-suspension test exerted significant antidepressant effects on restraint stress-induced depression in both wildtype and GluN2D-KO mice. The antidepressant effects of (RS-ketamine and (S-ketamine were sustained 96 h after the injection in both wildtype and GluN2D-KO mice, but such sustained antidepressant effects of (R-ketamine were only observed in wildtype mice. These data suggest that the GluN2D subunit is critical for the sustained antidepressant effects of (R-ketamine.
Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures
Energy Technology Data Exchange (ETDEWEB)
Little, M. W.; Oakley, T.; Briggs, J. H.; Sutcliffe, J. A.; Allouni, A. K.; Makris, G.; Bratby, M. J.; Tapping, C. R.; Patel, R.; Wigham, A.; Anthony, S.; Phillips-Hughes, J.; Uberoi, R., E-mail: Raman.uberoi@ouh.nhs.uk [Oxford University Hospitals NHS Foundation Trust, Department of Interventional Radiology, John Radcliffe Hospital (United Kingdom)
2016-10-15
AimsTo assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction.Methodology268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28–98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %).ResultsOverall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %.ConclusionLesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.
Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures
International Nuclear Information System (INIS)
Little, M. W.; Oakley, T.; Briggs, J. H.; Sutcliffe, J. A.; Allouni, A. K.; Makris, G.; Bratby, M. J.; Tapping, C. R.; Patel, R.; Wigham, A.; Anthony, S.; Phillips-Hughes, J.; Uberoi, R.
2016-01-01
AimsTo assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction.Methodology268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28–98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %).ResultsOverall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %.ConclusionLesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.
Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures.
Little, M W; Oakley, T; Briggs, J H; Sutcliffe, J A; Allouni, A K; Makris, G; Bratby, M J; Tapping, C R; Patel, R; Wigham, A; Anthony, S; Phillips-Hughes, J; Uberoi, R
2016-10-01
To assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction. 268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28-98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %). Overall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %. Lesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.
Olszewski, Rafal T; Janczura, Karolina J; Bzdega, Tomasz; Der, Elise K; Venzor, Faustino; O'Rourke, Brennen; Hark, Timothy J; Craddock, Kirsten E; Balasubramanian, Shankar; Moussa, Charbel; Neale, Joseph H
2017-09-01
Glutamate carboxypeptidase II (GCPII) inactivates the peptide neurotransmitter N-acetylaspartylglutamate (NAAG) following synaptic release. Inhibitors of GCPII increase extracellular NAAG levels and are efficacious in animal models of clinical disorders via NAAG activation of a group II metabotropic glutamate receptor. mGluR2 and mGluR3 knock-out (ko) mice were used to test the hypothesis that mGluR3 mediates the activity of GCPII inhibitors ZJ43 and 2-PMPA in animal models of memory and memory loss. Short- (1.5 h) and long- (24 h) term novel object recognition tests were used to assess memory. Treatment with ZJ43 or 2-PMPA prior to acquisition trials increased long-term memory in mGluR2, but not mGluR3, ko mice. Nine month-old triple transgenic Alzheimer's disease model mice exhibited impaired short-term novel object recognition memory that was rescued by treatment with a NAAG peptidase inhibitor. NAAG peptidase inhibitors and the group II mGluR agonist, LY354740, reversed the short-term memory deficit induced by acute ethanol administration in wild type mice. 2-PMPA also moderated the effect of ethanol on short-term memory in mGluR2 ko mice but failed to do so in mGluR3 ko mice. LY354740 and ZJ43 blocked ethanol-induced motor activation. Both GCPII inhibitors and LY354740 also significantly moderated the loss of motor coordination induced by 2.1 g/kg ethanol treatment. These data support the conclusion that inhibitors of glutamate carboxypeptidase II are efficacious in object recognition models of normal memory and memory deficits via an mGluR3 mediated process, actions that could have widespread clinical applications.
Exploring Valued-Added Options - Edge-Glued Panels and Blanks Offer Value-Added Opportunities
Bob Smith; Philip A. Araman
1997-01-01
As sawmills search for new opportunities to add value to rough sawn lumber, many consider producing dimension parts as one solution. Assembling dimension parts into edge-glued panels or standard blanks can add even further value. Blanks are defined as pieces of solid wood (which may be edge-glued) that are manufactured to a predetermined size. This article discusses...
Varga, Balázs; Kassai, Ferenc; Gyertyán, István
2012-12-01
CB(1) receptor antagonists proved to be effective anti-obesity drugs, however, their depressive and anxiogenic effects became also evident. Finding solution to overcome these psychiatric side effects is still in focus of research. Based on the available clinical and preclinical results we hypothesized that the combination of CB(1) and mGlu(5) receptor antagonisms may result in a pharmacological intervention, where the anxiolytic mGlu(5) receptor inhibition may counteract the anxiogenic psychiatric side effects of CB(1) antagonism, while CB(1) antagonism may ameliorate the memory impairing effect of mGlu(5) receptor antagonism. Further, the two components will synergistically interact in blocking food-intake and reducing obesity. For testing the interaction of mGlu(5) and CB(1) receptor antagonism MTEP [3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pridine; SIB-1757, 6-methyl-2-(phenylazo)-3-pyridinol)] (mGlu(5) antagonist) and rimonabant [(5-(4-Chlorophenyl)-1-(2,4-dichloro-phenyl)-4-methyl-N-(piperidin-1-yl)-1H-pyrazole-3-carboxamide)hydrochloride] (CB(1) antagonist) were used. All experiments were carried out in rats. Effects of the compounds on anxiety were tested in two foot shock induced ultrasonic vocalization paradigms, appetite suppression was assessed in the food intake test, while memory effects were tested in a context conditioned ultrasonic vocalization setup. MTEP abolished the anxiogenic effect of rimonabant, while there was an additive cooperation in suppressing appetite. However, rimonabant did not ameliorate the memory impairing effect of MTEP. By combination of CB(1) and mGluR5 antagonism, anxiety related side effects might be attenuated, appetite suppression maintained, nevertheless, the possible emergence of unwanted memory impairments can overshadow its therapeutic success. Copyright © 2012 Elsevier Inc. All rights reserved.
Coppedè, Fabio; Lo Gerfo, Annalisa; Carlesi, Cecilia; Piazza, Selina; Mancuso, Michelangelo; Pasquali, Livia; Murri, Luigi; Migliore, Lucia; Siciliano, Gabriele
2010-02-01
Impairments in DNA repair enzymes have been observed in amyotrophic lateral sclerosis (ALS) tissues, particularly in the activity of the apurinic/apyrimidinic endonuclease 1 (APEX1). Moreover, it was suggested that the common APEX1 Asp148Glu polymorphism might be associated with ALS risk. To further address this question we performed the present study aimed at evaluating the contribution of the APEX1 Asp148Glu polymorphism in sporadic ALS (sALS) risk and clinical presentation, including age and site of onset and disease progression. We screened 134 sALS Italian patients and 129 matched controls for the presence of the APEX1 Asp148Glu polymorphism. No difference in APEX1 Asp148Glu allele and genotype frequencies was found between the groups, nor was the polymorphism associated with age and site of onset or disease progression. Present results do not support a role for the APEX1 Asp148Glu polymorphism in sALS pathogenesis in the Italian population.
24 CFR 203.268 - Pro rata payment of periodic MIP.
2010-04-01
... HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES SINGLE FAMILY MORTGAGE INSURANCE Contract Rights and Obligations Mortgage Insurance Premiums-Periodic Payment § 203.268 Pro rata payment of periodic MIP. (a) If the insurance contract is terminated...
12 CFR 268.503 - Enforcement of final EEOC decisions.
2010-01-01
... the decision pursuant to title VII, the ADEA, the Equal Pay Act or the Rehabilitation Act and to seek... RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Remedies and Enforcement § 268.503 Enforcement of final... Procedures Act, 5 U.S.C. 701 et seq., and the mandamus statute, 28 U.S.C. 1361, or to commence de novo...
12 CFR 268.407 - Civil action: Equal Pay Act.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Civil action: Equal Pay Act. 268.407 Section... Civil action: Equal Pay Act. A complainant is authorized under section 16(b) of the Fair Labor Standards..., if the violation is willful, three years of the date of the alleged violation of the Equal Pay Act...
NMDA-induced potentiation of mGluR5 is mediated by activation of protein phosphatase 2B/calcineurin
Alagarsamy, Sudar; Saugstad, Julie; Warren, Lee; Mansuy, Isabelle M.; Gereau, Robert W.; Conn, P. Jeffrey
2010-01-01
Previous reports have shown that activation of N-methyl-D-aspartate (NMDA) receptors potentiates responses to activation of the group I metabotropic glutamate receptor mGluR5 by reversing PKC-mediated desensitization of this receptor. NMDA-induced reversal of mGluR5 desensitization is dependent on activation of protein phosphatases. However, the specific protein phosphatase involved and the precise mechanism by which NMDA receptor activation reduces mGluR desensitization are not known. We have performed a series of molecular, biochemical, and genetic studies to show that NMDA-induced regulation of mGluR5 is dependent on activation of calcium-dependent protein phosphatase 2B/calcineurin (PP2B/CaN). Furthermore, we report that purified calcineurin directly dephosphorylates the C-terminal tail of mGluR5 at sites that are phosphorylated by PKC. Finally, immunoprecipitation and GST fusion protein pull-down experiments reveal that calcineurin interacts with mGluR5, suggesting that these proteins could be colocalized in a signaling complex. Taken together with previous studies, these data suggest that activation of NMDA receptors leads to activation of calcineurin and that calcineurin modulates mGluR5 function by directly dephosphorylating mGluR5 at PKC sites that are involved in desensitization of this receptor. 2005 Elsevier Ltd. All rights reserved. PMID:16005030
Zhou, Chengwen; Sun, Hongyu; Klein, Peter M.; Jensen, Frances E.
2015-01-01
Neonatal seizures are commonly caused by hypoxic and/or ischemic injury during birth and can lead to long-term epilepsy and cognitive deficits. In a rodent hypoxic seizure (HS) model, we have previously demonstrated a critical role for seizure-induced enhancement of the AMPA subtype of glutamate receptor (GluA) in epileptogenesis and cognitive consequences, in part due to GluA maturational upregulation of expression. Similarly, as the expression and function of the N-Methyl-D-aspartate (NMDA) subtype of glutamate receptor (GluN) is also developmentally controlled, we examined how early life seizures during the critical period of synaptogenesis could modify GluN development and function. In a postnatal day (P)10 rat model of neonatal seizures, we found that seizures could alter GluN2/3 subunit composition of GluNs and physiological function of synaptic GluNs. In hippocampal slices removed from rats within 48–96 h following seizures, the amplitudes of synaptic GluN-mediated evoked excitatory postsynaptic currents (eEPSCs) were elevated in CA1 pyramidal neurons. Moreover, GluN eEPSCs showed a decreased sensitivity to GluN2B selective antagonists and decreased Mg2+ sensitivity at negative holding potentials, indicating a higher proportion of GluN2A and GluN3A subunit function, respectively. These physiological findings were accompanied by a concurrent increase in GluN2A phosphorylation and GluN3A protein. These results suggest that altered GluN function and expression could potentially contribute to future epileptogenesis following neonatal seizures, and may represent potential therapeutic targets for the blockade of future epileptogenesis in the developing brain. PMID:26441533
Stiffness analysis of glued connection of the timber-concrete structure
Daňková, Jana; Mec, Pavel; Majstríková, Tereza
2016-01-01
This paper presents results of experimental and mathematical analysis of stiffness characteristics of a composite timber-concrete structure. The composite timberconcrete structure presented herein is non-typical compared to similar types of building structures. The interaction between the timber and concrete part of the composite cross-section is not based on metal connecting elements, but it is ensured by a glued-in perforated mesh made of plywood. The paper presents results of experimental and mathematical analysis for material alternatives of the solution of the glued joint. The slip modulus values were determined experimentally. Data obtained from the experiment evaluated by means of regression analysis. Test results were also used as input data for the compilation of a 3D model of a composite structure by means of the 3D finite element model. On the basis of result evaluation, it can be stated that the stress-deformation behaviour at shear loading of this specific timber-concrete composite structure can be affected by the type of glue used. Parameters of the 3D model of both alternative of the structure represent well the behaviour of the composite structure and the model can be used for predicting design parameters of a building structure.
Association between ALDH 2 Glu504Lys polymorphism and ...
African Journals Online (AJOL)
: a meta-analysis. Jiang Xinhua, Zhao Yanfei. Abstract. Background: The findings from studies on the relationship between aldehyde dehydrogenases(ALDH) gene Glu504Lys polymorphism and colorectal cancer(CRC) were inconsistent.
Role of NMDA receptor GluN2D subunit in the antidepressant effects of enantiomers of ketamine.
Ide, Soichiro; Ikekubo, Yuiko; Mishina, Masayoshi; Hashimoto, Kenji; Ikeda, Kazutaka
2017-11-01
We investigated the rapid and sustained antidepressant effects of enantiomers of ketamine in N-methyl-d-aspartate (NMDA) receptor GluN2D subunit knockout (GluN2D-KO) mice. Intraperitoneal administration of ketamine or its enantiomers 10 min before the tail-suspension test exerted significant antidepressant effects on restraint stress-induced depression in both wildtype and GluN2D-KO mice. The antidepressant effects of (RS)-ketamine and (S)-ketamine were sustained 96 h after the injection in both wildtype and GluN2D-KO mice, but such sustained antidepressant effects of (R)-ketamine were only observed in wildtype mice. These data suggest that the GluN2D subunit is critical for the sustained antidepressant effects of (R)-ketamine. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
Rankinen, T; Rice, T; Pérusse, L; Chagnon, Y C; Gagnon, J; Leon, A S; Skinner, J S; Wilmore, J H; Rao, D C; Bouchard, C
2000-11-01
Endothelium-dependent vasodilation is a mechanism that may affect blood pressure response to endurance training. Because NO plays a central role in this process, the endothelial NO synthase gene is a good candidate for the regulation of exercise blood pressure. We investigated the associations between an endothelial NO synthase gene polymorphism (Glu298Asp) and endurance training-induced changes in resting and submaximal exercise blood pressure in 471 white subjects of the HERITAGE Family Study. Two submaximal exercise tests at 50 W were conducted both before and after a 20-week endurance training program. Steady-state exercise blood pressure was measured twice in each test with an automated unit. The Glu298Asp polymorphism was typed with a PCR-based method and digestion with BAN:II. Both systolic and diastolic blood pressure at 50 W decreased in response to the training program, whereas resting blood pressure remained unchanged. The decrease in diastolic blood pressure at 50 W was greater (P=0.0005, adjusted for age, gender, baseline body mass index, and baseline diastolic blood pressure at 50 W) in the Glu/Glu homozygotes (4.4 [SEM 0.4] mm Hg, n=187) than in the heterozygotes (3.1 [0.4] mm Hg, n=213) and the Asp/Asp homozygotes (1.3 [0.7] mm Hg, n=71). The genotype accounted for 2.3% of the variance in diastolic blood pressure at 50 W training response. Both the Glu298 homozygotes and the heterozygotes had a greater (P=0.013) training-induced reduction in rate-pressure product at 50 W than the Asp298 homozygotes. These data suggest that DNA sequence variation in the endothelial NO synthase gene locus is associated with the endurance training-induced decreases in submaximal exercise diastolic blood pressure and rate-pressure product in sedentary normotensive white subjects.
Fear extinction induces mGluR5-mediated synaptic and intrinsic plasticity in infralimbic neurons.
Sepulveda-Orengo, Marian T; Lopez, Ana V; Soler-Cedeño, Omar; Porter, James T
2013-04-24
Studies suggest that plasticity in the infralimbic prefrontal cortex (IL) in rodents and its homolog in humans is necessary for inhibition of fear during the recall of fear extinction. The recall of extinction is impaired by locally blocking metabotropic glutamate receptor type 5 (mGluR5) activation in IL during extinction training. This finding suggests that mGluR5 stimulation may lead to IL plasticity needed for fear extinction. To test this hypothesis, we recorded AMPA and NMDA currents, AMPA receptor (AMPAR) rectification, and intrinsic excitability in IL pyramidal neurons in slices from trained rats using whole-cell patch-clamp recording. We observed that fear extinction increases the AMPA/NMDA ratio, consistent with insertion of AMPARs into IL synapses. In addition, extinction training increased inward rectification, suggesting that extinction induces the insertion of calcium-permeable (GluA2-lacking) AMPARs into IL synapses. Consistent with this, selectively blocking calcium-permeable AMPARs with Naspm reduced the AMPA EPSCs in IL neurons to a larger degree after extinction. Extinction-induced changes in AMPA/NMDA ratio, rectification, and intrinsic excitability were blocked with an mGluR5 antagonist. These findings suggest that mGluR5 activation leads to consolidation of fear extinction by regulating the intrinsic excitability of IL neurons and modifying the composition of AMPARs in IL synapses. Therefore, impaired mGluR5 activity in IL synapses could be one factor that causes inappropriate modulation of fear expression leading to anxiety disorders.
Cysteine 893 is a target of regulatory thiol modifications of GluA1 AMPA receptors.
Directory of Open Access Journals (Sweden)
Lotta von Ossowski
Full Text Available Recent studies indicate that glutamatergic signaling involves, and is regulated by, thiol modifying and redox-active compounds. In this study, we examined the role of a reactive cysteine residue, Cys-893, in the cytosolic C-terminal tail of GluA1 AMPA receptor as a potential regulatory target. Elimination of the thiol function by substitution of serine for Cys-893 led to increased steady-state expression level and strongly reduced interaction with SAP97, a major cytosolic interaction partner of GluA1 C-terminus. Moreover, we found that of the three cysteine residues in GluA1 C-terminal tail, Cys-893 is the predominant target for S-nitrosylation induced by exogenous nitric oxide donors in cultured cells and lysates. Co-precipitation experiments provided evidence for native association of SAP97 with neuronal nitric oxide synthase (nNOS and for the potential coupling of Ca2+-permeable GluA1 receptors with nNOS via SAP97. Our results show that Cys-893 can serve as a molecular target for regulatory thiol modifications of GluA1 receptors, including the effects of nitric oxide.
Yu, Fei; Zhong, Peng; Liu, Xiaojie; Sun, Dalong; Gao, Hai-qing; Liu, Qing-song
2013-01-01
Antagonism of group I metabotropic glutamate receptors (mGluR1 and mGluR5) reduces behavioral effects of drugs of abuse, including cocaine. However, the underlying mechanisms remain poorly understood. Activation of mGluR5 increases protein synthesis at synapses. Although mGluR5-induced excessive protein synthesis has been implicated in the pathology of fragile X syndrome, it remains unknown whether group I mGluR-mediated protein synthesis is involved in any behavioral effects of drugs of abus...
Interaction of CPCCOEt with a chimeric mGlu1b and calcium sensing receptor
DEFF Research Database (Denmark)
Bräuner-Osborne, H; Jensen, Anders A.; Krogsgaard-Larsen, P
1999-01-01
7-Hydroxyiminocyclopropan[b]chromen-1a-carboxylic acid ethyl ester (CPCCOEt) has previously been shown to be a selective non-competitive antagonist at the metabotropic glutamate (mGlu) receptor subtype 1. In this study we have tested the effect of CPCCOEt on mGlu1b, the calcium sensing receptor (...
GluR2 ligand-binding core complexes
DEFF Research Database (Denmark)
Kasper, C; Lunn, M-L; Liljefors, T
2002-01-01
X-ray structures of the GluR2 ligand-binding core in complex with (S)-Des-Me-AMPA and in the presence and absence of zinc ions have been determined. (S)-Des-Me-AMPA, which is devoid of a substituent in the 5-position of the isoxazolol ring, only has limited interactions with the partly hydrophobic...
Repair of white oak glued-laminated beams
Lawrence A. Soltis; Robert J. Ross
1999-01-01
Connections between steel side plates and white oak glued-laminated beams subjected to tension perpendicular-to-grain stresses were tested to failure. The beams were then repaired with five different configurations using two sizes of lag screws, with and without steel reinforcing plates. The repaired beams were re-tested to failure. Results indicate that in all...
Study of gluing and wire bonding for the Belle II Silicon Vertex Detector
International Nuclear Information System (INIS)
Kang, K.H.; Hara, K.; Higuchi, T.; Hyun, H.J.; Jeon, H.B.; Joo, C.W.; Kah, D.H.; Kim, H.J.; Mibe, T.; Onuki, Y.; Park, H.; Rao, K.K.; Sato, N.; Shimizu, N.; Tanida, K.; Tsuboyama, T.; Uozumi, S.
2014-01-01
This paper describes an investigation into gluing and wire bonding for assembling the Silicon Vertex Detector (SVD) for the Belle II experiment at KEK in Japan. Optimizing the gluing of the silicon microstrip sensors, the support frame, and the readout flex cables is important for achieving the required mechanical precision. The wire bonding between the sensors and the readout electronic chips also needs special care to maximize the physics capability of the SVD. The silicon sensors and signal fan out flex circuits (pitch adapters) are glued and connected using wire bonding. We determine that gluing quality is important for achieving good bonding efficiency. The standard deviation in the glue thickness for the best result is measured to be 3.11 μm. Optimal machine parameters for wire bonding are determined to be 70 mW power, 20 gf force, and 20 ms for the pitch adapter and 60 mW power, 20 gf force, and 20 ms for the silicon strip sensors; these parameters provide a pull force of (10.92±0.72) gf. With these settings, 75% of the pitch adapters and 25% of the strip sensors experience the neck-broken type of break
[NMDA-GluR Subunit Antibody-Positive Encephalitis: A Clinical Analysis of Five Cases].
Kaneko, Chikako; Shakespear, Norshalena; Tuchiya, Mario; Kubo, Jin; Yamamoto, Teiji; Katayama, Soichi; Takahashi, Yukitoshi
2016-09-01
Five consecutive cases of anti-NMDA-receptor encephalitis that we encountered were marked by a rapidly fluctuating level of consciousness associated with psychotic and delirious mental states. Opisthotonus, catatonia, and rhythmic and non-rhythmic involuntary movements of the mouth and jaw were also characteristic features of these particular cases. Serious and potentially fatal problems included epilepsia partialis continua, partial and generalized seizures, and respiratory depression, resembling the symptoms of encephalitis lethargica. An epidemic of encephalitis lethargica, also known of Economo encephalitis, occurred around 1917. Magnetic resonance imaging revealed edema of the neocortex in two cases and electroencephalography showed polymorphic and monomorphic delta slowing in the acute stage, although electroencephalographic seizure activity were not apparent. Routine cerebrospinal fluid analyses revealed lymphocyte-dominant pleocytosis in three cases, but antibodies against the NMDA-GluR subunit, GluN2B N-terminal, were at a high level in the fluid. All patients recovered without apparent sequelae. Two patients found to have ovarian teratoma underwent surgery for tumor removal. Treatments included pulse intravenous methylprednisolone, high-dose immunoglobulin, and plasma exchange together with seizure control and respiratory support. However, rituximab and or cyclophosphamide pulse therapy should also be considered for intractable cases, as indicated by recent reports. (Received February 16, 2016; Accepted May 2, 2016; Published September 1, 2016).
Yu, Fei; Zhong, Peng; Liu, Xiaojie; Sun, Dalong; Gao, Hai-Qing; Liu, Qing-Song
2013-06-01
Antagonism of group I metabotropic glutamate receptors (mGluR1 and mGluR5) reduces behavioral effects of drugs of abuse, including cocaine. However, the underlying mechanisms remain poorly understood. Activation of mGluR5 increases protein synthesis at synapses. Although mGluR5-induced excessive protein synthesis has been implicated in the pathology of fragile X syndrome, it remains unknown whether group I mGluR-mediated protein synthesis is involved in any behavioral effects of drugs of abuse. We report that group I mGluR agonist DHPG induced more pronounced initial depression of inhibitory postsynaptic currents (IPSCs) followed by modest long-term depression (I-LTD) in dopamine neurons of rat ventral tegmental area (VTA) through the activation of mGluR1. The early component of DHPG-induced depression of IPSCs was mediated by the cannabinoid CB1 receptors, while DHPG-induced I-LTD was dependent on protein synthesis. Western blotting analysis indicates that mGluR1 was coupled to extracellular signal-regulated kinase (ERK) and mammalian target of rapamycin (mTOR) signaling pathways to increase translation. We also show that cocaine conditioning activated translation machinery in the VTA via an mGluR1-dependent mechanism. Furthermore, intra-VTA microinjections of mGluR1 antagonist JNJ16259685 and protein synthesis inhibitor cycloheximide significantly attenuated or blocked the acquisition of cocaine-induced conditioned place preference (CPP) and activation of translation elongation factors. Taken together, these results suggest that mGluR1 antagonism inhibits de novo protein synthesis; this effect may block the formation of cocaine-cue associations and thus provide a mechanism for the reduction in CPP to cocaine.
Directory of Open Access Journals (Sweden)
Michael Feyder
2007-12-01
Full Text Available There is compelling evidence that L-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA glutamate receptors containing the GluR1 subunit contribute to the molecular mechanisms associated with learning. AMPA GluR1 glutamate receptor knockout mice (KO exhibit abnormal hippocampal and amygdala plasticity, and deficits on various assays for cognition including Pavlovian fear conditioning. Here we examined associative fear learning in mice with complete absence (KO or partial loss (heterozygous mutant, HET of GluR1 on multiple fear conditioning paradigms. After multi-trial delay or trace conditioning, KO displayed impaired tone and context fear recall relative to WT, whereas HET were normal. After one-trial delay conditioning, both KO and HET showed impaired tone and context recall. HET and KO showed normal nociceptive sensitivity in the hot plate and tail flick tests. These data demonstrate that the complete absence of GluR1 subunit-containing receptors prevents the formation of associative fear memories, while GluR1 haploinsufficiency is sufficient to impair one-trial fear learning. These findings support growing evidence of a major role for GluR1-containing AMPA receptors in amygdalamediated forms of learning and memory.
Optical modulation of neurotransmission using calcium photocurrents through the ion channel LiGluR
Directory of Open Access Journals (Sweden)
Mercè eIzquierdo-Serra
2013-03-01
Full Text Available A wide range of light-activated molecules (photoswitches and phototriggers have been used to the study of computational properties of an isolated neuron by acting pre and postsynaptically. However, new tools are being pursued to elicit a presynaptic calcium influx that triggers the release of neurotransmitters, most of them based in calcium-permeable Channelrhodopsin-2 mutants. Here we describe a method to control exocytosis of synaptic vesicles through the use of a light-gated glutamate receptor (LiGluR, which has recently been demonstrated that supports secretion by means of calcium influx in chromaffin cells. Expression of LiGluR in hippocampal neurons enables reversible control of neurotransmission with light, and allows modulating the firing rate of the postsynaptic neuron with the wavelength of illumination. This method may be useful for the determination of the complex transfer function of individual synapses.
Directory of Open Access Journals (Sweden)
Francesca Nardecchia
2018-03-01
Full Text Available We studied group-I metabotropic glutamate (mGlu receptors in Pahenu2 (ENU2 mice, which mimic the genetics and neurobiology of human phenylketonuria (PKU, a metabolic disorder characterized, if untreated, by autism, and intellectual disability (ID. Male ENU2 mice showed increased mGlu5 receptor protein levels in the hippocampus and corpus striatum (but not in the prefrontal cortex whereas the transcript of the mGlu5 receptor was unchanged. No changes in mGlu1 receptor mRNA and protein levels were found in any of the three brain regions of ENU2 mice. We extended the analysis to Homer proteins, which act as scaffolds by linking mGlu1 and mGlu5 receptors to effector proteins. Expression of the long isoforms of Homer was significantly reduced in the hippocampus of ENU2 mice, whereas levels of the short Homer isoform (Homer 1a were unchanged. mGlu5 receptors were less associated to immunoprecipitated Homer in the hippocampus of ENU2 mice. The lack of mGlu5 receptor-mediated long-term depression (LTD in wild-type mice (of BTBR strain precluded the analysis of hippocampal synaptic plasticity in ENU2 mice. We therefore performed a behavioral analysis to examine whether pharmacological blockade of mGlu5 receptors could correct behavioral abnormalities in ENU2 mice. Using the same apparatus we sequentially assessed locomotor activity, object exploration, and spatial object recognition (spatial novelty test after displacing some of the objects from their original position in the arena. Systemic treatment with the mGlu5 receptor antagonist, MPEP (20 mg/kg, i.p., had a striking effect in the spatial novelty test by substantially increasing the time spent in exploring the displaced objects in ENU2 mice (but not in wild-type mice. These suggest a role for mGlu5 receptors in the pathophysiology of ID in PKU and suggest that, also in adult untreated animals, cognitive dysfunction may be improved by targeting these receptors with an appropriate therapy.
Sex Differences in Social Interaction in Rats: Role of the Immediate-Early Gene zif268
Stack, Ashley; Carrier, Nicole; Dietz, David; Hollis, Fiona; Sorenson, Jamie; Kabbaj, Mohamed
2009-01-01
Given both the high prevalence of anxiety disorders in women and the fact that little is known about the mechanisms of gender differences in anxiety, our primary aim in this study was to investigate the neurobiological mechanisms underlying sex differences in social anxiety-like behavior in rats. Through the use of zif268 antisense oligodeoxynucleotides (zif ASO), we induced a temporary downregulation of zif268 expression in the medial prefrontal cortex of male and female rats and found that ...
Directory of Open Access Journals (Sweden)
Yoko Hagino
Full Text Available Phencyclidine (PCP, a noncompetitive N-methyl-D-aspartate (NMDA receptor antagonist, increases locomotor activity in rodents and causes schizophrenia-like symptoms in humans. Although activation of the dopamine (DA pathway is hypothesized to mediate these effects of PCP, the precise mechanisms by which PCP induces its effects remain to be elucidated. The present study investigated the effect of PCP on extracellular levels of DA (DA(ex in the striatum and prefrontal cortex (PFC using in vivo microdialysis in mice lacking the NMDA receptor channel ε1 or ε4 subunit (GluRε1 [GluN2A] or GluRε4 [GluN2D] and locomotor activity. PCP significantly increased DA(ex in wildtype and GluRε1 knockout mice, but not in GluRε4 knockout mice, in the striatum and PFC. Acute and repeated administration of PCP did not increase locomotor activity in GluRε4 knockout mice. The present results suggest that PCP enhances dopaminergic transmission and increases locomotor activity by acting at GluRε4.
Yang, Juan; Sun-Waterhouse, Dongxiao; Cui, Chun; Dong, Keming; Wang, Wei
2017-10-04
The transpeptidase activity of glutaminase from Bacillus amyloliquefaciens (GBA) and Aspergillus oryzae (GAO) to yield γ-[Glu] n -Phe peptides were verified for the first time. In the presence of Gln and Phe, γ-Glu-Phe and γ-Glu-γ-Glu-Phe were synthesized by GAO, and γ-Glu-Phe, γ-Glu-γ-Glu-Phe, γ-Glu-γ-Glu-γ-Glu-Phe, γ-Glu-γ-Glu-γ-Glu-γ-Glu-Phe, and γ-Glu-γ-Glu-γ-Glu-γ-Glu-γ-Glu-Phe were synthesized by GBA. The K m values for the transpeptidation catalyzed by GBA and GAO were 47.88 and 153.92 mM (Phe as the acceptor), 84.89 and 236.47 mM (γ-Glu-Phe as the acceptor), indicating that GBA had a greater affinity than GAO for Phe and γ-Glu-Phe in the transpeptidation reaction. The K m values for the transpeptidation catalyzed by GBA against acceptors, Phe and γ-[Glu] (1≤n<5) -Phe (47.88-206.47 mM), increased with an elevated number of γ-glutamyl residue within the acceptor. The optimal conditions for γ-[Glu] n -Phe synthesis were pH 10 and 37 °C for 3 h, 300 mM Gln, 100 mM Phe, 0.05 U/mL GBA. All the γ-[Glu] (1≤n≤5) -Phe exhibited astringency in water and imparted a kokumi taste to commercial soy sauce and model chicken broth. The astringent threshold values (2.5-3.92 mM) were approximately 3-fold of the kokumi threshold concentrations (0.78-1.53 mM). γ-[Glu] n -Phe or the post-enzymatic reaction mixture enhanced the umami intensity of commercial soy sauce and model chicken broth.
Shibasaki, Masahiro; Ishii, Kazunori; Masukawa, Daiki; Ando, Koji; Ikekubo, Yuiko; Ishikawa, Yutori; Shibasaki, Yumiko; Mori, Tomohisa; Suzuki, Tsutomu
2014-09-05
Long-term exposure to zolpidem induces drug dependence, and it is well known that the balance between the GABAergic and glutamatergic systems plays a critical role in maintaining the neuronal network. In the present study, we investigated the interaction between GABAA receptor α1 subunit and mGlu5 receptor in the limbic forebrain including the N.Acc. after treatment with zolpidem for 7 days. mGlu5 receptor protein levels were significantly increased after treatment with zolpidem for 7 days, and this change was accompanied by the up-regulation of phospholipase Cβ1 and calcium/calmodulin-dependent protein kinase IIα, which are downstream of mGlu5 receptor in the limbic forebrain. To confirm that mGlu5 receptor is directly involved in dopamine-related behavior in mice following chronic treatment with zolpidem, we measured morphine-induced hyperlocomotion after chronic treatment with zolpidem in the presence or absence of an mGlu5 receptor antagonist. Although chronic treatment with zolpidem significantly enhanced morphine-induced hyperlocomotion, this enhancement of morphine-induced hyperlocomotion was suppressed by treating it with the mGlu5 receptor antagonist MPEP. These results suggest that chronic treatment with zolpidem caused neural plasticity in response to activation of the mesolimbic dopaminergic system accompanied by an increase in mGlu5 receptor. Copyright © 2014 Elsevier B.V. All rights reserved.
In vivo function of Pgβglu-1 in the release of acetophenones in white spruce
Directory of Open Access Journals (Sweden)
Melissa H. Mageroy
2017-07-01
Full Text Available Eastern spruce budworm (Choristoneura fumiferiana Clemens (ESBW is a major forest pest which feeds on young shoots of white spruce (Picea glauca and can cause landscape level economic and ecological losses. Release of acetophenone metabolites, piceol and pungenol, from their corresponding glycosides, picein and pungenin, can confer natural resistance of spruce to ESBW. A beta-glucosidase gene, Pgβglu-1, was recently discovered and the encoded enzyme was characterized in vitro to function in the release of the defensive acetophenone aglycons. Here we describe overexpression of Pgβglu-1 in a white spruce genotype whose metabolome contains the glucosylated acetophenones, but no detectable amounts of the aglycons. Transgenic overexpression of Pgβglu-1 resulted in release of the acetophenone aglycons in planta. This work provides in vivo evidence for the function of Pgβglu-1.
International Nuclear Information System (INIS)
Nakatsu, Yusuke; Kotake, Yaichiro; Takishita, Tomoko; Ohta, Shigeru
2009-01-01
Tributyltin (TBT), an endocrine-disrupting chemical, has been used commercially as a heat stabilizer, agricultural pesticide and component of antifouling paints. In this study, we investigated the effect of long-term exposure to endogenous levels of TBT on neuronal glutamate receptors. Cultured rat cortical neurons were exposed to 1-50 nM TBT for 9 days (from day 2 to day 10 in vitro). The number of neurons was reduced by long-term exposure to 50 nM TBT, but not to 1-20 nM TBT. Long-term exposure to 20 nM TBT decreased the mRNA expression of glutamate receptors NR1, NR2A, GluR1 and GluR2, and increased that of NR2B, GluR3 and GluR4. GluR2 protein was also reduced by long-term exposure to TBT. Because AMPA receptor lacking GluR2 exhibits Ca 2+ permeability, we investigated whether Ca 2+ influx or glutamate toxicity was affected. Indeed, glutamate-induced Ca 2+ influx was increased in TBT-treated neurons. Consistent with this, neurons became more susceptible to glutamate toxicity as a result of long-term exposure to TBT and this susceptibility was abolished by an antagonist of GluR2-lacking AMPA receptor. Thus, it is suggested that long-term exposure to endogenous levels of TBT induces a decrease of GluR2 protein, causing neurons become more susceptible to glutamate toxicity.
Nakatsu, Yusuke; Kotake, Yaichiro; Takishita, Tomoko; Ohta, Shigeru
2009-10-15
Tributyltin (TBT), an endocrine-disrupting chemical, has been used commercially as a heat stabilizer, agricultural pesticide and component of antifouling paints. In this study, we investigated the effect of long-term exposure to endogenous levels of TBT on neuronal glutamate receptors. Cultured rat cortical neurons were exposed to 1-50 nM TBT for 9 days (from day 2 to day 10 in vitro). The number of neurons was reduced by long-term exposure to 50 nM TBT, but not to 1-20 nM TBT. Long-term exposure to 20 nM TBT decreased the mRNA expression of glutamate receptors NR1, NR2A, GluR1 and GluR2, and increased that of NR2B, GluR3 and GluR4. GluR2 protein was also reduced by long-term exposure to TBT. Because AMPA receptor lacking GluR2 exhibits Ca2+ permeability, we investigated whether Ca2+ influx or glutamate toxicity was affected. Indeed, glutamate-induced Ca2+ influx was increased in TBT-treated neurons. Consistent with this, neurons became more susceptible to glutamate toxicity as a result of long-term exposure to TBT and this susceptibility was abolished by an antagonist of GluR2-lacking AMPA receptor. Thus, it is suggested that long-term exposure to endogenous levels of TBT induces a decrease of GluR2 protein, causing neurons become more susceptible to glutamate toxicity.
Holst, Sebastian C; Sousek, Alexandra; Hefti, Katharina; Saberi-Moghadam, Sohrab; Buck, Alfred; Ametamey, Simon M; Scheidegger, Milan; Franken, Paul; Henning, Anke; Seifritz, Erich; Tafti, Mehdi; Landolt, Hans-Peter
2017-10-05
Increased sleep time and intensity quantified as low-frequency brain electrical activity after sleep loss demonstrate that sleep need is homeostatically regulated, yet the underlying molecular mechanisms remain elusive. We here demonstrate that metabotropic glutamate receptors of subtype 5 (mGluR5) contribute to the molecular machinery governing sleep-wake homeostasis. Using positron emission tomography, magnetic resonance spectroscopy, and electroencephalography in humans, we find that increased mGluR5 availability after sleep loss tightly correlates with behavioral and electroencephalographic biomarkers of elevated sleep need. These changes are associated with altered cortical myo-inositol and glycine levels, suggesting sleep loss-induced modifications downstream of mGluR5 signaling. Knock-out mice without functional mGluR5 exhibit severe dysregulation of sleep-wake homeostasis, including lack of recovery sleep and impaired behavioral adjustment to a novel task after sleep deprivation. The data suggest that mGluR5 contribute to the brain's coping mechanisms with sleep deprivation and point to a novel target to improve disturbed wakefulness and sleep.
Hefti, Katharina; Saberi-Moghadam, Sohrab; Buck, Alfred; Ametamey, Simon M; Scheidegger, Milan; Franken, Paul; Henning, Anke; Seifritz, Erich
2017-01-01
Increased sleep time and intensity quantified as low-frequency brain electrical activity after sleep loss demonstrate that sleep need is homeostatically regulated, yet the underlying molecular mechanisms remain elusive. We here demonstrate that metabotropic glutamate receptors of subtype 5 (mGluR5) contribute to the molecular machinery governing sleep-wake homeostasis. Using positron emission tomography, magnetic resonance spectroscopy, and electroencephalography in humans, we find that increased mGluR5 availability after sleep loss tightly correlates with behavioral and electroencephalographic biomarkers of elevated sleep need. These changes are associated with altered cortical myo-inositol and glycine levels, suggesting sleep loss-induced modifications downstream of mGluR5 signaling. Knock-out mice without functional mGluR5 exhibit severe dysregulation of sleep-wake homeostasis, including lack of recovery sleep and impaired behavioral adjustment to a novel task after sleep deprivation. The data suggest that mGluR5 contribute to the brain's coping mechanisms with sleep deprivation and point to a novel target to improve disturbed wakefulness and sleep. PMID:28980941
International Nuclear Information System (INIS)
Ye, Eun-Ah; Kim, Tae-Jin; Choi, Jae-Sik; Jin, Mi-Joo; Jeon, Young-Ki; Kim, Moon-Sook; Jeon, Chang-Jin
2006-01-01
The subunit composition of the AMPA receptor is critical to its function. AMPA receptors that display very low calcium permeability include the GluR2 subunit, while AMPA receptors that contain other subunits, such as GluR1, display high calcium permeability. We have studied the distribution and morphology of neurons containing GluR1 in the hamster visual cortex with antibody immunocytochemistry. We compared this labeling to that for calbindin D28K, parvalbumin, and GABA. Anti-GluR1-immunoreactive (IR) neurons were located in all layers. The highest density of GluR1-IR neurons was found in layers II/III. The labeled neurons were non-pyramidal neurons, but were varied in morphology. The majority of the labeled neurons were round or oval cells. However, stellate, vertical fusiform, pyriform, and horizontal neurons were also labeled with the anti-GluR1 antibody. Two-color immunofluorescence revealed that many of the GluR1-IR neurons in the hamster visual cortex were double-labeled with either calbindin D28K (31.50%), or parvalbumin (22.91%), or GABA (63.89%). These results indicate that neurons in the hamster visual cortex express GluR1 differently according to different layers and selective cell types, and that many of the GluR1-IR neurons are limited to neurons that express calbindin D28K, parvalbumin, or GABA. The present study elucidates the neurochemical structure of GluR1, a useful clue in understanding the differential vulnerability of GluR1-containing neurons with regard to calcium-dependent excitotoxic mechanisms
Combinatorial Quantum Field Theory and Gluing Formula for Determinants
Reshetikhin, N.; Vertman, B.
2015-01-01
We define the combinatorial Dirichlet-to-Neumann operator and establish a gluing formula for determinants of discrete Laplacians using a combinatorial Gaussian quantum field theory. In case of a diagonal inner product on cochains we provide an explicit local expression for the discrete
International Nuclear Information System (INIS)
Reid, M.E.; Toms, N.J.; Bedingfield, J.S.; Roberts, P.J.
1999-01-01
In the current study, we have characterized group I metabotropic glutamate (mGlu) receptor enhancement of 4-aminopyridine (4AP)-evoked [ 3 H]glutamate release from rat cerebrocortical synaptosomes. The broad spectrum mGlu receptor agonist (1S,3R)-1-aminocyclopentane-1,3-dicarboxylic acid ((1S,3R)-ACPD, 10 μM) increased 4AP-evoked [ 3 H]glutamate release (143.32±2.73% control) only in the presence of exogenously applied arachidonic acid; an effect reversed by the inclusion of bovine serum albumin (BSA, fatty acid free). In contrast, the selective group I mGlu receptor agonist (S)-3,5-dihydroxyphenylglycine (DHPG) potentiated (EC 50 =1.60±0.25 μM; E max =147.61±10.96% control) 4AP-evoked [ 3 H]glutamate release, in the absence of arachidonic acid. This potentiation could be abolished by either the selective mGlu 1 receptor antagonist (R,S)-1-aminoindan-1,5-dicarboxylic acid (AIDA, 1 mM) or the selective PKC inhibitor (Ro 31-8220, 10 μM) and was BSA-insensitive. The selective mGlu 5 receptor agonist (R,S)-2-chloro-5-hydroxyphenylglycine (CHPG, 300μM) was without effect. DHPG (100 μM) also potentiated both 30 mM and 50 mM K + -evoked [ 3 H]glutamate release (121.60±12.77% and 121.50±4.45% control, respectively). DHPG (100 μM) failed to influence both 4AP-stimulated 45 Ca 2+ influx and 50 mM K + -induced changes in synaptosomal membrane potential. Possible group I mGlu receptor suppression of tonic adenosine A 1 receptor, group II/III mGlu receptors or GABA B receptor activity is unlikely since 4AP-evoked [ 3 H]glutamate release was insensitive to the selective inhibitory receptor antagonists 8-cyclopentyl-1,3-dimethylxanthine, (R,S)-α-cyclopropyl-4-phosphonophenylglycine or CGP55845A, respectively. These data suggest an 'mGlu 1 receptor-like' receptor potentiates [ 3 H]glutamate release from cerebrocortical synaptosomes in the absence of exogenously applied arachidonic acid. This PKC dependent effect is unlikely to be via modulation of synaptosomal membrane
Recent Advances in the Medicinal Chemistry of the Metabotropic Glutamate Receptor 1 (mGlu1)
2011-01-01
This Review summarizes the medicinal chemistry found in publications on both orthosteric and allosteric modulators of the metabotropic glutamate receptor 1 (mGlu1) from 2005 to the present. The time period covered by the scope of this current review has been particularly rich in mGlu1-related publications with numbers quadrupling when compared to the preceding five year period of 2000−2005. Publications in the field peaked in 2007 with over 35 articles appearing in the peer reviewed literature in the course of that year. Given that glutamate is one of the primary excitatory neurotransmitters in the mammalian central nervous system (CNS), it is unsurprising that it acts upon several receptors that are considered to be of potential therapeutic interest for many indications. Orthosteric and allosteric modulation of the receptor is possible, with a logical extrapolation to the chemotypes used for each strategy. The last five years of publications have yielded many mGlu1 selective antagonist chemotypyes, most of which have shown efficacy in pain in vivo models. However, the primary impact of these compounds has been to highlight the mechanistic safety risks of mGlu1 antagonism, independent of chemotype. As a review in medicinal chemistry, the primary focus of this paper will be on the design and, to a lesser degree, synthetic strategies for the delivery of subtype selective, CNS penetrant, druglike compounds through a “medchem” program, targeting modulators of the mGlu1 receptor. PMID:22860168
ANALYSIS OF EUCALYPTUS GLUED-LAMINATED TIMBER PORTICOS STRUCTURAL PERFORMANCE
Directory of Open Access Journals (Sweden)
Sandra Maria Ferreira Couri Petrauski
Full Text Available ABSTRACT This study evaluated the structural behavior of porticos made from eucalyptus glued boards, using wood of Eucalyptus sp and resorcinol formaldehyde adhesive. Three units, in real scale, of tri-articulated straight porticos, with a 5 meter porthole and a 26º inclination, capable to support tiles covering placement were designed, constructed and subjected to load testing, until rupture. The amount of adhesive used in the construction of the porticos was 250 g/m2 and the bonding pressure of 1.3 MPa. The Hankinson model was employed as an estimator of the glued joints strength, under different angles between the fibers. The average value for the last resistance of the structures was 4.63 times the design load, according to the criteria established by the ABNT, 1997. The structures showed satisfactory mechanical performance and deformations lower than the ones allowed by the standard. It was concluded there is technical feasibility to manufacture porticos fully bonded with small thickness veneers.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Limin; Huang, Yujie; Zhang, Yingying [Institute of Pharmacology, Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Sciences, Zhejiang University, No. 866, Yu Hang Tang Road, Hangzhou 310058 (China); Zhao, Qingwei [The First Affiliated Hospital, College of Medicine, Zhejiang University, No. 79, Qing Chun Road, Hangzhou 310003 (China); Zheng, Bei; Lou, Yijia [Institute of Pharmacology, Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Sciences, Zhejiang University, No. 866, Yu Hang Tang Road, Hangzhou 310058 (China); Zhu, Danyan, E-mail: zdyzxb@zju.edu.cn [Institute of Pharmacology, Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Sciences, Zhejiang University, No. 866, Yu Hang Tang Road, Hangzhou 310058 (China)
2013-06-10
Icariin (ICA) has been reported to facilitate cardiac differentiation of mouse embryonic stem (ES) cells; however, the mechanism by which ICA induced cardiomyogenesis has not been fully elucidated yet. Here, an underlying signaling network including metabotropic glutamate receptor 5 (mGluR5), Homer, phosphatidylinositol 3-Kinase Enhancer (PIKE), phosphatidylinositol 3-Kinase (PI3K), reactive oxygen species (ROS) and nuclear factor-kappaB (NF-κB) was investigated in ICA induced cardiomyogenesis. Our results showed that the co-expression of mGluR5 together with α-actinin or Troponin T in embryoid bodies (EBs) treated with ICA was elevated to 10.86% and 9.62%, compared with the case in the control (4.04% and 3.45%, respectively). Exposure of EBs to ICA for 2 h remarkably increased the dimeric form of mGluR5, which was inhibited by small interfering RNA targeting mGluR5 (si-mGluR5). Moreover, the extracellular glutamate concentration in ICA treatment medium was elevated to 28.9±3.5 μM. Furthermore, the activation of mGluR5 by ICA triggered the formation of Homer–PIKE complex and activated PI3K, stimulating ROS generation and NF-κB nuclear translocation. Knockdown of mGluR5 or inhibition of PI3K by LY294002 blocked ICA induced cardiomyogenesis via repressing mGluR5 pathway, reducing ROS and NF-κB activation. These results revealed that the inducible mechanisms of ICA were related to activate mGluR5 pathway. -- Highlights: • ICA increased mGluR5 expression in cardiac differentiation of ES cells. • ICA enhanced the glutamate level and the receptor mGluR5 dimerization, stimulating the formation of Homer–PIKE complex. • Knockdown of mGluR5 or inhibition of PI3K by LY294002 inhibited ICA induced ROS generation and NF-κB nuclear translocation.
Differential regulation of GluA1 expression by ketamine and memantine.
Zhang, Ke; Yamaki, Vitor Nagai; Wei, Zhisheng; Zheng, Yu; Cai, Xiang
2017-01-01
Evidence from preclinical and clinical studies shows that ketamine, a noncompetitive NMDA receptor antagonist, exerts rapid and sustained antidepressant responses. However, ketamine's psychotomimetic side effects and abuse liability limit the clinical use of the compound. Interestingly, memantine, another NMDA receptor channel blocker, processes no defined antidepressant property but is much safer and clinical tolerated. Understanding why ketamine but not memantine exhibits rapid antidepressant responses is important to elucidate the cellular signaling underlying the fast antidepressant actions of ketamine and to design a new safer generation of fast-acting antidepressants. Here we show that ketamine but memantine caused a rapid and sustained antidepressant-like responses in forced swim test (FST). Both drugs enhanced GluA1 S845 phosphorylation and potentiated Schaffer collateral-CA1 synaptic transmission. However, ketamine but not memantine elevated the expression of GluA1. Incubating acutely prepared hippocampal slices with ketamine but not memantine enhanced mTOR phosphorylation in a time course parallel to the time course of GluA1 elevation. Our results suggest that distinct properties in regulation of mTOR phosphorylation and synaptic protein expression may underlie the differential effectiveness of ketamine and memantine in their antidepressant responses. Copyright © 2016 Elsevier B.V. All rights reserved.
12 CFR 268.205 - Employment of aliens; Access to sensitive information.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Employment of aliens; Access to sensitive... Complaints § 268.205 Employment of aliens; Access to sensitive information. (a) Definitions. The definitions...— (i) A citizen or National of the United States, (ii) An alien who: (A) Meets the conditions set forth...
Liu, Shui-Bing; Ma, Lan; Guo, Hong-Ju; Feng, Bin; Guo, Yan-Yan; Li, Xiao-Qiang; Sun, Wen-Ji; Zheng, Lian-He; Zhao, Ming-Gao
2012-08-01
Gentiopicroside (Gent) is one of the secoiridoid compound isolated from Gentiana lutea. This compound exhibits analgesic activities and inhibits the expression of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the anterior cingulate cortex in mice. Nucleus accumbens (NAc) is a forebrain structure known for its role in drug addiction. However, little is known about the role of Gent on morphine dependence and synaptic transmission changes in the NAc. Conditioned place preference (CPP) test and behavioral sensitization of locomotor activity were used to investigate drug-seeking related behaviors. Brain slices containing NAc were prepared, and whole-cell patch-clamp recordings were performed to record the excitatory postsynaptic currents (EPSCs). Expression of proteins was detected by Western blot analysis. Systemic administration of Gent attenuated the CPP effect induced by morphine, but had no effect on morphine-induced behavioral sensitization. Gent significantly reversed overexpression of GluN2B-containing NMDA receptors and dopamine D2 receptors in NAc during the first week of morphine withdrawal. However, the compound did not affect the overexpression of GluN2A-containing NMDA receptors, GluA1, and dopamine D1 receptors. Lastly, Gent significantly reduced NMDA receptors-mediated EPSCs in the NAc. Our study provides strong evidence that Gent inhibits morphine dependence through downregulation of GluN2B-containing NMDA receptors in the NAc. © 2012 Blackwell Publishing Ltd.
Wang, Yue-Yue; Li, Yu-Dong; Liu, Jian-Bo; Ran, Xin-Xin; Guo, Yuan-Yang; Ren, Ni-Ni; Chen, Xin; Jiang, Hui; Li, Yong-Quan
2014-01-01
Phosphopantetheinyl transferases (PPTases), which play an essential role in both primary and secondary metabolism, are magnesium binding enzymes. In this study, we characterized the magnesium binding residues of all known group II PPTases by biochemical and evolutionary analysis. Our results suggested that group II PPTases could be classified into two subgroups, two-magnesium-binding-residue-PPTases containing the triad Asp-Xxx-Glu and three-magnesium-binding-residue-PPTases containing the triad Asp-Glu-Glu. Mutations of two three-magnesium-binding-residue-PPTases and one two-magnesium-binding-residue-PPTase indicate that the first and the third residues in the triads are essential to activities; the second residues in the triads are non-essential. Although variations of the second residues in the triad Asp-Xxx-Glu exist throughout the whole phylogenetic tree, the second residues are conserved in animals, plants, algae, and most prokaryotes, respectively. Evolutionary analysis suggests that: the animal group II PPTases may originate from one common ancestor; the plant two-magnesium-binding-residue-PPTases may originate from one common ancestor; the plant three-magnesium-binding-residue-PPTases may derive from horizontal gene transfer from prokaryotes.
A PRECISE PHYSICAL ORBIT FOR THE M-DWARF BINARY GLIESE 268
Energy Technology Data Exchange (ETDEWEB)
Barry, R. K.; Danchi, W. C. [NASA Goddard Space Flight Center, Laboratory for Exoplanets and Stellar Astrophysics, Code 667, Greenbelt, MD 20771 (United States); Demory, B.-O.; Segransan, D.; Di Folco, E.; Queloz, D.; Udry, S. [Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Forveille, T.; Delfosse, X.; Mayor, M.; Perrier, C. [Geneva Observatory, Geneva University, 51 Ch.des Maillettes, CH-1290 Versoix (Switzerland); Spooner, H. R. [University of Maryland, College Park, MD 20742 (United States); Torres, G. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02136 (United States); Traub, W. A., E-mail: Richard.K.Barry@nasa.gov [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States)
2012-11-20
We report high-precision interferometric and radial velocity (RV) observations of the M-dwarf binary Gl 268. Combining measurements conducted using the IOTA interferometer and the ELODIE and Harvard Center for Astrophysics RV instruments leads to a mass of 0.22596 {+-} 0.00084 M {sub Sun} for component A and 0.19230 {+-} 0.00071 M {sub Sun} for component B. The system parallax as determined by these observations is 0.1560 {+-} 0.0030 arcsec-a measurement with 1.9% uncertainty in excellent agreement with Hipparcos (0.1572 {+-} 0.0033). The absolute H-band magnitudes of the component stars are not well constrained by these measurements; however, we can place an approximate upper limit of 7.95 and 8.1 for Gl 268A and B, respectively. We test these physical parameters against the predictions of theoretical models that combine stellar evolution with high fidelity, non-gray atmospheric models. Measured and predicted values are compatible within 2{sigma}. These results are among the most precise masses measured for visual binaries and compete with the best adaptive optics and eclipsing binary results.
Group I mGlu receptor stimulation inhibits activation-induced cell death of human T lymphocytes
Chiocchetti, Annalisa; Miglio, Gianluca; Mesturini, Riccardo; Varsaldi, Federica; Mocellin, Marco; Orilieri, Elisabetta; Dianzani, Chiara; Fantozzi, Roberto; Dianzani, Umberto; Lombardi, Grazia
2006-01-01
The effects of L-glutamate on activation-induced cell death (AICD) of human activated (1 μg ml−1 phytohemagglutinin plus 2 U ml−1 interleukin-2; 8 days) T lymphocytes were studied by measuring anti-CD3 monoclonal antibody (10 μg ml−1; 18 h)-induced cell apoptosis (Annexin V and propidium iodide staining). L-Glutamate (1 × 10−8–1 × 10−4 M) significantly (P⩽0.01) inhibited AICD in a concentration-dependent manner (EC50=6.3 × 10−8 M; maximum inhibition 54.8±6.3% at 1 × 10−6 M). The L-glutamate inhibitory effect was pharmacologically characterized as mediated by group I mGlu receptors, since mGlu receptor agonists reproduced this effect. The EC50 values were: 3.2 × 10−7 M for (1S,3R)-ACPD; 4.5 × 10−8 M for quisqualate; 1.0 × 10−6 M for (S)-3,5-DHPG; 2.0 × 10−5 M for CHPG. Group I mGlu receptor antagonists inhibited the effects of quisqualate 1.0 × 10−6 M. The IC50 values calculated were: 8.7 × 10−5, 4.3 × 10−6 and 6.3 × 10−7 M for AIDA, LY 367385 and MPEP, respectively. L-Glutamate (1 × 10−6 M; 18 h) significantly (P⩽0.05) inhibited FasL expression (40.8±11.3%) (cytofluorimetric analysis), whereas it did not affect Fas signalling. Expression of both mGlu1 and mGlu5 receptor mRNA by T lymphocytes and T-cell lines, as demonstrated by reverse transcriptase–PCR analysis, suggests that L-glutamate-mediated inhibition of AICD was exerted on T cells. These data depict a novel role for L-glutamate in the regulation of the immune response through group I mGlu receptor-mediated mechanisms. PMID:16751798
Changes in the Adult GluN2B Associated Proteome following Adolescent Intermittent Ethanol Exposure.
Directory of Open Access Journals (Sweden)
H Scott Swartzwelder
Full Text Available Adolescent alcohol use is the strongest predictor for alcohol use disorders. In rodents, adolescents have distinct responses to acute ethanol, and prolonged alcohol exposure during adolescence can maintain these phenotypes into adulthood. One brain region that is particularly sensitive to the effects of both acute and chronic ethanol exposure is the hippocampus. Adolescent intermittent ethanol exposure (AIE produces long lasting changes in hippocampal synaptic plasticity and dendritic morphology, as well as in the susceptibility to acute ethanol-induced spatial memory impairment. Given the pattern of changes in hippocampal structure and function, one potential target for these effects is the ethanol sensitive GluN2B subunit of the NMDA receptor, which is known to be involved in synaptic plasticity and dendritic morphology. Thus we sought to determine if there were persistent changes in hippocampal GluN2B signaling cascades following AIE. We employed a previously validated GluN2B-targeted proteomic strategy that was used to identify novel signaling mechanisms altered by chronic ethanol exposure in the adult hippocampus. We collected adult hippocampal tissue (P70 from rats that had been given 2 weeks of AIE from P30-45. Tissue extracts were fractionated into synaptic and non-synaptic pools, immuno-precipitated for GluN2B, and then analyzed using proteomic methods. We detected a large number of proteins associated with GluN2B. AIE produced significant changes in the association of many proteins with GluN2B in both synaptic and non-synaptic fractions. Intriguingly the number of proteins changed in the non-synaptic fraction was double that found in the synaptic fraction. Some of these proteins include those involved in glutamate signaling cytoskeleton rearrangement, calcium signaling, and plasticity. Disruptions in these pathways may contribute to the persistent cellular and behavioral changes found in the adult hippocampus following AIE. Further
Deletion of the GluA1 AMPA Receptor Subunit Alters the Expression of Short-Term Memory
Sanderson, David J.; Sprengel, Rolf; Seeburg, Peter H.; Bannerman, David M.
2011-01-01
Deletion of the GluA1 AMPA receptor subunit selectively impairs short-term memory for spatial locations. We further investigated this deficit by examining memory for discrete nonspatial visual stimuli in an operant chamber. Unconditioned suppression of magazine responding to visual stimuli was measured in wild-type and GluA1 knockout mice.…
SPARC and GluA1-Containing AMPA Receptors Promote Neuronal Health Following CNS Injury
Directory of Open Access Journals (Sweden)
Emma V. Jones
2018-02-01
Full Text Available The proper formation and maintenance of functional synapses in the central nervous system (CNS requires communication between neurons and astrocytes and the ability of astrocytes to release neuromodulatory molecules. Previously, we described a novel role for the astrocyte-secreted matricellular protein SPARC (Secreted Protein, Acidic and Rich in Cysteine in regulating α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs and plasticity at developing synapses. SPARC is highly expressed by astrocytes and microglia during CNS development but its level is reduced in adulthood. Interestingly, SPARC has been shown to be upregulated in CNS injury and disease. However, the role of SPARC upregulation in these contexts is not fully understood. In this study, we investigated the effect of chronic SPARC administration on glutamate receptors on mature hippocampal neuron cultures and following CNS injury. We found that SPARC treatment increased the number of GluA1-containing AMPARs at synapses and enhanced synaptic function. Furthermore, we determined that the increase in synaptic strength induced by SPARC could be inhibited by Philanthotoxin-433, a blocker of homomeric GluA1-containing AMPARs. We then investigated the effect of SPARC treatment on neuronal health in an injury context where SPARC expression is upregulated. We found that SPARC levels are increased in astrocytes and microglia following middle cerebral artery occlusion (MCAO in vivo and oxygen-glucose deprivation (OGD in vitro. Remarkably, chronic pre-treatment with SPARC prevented OGD-induced loss of synaptic GluA1. Furthermore, SPARC treatment reduced neuronal death through Philanthotoxin-433 sensitive GluA1 receptors. Taken together, this study suggests a novel role for SPARC and GluA1 in promoting neuronal health and recovery following CNS damage.
Sada, Yoshinao; Ikeda, Hajime; Yamato, Seiji; Kizawa, Satoru
2013-09-01
Schoenoplectus juncoides, a noxious weed for paddy rice, is known to become resistant to sulfonylurea (SU) herbicides by a target-site mutation in either of the two acetolactate synthase (ALS) genes (ALS1 and ALS2). SU-resistant S. juncoides plants having an Asp376Glu mutation in ALS2 were found from a paddy rice field in Japan, but their resistance profile has not been quantitatively investigated. In this study, dose-response of the SU-resistant accession was compared with that of a SU-susceptible accession at in vivo whole-plant level as well as at in vitro enzymatic level. In whole-plant tests, resistance factors (RFs) based on 50% growth reduction (GR50) for imazosulfuron (ISF), bensulfuron-methyl (BSM), metsulfuron-methyl (MSM), bispyribac-sodium (BPS), and imazaquin (IMQ) were 176, 40, 14, 5.2 and 1.5, respectively. Thus, the accession having an Asp376Glu mutation in ALS2 was highly resistant to the three SU herbicides and moderately resistant to BPS, but was not substantially resistant to IMQ. This is slightly different from the earlier results reported from other weeds with an Asp376Glu mutation, in which the mutation confers resistance to broadly all the chemical classes of ALS-inhibiting herbicides. In enzymatic tests, ALS2 of S. juncoides was expressed in E. coli; the resultant ALS2 was subjected to an in vitro assay. RFs of the mutated ALS2 based on 50% enzymatic inhibition (I50) for ISF, BSM, MSM, BPS, and IMQ were 3699, 2438, 322, 80, and 4.8, respectively. The RFs of ALS2 were highly correlated with those of the whole-plant; this suggests that the Asp376Glu mutation in ALS2 is a molecular basis for the whole-plant resistance. The presence of two ALS genes in S. juncoides can at least partially explain why the whole-plant RFs were less than those of the expressed ALS2 enzymes. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Amira Latif-Hernandez
2014-03-01
Full Text Available Neurons have the ability to modify their structure and function which ultimately serves for learning (Abraham and Bear, 1996. Dendritic events provide a major contribution to such modifications. For example, natural and artificial patterns of afferent activation have been shown to induce persistent forms of synaptic plasticity, such as long-term potentiation (LTP and long-term depression (LTD at distinct dendritic synapses. LTP and LTD are both assumed to occur during the physiological processes of learning and memory formation and to sustain the latter (Abraham, 2008. In recent years, there has been a burgeoning interest in the understanding of metaplasticity, which refers to the plasticity of synaptic plasticity (Abraham and Bear, 1996. In particular, depotentiation (DP is the mechanism by which synapses that have recently undergone LTP can reverse their synaptic strengthening in response to low frequency stimulation (LFS; Abraham, 2008. Typically, DP is thought to prevent the saturation of synaptic potentiation by resetting synapses into a more efficient state to store new information. The detailed mechanisms that underlie DP still remain unclear. Bortolotto et al. (1994 first identified metabotropic glutamate receptors (mGluRs as being involved in DP. Experimental evidence indicates that both subtypes of group I mGluRs (mGluR1 and mGluR5 have distinct functions in synaptic plasticity in the hippocampal CA1 region (Gladding et al., 2008. However, their role in DP was not addressed yet in detail and appear to be distinct from those involved in NMDAR-dependent DP (Zho et al., 2002. Therefore, we investigated the precise mechanisms responsible for NMDAR and mGluR-dependent DP by combining electrophysiological recordings in vitro and pharmacological approach. Transverse hippocampal slices (400 µm thick were prepared from the right hippocampus with a tissue chopper and placed into a submerged-type chamber, where they were continuously perfused
Directory of Open Access Journals (Sweden)
Diana L Price
2010-11-01
Full Text Available Dementia with Lewy bodies (DLB and Parkinson's Disease (PD are neurodegenerative disorders of the aging population characterized by the abnormal accumulation of alpha-synuclein (alpha-syn. Previous studies have suggested that excitotoxicity may contribute to neurodegeneration in these disorders, however the underlying mechanisms and their relationship to alpha-syn remain unclear. For this study we proposed that accumulation of alpha-syn might result in alterations in metabotropic glutamate receptors (mGluR, particularly mGluR5 which has been linked to deficits in murine models of PD. In this context, levels of mGluR5 were analyzed in the brains of PD and DLB human cases and alpha-syn transgenic (tg mice and compared to age-matched, unimpaired controls, we report a 40% increase in the levels of mGluR5 and beta-arrestin immunoreactivity in the frontal cortex, hippocampus and putamen in DLB cases and in the putamen in PD cases. In the hippocampus, mGluR5 was more abundant in the CA3 region and co-localized with alpha-syn aggregates. Similarly, in the hippocampus and basal ganglia of alpha-syn tg mice, levels of mGluR5 were increased and mGluR5 and alpha-syn were co-localized and co-immunoprecipitated, suggesting that alpha-syn interferes with mGluR5 trafficking. The increased levels of mGluR5 were accompanied by a concomitant increase in the activation of downstream signaling components including ERK, Elk-1 and CREB. Consistent with the increased accumulation of alpha-syn and alterations in mGluR5 in cognitive- and motor-associated brain regions, these mice displayed impaired performance in the water maze and pole test, these behavioral alterations were reversed with the mGluR5 antagonist, MPEP. Taken together the results from study suggest that mGluR5 may directly interact with alpha-syn resulting in its over activation and that this over activation may contribute to excitotoxic cell death in select neuronal regions. These results highlight the
Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...
African Journals Online (AJOL)
Administrator
2011-09-12
Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.
Neuroprotective effects of (Val8)GLP-1-Glu-PAL in the MPTP Parkinson's disease mouse model.
Zhang, YanFang; Chen, YiMei; Li, Lin; Hölscher, Christian
2015-10-15
Glucagon-like peptide 1 (GLP-1) is a hormone and a growth factor. GLP-1 mimetics are currently on the market as treatments for type 2 diabetes. They also have shown neuroprotective properties in animal models of neurodegenerative disorders. In addition, the GLP-1 mimetic exendin-4 has shown protective effects in animal models of Parkinson's disease (PD), and a first clinical trial in PD patients showed promising results. (Val8)GLP-1-glu-PAL is a new GLP-1 analogue which has a longer biological half-life than exendin-4. We previously showed that (Val8)GLP-1-glu-PAL has neuroprotective properties. Here we tested the drug in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of PD. MPTP was injected (30mg/kg i.p.) along with (Val8)GLP-1-glu-PAL (25nmol/kg i.p.) once-daily for 8 days. (Val8)GLP-1-glu-PAL showed good effects in preventing the MPTP-induced motor impairment (Rotarod, open field locomotion, swim test), reduction in tyrosine hydroxylase levels (dopamine synthesis) in the substantia nigra, a reduction of activated caspase 3 levels, of TUNEL positive cell numbers, of the pro-apoptotic signaling molecule BAX and an increase in the growth signaling molecule Bcl-2. The results demonstrate that (Val8)GLP-1-glu-PAL shows promise as a novel treatment of PD. Copyright © 2015 Elsevier B.V. All rights reserved.
An adventitious interaction of filamin A with RhoGDI2(Tyr153Glu)
International Nuclear Information System (INIS)
Song, Mia; He, Qianjing; Berk, Benjamin-Andreas; Hartwig, John H.; Stossel, Thomas P.; Nakamura, Fumihiko
2016-01-01
Filamin A (FLNA) is an actin filament crosslinking protein with multiple intracellular binding partners. Mechanical force exposes cryptic FLNA binding sites for some of these ligands. To identify new force-dependent binding interactions, we used a fusion construct composed of two FLNA domains, one of which was previously identified as containing a force-dependent binding site as a bait in a yeast two-hybrid system and identified the Rho dissociation inhibitor 2 (RhoGDI2) as a potential interacting partner. A RhoGDI2 truncate with 81 N-terminal amino acid residues and a phosphomimetic mutant, RhoGDI(Tyr153Glu) interacted with the FLNA construct. However, neither wild-type or full-length RhoGDI2 phosphorylated at Y153 interacted with FLNA. Our interpretation of these contradictions is that truncation and/or mutation of RhoGDI2 perturbs its conformation to expose a site that adventitiously binds FLNA and is not a bona–fide interaction. Therefore, previous studies reporting that a RhoGDI(Y153E) mutant suppresses the metastasis of human bladder cancer cells must be reinvestigated in light of artificial interaction of this point mutant with FLNA. - Highlights: • RhoGDI2 is identified as a potential filamin A (FLNA)-binding partner. • Phosphomimetic mutant, RhoGDI2(Tyr153Glu) interacts with FLNA. • RhoGDI2 phosphorylated (Tyr153) by src kinase does not interact with FLNA. • Mutation of Tyr-153 to Glu of RhoGDI2 does not mimic phosphorylation. • RhoGDI2(Tyr153Glu) provokes an adventitious interaction with FLNA.
An adventitious interaction of filamin A with RhoGDI2(Tyr153Glu)
Energy Technology Data Exchange (ETDEWEB)
Song, Mia; He, Qianjing [Hematology Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston MA (United States); Berk, Benjamin-Andreas [Faculty of Veterinary Medicine and Faculty of Biosciences and Pharmacy, University of Leipzig, Leipzig (Germany); Hartwig, John H.; Stossel, Thomas P. [Hematology Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston MA (United States); Nakamura, Fumihiko, E-mail: fnakamura@partners.org [Hematology Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston MA (United States)
2016-01-15
Filamin A (FLNA) is an actin filament crosslinking protein with multiple intracellular binding partners. Mechanical force exposes cryptic FLNA binding sites for some of these ligands. To identify new force-dependent binding interactions, we used a fusion construct composed of two FLNA domains, one of which was previously identified as containing a force-dependent binding site as a bait in a yeast two-hybrid system and identified the Rho dissociation inhibitor 2 (RhoGDI2) as a potential interacting partner. A RhoGDI2 truncate with 81 N-terminal amino acid residues and a phosphomimetic mutant, RhoGDI(Tyr153Glu) interacted with the FLNA construct. However, neither wild-type or full-length RhoGDI2 phosphorylated at Y153 interacted with FLNA. Our interpretation of these contradictions is that truncation and/or mutation of RhoGDI2 perturbs its conformation to expose a site that adventitiously binds FLNA and is not a bona–fide interaction. Therefore, previous studies reporting that a RhoGDI(Y153E) mutant suppresses the metastasis of human bladder cancer cells must be reinvestigated in light of artificial interaction of this point mutant with FLNA. - Highlights: • RhoGDI2 is identified as a potential filamin A (FLNA)-binding partner. • Phosphomimetic mutant, RhoGDI2(Tyr153Glu) interacts with FLNA. • RhoGDI2 phosphorylated (Tyr153) by src kinase does not interact with FLNA. • Mutation of Tyr-153 to Glu of RhoGDI2 does not mimic phosphorylation. • RhoGDI2(Tyr153Glu) provokes an adventitious interaction with FLNA.
Directory of Open Access Journals (Sweden)
Weixiang Guo
2015-06-01
Full Text Available Fragile X mental retardation protein (FMRP and its autosomal paralog FXR2P are selective neuronal RNA-binding proteins, and mice that lack either protein exhibit cognitive deficits. Although double-mutant mice display more severe learning deficits than single mutants, the molecular mechanism behind this remains unknown. In the present study, we discovered that FXR2P (also known as FXR2 is important for neuronal dendritic development. FMRP and FXR2P additively promote the maturation of new neurons by regulating a common target, the AMPA receptor GluA1, but they do so via distinct mechanisms: FXR2P binds and stabilizes GluA1 mRNA and enhances subsequent protein expression, whereas FMRP promotes GluA1 membrane delivery. Our findings unveil important roles for FXR2P and GluA1 in neuronal development, uncover a regulatory mechanism of GluA1, and reveal a functional convergence between fragile X proteins in neuronal development.
Directory of Open Access Journals (Sweden)
Yasuhiro Kawasaki
2018-04-01
Full Text Available Glutamatergic dendritic EPSPs evoked in cortical pyramidal neurons are depressed by activation of hyperpolarization-activated cyclic nucleotide-gated (HCN channels expressed in dendritic spines. This depression has been attributed to shunting effects of HCN current (Ih on input resistance or Ih deactivation. Primary sensory neurons in the rat mesencephalic trigeminal nucleus (MTN have the somata covered by spine-like microvilli that express HCN channels. In rat MTN neurons, we demonstrated that Ih enhancement apparently diminished the glutamate receptor (GluR current (IGluR evoked by puff application of glutamate/AMPA and enhanced a transient outward current following IGluR (OT-IGluR. This suggests that some outward current opposes inward IGluR. The IGluR inhibition displayed a U-shaped voltage-dependence with a minimal inhibition around the resting membrane potential, suggesting that simple shunting effects or deactivation of Ih cannot explain the U-shaped voltage-dependence. Confocal imaging of Na+ revealed that GluR activation caused an accumulation of Na+ in the microvilli, which can cause a negative shift of the reversal potential for Ih (Eh. Taken together, it was suggested that IGluR evoked in MTN neurons is opposed by a transient decrease or increase in standing inward or outward Ih, respectively, both of which can be caused by negative shifts of Eh, as consistent with the U-shaped voltage-dependence of the IGluR inhibition and the OT-IGluR generation. An electron-microscopic immunohistochemical study revealed the colocalization of HCN channels and glutamatergic synapses in microvilli of MTN neurons, which would provide a morphological basis for the functional interaction between HCN and GluR channels. Mathematical modeling eliminated the possibilities of the involvements of Ih deactivation and/or shunting effect and supported the negative shift of Eh which causes the U-shaped voltage-dependent inhibition of IGluR.
49 CFR 268.5 - Federal funding sources for the Maglev Deployment Program.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Federal funding sources for the Maglev Deployment... TECHNOLOGY DEPLOYMENT PROGRAM Overview § 268.5 Federal funding sources for the Maglev Deployment Program. (a) Federal Maglev Funds. Section 322 of Title 23 provides for the following funds for the Maglev Deployment...
DEFF Research Database (Denmark)
Stensbøl, T B; Jensen, H S; Nielsen, B
2001-01-01
)-Glu) receptors (EC(50)=14 microM), comparable in potency with ATPA (EC(50)=34 microM). Recent findings, that (S)-ATPA is a potent (EC(50)=0.48 microM) and selective agonist at homomerically expressed ionotropic GluR5, prompted us to resolve thio-ATPA using chiral chromatography and pharmacologically characterize...
Energy Technology Data Exchange (ETDEWEB)
Reid, M.E.; Toms, N.J.; Bedingfield, J.S.; Roberts, P.J. [Department of Pharmacology, School of Medical Sciences, University of Bristol, University Walk, Bristol, BS8 1TD (United Kingdom)
1999-04-01
In the current study, we have characterized group I metabotropic glutamate (mGlu) receptor enhancement of 4-aminopyridine (4AP)-evoked [{sup 3}H]glutamate release from rat cerebrocortical synaptosomes. The broad spectrum mGlu receptor agonist (1S,3R)-1-aminocyclopentane-1,3-dicarboxylic acid ((1S,3R)-ACPD, 10 {mu}M) increased 4AP-evoked [{sup 3}H]glutamate release (143.32{+-}2.73% control) only in the presence of exogenously applied arachidonic acid; an effect reversed by the inclusion of bovine serum albumin (BSA, fatty acid free). In contrast, the selective group I mGlu receptor agonist (S)-3,5-dihydroxyphenylglycine (DHPG) potentiated (EC{sub 50}=1.60{+-}0.25 {mu}M; E{sub max}=147.61{+-}10.96% control) 4AP-evoked [{sup 3}H]glutamate release, in the absence of arachidonic acid. This potentiation could be abolished by either the selective mGlu{sub 1} receptor antagonist (R,S)-1-aminoindan-1,5-dicarboxylic acid (AIDA, 1 mM) or the selective PKC inhibitor (Ro 31-8220, 10 {mu}M) and was BSA-insensitive. The selective mGlu{sub 5} receptor agonist (R,S)-2-chloro-5-hydroxyphenylglycine (CHPG, 300{mu}M) was without effect. DHPG (100 {mu}M) also potentiated both 30 mM and 50 mM K{sup +}-evoked [{sup 3}H]glutamate release (121.60{+-}12.77% and 121.50{+-}4.45% control, respectively). DHPG (100 {mu}M) failed to influence both 4AP-stimulated {sup 45}Ca{sup 2+} influx and 50 mM K{sup +}-induced changes in synaptosomal membrane potential. Possible group I mGlu receptor suppression of tonic adenosine A{sub 1} receptor, group II/III mGlu receptors or GABA{sub B} receptor activity is unlikely since 4AP-evoked [{sup 3}H]glutamate release was insensitive to the selective inhibitory receptor antagonists 8-cyclopentyl-1,3-dimethylxanthine, (R,S)-{alpha}-cyclopropyl-4-phosphonophenylglycine or CGP55845A, respectively. These data suggest an 'mGlu{sub 1} receptor-like' receptor potentiates [{sup 3}H]glutamate release from cerebrocortical synaptosomes in the absence of
A Precise Physical Orbit For The M-Dwarf Binary Gliese 268
Barry, R. K.; Demory, B. -O.; Segransan, D.; Forveille, T.; Danchi, W. C.; Di Folco, E.; Queloz, D.; Spooner, H. R.; Torres, G.; Traub, W. A.;
2012-01-01
We report high-precision interferometric and radial velocity (RV) observations of the M-dwarf binary Gl 268. Combining measurements conducted using the IOTA interferometer and the ELODIE and Harvard Center for Astrophysics RV instruments leads to a mass of 0.22596 plus-minus 0.00084 Mass compared to the sun for component A and 0.19230 plus-minus 0.00071 Mass compared to the sun for component B. The system parallax as determined by these observations is 0.1560 plus-minus 0.0030 arcsec - a measurement with 1.9% uncertainty in excellent agreement with Hipparcos (0.1572 plus-minus 0.0033). The absolute H-band magnitudes of the component stars are not well constrained by these measurements; however, we can place an approximate upper limit of 7.95 and 8.1 for Gl 268A and B, respectively.We test these physical parameters against the predictions of theoretical models that combine stellar evolution with high fidelity, non-gray atmospheric models. Measured and predicted values are compatible within 2sigma. These results are among the most precise masses measured for visual binaries and compete with the best adaptive optics and eclipsing binary results.
DEFF Research Database (Denmark)
Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus
2017-01-01
Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D...
International Nuclear Information System (INIS)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan; Im, Young Jun; Kim, Mun-Kyoung; Kang, Gil Bu; Eom, Soo Hyun
2005-01-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222 1 , with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V M value of 2.49 Å 3 Da −1 . The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)
Energy Technology Data Exchange (ETDEWEB)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan; Im, Young Jun; Kim, Mun-Kyoung; Kang, Gil Bu; Eom, Soo Hyun, E-mail: eom@gist.ac.kr [Department of Life Science, Gwangju Institute of Science and Technology, Gwangju 500-712 (Korea, Republic of)
2005-11-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}. The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)
Automatic Color Sorting of Hardwood Edge-Glued Panel Parts
D. Earl Kline; Richard Conners; Qiang Lu; Philip A. Araman
1997-01-01
This paper describes an automatic color sorting system for red oak edge-glued panel parts. The color sorting system simultaneously examines both faces of a panel part and then determines which face has the "best" color, and sorts the part into one of a number of color classes at plant production speeds. Initial test results show that the system generated over...
Directory of Open Access Journals (Sweden)
Rachel D. Moloney
2015-01-01
Full Text Available Glutamate, the main excitatory neurotransmitter in the central nervous system, exerts its effect through ionotropic and metabotropic receptors. Of these, group III mGlu receptors (mGlu 4, 6, 7, 8 are among the least studied due to a lack of pharmacological tools. mGlu7 receptors, the most highly conserved isoform, are abundantly distributed in the brain, especially in regions, such as the amygdala, known to be crucial for the emotional processing of painful stimuli. Visceral hypersensitivity is a poorly understood phenomenon manifesting as an increased sensitivity to visceral stimuli. Glutamate has long been associated with somatic pain processing leading us to postulate that crossover may exist between these two modalities. Moreover, stress has been shown to exacerbate visceral pain. ADX71743 is a novel, centrally penetrant, negative allosteric modulator of mGlu7 receptors. Thus, we used this tool to explore the possible involvement of this receptor in the mediation of visceral pain in a stress-sensitive model of visceral hypersensitivity, namely the Wistar Kyoto (WKY rat. ADX71743 reduced visceral hypersensitivity in the WKY rat as exhibited by increased visceral sensitivity threshold with concomitant reductions in total number of pain behaviours. Moreover, AD71743 increased total distance and distance travelled in the inner zone of the open field. These findings show, for what is to our knowledge, the first time, that mGlu7 receptor signalling plays a role in visceral pain processing. Thus, negative modulation of the mGlu7 receptor may be a plausible target for the amelioration of stress-induced visceral pain where there is a large unmet medical need.
Internal amplification control of PCR for the Glu1-Dx5 allele in wheat.
Heim, H N; Vieira, E S N; Polo, L R T; Lima, N K; Silva, G J; Linde, G A; Colauto, N B; Schuster, I
2017-08-17
One of the limiting factors in using dominant markers is the unique amplification of the target fragment. Therefore, failures in polymerase chain reaction (PCR) or non-amplifications can be interpreted as an absence of the allele. The possibility of false negatives implies in reduced efficiency in the selection process in genetic breeding programs besides the loss of valuable genetic material. Thus, this study aimed to evaluate the viability of a microsatellite marker as an internal amplification control with a dominant marker for the wheat Glu1-Dx5 gene. A population of 77 wheat cultivars/breeding lines was analyzed. Fourteen microsatellite markers were analyzed in silico regarding the formation of dimers and clamps. The biplex reaction conditions were optimized, and the Xbarc117 marker was selected as the internal amplification control with a Glu1-Dx5 marker in wheat. It was concluded that the Xbarc117 microsatellite marker was effective in the simultaneous amplification with a dominant Glu1-Dx5 marker, making biplex PCR viable in wheat for the studied markers.
Directory of Open Access Journals (Sweden)
Hyunjeong Yang
Full Text Available Some ubiquitin-like (UBL domain-containing proteins are known to play roles in receptor trafficking. Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors (AMPARs undergo constitutive cycling between the intracellular compartment and the cell surface in the central nervous system. However, the function of UBL domain-containing proteins in the recycling of the AMPARs to the synaptic surface has not yet been reported.Here, we report that the Transmembrane and ubiquitin-like domain-containing 1 (Tmub1 protein, formerly known as the Hepatocyte Odd Protein Shuttling (HOPS protein, which is abundantly expressed in the brain and which exists in a synaptosomal membrane fraction, facilitates the recycling of the AMPAR subunit GluR2 to the cell surface. Neurons transfected with Tmub1/HOPS-RNAi plasmids showed a significant reduction in the AMPAR current as compared to their control neurons. Consistently, the synaptic surface expression of GluR2, but not of GluR1, was significantly decreased in the neurons transfected with the Tmub1/HOPS-RNAi and increased in the neurons overexpressing EGFP-Tmub1/HOPS. The altered surface expression of GluR2 was speculated to be due to the altered surface-recycling of the internalized GluR2 in our recycling assay. Eventually, we found that GluR2 and glutamate receptor interacting protein (GRIP were coimmunoprecipitated by the anti-Tmub1/HOPS antibody from the mouse brain. Taken together, these observations show that the Tmub1/HOPS plays a role in regulating basal synaptic transmission; it contributes to maintain the synaptic surface number of the GluR2-containing AMPARs by facilitating the recycling of GluR2 to the plasma membrane.
Handford, Charlotte E; Tan, Shawn; Lawrence, Andrew J; Kim, Jee Hyun
2014-09-01
The metabotropic glutamate receptor 5 (mGlu5) and N-methyl-D-aspartate (NMDA) receptor are critical for processes underlying synaptic plasticity, such as long-term potentiation. mGlu5 signaling increases neuronal excitability and potentiates NMDA receptor currents in the amygdala and the hippocampus. The present study examined the involvement of mGlu5 in the acquisition and consolidation of conditioned fear to a tone and context in mice, and explored the functional relationship between mGlu5 and NMDA receptors in this regard. Experiment 1 showed that systemic administration of the mGlu5 negative allosteric modulator 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) prior to conditioning significantly attenuated cue-elicited freezing during fear conditioning, which suggests that mGlu5 is necessary for the formation of a tone-shock association. This effect was dose-related (Experiment 2) and not due to any effects of MTEP on shock sensitivity or state-dependency (Experiment 3). Post-conditioning injection of MTEP had no effects (Experiment 4). Although post-conditioning injection of the NMDA receptor partial agonist D-cycloserine (DCS) alone facilitated consolidation of conditioned fear (Experiment 6), it was not able to rescue the acquisition deficit caused by MTEP (Experiment 5). Taken together, these findings indicate a crucial role for mGlu5 signaling in acquisition and NMDA receptor signaling in consolidation of conditioned fear.
Automatic Color Sorting System for Hardwood Edge-Glued Panel Parts
Richard W. Conners; D.Earl Kline; Philip A. Araman
1996-01-01
The color sorting of edge-glued panel parts is becoming more important in the manufacture of hardwood products. Consumers, while admiring the natural appearance of hardwoods, do not like excessive color variation across product surfaces. Color uniformity is particularly important today because of the popularity of lightly stained products. Unfortunately, color sorting...
Yamamoto, Hideko; Kamegaya, Etsuko; Hagino, Yoko; Takamatsu, Yukio; Sawada, Wakako; Matsuzawa, Maaya; Ide, Soichiro; Yamamoto, Toshifumi; Mishina, Masayoshi; Ikeda, Kazutaka
2017-01-01
The N-methyl-d-aspartate (NMDA) receptor channel is involved in various physiological functions, including learning and memory. The GluN2D subunit of the NMDA receptor has low expression in the mature brain, and its role is not fully understood. In the present study, the effects of GluN2D subunit deficiency on emotional and cognitive function were investigated in GluN2D knockout (KO) mice. We found a reduction of motility (i.e., a depressive-like state) in the tail suspension test and a reduction of sucrose preference (i.e., an anhedonic state) in GluN2D KO mice that were group-housed with littermates. Despite apparently normal olfactory function and social interaction, GluN2D KO mice exhibited a decrease in preference for social novelty, suggesting a deficit in social recognition or memory. Golgi-Cox staining revealed a reduction of the complexity of dendritic trees in the accessory olfactory bulb in GluN2D KO mice, suggesting a deficit in pheromone processing pathway activation, which modulates social recognition. The deficit in social recognition may result in social stress in GluN2D KO mice. Isolation housing is a procedure that has been shown to reduce stress in mice. Interestingly, 3-week isolation and treatment with agomelatine or the 5-hydroxytryptamine-2C (5-HT 2C ) receptor antagonist SB242084 reversed the anhedonic-like state in GluN2D KO mice. In contrast, treatment with the 5-HT 2C receptor agonist CP809101 induced depressive- and anhedonic-like states in isolated GluN2D KO mice. These results suggest that social stress that is caused by a deficit in social recognition desensitizes 5-HT 2c receptors, followed by an anhedonic- and depressive-like state, in GluN2D KO mice. The GluN2D subunit of the NMDA receptor appears to be important for the recognition of individuals and development of normal emotionality in mice. 5-HT 2C receptor antagonism may be a therapeutic target for treating social stress-induced anhedonia. This article is part of the Special
Bahi, Amine
2013-10-01
Whether metabotropic glutamate 7 (mGluR7) -activation enhances or diminishes the reinforcing properties of psychostimulants remains unclear. We have previously shown that systemic mGluR7 activation reduced alcohol consumption and preference as well as locomotor-stimulating and rewarding properties of ethanol. In this study, we further examined the contribution of mGluR7 on the effect of ethanol within the nucleus accumbens (NAcc), a neural target for many drugs of abuse. Using short hairpin RNA (shRNA)-expressing lentiviral vectors (LV) to alter locally the activity of mGluR7 in male rats, we have shown that blocking mGluR7 expression increased ethanol consumption and preference in a two-bottle choice drinking paradigm with no effect either on saccharin or on quinine used for taste discrimination. In addition, mGluR7 knockdown increases preference for environments previously paired with low doses of ethanol in the conditioned place preference (CPP) test, as it shifted the dose-response curve for ethanol CPP to the left, indicating alterations in the rewarding effects of alcohol. More importantly, mGluR7 blockade in the dorsal striatum (DS) neither affected ethanol consumption nor ethanol-elicited CPP. These results show that levels of mGluR7 in the NAcc regulate responsiveness to alcohol. Taken together, these findings clearly demonstrate that mGluR7 signaling within the NAcc is a key modulator of functional responses to ethanol and offer an important target for regulating the addictive effects of alcohol.
Rossi, Pia Irene Anna; Musante, Ilaria; Summa, Maria; Pittaluga, Anna; Emionite, Laura; Ikehata, Masami; Rastaldi, Maria Pia; Ravazzolo, Roberto; Puliti, Aldamaria
2013-09-01
The metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, the only members of group I mGlu receptors, are implicated in synaptic plasticity and mechanisms of feedback control of glutamate release. They exhibit nearly complementary distributions throughout the central nervous system, well evident in the cerebellum, where mGlu1 receptor is most intensely expressed while mGlu5 receptor is not. Despite their different distribution, they show a similar subcellular localization and use common transducing pathways. We recently described the Grm1(crv4) mouse with motor coordination deficits and renal anomalies caused by a spontaneous mutation inactivating the mGlu1 receptor. To define the neuropathological mechanisms in these mice, we evaluated expression and function of the mGlu5 receptor in cerebral and cerebellar cortices. Western blot and immunofluorescence analyses showed mGlu5 receptor overexpression. Quantitative reverse transcriptase-polymerase chain reaction results indicated that the up-regulation is already evident at RNA level. Functional studies confirmed an enhanced glutamate release from cortical cerebral and cerebellar synaptosomes when compared with wild-type that is abolished by the mGlu5 receptor-specific inhibitor, 2-methyl-6-(phenylethynyl) pyridine hydrochloride (MPEP). Finally, acute MPEP treatment of Grm1(crv4/crv4) mice induced an evident although incomplete improvement of motor coordination, suggesting that mGlu5 receptors enhanced activity worsens, instead of improving, the motor-coordination defects in the Grm1(crv4/crv4) mice.
Synthesis, in vitro and in vivo evaluation of [11C]MMTP: a potential PET ligand for mGluR1 receptors
DEFF Research Database (Denmark)
Prabhakaran, Jaya; Majo, Vattoly J; Milak, Matthew S
2010-01-01
Synthesis, in vitro and in vivo evaluation of [O-methyl-(11)C]dimethylamino-3(4-methoxyphenyl)-3H-pyrido[3',2':4,5]thieno[3,2-d]pyrimidin-4-one (1), a potential imaging agent for mGluR1 receptors using PET are described. Synthesis of the corresponding desmethyl precursor 2 was achieved...... selectively labeled mGluR1 receptors in slide-mounted sections of postmortem human brain containing cerebellum, hippocampus, prefrontal cortex and striatum as demonstrated by in vitro autoradiography using phosphor-imaging. PET studies in anesthetized baboon show that [(11)C]1 penetrates the BBB...... and accumulates in cerebellum, a region reported to have higher expression of mGluR1. These findings suggest [(11)C]1 is a promising PET radiotracer candidate for mGluR1....
Directory of Open Access Journals (Sweden)
Aykut Üner
2015-10-01
Conclusions: GluN2B-containing NMDA receptors in AgRP neurons play a critical role in central control of body weight homeostasis and blood glucose balance via mechanisms that likely involve regulation of AgRP neuronal survival and structure, and modulation of hypothalamic leptin action.
Tamminga, Carol A.; Zukin, R. Suzanne
2017-01-01
The hippocampus is strongly implicated in the psychotic symptoms of schizophrenia. Functionally, basal hippocampal activity (perfusion) is elevated in schizophrenic psychosis, as measured with positron emission tomography (PET) and with magnetic resonance (MR) perfusion techniques, while hippocampal activation to memory tasks is reduced. Subfield-specific hippocampal molecular pathology exists in human psychosis tissue which could underlie this neuronal hyperactivity, including increased GluN2B-containing NMDA receptors in hippocampal CA3, along with increased postsynaptic density protein-95 (PSD-95) along with augmented dendritic spines on the pyramidal neuron apical dendrites. We interpret these observations to implicate a reduction in the influence of a ubiquitous gene repressor, repressor element-1 silencing transcription factor (REST) in psychosis; REST is involved in the age-related maturation of the NMDA receptor from GluN2B- to GluN2A-containing NMDA receptors through epigenetic remodeling. These CA3 changes in psychosis leave the hippocampus liable to pathological increases in neuronal activity, feedforward excitation and false memory formation, sometimes with psychotic content. PMID:26211447
Directory of Open Access Journals (Sweden)
Xu Zhao-Hui
2012-05-01
Full Text Available Abstract Background Fragile X syndrome (FXS is caused by the absence of the mRNA-binding protein Fragile X mental retardation protein (FMRP, encoded by the Fmr1 gene. Overactive signaling by group 1 metabotropic glutamate receptor (Grp1 mGluR could contribute to slowed synaptic development and other symptoms of FXS. Our previous study has identified that facilitation of synaptic long-term potentiation (LTP by D1 receptor is impaired in Fmr1 knockout (KO mice. However, the contribution of Grp1 mGluR to the facilitation of synaptic plasticity by D1 receptor stimulation in the prefrontal cortex has been less extensively studied. Results Here we demonstrated that DL-AP3, a Grp1 mGluR antagonist, rescued LTP facilitation by D1 receptor agonist SKF81297 in Fmr1KO mice. Grp1 mGluR inhibition restored the GluR1-subtype AMPA receptors surface insertion by D1 activation in the cultured Fmr1KO neurons. Simultaneous treatment of Grp1 mGluR antagonist with D1 agonist recovered the D1 receptor signaling by reversing the subcellular redistribution of G protein-coupled receptor kinase 2 (GRK2 in the Fmr1KO neurons. Treatment of SKF81297 alone failed to increase the phosphorylation of NR2B-containing N-methyl D-aspartate receptors (NMDARs at Tyr-1472 (p-NR2B-Tyr1472 in the cultures from KO mice. However, simultaneous treatment of DL-AP3 could rescue the level of p-NR2B-Tyr1472 by SKF81297 in the cultures from KO mice. Furthermore, behavioral tests indicated that simultaneous treatment of Grp1 mGluR antagonist with D1 agonist inhibited hyperactivity and improved the learning ability in the Fmr1KO mice. Conclusion The findings demonstrate that mGluR1 inhibition is a useful strategy to recover D1 receptor signaling in the Fmr1KO mice, and combination of Grp1 mGluR antagonist and D1 agonist is a potential drug therapy for the FXS.
Directory of Open Access Journals (Sweden)
Ioana Neagoe
2018-04-01
Full Text Available Abnormal signaling pathways mediated by N-methyl-d-aspartate receptors (NMDARs have been implicated in the pathogenesis of various CNS disorders and have been long considered as promising points of therapeutic intervention. However, few efforts have been previously described concerning evaluation of therapeutic modulators of NMDARs and their downstream pathways in human neurons with endogenous expression of NMDARs. In the present study, we assessed expression, functionality, and subunit composition of endogenous NMDARs in human induced pluripotent stem cell (hiPSC-derived cortical neurons (iCell Neurons and iCell GlutaNeurons. We initially confirmed the expected pharmacological response of iCell Neurons and iCell GlutaNeurons to NMDA by patch-clamp recordings. Subsequent pharmacological interrogation using GluN2 subunit-selective antagonists revealed the predominance of GluN2B in both iCell Neurons and iCell GlutaNeurons. This observation was also supported by qRT-PCR and Western blot analyses of GluN2 subunit expression as well as pharmacological experiments using positive allosteric modulators with distinct GluN2 subunit selectivity. We conclude that iCell Neurons and iCell GlutaNeurons express functional GluN2B-containing NMDARs and could serve as a valuable system for development and validation of GluN2B-modulating pharmaceutical agents. Keywords: Human induced pluripotent stem cell-derived neurons, iCell Neurons, iCell GlutaNeurons, NMDA receptors, GluN2B, Positive allosteric modulators
Directory of Open Access Journals (Sweden)
Ahn Dong-Kuk
2009-09-01
Full Text Available Abstract Group I mGluRs (mGluR1 and 5 pre- and/or postsynaptically regulate synaptic transmission at glutamatergic synapses. By recording spontaneous EPSCs (sEPSCs in the spinal trigeminal subnucleus oralis (Vo, we here investigated the regulation of glutamatergic transmission through the activation of group I mGluRs. Bath-applied DHPG (10 μM/5 min, activating the group I mGluRs, increased sEPSCs both in frequency and amplitude; particularly, the increased amplitude was long-lasting. The DHPG-induced increases of sEPSC frequency and amplitude were not NMDA receptor-dependent. The DHPG-induced increase in the frequency of sEPSCs, the presynaptic effect being further confirmed by the DHPG effect on paired-pulse ratio of trigeminal tract-evoked EPSCs, an index of presynaptic modulation, was significantly but partially reduced by blockades of voltage-dependent sodium channel, mGluR1 or mGluR5. Interestingly, PKC inhibition markedly enhanced the DHPG-induced increase of sEPSC frequency, which was mainly accomplished through mGluR1, indicating an inhibitory role of PKC. In contrast, the DHPG-induced increase of sEPSC amplitude was not affected by mGluR1 or mGluR5 antagonists although the long-lasting property of the increase was disappeared; however, the increase was completely inhibited by blocking both mGluR1 and mGluR5. Further study of signal transduction mechanisms revealed that PLC and CaMKII mediated the increases of sEPSC in both frequency and amplitude by DHPG, while IP3 receptor, NO and ERK only that of amplitude during DHPG application. Altogether, these results indicate that the activation of group I mGluRs and their signal transduction pathways differentially regulate glutamate release and synaptic responses in Vo, thereby contributing to the processing of somatosensory signals from orofacial region.
D'Amore, V.; Santolini, I.; Rijn, C.M. van; Biagioni, F.; Molinaro, G.; Prete, A.; Conn, P.J.; Lindsley, C.W.; Zhou, Y.; Vinson, P.N.; Rodriguez, A.L.; Jones, C.K.; Stauffer, S.R.; Nicoletti, F.; Luijtelaar, E.L.J.M. van; Ngomba, R.T.
2013-01-01
Absence epilepsy is generated by the cortico-thalamo-cortical network, which undergoes a finely tuned regulation by metabotropic glutamate (mGlu) receptors. We have shown previously that potentiation of mGlu1 receptors reduces spontaneous occurring spike and wave discharges (SWDs) in the WAG/Rij rat
Isherwood, Sarah N; Robbins, Trevor W; Nicholson, Janet R; Dalley, Jeffrey W; Pekcec, Anton
2017-09-01
Metabotropic glutamate receptor 4 (mGluR4) and dopamine D 2 receptors are specifically expressed within the indirect pathway neurons of the striato-pallidal-subthalamic pathway. This unique expression profile suggests that mGluR4 and D 2 receptors may play a cooperative role in the regulation and inhibitory control of behaviour. We investigated this possibility by testing the effects of a functionally-characterised positive allosteric mGluR4 modulator, 4-((E)-styryl)-pyrimidin-2-ylamine (Cpd11), both alone and in combination with the D 2 receptor antagonist eticlopride, on two distinct forms of impulsivity. Rats were trained on the five-choice serial reaction time task (5-CSRTT) of sustained visual attention and segregated according to low, mid, and high levels of motor impulsivity (LI, MI and HI, respectively), with unscreened rats used as an additional control group. A separate group of rats was trained on a delay discounting task (DDT) to assess choice impulsivity. Systemic administration of Cpd11 dose-dependently increased motor impulsivity and impaired attentional accuracy on the 5-CSRTT in all groups tested. Eticlopride selectively attenuated the increase in impulsivity induced by Cpd11, but not the accompanying attentional impairment, at doses that had no significant effect on behavioural performance when administered alone. Cpd11 also decreased choice impulsivity on the DDT (i.e. increased preference for the large, delayed reward) and decreased locomotor activity. These findings demonstrate that mGluR4s, in conjunction with D 2 receptors, affect motor- and choice-based measures of impulsivity, and therefore may be novel targets to modulate impulsive behaviour associated with a number of neuropsychiatric syndromes. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Association of Gln27Glu polymorphism of the β-2- adrenergic ...
African Journals Online (AJOL)
A group of 66 patients with preeclampsia and 72 control subjects were analyzed for the Arg16Gly and Gln27Glu polymorphisms of the ADRB2 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Comparisons of the ADRB2 genotypes or alleles between different groups were performed ...
Babiec, Walter E.; Guglietta, Ryan; O'Dell, Thomas J.
2016-01-01
Dephosphorylation of AMPA receptor (AMPAR) GluA1 subunits at two sites, serine 845 (S845) and threonine 840 (T840), is thought to be involved in NMDA receptor-dependent forms of long-term depression (LTD). Importantly, the notion that dephosphorylation of these sites contributes to LTD assumes that a significant fraction of GluA1 subunits are…
2014-01-01
Background We previously performed systematic association studies of glutamate receptor gene family members with schizophrenia, and found positive associations of polymorphisms in the GRM3 (a gene of metabotropic glutamate receptor 3: mGluR3) with the disorder. Physiological roles of GRM3 in brain functions and its functional roles in the pathogenesis of schizophrenia remain to be resolved. Results We generated mGluR3 knockout (KO) mice and conducted comprehensive behavioral analyses. KO mice showed hyperactivity in the open field, light/dark transition, and 24-hour home cage monitoring tests, impaired reference memory for stressful events in the Porsolt forced swim test, impaired contextual memory in cued and contextual fear conditioning test, and impaired working memory in the T-Maze forced alternation task test. Hyperactivity and impaired working memory are known as endophenotypes of schizophrenia. We examined long-term synaptic plasticity by assessing long-term potentiation (LTP) in the CA1 region in the hippocampi of KO and wild-type (WT) mice. We observed no differences in the amplitude of LTP between the two genotypes, suggesting that mGluR3 is not essential for LTP in the CA1 region of the mouse hippocampus. As hyperactivity is typically associated with increased dopaminergic transmission, we performed in vivo microdialysis measurements of extracellular dopamine in the nucleus accumbens of KO and WT mice. We observed enhancements in the methamphetamine (MAP)-induced release of dopamine in KO mice. Conclusions These results demonstrate that a disturbance in the glutamate-dopamine interaction may be involved in the pathophysiology of schizophrenia-like behavior, such as hyperactivity in mGluR3 KO mice. PMID:24758191
Machine Vision System for Color Sorting Wood Edge-Glued Panel Parts
Qiang Lu; S. Srikanteswara; W. King; T. Drayer; Richard Conners; D. Earl Kline; Philip A. Araman
1997-01-01
This paper describes an automatic color sorting system for hardwood edge-glued panel parts. The color sorting system simultaneously examines both faces of a panel part and then determines which face has the "better" color given specified color uniformity and priority defined by management. The real-time color sorting system software and hardware are briefly...
Jensen, V.; Kaiser, K.M.M.; Borchardt, T.; Adelmann, G.; Rozov, A.; Burnashev, N.; Brix, C.; Frotscher, M.; Anderson, P.; Hvalby, O.; Sakmann, B.; Seeburg, P.H.; Sprengel, R.
2003-01-01
In adult mice, long-term potentiation (LTP) of synaptic transmission at CA3-to-CA1 synapses induced by tetanic stimulation requires L-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptors containing GluR-A subunits. Here, we report a GluR-A-independent form of LTP, which is comparable in
DEFF Research Database (Denmark)
Kvist, Trine; Steffensen, Thomas Bielefeldt; Greenwood, Jeremy R
2013-01-01
NMDA receptors are ligand-gated ion channels that mediate excitatory neurotransmission in the brain. They are tetrameric complexes composed of glycine-binding GluN1 and GluN3 subunits together with glutamate-binding GluN2 subunits. Subunit-selective antagonists that discriminate between the glyci...... screening. Furthermore, the structure reveals that the imino acetamido group of TK40 acts as an α-amino acid bioisostere, which could be of importance in bioisosteric replacement strategies for future ligand design....
Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena
2014-01-01
Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413
Directory of Open Access Journals (Sweden)
Yan Zhao
2015-01-01
Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.
Directory of Open Access Journals (Sweden)
Diego Sepúlveda Falla
2010-05-01
Full Text Available
Dehydroepiandrosterone sulfate (DHEA-S is a neurosteroid that has effects such as neuromodulator of synaptic transmission and neuroprotection. The specific signaling pathways for these effects are not elucidated yet. Given that, some neurosteroids act through the activation of ionotropic glutamate receptors, therefore the effect of DHEA-S on the subunits GluR2 and GluR3 of the AMPA receptor was evaluated. Either DHEA-S or a control substance was administered to C57/BL6 mice. Subunit expression of the AMPA receptor was analyzed by Western blotting.
Results show that long-term DHEA-S administration to C57/BL6 mice, increases the protein levels of the subunits GluR2 and GluR2/3 of the AMPA receptors located in the hippocampus.
D’Ascenzo, Marcello; Podda, Maria Vittoria; Fellin, Tommaso; Azzena, Gian Battista; Haydon, Philip; Grassi, Claudio
2009-01-01
The involvement of metabotropic glutamate receptors type 5 (mGluR5) in drug-induced behaviours is well-established but limited information is available on their functional roles in addiction-relevant brain areas like the nucleus accumbens (NAc). This study demonstrates that pharmacological and synaptic activation of mGluR5 increases the spike discharge of medium spiny neurons (MSNs) in the NAc. This effect was associated with the appearance of a slow afterdepolarization (ADP) which, in voltage-clamp experiments, was recorded as a slowly inactivating inward current. Pharmacological studies showed that ADP was elicited by mGluR5 stimulation via G-protein-dependent activation of phospholipase C and elevation of intracellular Ca2+ levels. Both ADP and spike aftercurrents were significantly inhibited by the Na+ channel-blocker, tetrodotoxin (TTX). Moreover, the selective blockade of persistent Na+ currents (INaP), achieved by NAc slice pre-incubation with 20 nm TTX or 10 μm riluzole, significantly reduced the ADP amplitude, indicating that this type of Na+ current is responsible for the mGluR5-dependent ADP. mGluR5 activation also produced significant increases in INaP, and the pharmacological blockade of this current prevented the mGluR5-induced enhancement of spike discharge. Collectively, these data suggest that mGluR5 activation upregulates INaP in MSNs of the NAc, thereby inducing an ADP that results in enhanced MSN excitability. Activation of mGluR5 will significantly alter spike firing in MSNs in vivo, and this effect could be an important mechanism by which these receptors mediate certain aspects of drug-induced behaviours. PMID:19433572
Dossat, Amanda M; Jourdi, Hussam; Wright, Katherine N; Strong, Caroline E; Sarkar, Ambalika; Kabbaj, Mohamed
2017-01-06
In humans, some males experience reductions in testosterone levels, as a natural consequence of aging or in the clinical condition termed hypogonadism, which are associated with impaired cognitive performance and mood disorder(s). Some of these behavioral deficits can be reversed by testosterone treatment. Our previous work in rats reported that sex differences in the expression of the transcription factor Zif268, a downstream target of testosterone, within the medial prefrontal cortex (mPFC) mediates sex differences in social interaction. In the present study, we aimed to examine the effects of gonadectomy (GNX) in male rats on mPFC Zif268 expression, mood and cognitive behaviors. We also examined whether reinstitution of Zif268 in GNX rats will correct some of the behavioral deficits observed following GNX. Our results show that GNX induced a downregulation of Zif268 protein in the mPFC, which was concomitant with impaired memory in the y-maze and spontaneous object recognition test, reduced social interaction time, and depression-like behaviors in the forced swim test. Reinstitution of mPFC Zif268, using a novel adeno-associated-viral (AAV) construct, abrogated GNX-induced working memory and long-term memory impairments, and reductions in social interaction time, but not GNX-induced depression-like behaviors. These findings suggest that mPFC Zif268 exerts beneficial effects on memory and social interaction, and could be a potential target for novel treatments for behavioral impairments observed in hypogonadal and aged men with declining levels of gonadal hormones. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
André, Marion Agnes Emma; Güntürkün, Onur; Manahan-Vaughan, Denise
2015-02-01
The metabotropic glutamate (mGlu) receptors and, in particular, mGlu5 are crucially involved in multiple forms of synaptic plasticity that are believed to underlie explicit memory. MGlu5 is also required for information transfer through neuronal oscillations and for spatial memory. Furthermore, mGlu5 is involved in extinction of implicit forms of learning. This places this receptor in a unique position with regard to information encoding. Here, we explored the role of this receptor in context-dependent extinction learning under constant, or changed, contextual conditions. Animals were trained over 3 days to take a left turn under 25% reward probability in a T-maze with a distinct floor pattern (Context A). On Day 4, they experienced either a floor pattern change (Context B) or the same floor pattern (Context A) in the absence of reward. After acquisition of the task, the animals were returned to the maze once more on Day 5 (Context A, no reward). Treatment with the mGlu5 antagonist, 2-methyl-6-(phenylethynyl) pyridine, before maze exposure on Day 4 completely inhibited extinction learning in the AAA paradigm but had no effect in the ABA paradigm. A subsequent return to the original context (A, on Day 5) revealed successful extinction in the AAA paradigm, but impairment of extinction in the ABA paradigm. These data support that although extinction learning in a new context is unaffected by mGlu5 antagonism, extinction of the consolidated context is impaired. This suggests that mGlu5 is intrinsically involved in enabling learning that once-relevant information is no longer valid. © 2014 The Authors. Hippocampus Published by Wiley Periodicals, Inc.
Barker, Jacqueline M; Lench, Daniel H; Chandler, L Judson
2016-01-01
Alcohol use disorders are associated with deficits in adaptive behavior. While some behavioral impairments that are associated with alcohol use disorders may predate exposure to drugs of abuse, others may result directly from exposure to drugs of abuse, including alcohol. Identifying a causal role for how alcohol exposure leads to these impairments will enable further investigation of the neurobiological mechanisms by which it acts to dysregulate adaptive behavior. In the present study, we examined the effects of chronic intermittent ethanol exposure (CIE) on the use of reward-paired cues to guide consummatory behaviors in a mouse model, and further, how manipulations of mGluR2/3 signaling-known to be dysregulated after chronic alcohol exposure-may alter the expression of this behavior. Adult male C57B/6J mice were trained to self-administer 10 % ethanol and exposed to CIE via vapor inhalation. After CIE exposure, mice were trained in a Pavlovian task wherein a cue (tone) was paired with the delivery of a 10 % sucrose unconditioned stimulus. The use of the reward-paired cue to guide licking behavior was determined across training. The effect of systemic mGluR2/3 manipulation on discrimination between cue-on and cue-off intervals was assessed by administration of the mGluR2/3 agonist LY379268 or the antagonist LY341495 prior to a testing session. Exposure to CIE resulted in reductions in discrimination between cue-on and cue-off intervals, with CIE-exposed mice exhibiting significantly lower consummatory behavior during reward-paired cues than air controls. In addition, systemic administration of an mGluR2/3 agonist restored the use of reward-paired cues in CIE-exposed animals without impacting behavior in air controls. Conversely, administration of an mGluR2/3 antagonist mimicked the effects of CIE on cue-guided licking behavior, indicating that mGluR2/3 signaling can bidirectionally regulate the ability to use reward-paired cues to guide behavior. Together
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-Soils... Prohibitions on Land Disposal § 268.32 Waste specific prohibitions—Soils exhibiting the toxicity characteristic... from land disposal: any volumes of soil exhibiting the toxicity characteristic solely because of the...
Kumar, Dhivya Ashok; Agarwal, Amar; Packiyalakshmi, Sathiya; Jacob, Soosan; Agarwal, Athiya
2013-08-01
To evaluate the complications and visual outcomes of glued intrascleral-fixated foldable intraocular lens (IOL) in eyes with deficient capsules. Dr Agarwal's Eye Hospital and Eye Research Centre, Chennai, India. Case series. Data were evaluated from the records of patients with a primary glued foldable IOL for intraoperative capsular loss or subluxated lens or secondary glued foldable IOL for aphakia. Exclusion criteria included preoperative glaucoma, aniridia, macular scar, traumatic subluxation, combined surgeries, incomplete operative medical records, and postoperative follow-up less than 6 months. The intraoperative and postoperative complication rates, reoperation rate, and visual outcomes were analyzed. The study comprised 208 eyes (185 patients). The mean follow-up was 16.7 months ± 10.2 (SD). The intraoperative complications were hyphema (0.4%), haptic breakage (0.4%), and deformed haptics (0.9%). Early complications occurred in 29 eyes (13.9%) and included corneal edema (5.7%), epithelial defect (1.9%), and grade 2 anterior chamber reaction (2.4%). Late complications occurred in 39 eyes (18.7%) and included optic capture (4.3%), IOL decentration (3.3%), haptic extrusion (1.9%), subconjunctival haptic (1.4%), macular edema (1.9%), and pigment dispersion (1.9%). Reoperation was required in 16 eyes (7.7%). Haptic position was altered in eyes with IOL decentration. Corrected distance visual acuity (CDVA) improved or remained unchanged in 84.6% of eyes. The postoperative CDVA was 20/40 or better and 20/60 or better in 38.9% and 48.5% of eyes, respectively. The foldable glued-IOL procedure showed satisfactory visual outcomes without serious complications. Intraocular lens decentration was due to haptic-related problems. Copyright © 2013 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Tran, Hai-Quyen; Chung, Yoon Hee; Shin, Eun-Joo; Tran, The-Vinh; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Yamada, Kiyofumi; Nabeshima, Toshitaka; Kim, Hyoung-Chun
2017-11-01
Dextromethorphan (DM) is a dextrorotatory isomer of levorphanol, a typical morphine-like opioid. When administered at supra-antitussive doses, DM produces psychotoxic and neurotoxic effects in humans. Although DM abuse has been well-documented, few studies have examined the effects of high-dose DM. The present study aimed to explore the effects of a single high dose of DM on mortality and seizure occurrence. After intraperitoneal administration with a high dose of DM (80mg/kg), Sprague-Dawley rats showed increased seizure occurrence and intensity. Hippocampal expression levels of N-methyl-d-aspartate (NMDA) receptor subunits (GluN1<GluN2A<GluN2B), c-Fos and pro-apoptotic factors (Bax and cleaved caspase-3) were upregulated by DM treatment; while levels of anti-apoptotic factors (Bcl-2 and Bcl-xL) were downregulated. Consistently, DM also induced ultrastructural degeneration in the hippocampus. A non-competitive NMDA receptor antagonist, MK-801, attenuated these effects of high-dose DM, whereas an opioid antagonist, naloxone, did not affect DM-induced neurotoxicity. Moreover, pretreatment with a highly specific GluN2B subunit inhibitor, traxoprodil, was selectively effective in preventing DM-induced c-Fos expression and apoptotic changes. These results suggest that high-dose DM produces convulsive behaviors by activating GluN2B/NMDA signaling that leads to pro-apoptotic changes. Copyright © 2017. Published by Elsevier Inc.
Berrout, Liza; Isokawa, Masako
2018-01-01
Ghrelin and its receptor GHSR1a have been shown to exert numerous physiological functions in the brain, in addition to the well-established orexigenic role in the hypothalamus. Earlier work indicated that ghrelin stimulated the phosphorylation of the GluN1 subunit of the NMDA receptor (NMDAR) and enhanced synaptic transmission in the hippocampus. In the present study, we report that the exogenous application of ghrelin increased GluN2B phosphorylation. This increase was independent of GluN2B subunit activity or NMDAR channel activity. However, it depended on the activation of GHSR1a and Fyn as it was blocked by D-Lys3-GHRP-6 and PP2, respectively. Inhibitors for G-protein-regulated second messengers, such as Rp-cAMP, H89, TBB, ryanodine, and thapsigargin, unexpectedly enhanced GluN2B phosphorylation, suggesting that cAMP, PKA, casein kinase II, and cytosolic calcium signaling may oppose to the effect of ghrelin on the phosphorylation of GluN2B. Our findings suggest that 1) GluN2B is likely a molecular target of ghrelin and GHSR1a-driven signaling cascades, and 2) the ghrelin-mediated phosphorylation of GluN2B depends on Fyn activation under complex negative regulation by other second messengers. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Ortega S, D.
2015-01-01
The prostate specific membrane antigen (PSMA) is a zinc metalloenzyme that is expressed on the cell membrane and highly expressed in prostate cancer. Recently, it has been demonstrated that the peptide sequence Glu-Nh-CO-Nh-Lys inhibit PSMA activity through an electrostatic interaction with the Zn. Several theragnostic radiopharmaceuticals with base in 177 Lu have been developed for radiotherapy of specific molecular targets because gamma and beta emissions of the radionuclide (β = 0.498 MeV and γ= 0.133 MeV). However, there is currently no label a formulation for preparing a radiopharmaceutical of 177 Lu-Glu-Nh-CO-Nh-Lys useful treatment of prostate cancer. The aim of this research was to optimize and document the process of production of the radiopharmaceutical 177 Lu-Glu-Nh-CO-Nh-Lys for sanitary registration application before the Comision Federal para la Proteccion contra Riesgos Sanitarios (COFEPRIS). The optimization of the production process was assessed a factorial design of three variables with mixed levels (3 x 3 x 2) where the dependent variable is the radiochemical purity, the analytical method was validated by UV-Vis spectrophotometry. Next, process validation was carried out by labeling 3 lots of the optimized formulation of the radiopharmaceutical (5.55 GBq (2.16 μg) of 177 LuCl 3 , 90 mg peptide PSMA, 50 mg ascorbic acid and 150 μL of acetate buffer 1 M ph 5), long-term stability was performed by high resolution liquid chromatography) to determine its useful shelf life. 3 validation batches were prepared under protocols of Good Manufacturing Practice (GMP) in the Production Plant of Radiopharmaceuticals of the Instituto Nacional de Investigaciones Nucleares (ININ), meet specifications preset by obtaining a sterile and free development of bacterial endotoxin yields of labeled 100% and which retains its quality characteristics radiochemical purity greater than 90% for at least 15 days. (Author)
Metabotrobic Glutamate Receptor mGluR4 as a Novel Target for Parkinson's Disease
National Research Council Canada - National Science Library
Levey, Alan
2000-01-01
...) as a novel target for the treatment of PD. We have localized mGluP4 in basal ganglia structures, and explored its role in mediating the electrophysiological effects of glutamate in rat brain slices...
Metabotropic Glutamate Receptor mGluR4 as a Novel Target for Parkinson's Disease
National Research Council Canada - National Science Library
Levey, Allan
2001-01-01
...) as a novel target for the treatment of PD. We have localized mGluR4 in basal ganglia structures, and explored its role in mediating the electrophysiological effects of glutamate in rat brain slices...
Residual Strength of Glued-in Bolts After 9 Years In Situ Loading
DEFF Research Database (Denmark)
Pedersen, Martin Bo Uhre; Clorius, Christian Odin; Damkilde, Lars
1996-01-01
In 1993 one of the wooden blades of the Nibe-B windmill was struck by lightning and subsequently demounted after 9 years of use. The mishap offered a unique opportunity to investigate the residual strength of the 28 glued-in bolts used to form the blade to rotor hub connection.The test method...
Montgomery, I A; Irwin, N; Flatt, P R
2013-06-01
Cholecystokinin (CCK) is a gastrointestinal hormone with potential therapeutic promise for obesity-diabetes. The present study examined the effects of twice daily administration of the N-terminally modified stable CCK-8 analogue, (pGlu-Gln)-CCK-8, on metabolic control and hypothalamic gene expression in high fat fed mice. Sub-chronic twice daily injection of (pGlu-Gln)-CCK-8 for 16 days significantly decreased body weight (penergy intake (pcontrols. Furthermore, (pGlu-Gln)-CCK-8 markedly improved glucose tolerance (p<0.05) and insulin sensitivity (p<0.05). Assessment of hypothalamic gene expression on day 16 revealed significantly elevated NPY (p<0.05) and reduced POMC (p<0.05) and MC4R (p<0.05) mRNA expression in (pGlu-Gln)-CCK-8 treated mice. High fat feeding or (pGlu-Gln)-CCK-8 treatment had no significant effects on hypothalamic gene expression of receptors for leptin, CCK₁ and GLP-1. These studies underscore the potential of (pGlu-Gln)-CCK-8 for the treatment of obesity-diabetes and suggest modulation of NPY and melanocortin related pathways may be involved in the observed beneficial effects. © Georg Thieme Verlag KG Stuttgart · New York.
Hippocampal GluA1-containing AMPA receptors mediate context-dependent sensitization to morphine.
Xia, Yan; Portugal, George S; Fakira, Amanda K; Melyan, Zara; Neve, Rachael; Lee, H Thomas; Russo, Scott J; Liu, Jie; Morón, Jose A
2011-11-09
Glutamatergic systems, including AMPA receptors (AMPARs), are involved in opiate-induced neuronal and behavioral plasticity, although the mechanisms underlying these effects are not fully understood. In the present study, we investigated the effects of repeated morphine administration on AMPAR expression, synaptic plasticity, and context-dependent behavioral sensitization to morphine. We found that morphine treatment produced changes of synaptic AMPAR expression in the hippocampus, a brain area that is critically involved in learning and memory. These changes could be observed 1 week after the treatment, but only when mice developed context-dependent behavioral sensitization to morphine in which morphine treatment was associated with drug administration environment. Context-dependent behavioral sensitization to morphine was also associated with increased basal synaptic transmission and disrupted hippocampal long-term potentiation (LTP), whereas these effects were less robust when morphine administration was not paired with the drug administration environment. Interestingly, some effects may be related to the prior history of morphine exposure in the drug-associated environment, since alterations of AMPAR expression, basal synaptic transmission, and LTP were observed in mice that received a saline challenge 1 week after discontinuation of morphine treatment. Furthermore, we demonstrated that phosphorylation of GluA1 AMPAR subunit plays a critical role in the acquisition and expression of context-dependent behavioral sensitization, as this behavior is blocked by a viral vector that disrupts GluA1 phosphorylation. These data provide evidence that glutamatergic signaling in the hippocampus plays an important role in context-dependent sensitization to morphine and supports further investigation of glutamate-based strategies for treating opiate addiction.
Directory of Open Access Journals (Sweden)
M. Foster eOlive
2012-01-01
Full Text Available Pharmacological manipulation of the type 5 metabotropic glutamate (mGlu5 receptor alters various addiction related behaviors such as drug self-administration and the extinction and reinstatement of drug-seeking behavior. However, the effects of pharmacological modulation of mGlu5 receptors on brain reward function have not been widely investigated. We examined the effects of acute administration of positive and negative allosteric modulators (PAMs and NAMs, respectively on brain reward function by assessing thresholds for intracranial self-stimulation (ICSS. In addition, when acute effects were observed, we examined potential changes in altered ICSS thresholds following repeated administration. Male Sprague-Dawley rats were implanted with bipolar electrodes into the medial forebrain bundle and trained to respond for ICSS, followed by assessment of effects of mGlu5 ligands on ICSS thresholds using a discrete trials current intensity threshold determination procedure. Acute administration of the selective mGlu5 NAMs MTEP (0, 0.3, 1 or 3 mg/kg and fenobam (0, 3, 10, or 30 mg/kg dose-dependently increased ICSS thresholds (~70% at the highest dose tested, suggesting a deficit in brain reward function. Acute administration of the mGlu5 PAMs CDPPB (0, 10, 30 and 60 mg/kg or ADX47273 (0, 10, 30 and 60 mg/kg was without effect at any dose tested. When administered once daily for 5 consecutive days, the development of tolerance to the ability of threshold-elevating doses of MTEP and fenobam to increase ICSS thresholds was observed. We conclude that mGlu5 PAMs and NAMs differentially affect brain reward function, and that tolerance to the ability of mGlu5 NAMs to reduce brain reward function develops with repeated administration. These brain reward deficits should be taken into consideration when interpreting acute effects of mGlu5 NAMs on drug self-administration, and repeated administration may be an effective method to reduce these deficits.
Potentiation of glucose-induced insulin release in islets by desHis1[Glu9]glucagon amide
DEFF Research Database (Denmark)
Kofod, Hans; Unson, C G; Merrifield, R B
1988-01-01
Glucagon and secretin and some of their hybrid analogs potentiate glucose-induced release of insulin from isolated mouse pancreatic islets. It was recently shown that the synthetic glucagon analog, desHis1[Glu9]glucagon amide, does not stimulate the formation of cyclic adenosine monophosphate...... in the rat hepatocyte membrane, but binds well to the glucagon receptor and is a good competitive antagonist of glucagon. In the present study the effect of this analog on isolated islets was examined. desHis1-[Glu9]glucagon amide at 3 x 10(-7) M, in the presence of 0.01 M D-glucose, increased the release...
DEFF Research Database (Denmark)
Bjerrum, Esben J; Kristensen, Anders S; Pickering, Darryl S
2003-01-01
On the basis of structural studies, chloro-homoibotenic acid (Cl-HIBO) was designed and synthesized. Cl-HIBO was characterized in binding and electrophysiology experiments on native and cloned subtypes of GluRs. Electrophysiological selectivities ranged from 275 to 1600 for GluR1/2 over GluR3/4. ...
Liu, Shui-bing; Zhao, Rong; Li, Xu-sheng; Guo, Hong-ju; Tian, Zhen; Zhang, Nan; Gao, Guo-dong; Zhao, Ming-gao
2014-06-01
Epidemiological studies demonstrate that pain frequently occurs comorbid with depression. Gentiopicroside (Gent) is a secoiridoid compound isolated from Gentiana lutea that exhibits analgesic properties and inhibits the expression of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the anterior cingulate cortex of mice. However, the effects of Gent on the reserpine-induced pain/depression dyad and its underlying mechanisms are unclear. Reserpine administration (1 mg/kg subcutaneous daily for 3 days) caused a significant decrease in the nociceptive threshold as evidenced by the reduced paw withdrawal latency in response to a radiant heat source and mechanical allodynia. Behavioral detection indicated a significant increase in immobility time during a forced swim test, as well as decreased time in the central area and total travel distance in an open field test. Furthermore, reserpinized animals exhibited increased oxidative stress. Systemic Gent administration dose-dependently ameliorated the behavioral deficits associated with reserpine-induced pain/depression dyad. At the same time, the decrease in biogenic amine levels (norepinephrine, dopamine, and serotonin) was integrated with the increase in caspase-3 levels and GluN2B-containing NMDA receptors in the amygdala of the reserpine-injected mice. Gent significantly reversed the changes in the levels of biogenic amines, caspase-3, and GluN2B-containing NMDA receptors in amygdala. However, Gent did not affect the expression of GluN2A-containing NMDA receptors. The inhibitory effects of Gent on oxidative stress were occluded by simultaneous treatment of GluN2B receptors antagonist Ro25-6981. Our study provides strong evidence that Gent inhibits reserpine-induced pain/depression dyad by downregulating GluN2B receptors in the amygdala.
Okuda, Kosuke; Kobayashi, Shizuka; Fukaya, Masahiro; Watanabe, Aya; Murakami, Takuto; Hagiwara, Mai; Sato, Tempei; Ueno, Hiroe; Ogonuki, Narumi; Komano-Inoue, Sayaka; Manabe, Hiroyuki; Yamaguchi, Masahiro; Ogura, Atsuo; Asahara, Hiroshi; Sakagami, Hiroyuki; Mizuguchi, Masashi; Manabe, Toshiya; Tanaka, Teruyuki
2017-10-01
Mutations in the Cyclin-dependent kinase-like 5 (CDKL5) gene cause severe neurodevelopmental disorders accompanied by intractable epilepsies, i.e. West syndrome or atypical Rett syndrome. Here we report generation of the Cdkl5 knockout mouse and show that CDKL5 controls postsynaptic localization of GluN2B-containing N-methyl-d-aspartate (NMDA) receptors in the hippocampus and regulates seizure susceptibility. Cdkl5 -/Y mice showed normal sensitivity to kainic acid; however, they displayed significant hyperexcitability to NMDA. In concordance with this result, electrophysiological analysis in the hippocampal CA1 region disclosed an increased ratio of NMDA/α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor-mediated excitatory postsynaptic currents (EPSCs) and a significantly larger decay time constant of NMDA receptor-mediated EPSCs (NMDA-EPSCs) as well as a stronger inhibition of the NMDA-EPSCs by the GluN2B-selective antagonist ifenprodil in Cdkl5 -/Y mice. Subcellular fractionation of the hippocampus from Cdkl5 -/Y mice revealed a significant increase of GluN2B and SAP102 in the PSD (postsynaptic density)-1T fraction, without changes in the S1 (post-nuclear) fraction or mRNA transcripts, indicating an intracellular distribution shift of these proteins to the PSD. Immunoelectron microscopic analysis of the hippocampal CA1 region further confirmed postsynaptic overaccumulation of GluN2B and SAP102 in Cdkl5 -/Y mice. Furthermore, ifenprodil abrogated the NMDA-induced hyperexcitability in Cdkl5 -/Y mice, suggesting that upregulation of GluN2B accounts for the enhanced seizure susceptibility. These data indicate that CDKL5 plays an important role in controlling postsynaptic localization of the GluN2B-SAP102 complex in the hippocampus and thereby regulates seizure susceptibility, and that aberrant NMDA receptor-mediated synaptic transmission underlies the pathological mechanisms of the CDKL5 loss-of-function. Copyright © 2017 Elsevier Inc. All rights
Energy Technology Data Exchange (ETDEWEB)
Ortega S, D.
2015-07-01
The prostate specific membrane antigen (PSMA) is a zinc metalloenzyme that is expressed on the cell membrane and highly expressed in prostate cancer. Recently, it has been demonstrated that the peptide sequence Glu-Nh-CO-Nh-Lys inhibit PSMA activity through an electrostatic interaction with the Zn. Several theragnostic radiopharmaceuticals with base in {sup 177}Lu have been developed for radiotherapy of specific molecular targets because gamma and beta emissions of the radionuclide (β = 0.498 MeV and γ= 0.133 MeV). However, there is currently no label a formulation for preparing a radiopharmaceutical of {sup 177}Lu-Glu-Nh-CO-Nh-Lys useful treatment of prostate cancer. The aim of this research was to optimize and document the process of production of the radiopharmaceutical {sup 177}Lu-Glu-Nh-CO-Nh-Lys for sanitary registration application before the Comision Federal para la Proteccion contra Riesgos Sanitarios (COFEPRIS). The optimization of the production process was assessed a factorial design of three variables with mixed levels (3 x 3 x 2) where the dependent variable is the radiochemical purity, the analytical method was validated by UV-Vis spectrophotometry. Next, process validation was carried out by labeling 3 lots of the optimized formulation of the radiopharmaceutical (5.55 GBq (2.16 μg) of {sup 177}LuCl{sub 3}, 90 mg peptide PSMA, 50 mg ascorbic acid and 150 μL of acetate buffer 1 M ph 5), long-term stability was performed by high resolution liquid chromatography) to determine its useful shelf life. 3 validation batches were prepared under protocols of Good Manufacturing Practice (GMP) in the Production Plant of Radiopharmaceuticals of the Instituto Nacional de Investigaciones Nucleares (ININ), meet specifications preset by obtaining a sterile and free development of bacterial endotoxin yields of labeled 100% and which retains its quality characteristics radiochemical purity greater than 90% for at least 15 days. (Author)
Directory of Open Access Journals (Sweden)
Zhenzhen Wang
2018-03-01
Full Text Available Glu-1Ay, one of six genes encoding a high molecular weight glutenin subunit (HMW-GS, is frequently silenced in hexaploid common wheat. Here, an active allele of Glu-1Ay was integrated from wild emmer wheat (Triticum turgidum ssp. dicoccoides accession D97 into the common wheat (Triticum aestivum cultivar Chuannong 16 via the repeated self-fertilization of the pentaploid interspecific hybrid, culminating in the selection of a line TaAy7-40 shown to express the wild emmer Glu-1Ay allele. The open reading frame of this allele was a 1830 bp long sequence, demonstrated by its heterologous expression in Escherichia coli to encode a 608-residue polypeptide. Its nucleotide sequence was 99.2% identical to that of the sequence within the wild emmer parent. The TaAy7-40 introgression line containing the active Glu-1Ay allele showed higher protein content, higher sodium dodecyl sulfate (SDS sedimentation value, higher content of wet gluten in the flour, higher grain weight, and bigger grain size than Chuannong 16. The end-use quality parameters of the TaAy7-40 were superior to those of the medium gluten common wheat cultivars Mianmai 37 and Neimai 9. Thus, the active Glu-1Ay allele might be of potential value in breeding programs designed to improve wheat flour quality.
Mutation at Glu23 eliminates the neuron growth inhibitory activity of human metallothionein-3
International Nuclear Information System (INIS)
Ding Zhichun; Teng Xinchen; Cai Bin; Wang Hui; Zheng Qi; Wang Yang; Zhou Guoming; Zhang Mingjie; Wu Houming; Sun Hongzhe; Huang Zhongxian
2006-01-01
Human metallothionein-3 (hMT3), first isolated and identified as a neuronal growth inhibitory factor (GIF), is a metalloprotein expressed predominantly in brain. However, untill now, the exact mechanism of the bioactivity of hMT3 is still unknown. In order to study the influence of acid-base catalysis on S-nitrosylation of hMT3, we constructed the E23K mutant of hMT3. During the course of bioassay, we found out unexpectedly that mutation at E23 of hMT3 eliminates the neuronal growth inhibitory activity completely. To the best of our knowledge, it is First report that other residues, besides the TCPCP motif, in the β-domain can alter the bioactivity of hMT3. In order to figure out the causes for the loss of bioactivity of the E23K mutant, the biochemical properties were characterized by UV-vis spectroscopy, CD spectroscopy, pH titration, DTNB reaction, EDTA reaction, and SNOC reaction. All data demonstrated that stability of the metal-thiolate cluster and overall structure of the E23K mutant were not altered too much. However, the reaction of the E23K mutant with SNOC exhibited biphasic kinetics and the mutant protein released zinc ions much faster than hMT3 in the initial step, while hMT3 exhibited single kinetic process. The 2D [ 1 H- 15 N] HSQC was also employed to characterize structural changes during the reaction of hMT3 with varying mounts of nitric oxide. It was shown that the resonance of Glu23 disappeared at a molar ratio of NO to protein of 4. Based on these results, we suggest that mutation at Glu23 may alter the NO metabolism and/or affect zinc homeostasis in brain, thus altering the neuronal growth inhibitory activity
Allelic variation at Glu-1 loci and its association with grain quality of ...
African Journals Online (AJOL)
Valued Acer Customer
2011-11-09
Nov 9, 2011 ... grain quality of wheat grown in an irrigated hot environment ... no significant associations were found between Glu-1 QS and other mixograph parameters such as mixograph peak ... amount of the two major components of gluten which are glutenin and ... composition and different quality attributes for wheat.
Jacob, Soosan; Narasimhan, Smita; Agarwal, Amar; Mazzotta, Cosimo; Rechichi, Miguel; Agarwal, Athiya
2017-03-01
We describe a technique to prevent late intraocular lens (IOL) subluxation and dislocation that can be associated with progressive zonulopathy. Supracapsular glued IOL fixation is done to retain an intact anterior hyaloid face and avoid vitreous disturbance while providing stable long-term IOL fixation. Phacoemulsification is followed by glued IOL implantation above intact anterior and posterior capsules. Sclerotomies are created ab interno in a supracapsular plane under diametrically opposite lamellar scleral flaps without entering the vitreous cavity. Haptics are externalized in the supracapsular plane and tucked into intrascleral tunnels. Intraoperative or postoperative posterior capsulorhexis or capsulotomy and anterior capsule relaxing cuts can prevent capsule phimosis. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Liu, Yong; Tang, Yamei; Pu, Weidan; Zhang, Xianghui; Zhao, Jingping
2011-08-01
To explore the related neurobiochemical mechanism by comparing the concentration change of dopamine (DA), dihydroxy-phenyl acetic acid (DOPAC), glutamate (Glu), and γ-aminobutyric acid (GABA) in the brain tissues in schizophrenia (SZ) developmental model rats and chronic medication model rats. A total of 60 neonatal male Spragur-Dawley (SD) rats were randomly assigned to 3 groups at the postnatal day 6: an SZ developmental rat model group (subcutaneous injection with MK-801 at the postnatal day 7-10, 0.1 mg/kg, Bid), a chronic medication model group (intraperitoneal injection at the postnatal day 47-60, 0.2 mg/kg,Qd), and a normal control group (injection with 0.9% normal saline during the corresponding periods). DA, DOPAC, Glu, and GABA of the tissue homogenate from the medial prefrontal cortex (mPFC) and hippocampus were examined with Coularray electrochemic detection by high performance liquid chromatogram technique. The utilization rate of DA and Glu was calculated. Compared with the normal control group, the concentration of DA and DOPAC in the mPFC and the hippocampus in the SZ developmental model group significantly decreased (PGABA concentration and Glu utilization rate in the mPFC also decreased (PGABA system decrease in the mPFC and the DA system function reduces in the hippocampus of SZ developmental rats.
Czech Academy of Sciences Publication Activity Database
Borovička, Jan; Mihaljevič, M.; Gryndler, Milan; Kubrová, Jaroslava; Žigová, Anna; Hršelová, Hana; Řanda, Zdeněk
2014-01-01
Roč. 43, APR (2014), s. 114-120 ISSN 0883-2927 R&D Projects: GA ČR(CZ) GAP504/11/0484 Institutional support: RVO:61388971 ; RVO:67985831 ; RVO:61389005 Keywords : macrofungi * Pb isotopic ratio * soils Subject RIV: CH - Nuclear ; Quantum Chemistry; DD - Geochemistry (GLU-S); EE - Microbiology, Virology (MBU-M) Impact factor: 2.268, year: 2014
De Sarro, Giovambattista; Chimirri, Alba; Meldrum, Brian S
2002-09-06
We report the anticonvulsant action in DBA/2 mice of two mGlu Group III receptor agonists: (R,S)-4-phosphonophenylglycine, (R,S)-PPG, a compound with moderate mGlu8 selectivity, and of (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid, ACPT-1, a selective agonist for mGlu4alpha receptors. Both compounds, given intracerebroventricularly at doses which did not show marked anticonvulsant activity, produced a consistent shift to the left of the dose-response curves (i.e. enhanced the anticonvulsant properties) of 1-(4'-aminophenyl)-3,5-dihydro-7,8-dimethoxy-4H-2,3-benzodiazepin-4-one hydrochloride, CFM-2, a noncompetitive AMPA receptor antagonist, and 3-((+/-)-2-carboxypiperazin-4-yl)-1-phosphonic acid, CPPene, a competitive NMDA receptor antagonist, in DBA/2 mice. In addition, (R,S)-PPG and ACPT-1 administered intracerebroventricularly prolonged the time course of the anticonvulsant properties of CFM-2 (33 micromol/kg, i.p.) and CPPene (3.3 micromol/kg, i.p.) administered intraperitoneally. We conclude that modest reduction of synaptic glutamate release by activation of Group III metabotropic receptors potentiates the anticonvulsant effect of AMPA and NMDA receptor blockade. Copyright 2002 Elsevier Science B.V.
Directory of Open Access Journals (Sweden)
Mathieu Verdet
2016-08-01
Full Text Available Glued-in rods have successfully been used for connections or reinforcement of timber structures due to their high strength and stiffness. However, their performance is potentially sensitive to temperature. This paper deals with an experimental investigation of the connections and adhesives in elevated temperatures. First, dynamic mechanical analysis (DMA tests were performed to characterize an epoxy (EPX and a polyurethane (PUR adhesive. The evolution of the stiffness and the glass transition temperature, Tg, were measured in the range of 30 °C to 120 °C. Then, a total of 66 specimens with glued-in rods and the same adhesives were tested under a static tensile load at 20 °C, 40 °C, 50 °C, 60 °C, and 70 °C. In both types of tests, the EPX outperformed PUR due to its higher stiffness at temperatures of up to 40 °C; however, it showed a more rapid degradation of the stiffness and strength than the PUR at higher temperatures. No direct correlation was established between the Tg and the performance of the connections. The test results suggest that timber structures with glued-in rods may be vulnerable in service at temperatures above 40 °C.
Directory of Open Access Journals (Sweden)
Wu Long-Jun
2009-06-01
Full Text Available Abstract The molecular mechanism underlying muscarinic acetylcholine receptor-dependent LTD (mAChR-LTD in the hippocampus is less studied. In a recent study, a novel mechanism is described. The induction of mAChR-LTD required the activation of protein tyrosine phosphatase (PTP, and the expression was mediated by AMPA receptor endocytosis via interactions between GluA2, GRIP and liprin-α. The hook-up of these proteins may result in the recruitment of leukocyte common antigen-related receptor (LAR, a PTP that is known to be involved in AMPA receptor trafficking. Interestingly, the similar molecular interaction cannot be applied to mGluR-LTD, despite the fact that the same G-protein involved in LTD is activated by both mAChR and mGluR. This discovery provides key molecular insights for cholinergic dependent cognitive function, and mAChR-LTD can serve as a useful cellular model for studying the roles of cholinergic mechanism in learning and memory.
International Nuclear Information System (INIS)
Prasad, C.; Rao, J.K.; Ponte, E.; Jayaraman, A.
1986-01-01
Since CSF is in constant exchange with the brain extracellular fluids, studies on the development of TRH metabolism in CSF might give insight into the functions of TRH in the brain. In human CSF, TRH metabolism is exclusively catalyzed by enzyme Pyroglutamate animopeptidase (pGlu-peptidase) yielding cyclo(His-Pro) as product. [ 3 H-Pro]-TRH (20 μM, 0.1 μCi) was incubated with CSF at 37C for 15, 30, 45 and 60 minutes and the rates of cyclo(His-Pro) formation was calculated. pGlu-peptidase activities [pmol cyclo(His-Pro) formed from TRH/min/ml CSF] in CSF from pre-term (gestational age: 29-36 weeks) and newborn (0-8 days) babies were significantly (p 0.2] or the mixing of pediatric and adult CSF did not decrease the enzyme activity of adult CSF. In conclusion, TRH metabolism in CSF increases with age and low pGlu-peptidase activity in pediatric CSF may suggest some unique development role for this enzyme in brain TRH function(s)
DEFF Research Database (Denmark)
Kasper, Christina; Pickering, Darryl S; Mirza, Osman
2006-01-01
domains has been observed. (S)-NS1209 adopts a novel binding mode, including hydrogen bonding to Tyr450 and Gly451 of D1. Parts of (S)-NS1209 occupy new areas of the GluR2 ligand-binding cleft, and bind near residues that are not conserved among receptor subtypes. The affinities of (RS)-NS1209 at the Glu....... The thermodynamics of binding of the antagonists (S)-NS1209, DNQX and (S)-ATPO to the GluR2 ligand-binding core have been determined by displacement isothermal titration calorimetry. The displacement of (S)-glutamate by all antagonists was shown to be driven by enthalpy....
GLU298ASP and 4G/5G Polymorphisms and the Risk of Ischemic Stroke in Young Individuals.
Esparza-García, Juan Carlos; Santiago-Germán, David; Guadalupe Valades-Mejía, María; Hernández-Juárez, Jesus; Aguilar-Sosa, Eberth; Leaños-Miranda, Alfredo; Alvarado-Moreno, Antonio; Majluf-Cruz, Abraham; Isordia-Salas, Irma
2015-09-01
Polymorphisms in the endothelial nitric oxide synthase (eNOS) and in the plasminogen activator inhibitor -1 (PAI-1) genes have been implicated in stroke pathogenesis but results are still controversial. The aim of this study was to examine the possible contribution of Glu298Asp in the eNOS and 4G/5G in the PAI-1polymorphisms with ischemic stroke in a young Mexican population. In a case-control study, conducted between January 2006 and June 2010, 204 patients ≤45 years of age with ischemic stroke and 204 controls matched by age and gender, were recruited. The Glu298Asp and 4G/5G polymorphisms were determined in all participants by polymerase chain reaction-restriction fragment length polymorphism. There was a significant difference in the Glu298Asp genotype distribution (P=0.001) and allele frequency between the two groups (P=0.001). The 4G/5G genotype distribution (P=0.40) and the allele frequency was similar between groups; (P=0.13). There were independent factors for ischemic stroke: Asp carriage (GluAsp+AspAsp) (P=0.02); smoking (P=0.01); hypertension (P=0.03), and familial history of atherothrombotic disease (P=0.04). The Asp allele from the Gu298Asp gene represents an independent risk factor for ischemic stroke in a young Mexican population. In contrast, the 4G/5G was not associated with an increased risk for this disease in the same group of patients, as previously has been demonstrated in other populations.
Allelic variation at Glu-1 loci and its association with grain quality of ...
African Journals Online (AJOL)
The high molecular weight glutenin subunits (HMW-GS) are important determinants of wheat flour quality. The HMW-GS patterns of the major released wheat cultivars in Sudan, in addition to some advanced lines, were analyzed using SDS-PAGE. The associations of the HMW-GS quality scores (Glu-1 QS) with the flour ...
Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway
Schwarz, Lindsay A.; Hall, Benjamin J.; Patrick, Gentry N.
2010-01-01
The accurate trafficking of AMPA receptors (AMPARs) to and from the synapse is a critical component of learning and memory in the brain, while dysfunction of AMPAR trafficking is hypothesized to be an underlying mechanism of Alzheimer’s disease. Previous work has shown that ubiquitination of integral membrane proteins is a common post-translational modification used to mediate endocytosis and endocytic sorting of surface proteins in eukaryotic cells. Here we report that mammalian AMPARs become ubiquitinated in response to their activation. Using a mutant of GluA1 that is unable to be ubiquitinated at lysines on its carboxy-terminus, we demonstrate that ubiquitination is required for internalization of surface AMPARs and their trafficking to the lysosome in response to the AMPAR agonist AMPA, but not for internalization of AMPARs in response to the NMDA receptor (NMDAR) agonist NMDA. Through over-expression or RNAi-mediated knockdown, we identify that a specific E3 ligase, Nedd4-1, is necessary for this process. Finally, we show that ubiquitination of GluA1 by Nedd4-1 becomes more prevalent as neurons mature. Together, these data show that ubiquitination of GluA1-containing AMPARs by Nedd4-1 mediates their endocytosis and trafficking to the lysosome. Furthermore, these results provide insight into how hippocampal neurons regulate AMPAR trafficking and degradation with high specificity in response to differing neuronal signaling cues, and suggest that changes to this pathway may occur as neurons mature. PMID:21148011
Generalized graph manifolds and their effective recognition
International Nuclear Information System (INIS)
Matveev, S V
1998-01-01
A generalized graph manifold is a three-dimensional manifold obtained by gluing together elementary blocks, each of which is either a Seifert manifold or contains no essential tori or annuli. By a well-known result on torus decomposition each compact three-dimensional manifold with boundary that is either empty or consists of tori has a canonical representation as a generalized graph manifold. A short simple proof of the existence of a canonical representation is presented and a (partial) algorithm for its construction is described. A simple hyperbolicity test for blocks that are not Seifert manifolds is also presented
Mutational analysis of Glu272 in elongation factor 1A of E. coli
DEFF Research Database (Denmark)
Mansilla, Francisco; Knudsen, Charlotte Rohde; Clark, Brian F. C.
1998-01-01
In our previous work (Mansilla et al. (1997) Protein Eng. 10, 927-934) we showed that Arg7 of Escherichia coli elongation factor Tu (EF1A) plays an essential role in aminoacyl-tRNA (aa-tRNA) binding. Substitution of Arg7 by Ala or Glu lost this activity. We proposed that Arg7 forms a salt bridge...
Mutational analysis of Glu272 in elongation factor 1A of E. coli
DEFF Research Database (Denmark)
Mansilla, Francisco; Knudsen, Charlotte Rohde; Clark, Brian F. C.
1998-01-01
In our previous work (Mansilla et al. (1997) Protein Eng. 10, 927-934) we showed that Arg7 of Escherichia coli elongation factor Tu (EF1A) plays an essential role in aminoacyl-tRNA (aa-tRNA) binding. Substitution of Arg7 by Ala or Glu lost this activity. We proposed that Arg7 forms a salt bridge ...
Peachey, Neal S; Hasan, Nazarul; FitzMaurice, Bernard; Burrill, Samantha; Pangeni, Gobinda; Karst, Son Yong; Reinholdt, Laura; Berry, Melissa L; Strobel, Marge; Gregg, Ronald G; McCall, Maureen A; Chang, Bo
2017-08-01
GRM6 encodes the metabotropic glutamate receptor 6 (mGluR6) used by retinal depolarizing bipolar cells (DBCs). Mutations in GRM6 lead to DBC dysfunction and underlie the human condition autosomal recessive complete congenital stationary night blindness. Mouse mutants for Grm6 are important models for this condition. Here we report a new Grm6 mutant, identified in an electroretinogram (ERG) screen of mice maintained at The Jackson Laboratory. The Grm6 nob8 mouse has a reduced-amplitude b-wave component of the ERG, which reflects light-evoked DBC activity. Sequencing identified a missense mutation that converts a highly conserved methionine within the ligand binding domain to leucine (p.Met66Leu). Consistent with prior studies of Grm6 mutant mice, the laminar size and structure in the Grm6 nob8 retina were comparable to control. The Grm6 nob8 phenotype is distinguished from other Grm6 mutants that carry a null allele by a reduced but not absent ERG b-wave, decreased but present expression of mGluR6 at DBC dendritic tips, and mislocalization of mGluR6 to DBC somas. Consistent with a reduced but not absent b-wave, there were a subset of retinal ganglion cells whose responses to light onset have times to peak within the range of those in control retinas. These data indicate that the p.Met66Leu mutant mGluR6 is trafficked less than control. However, the mGluR6 that is localized to the DBC dendritic tips is able to initiate DBC signal transduction. The Grm6 nob8 mouse extends the Grm6 allelic series and will be useful for elucidating the role of mGluR6 in DBC signal transduction and in human disease. NEW & NOTEWORTHY This article describes a mouse model of the human disease complete congenital stationary night blindness in which the mutation reduces but does not eliminate GRM6 expression and bipolar cell function, a distinct phenotype from that seen in other Grm6 mouse models.
Rijsingen, M.C.J. van; Bon, B.W. van; Wilt, G.J. van der; Lagro-Janssen, A.L.M.; Gerritsen, M.J.P.
2014-01-01
BACKGROUND: Given the increase in skin cancer (SC) it seems inevitable that general practitioners (GPs) will play a larger role in SC care in the near future. OBJECTIVES: To obtain insights into the opinion of GPs with respect to their role in SC care, and their SC knowledge and skills. METHODS: A
Liu, Zhaofei; Yan, Yongjun; Chin, Frederic T; Wang, Fan; Chen, Xiaoyuan
2009-01-22
Radiolabeled RGD and bombesin peptides have been extensively investigated for tumor integrin alpha(v)beta(3) and GRPR imaging, respectively. Due to the fact that many tumors are both integrin and GRPR positive, we designed and synthesized a heterodimeric peptide Glu-RGD-BBN, which is expected to be advantageous over the monomeric peptides for dual-receptor targeting. A PEG(3) spacer was attached to the glutamate alpha-amino group of Glu-RGD-BBN to enhance the (18)F labeling yield and to improve the in vivo kinetics. PEG(3)-Glu-RGD-BBN possesses the comparable GRPR and integrin alpha(v)beta(3) receptor-binding affinities as the corresponding monomers, respectively. The dual-receptor targeting properties of (18)F-FB-PEG(3)-Glu-RGD-BBN were observed in PC-3 tumor model. (18)F-FB-PEG(3)-Glu-RGD-BBN with high tumor contrast and favorable pharmacokinetics is a promising PET tracer for dual integrin and GRPR positive tumor imaging. This heterodimer strategy may also be an applicable method to develop other molecules with improved in vitro and in vivo characterizations for tumor diagnosis and therapy.
Sun, Na; Cui, Pengbo; Li, Dongmei; Jin, Ziqi; Zhang, Shuyu; Lin, Songyi
2017-09-20
A novel peptide from egg white, Asp-His-Thr-Lys-Glu (DHTKE), contains specific amino acids associated with iron binding. The present study aims to better understand the molecular basis of interactions between the DHTKE peptide and iron ions. The ultraviolet-visible and fluorescence spectra indicate an interaction between the DHTKE peptide and iron ions, which leads to the formation of a DHTKE-iron complex. Notably, Asp, Glu, His, and Lys in the DHTKE peptide play crucial roles in the formation of the DHTKE-iron complex, and the iron-binding site of the DHTKE peptide corresponds primarily to the amide and carboxyl groups. The DHTKE peptide can bind iron ions in a 1 : 2 ratio with a binding constant of 1.312 × 10 5 M -1 . Moreover, the DHTKE-iron complex belongs to thermodynamically stable nanoparticles that are present in the crystalline structure, which might be attributed to peptide folding induced by iron binding. Meanwhile, the DHTKE-iron complex exhibits a relatively high iron-releasing percentage and exerts excellent solubility in the human gastrointestinal tract in vitro. This suggests a potential application of peptides containing Asp, Glu, His, or Lys residues as potential iron supplements.
Fazio, F.; Notartomaso, S.; Aronica, E.; Storto, M.; Battaglia, G.; Vieira, E.; Gatti, S.; Bruno, V.; Biagioni, F.; Gradini, R.; Nicoletti, F.; Di Marco, R.
2008-01-01
Recent evidence suggests that changes in the expression of membrane receptors/ion channels in cerebellar Purkinje cells contribute to the onset of cerebellar motor symptoms in patients with multiple sclerosis (MS). We examined the expression of group-I metabotropic glutamate receptors (mGlu1 and
van Lith, Sanne A M; Roodink, Ilse; Verhoeff, Joost J C; Mäkinen, Petri I; Lappalainen, Jari P; Ylä-Herttuala, Seppo; Raats, Jos; van Wijk, Erwin; Roepman, Ronald; Letteboer, Stef J; Verrijp, Kiek; Leenders, William P J
2016-11-01
Diffuse gliomas are primary brain cancers that are characterised by infiltrative growth. Whereas high-grade glioma characteristically presents with perinecrotic neovascularisation, large tumor areas thrive on pre-existent vasculature as well. Clinical studies have revealed that pharmacological inhibition of the angiogenic process does not improve survival of glioblastoma patients. Direct targeting of tumor vessels may however still be an interesting therapeutic approach as it allows pinching off the blood supply to tumor cells. Such tumor vessel targeting requires the identification of tumor-specific vascular targeting agents (TVTAs).Here we describe a novel TVTA, C-C7, which we identified via in vivo biopanning of a llama nanobody phage display library in an orthotopic mouse model of diffuse glioma. We show that C-C7 recognizes a subpopulation of tumor blood vessels in glioma xenografts and clinical glioma samples. Additionally, C-C7 recognizes macrophages and activated endothelial cells in atherosclerotic lesions. By using C-C7 as bait in yeast-2-hybrid (Y2H) screens we identified dynactin-1-p150Glued as its binding partner. The interaction was confirmed by co-immunostainings with C-C7 and a commercial anti-dynactin-1-p150Glued antibody, and via co-immunoprecipitation/western blot studies. Normal brain vessels do not express dynactin-1-p150Glued and its expression is reduced under anti-VEGF therapy, suggesting that dynactin-1-p150Glued is a marker for activated endothelial cells.In conclusion, we show that in vivo phage display combined with Y2H screenings provides a powerful approach to identify tumor-targeting nanobodies and their binding partners. Using this combination of methods we identify dynactin-1-p150Glued as a novel targetable protein on activated endothelial cells and macrophages.
Imre, Gabor; Salomons, Amber; Jongsma, Minke; Fokkema, Dirk S.; Den Boer, Johan A.; Ter Horst, Gert J.
One of the functions of group 11 metabotropic glutamate receptors (mGluR2/3) is to modulate glutamate release. Thus, targeting mGluR2/3s might be a novel treatment for several psychiatric disorders associated with inappropriate glutamatergic neurotransmission, such as schizophrenia. In an effort to
International Nuclear Information System (INIS)
Blanco Lezcano, Lisette; Lorigados Pedre, Lourdes del Carmen; Gonzalez Fraguela, Maria Elena and others
2011-01-01
Although the pharmacological manipulation of the glutamatergic and cholinergic systems have been studied in animal models of Parkinson's Disease (PD), only some authors have done work on this topic at the pedunculopontine nucleus (PPN). The present work studied the changes in glutamate (Glu) and δ-aminobutyric acid (GABA) extracellular concentrations (EC) in the PPN from hemiparkinsonian rats by 6hydroxydopamine injection. The rats were locally perfused by MK-801 (10 μ mol/l) or (-) nicotine (10 mm) solutions by cerebral microdialysis. The biochemical studies were carried out through high performance liquid chromatography coupled to fluorescence detection. Mk-801 infusion induced a significant decrease of Glu (p< 0.01) and GABA (p< 0.01) EC in PPN. On the other hand (-) nicotine infusion induced a significant increase of Glu (p< 0.001) and GABA (p< 0.001) EC in PPN from hemiparkinsonian rats. The local blockade of NMDA receptors by MK-801 infusion facilitates the interaction between Glu and their metabotropic receptors that take part in presynaptic inhibition mechanisms and interfere with neurotransmitters release. Meanwhile, the nicotine infusion sums the effects of nicotinic receptor activation with the glutamatergic and gabaergic neurotransmission changes produced in the PPN in the parkinsonian condition. The cholinergic and glutamergic drug infusion in PPN impose a new adjustment to the neurotransmission at this level that is added to the neurochemical changes associated to dopaminergic denervation.
Directory of Open Access Journals (Sweden)
Jiri Paral
2014-07-01
Conclusion: Healing with absorbable synthetic glue was as good as with staples. Glued anastomoses resisted pressures that were statistically significantly higher than physiological intraluminal colon pressures but lower than stapled ones.
Directory of Open Access Journals (Sweden)
Irina Lonskaya
Full Text Available Matrix metalloproteinases (MMPs are zinc dependent endopeptidases that can be released from neurons in an activity dependent manner to play a role in varied forms of learning and memory. MMP inhibitors impair hippocampal long term potentiation (LTP, spatial memory, and behavioral correlates of drug addiction. Since MMPs are thought to influence LTP through a β1 integrin dependent mechanism, it has been suggested that these enzymes cleave specific substrates to generate integrin binding ligands. In previously published work, we have shown that neuronal activity stimulates rapid MMP dependent shedding of intercellular adhesion molecule-5 (ICAM-5, a synaptic adhesion molecule expressed on dendrites of the telencephalon. We have also shown that the ICAM-5 ectodomain can interact with β1 integrins to stimulate integrin dependent phosphorylation of cofilin, an event that occurs with dendritic spine maturation and LTP. In the current study, we investigate the potential for the ICAM-5 ectodomain to stimulate changes in α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate receptor (AMPAR dependent glutamatergic transmission. Single cell recordings show that the ICAM-5 ectodomain stimulates an increase in the frequency, but not the amplitude, of AMPA mini excitatory post synaptic currents (mEPSCs. With biotinylation and precipitation assays, we also show that the ICAM-5 ectodomain stimulates an increase in membrane levels of GluA1, but not GluA2, AMPAR subunits. In addition, we observe an ICAM-5 associated increase in GluA1 phosphorylation at serine 845. Concomitantly, ICAM-5 affects an increase in GluA1 surface staining along dendrites without affecting an increase in dendritic spine number. Together these data are consistent with the possibility that soluble ICAM-5 increases glutamatergic transmission and that post-synaptic changes, including increased phosphorylation and dendritic insertion of GluA1, could contribute. We suggest that future studies
Schwarz, Lindsay A; Hall, Benjamin J; Patrick, Gentry N
2010-12-08
The accurate trafficking of AMPA receptors (AMPARs) to and from the synapse is a critical component of learning and memory in the brain, whereas dysfunction of AMPAR trafficking is hypothesized to be an underlying mechanism of Alzheimer's disease. Previous work has shown that ubiquitination of integral membrane proteins is a common posttranslational modification used to mediate endocytosis and endocytic sorting of surface proteins in eukaryotic cells. Here we report that mammalian AMPARs become ubiquitinated in response to their activation. Using a mutant of GluA1 that is unable to be ubiquitinated at lysines on its C-terminus, we demonstrate that ubiquitination is required for internalization of surface AMPARs and their trafficking to the lysosome in response to the AMPAR agonist AMPA but not for internalization of AMPARs in response to the NMDA receptor agonist NMDA. Through overexpression or RNA interference-mediated knockdown, we identify that a specific E3 ligase, Nedd4-1 (neural-precursor cell-expressed developmentally downregulated gene 4-1), is necessary for this process. Finally, we show that ubiquitination of GluA1 by Nedd4-1 becomes more prevalent as neurons mature. Together, these data show that ubiquitination of GluA1-containing AMPARs by Nedd4-1 mediates their endocytosis and trafficking to the lysosome. Furthermore, these results provide insight into how hippocampal neurons regulate AMPAR trafficking and degradation with high specificity in response to differing neuronal signaling cues and suggest that changes to this pathway may occur as neurons mature.
Directory of Open Access Journals (Sweden)
Bashir A Akhoon
Full Text Available The rapid appearance of resistant malarial parasites after introduction of atovaquone (ATQ drug has prompted the search for new drugs as even single point mutations in the active site of Cytochrome b protein can rapidly render ATQ ineffective. The presence of Y268 mutations in the Cytochrome b (Cyt b protein is previously suggested to be responsible for the ATQ resistance in Plasmodium falciparum (P. falciparum. In this study, we examined the resistance mechanism against ATQ in P. falciparum through computational methods. Here, we reported a reliable protein model of Cyt bc1 complex containing Cyt b and the Iron-Sulphur Protein (ISP of P. falciparum using composite modeling method by combining threading, ab initio modeling and atomic-level structure refinement approaches. The molecular dynamics simulations suggest that Y268S mutation causes ATQ resistance by reducing hydrophobic interactions between Cyt bc1 protein complex and ATQ. Moreover, the important histidine contact of ATQ with the ISP chain is also lost due to Y268S mutation. We noticed the induced mutation alters the arrangement of active site residues in a fashion that enforces ATQ to find its new stable binding site far away from the wild-type binding pocket. The MM-PBSA calculations also shows that the binding affinity of ATQ with Cyt bc1 complex is enough to hold it at this new site that ultimately leads to the ATQ resistance.
Multistability and gluing bifurcation to butterflies in coupled networks with non-monotonic feedback
International Nuclear Information System (INIS)
Ma Jianfu; Wu Jianhong
2009-01-01
Neural networks with a non-monotonic activation function have been proposed to increase their capacity for memory storage and retrieval, but there is still a lack of rigorous mathematical analysis and detailed discussions of the impact of time lag. Here we consider a two-neuron recurrent network. We first show how supercritical pitchfork bifurcations and a saddle-node bifurcation lead to the coexistence of multiple stable equilibria (multistability) in the instantaneous updating network. We then study the effect of time delay on the local stability of these equilibria and show that four equilibria lose their stability at a certain critical value of time delay, and Hopf bifurcations of these equilibria occur simultaneously, leading to multiple coexisting periodic orbits. We apply centre manifold theory and normal form theory to determine the direction of these Hopf bifurcations and the stability of bifurcated periodic orbits. Numerical simulations show very interesting global patterns of periodic solutions as the time delay is varied. In particular, we observe that these four periodic solutions are glued together along the stable and unstable manifolds of saddle points to develop a butterfly structure through a complicated process of gluing bifurcations of periodic solutions
Sanderson, David J.; Good, Mark A.; Skelton, Kathryn; Sprengel, Rolf; Seeburg, Peter H.; Rawlins, J. Nicholas P.; Bannerman, David M.
2009-01-01
The GluA1 AMPA receptor subunit is a key mediator of hippocampal synaptic plasticity and is especially important for a rapidly-induced, short-lasting form of potentiation. GluA1 gene deletion impairs hippocampus-dependent, spatial working memory, but spares hippocampus-dependent spatial reference memory. These findings may reflect the necessity of…
Importance of GluA1 subunit-containing AMPA glutamate receptors for morphine state-dependency.
Directory of Open Access Journals (Sweden)
Teemu Aitta-aho
Full Text Available In state-dependency, information retrieval is most efficient when the animal is in the same state as it was during the information acquisition. State-dependency has been implicated in a variety of learning and memory processes, but its mechanisms remain to be resolved. Here, mice deficient in AMPA-type glutamate receptor GluA1 subunits were first conditioned to morphine (10 or 20 mg/kg s.c. during eight sessions over four days using an unbiased procedure, followed by testing for conditioned place preference at morphine states that were the same as or different from the one the mice were conditioned to. In GluA1 wildtype littermate mice the same-state morphine dose produced the greatest expression of place preference, while in the knockout mice no place preference was then detected. Both wildtype and knockout mice expressed moderate morphine-induced place preference when not at the morphine state (saline treatment at the test; in this case, place preference was weaker than that in the same-state test in wildtype mice. No correlation between place preference scores and locomotor activity during testing was found. Additionally, as compared to the controls, the knockout mice showed unchanged sensitization to morphine, morphine drug discrimination and brain regional μ-opioid receptor signal transduction at the G-protein level. However, the knockout mice failed to show increased AMPA/NMDA receptor current ratios in the ventral tegmental area dopamine neurons of midbrain slices after a single injection of morphine (10 mg/kg, s.c., sliced prepared 24 h afterwards, in contrast to the wildtype mice. The results indicate impaired drug-induced state-dependency in GluA1 knockout mice, correlating with impaired opioid-induced glutamate receptor neuroplasticity.
Leong, Max K; Syu, Ren-Guei; Ding, Yi-Lung; Weng, Ching-Feng
2017-01-06
The glycine-binding site of the N-methyl-D-aspartate receptor (NMDAR) subunit GluN1 is a potential pharmacological target for neurodegenerative disorders. A novel combinatorial ensemble docking scheme using ligand and protein conformation ensembles and customized support vector machine (SVM)-based models to select the docked pose and to predict the docking score was generated for predicting the NMDAR GluN1-ligand binding affinity. The predicted root mean square deviation (RMSD) values in pose by SVM-Pose models were found to be in good agreement with the observed values (n = 30, r 2 = 0.928-0.988, = 0.894-0.954, RMSE = 0.002-0.412, s = 0.001-0.214), and the predicted pK i values by SVM-Score were found to be in good agreement with the observed values for the training samples (n = 24, r 2 = 0.967, = 0.899, RMSE = 0.295, s = 0.170) and test samples (n = 13, q 2 = 0.894, RMSE = 0.437, s = 0.202). When subjected to various statistical validations, the developed SVM-Pose and SVM-Score models consistently met the most stringent criteria. A mock test asserted the predictivity of this novel docking scheme. Collectively, this accurate novel combinatorial ensemble docking scheme can be used to predict the NMDAR GluN1-ligand binding affinity for facilitating drug discovery.
DEFF Research Database (Denmark)
Clausen, Rasmus Prætorius; Naur, Peter; Kristensen, Anders Skov
2009-01-01
The design, synthesis, and pharmacological characterization of a highly potent and selective glutamate GluR5 agonist is reported. (S)-2-Amino-3-((RS)-3-hydroxy-8-methyl-7,8-dihydro-6H-cyclohepta[d]isoxazol-4-yl)propionic acid (5) is the 8-methyl analogue of (S)-2-amino-3-(3-hydroxy-7,8-dihydro-6H......-cyclohepta[d]isoxazol-4-yl)propionic acid ((S)-4-AHCP, 4). Compound 5 displays an improved selectivity profile compared to 4. A versatile stereoselective synthetic route for this class of compounds is presented along with the characterization of the binding affinity of 5 to ionotropic glutamate receptors (i......GluRs). Functional characterization of 5 at cloned iGluRs using a calcium imaging assay and voltage-clamp recordings show a different activation of GluR5 compared to (S)-glutamic acid (Glu), kainic acid (KA, 1), and (S)-2-amino-3-(3-hydroxy-5-tert-butyl-4-isoxazolyl)propionic acid ((S)-ATPA, 3) as previously...
Nicole M. Stark; Zhiyong Cai; Charles Carll
2010-01-01
This chapter gives an overview of the general types and composition of wood-based composite products and the materials and processes used to manufacture them. It describes conventional wood-based composite panels and structural composite materials intended for general construction, interior use, or both. This chapter also describes woodânonwood composites. Mechanical...
Moody, Teena D.; Watabe, Ayako M.; Indersmitten, Tim; Komiyama, Noboru H.; Grant, Seth G. N.; O'Dell, Thomas J.
2011-01-01
Through protein interactions mediated by their cytoplasmic C termini the GluN2A and GluN2B subunits of NMDA receptors (NMDARs) have a key role in the formation of NMDAR signaling complexes at excitatory synapses. Although these signaling complexes are thought to have a crucial role in NMDAR-dependent forms of synaptic plasticity such as long-term…
Directory of Open Access Journals (Sweden)
Mili V Mehta
Full Text Available Autism spectrum disorders (ASD are highly disabling developmental disorders with a population prevalence of 1-3%. Despite a strong genetic etiology, there are no current therapeutic options that target the core symptoms of ASD. Emerging evidence suggests that dysfunction of glutamatergic signaling, in particular through metabotropic glutamate receptor 5 (mGluR5 receptors, may contribute to phenotypic deficits and may be appropriate targets for pharmacologic intervention. This study assessed the therapeutic potential of 2-methyl-6-phenylethyl-pyrididine (MPEP, an mGluR5-receptor antagonist, on repetitive and anxiety-like behaviors in the valproic acid (VPA mouse model of autism. Mice were exposed prenatally on day E13 to VPA and assessed for repetitive self-grooming and marble burying behaviors as adults. Anxiety-like behavior and locomotor activity were measured in an open-field. VPA-exposed mice displayed increased repetitive and anxiety-like behaviors, consistent with previously published results. Across both marble burying and self-grooming assays, MPEP significantly reduced repetitive behaviors in VPA-treated mice, but had no effect on locomotor activity. These results are consistent with emerging preclinical literature that mGluR5-antagonists may have therapeutic efficacy for core symptoms of autism.
Sanderson, David J; Good, Mark A; Skelton, Kathryn; Sprengel, Rolf; Seeburg, Peter H; Rawlins, J Nicholas P; Bannerman, David M
2009-06-01
The GluA1 AMPA receptor subunit is a key mediator of hippocampal synaptic plasticity and is especially important for a rapidly-induced, short-lasting form of potentiation. GluA1 gene deletion impairs hippocampus-dependent, spatial working memory, but spares hippocampus-dependent spatial reference memory. These findings may reflect the necessity of GluA1-dependent synaptic plasticity for short-term memory of recently visited places, but not for the ability to form long-term associations between a particular spatial location and an outcome. This hypothesis is in concordance with the theory that short-term and long-term memory depend on dissociable psychological processes. In this study we tested GluA1-/- mice on both short-term and long-term spatial memory using a simple novelty preference task. Mice were given a series of repeated exposures to a particular spatial location (the arm of a Y-maze) before their preference for a novel spatial location (the unvisited arm of the maze) over the familiar spatial location was assessed. GluA1-/- mice were impaired if the interval between the trials was short (1 min), but showed enhanced spatial memory if the interval between the trials was long (24 h). This enhancement was caused by the interval between the exposure trials rather than the interval prior to the test, thus demonstrating enhanced learning and not simply enhanced performance or expression of memory. This seemingly paradoxical enhancement of hippocampus-dependent spatial learning may be caused by GluA1 gene deletion reducing the detrimental effects of short-term memory on subsequent long-term learning. Thus, these results support a dual-process model of memory in which short-term and long-term memory are separate and sometimes competitive processes.
Experimental analysis of bonding in steel bars glued into chestnut and tali timber
Directory of Open Access Journals (Sweden)
Otero Chans, D.
2010-03-01
Full Text Available This article summarizes the results of an extensive experiment designed to determine the effect of geometric and mechanical parameters on the axial strength of the bonds formed when threaded steel bars are glued into sawn hardwood timber. The studies conducted to date on glued wood joints have focused primarily on softwood glued laminated timber or glulam. In the present study, specimens made from two hardwood species with very different physical and mechanical properties were used to evaluate the effect of wood characteristics on the axial strength of such bonds. Several geometries were tested by loading a total of 190 specimens to failure.
The ultimate load values found for the specimens were compared to the design values proposed in the final draft version of Eurocode 5 (prEN 1995-1-1(2001.
En el presente artículo se resumen los resultados de una amplia campaña experimental encaminada a evaluar la influencia de los distintos parámetros geométricos y mecánicos en la capacidad resistente de uniones realizadas con barras roscadas de acero encoladas en madera aserrada de frondosa. Los estudios existentes en el campo de las uniones encoladas en madera se han centrado fundamentalmente en el análisis de uniones realizadas en madera laminada de especies coníferas. Con objeto de evaluar la influencia de las características de la madera en la capacidad resistente de la unión se ensayaron probetas realizadas con dos especies de madera frondosa de características físicas y mecánicas muy diferentes. Se utilizaron diversas configuraciones geométricas. Un total de 190 probetas han sido ensayadas hasta rotura.
Los valores de carga de rotura alcanzados por las probetas se han comparado además con los valores de cálculo propuestos por el Eurocódigo 5, en su versión de borrador final prEN 1995-1-1(2001.
Atala, Magda M; Goulart, Alessandra; Guerra, Grazia M; Mostarda, Cristiano; Rodrigues, Bruno; Mello, Priscila R; Casarine, Dulce E; Irigoyen, Maria-Claudia; Pereira, Alexandre C; Consolim-Colombo, Fernanda M
2015-01-01
The association between functional β2 adrenergic receptor (β2-AR) polymorphisms and cardiac autonomic modulation is still unclear. Thus, two common polymorphisms in the β2-AR gene (Gln27Glu β2 and Arg16Gly β2) were studied to determine whether they might affect tonic and reflex cardiac sympathetic activity in healthy young subjects. A total of 213 healthy young white subjects of both genders (53% female), aged 18-30 years (23.5±3.4 y), had their continuous blood pressure curves noninvasively recorded by Finometer at baseline, and other hemodynamic parameters, as cardiac autonomic modulation, baroreflex sensitivity, and allele, genotype, and diplotype frequencies calculated. Associations were made between Arg16Gly β2 and Gln27Glu β2 polymorphisms and between β2-AR diplotypes and all variables. The heart rate was significantly lower (P<0.001) in the presence of homozygous Arg/Arg alleles (60.9±1.5 bpm) than in that of Arg/Gly heterozygotes (65.9±1.0 bpm) or Gly/Gly homozygotes (66.3±1.2 bpm). Homozygous carriers of Arg16 allele had an alpha index (19.2±1.3) significantly higher (P<0.001) than that of the subjects with the Gly allele Gly/Gly (14.5±0.7) or Arg/Gly (14.6±0.7). Furthermore, the recessive Glu27Glu and the heterozygous Gln27Glu genotypes had a higher percentage of low-frequency components (LF%) than the homozygous Gln27Gln (15.1% vs. 16.0% vs. 8.2%, P=0.03, respectively). In healthy young subjects, the presence of β2-AR Arg16 allele in a recessive model was associated with higher baroreflex sensitivity, and increased parasympathetic modulation in studied individuals. PMID:25755837
Discrimination Power of Polynomial-Based Descriptors for Graphs by Using Functional Matrices.
Dehmer, Matthias; Emmert-Streib, Frank; Shi, Yongtang; Stefu, Monica; Tripathi, Shailesh
2015-01-01
In this paper, we study the discrimination power of graph measures that are based on graph-theoretical matrices. The paper generalizes the work of [M. Dehmer, M. Moosbrugger. Y. Shi, Encoding structural information uniquely with polynomial-based descriptors by employing the Randić matrix, Applied Mathematics and Computation, 268(2015), 164-168]. We demonstrate that by using the new functional matrix approach, exhaustively generated graphs can be discriminated more uniquely than shown in the mentioned previous work.
Hamill, Terence G; Krause, Stephen; Ryan, Christine; Bonnefous, Celine; Govek, Steve; Seiders, T Jon; Cosford, Nicholas D P; Roppe, Jeffrey; Kamenecka, Ted; Patel, Shil; Gibson, Raymond E; Sanabria, Sandra; Riffel, Kerry; Eng, Waisi; King, Christopher; Yang, Xiaoqing; Green, Mitchell D; O'Malley, Stacey S; Hargreaves, Richard; Burns, H Donald
2005-06-15
Three metabotropic glutamate receptor subtype 5 (mGluR5) PET tracers have been labeled with either carbon-11 or fluorine-18 and their in vitro and in vivo behavior in rhesus monkey has been characterized. Each of these tracers share the common features of high affinity for mGluR5 (0.08-0.23 nM vs. rat mGluR5) and moderate lipophilicity (log P 2.8-3.4). Compound 1b was synthesized using a Suzuki or Stille coupling reaction with [11C]MeI. Compounds 2b and 3b were synthesized by a SNAr reaction using a 3-chlorobenzonitrile precursor. Autoradiographic studies in rhesus monkey brain slices using 2b and 3b showed specific binding in cortex, caudate, putamen, amygdala, hippocampus, most thalamic nuclei, and lower binding in the cerebellum. PET imaging studies in monkey showed that all three tracers readily enter the brain and provide an mGluR5-specific signal in all gray matter regions, including the cerebellum. The specific signal observed in the cerebellum was confirmed by the autoradiographic studies and saturation binding experiments that showed tracer binding in the cerebellum of rhesus monkeys. In vitro metabolism studies using the unlabeled compounds showed that 1a, 2a, and 3a are metabolized slower by human liver microsomes than by monkey liver microsomes. In vivo metabolism studies showed 3b to be long-lived in rhesus plasma with only one other more polar metabolite observed. (c) 2005 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Jaime Pei Pei Foong
2009-05-01
Full Text Available Vasoactive intestinal peptide (VIP immunoreactive secretomotor neurons in the submucous plexus are involved in mediating bacterial toxin-induced hypersecretion leading to diarrhoea. VIP neurons become hyperexcitable after the mucosa is exposed to cholera toxin, which suggests that the manipulation of the excitability of these neurons may be therapeutic. This study used standard intracellular recording methods to systematically characterize slow excitatory postsynaptic potentials (EPSPs evoked in submucosal VIP neurons by different stimulus regimes (1, 3 and 15 pulse 30 Hz stimulation, together with their associated input resistances and pharmacology. All slow EPSPs were associated with a significant increase in input resistance compared to baseline values. Slow EPSPs evoked by a single stimulus were confirmed to be purinergic, however, slow EPSPs evoked by 15 pulse trains were non-purinergic and those evoked by 3 pulse trains were mixed. NK1 or NK3 receptor antagonists did not affect slow EPSPs. The group I mGluR receptor antagonist, PHCCC reduced the amplitude of purinergic and non-purinergic slow EPSPs. Blocking mGluR1 receptors depressed the overall response to 3 and 15 pulse trains, but this effect was inconsistent, while blockade of mGluR5 receptors had no effect on the non-purinergic slow EPSPs. Thus, although other receptors are almost certainly involved, our data indicate that there are at least two pharmacologically distinct types of slow EPSPs in the VIP secretomotor neurons: one mediated by P2Y receptors and the other in part by mGluR1 receptors.
1997 Hardwood Research Award Winner: "Automatic Color Sorting of Hardwood Edge-Glued Panel Parts"
D. Earl Kline; Richard Conners; Qiang Lu; Philip A. Araman
1997-01-01
The National Hardwood Lumber Association's 1997 Hardwood Research Award was presented to D. Earl Kline, Richard Conners, Qiang Lu and Philip Araman at the 25th Annual Hardwood Symposium for developing an automatic system for color sorting hardwood edge-glued panel parts. The researchers comprise a team from Virginia Tech University and the USDA Forest Service in...
Peterson, Bethany L; Park, Thomas J; Larson, John
2012-01-11
Adult naked mole-rats show a number of systemic adaptations to a crowded underground habitat that is low in oxygen and high in carbon dioxide. Remarkably, brain slice tissue from adult naked mole-rats also is extremely tolerant to oxygen deprivation as indicated by maintenance of synaptic transmission under hypoxic conditions as well as by a delayed neuronal depolarization during anoxia. These characteristics resemble hypoxia tolerance in brain slices from neonates in a variety of mammal species. An important component of neonatal tolerance to hypoxia involves the subunit composition of NMDA receptors. Neonates have a high proportion of NMDA receptors with GluN2D subunits which are protective because they retard calcium entry into neurons during hypoxic episodes. Therefore, we hypothesized that adult naked mole-rats retain a protective, neonatal-like, NMDA receptor subunit profile. We used immunoblotting to assess age-related changes in NMDA receptor subunits in naked mole-rats and mice. The results show that adult naked mole-rat brain retains a much greater proportion of the hypoxia-protective GluN2D subunit compared to adult mice. However, age-related changes in other subunits (GluN2A and GluN2B) from the neonatal period to adulthood were comparable in mice and naked mole-rats. Hence, adult naked mole-rat brain only retains the neonatal NMDA receptor subunit that is associated with hypoxia tolerance. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Aguirre, Jose A; Kehr, Jan; Yoshitake, Takashi; Liu, Fang-Ling; Rivera, Alicia; Fernandez-Espinola, Sergio; Andbjer, Beth; Leo, Giuseppina; Medhurst, Andrew D; Agnati, Luigi F; Fuxe, Kjell
2005-02-08
The mGluR5 antagonist MPEP was used to study the role of mGluR5 in MPTP-induced injury of the nigrostriatal DA neurons. The findings indicate that acute blockade of mGluR5 may result in neuroprotective actions against MPTP neurotoxicity on nigral DA cell bodies and striatal DA terminals using stereological analysis of TH immunoreactivity and microdensitometry. Biochemical analysis showed no restoration of DA levels and metabolism indicating a maintained reduction of DA transmission.
Quiroz-Rocha, Elva; Moreno, Renata; Hernández-Ortíz, Armando; Fragoso-Jiménez, Juan Carlos; Muriel-Millán, Luis Felipe; Guzmán, Josefina; Espín, Guadalupe; Rojo, Fernando; Núñez, Cinthia
2017-04-12
Azotobacter vinelandii, a strict aerobic, nitrogen fixing bacterium in the Pseudomonadaceae family, exhibits a preferential use of acetate over glucose as a carbon source. In this study, we show that GluP (Avin04150), annotated as an H + -coupled glucose-galactose symporter, is the glucose transporter in A. vinelandii. This protein, which is widely distributed in bacteria and archaea, is uncommon in Pseudomonas species. We found that expression of gluP was under catabolite repression control thorugh the CbrA/CbrB and Crc/Hfq regulatory systems, which were functionally conserved between A. vinelandii and Pseudomonas species. While the histidine kinase CbrA was essential for glucose utilization, over-expression of the Crc protein arrested cell growth when glucose was the sole carbon source. Crc and Hfq proteins from either A. vinelandii or P. putida could form a stable complex with an RNA A-rich Hfq-binding motif present in the leader region of gluP mRNA. Moreover, in P. putida, the gluP A-rich Hfq-binding motif was functional and promoted translational inhibition of a lacZ reporter gene. The fact that gluP is not widely distributed in the Pseudomonas genus but is under control of the CbrA/CbrB and Crc/Hfq systems demonstrates the relevance of these systems in regulating metabolism in the Pseudomonadaceae family.
Directory of Open Access Journals (Sweden)
Yachun Su
2016-09-01
Full Text Available Beta-1,3-glucanases (EC 3.2.1.39, commonly known as pathogenesis-related (PR proteins, play an important role not only in plant defense against fungal pathogens but also in plant physiological and developmental processes. However, only a limited number of sugarcane beta-1,3-glucanase genes have been isolated. In the present study, we identified and characterized a new beta-1,3-glucanase gene ScGluD2 (GenBank Acc No. KF664181 from sugarcane. An X8 domain was present at the C terminal region of ScGluD2, suggesting beta-1,3-glucan-binding function. Phylogenetic analysis showed that the predicted ScGluD2 protein was classified into subfamily D beta-1,3-glucanase. Localization of the ScGluD2 protein in the plasma membrane was determined by tagging it with green fluorescent protein. The expression of ScGluD2 was more up-regulated in sugarcane smut-resistant cultivars in the early stage (1 d or 3 d than in the susceptible ones after being challenged by the smut pathogen, revealing that ScGluD2 may be involved in defense against the invasion of Sporisorium scitamineum. Transient overexpression of ScGluD2 in Nicotiana benthamiana leaves induced a defense response and exhibited antimicrobial action on the tobacco pathogens Pseudomonas solanacearum and Botrytis cinerea, further demonstrating that ScGluD2 was related to the resistance to plant pathogens. However, the transcripts of ScGluD2 partially increased (12 h under NaCl stress, and were steadily up-regulated from 6 h to 24 h upon ABA, H2O2, and CdCl2 treatments, suggesting that ABA may be a signal molecule regulating oxidative stress and play a role in the salt and heavy metal stress-induced stimulation of ScGluD2 transcripts. Taken together, ScGluD2, a novel member of subfamily D beta-1,3-glucanase, was a stress-related gene of sugarcane involved in plant defense against smut pathogen attack and salt and heavy metal stresses.
DEFF Research Database (Denmark)
Krintel, Christian; Frydenvang, Karla; Olsen, Lars
2012-01-01
Positive allosteric modulators of the ionotropic glutamate receptor-2 (GluA2) are promising compounds for the treatment of cognitive disorders, e.g. Alzheimer's disease. These modulators bind within the dimer interface of the ligand-binding domain and stabilize the agonist-bound conformation slow...
Kawaura, Kazuaki; Karasawa, Jun-Ichi; Hikichi, Hirohiko
2016-02-01
Negative symptoms of schizophrenia are poorly managed using the currently available antipsychotics. Previous studies indicate that agonists of the metabotropic glutamate (mGlu) 2/3 receptors may provide a novel approach for the treatment of schizophrenia. However, the effects of mGlu2/3 receptor agonists or mGlu2 receptor positive allosteric modulators have not yet been clearly elucidated in animal models of the negative symptoms of schizophrenia. Recently, we reported that the forced swimming test in rats treated with subchronic MK-801, an NMDA receptor antagonist, may be regarded as a useful test to evaluate the activities of drugs against the negative symptoms of schizophrenia. We evaluated the effects of LY379268, an mGlu2/3 receptor agonist, and BINA, an mGlu2 receptor positive allosteric modulator, on the hyperlocomotion induced by acute administration of MK-801 (0.15mg/kg, sc) and on the increase in the immobility time in the forced swimming test induced by subchronic treatment with MK-801 (0.5mg/kg, sc, twice a day for 7 days) in rats. Both LY379268 (3mg/kg, sc) and BINA (100mg/kg, ip) attenuated the increase in the immobility time induced by subchronic treatment with MK-801 at the same doses at which they attenuated the MK-801-induced increase in locomotor activity, but had no effect on the immobility time in saline-treated rats. The present results suggest that stimulation of the mGlu2 receptor attenuates the increase in the immobility time in the forced swimming test elicited by subchronic administration of MK-801, and may be potentially useful for treatment of the negative symptoms of schizophrenia. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Generalized eigenvalue based spectrum sensing
Shakir, Muhammad
2012-01-01
Spectrum sensing is one of the fundamental components in cognitive radio networks. In this chapter, a generalized spectrum sensing framework which is referred to as Generalized Mean Detector (GMD) has been introduced. In this context, we generalize the detectors based on the eigenvalues of the received signal covariance matrix and transform the eigenvalue based spectrum sensing detectors namely: (i) the Eigenvalue Ratio Detector (ERD) and two newly proposed detectors which are referred to as (ii) the GEometric Mean Detector (GEMD) and (iii) the ARithmetic Mean Detector (ARMD) into an unified framework of generalize spectrum sensing. The foundation of the proposed framework is based on the calculation of exact analytical moments of the random variables of the decision threshold of the respective detectors. The decision threshold has been calculated in a closed form which is based on the approximation of Cumulative Distribution Functions (CDFs) of the respective test statistics. In this context, we exchange the analytical moments of the two random variables of the respective test statistics with the moments of the Gaussian (or Gamma) distribution function. The performance of the eigenvalue based detectors is compared with the several traditional detectors including the energy detector (ED) to validate the importance of the eigenvalue based detectors and the performance of the GEMD and the ARMD particularly in realistic wireless cognitive radio network. Analytical and simulation results show that the newly proposed detectors yields considerable performance advantage in realistic spectrum sensing scenarios. Moreover, the presented results based on proposed approximation approaches are in perfect agreement with the empirical results. © 2012 Springer Science+Business Media Dordrecht.
Quantification of patterns of regional cardiac metabolism
International Nuclear Information System (INIS)
Lear, J.L.; Ackermann, R.F.
1990-01-01
To quantitatively map and compare patterns of regional cardiac metabolism with greater spatial resolution than is possible with positron emission tomography (PET), the authors developed autoradiographic techniques for use with combinations of radiolabeled fluorodeoxyglucose (FDG), glucose (GLU), and acetate (ACE) and applied the techniques to normal rats. Kinetic models were developed to compare GLU-based oxidative glucose metabolism with FDG-based total glucose metabolism (oxidative plus anaerobic) and to compare ACE-based overall oxidative metabolism with FDG-based total glucose metabolism. GLU-based metabolism generally paralleled FDG-based metabolism, but divergence occurred in certain structures such as the papillary muscles, where FDG-based metabolism was much greater. ACE-based metabolism also generally paralleled FDG-based metabolism, but again, the papillary muscles had relatively greater FDG-based metabolism. These discrepancies between FDG-based metabolism and GLU- or ACE-based metabolism suggest the presence of high levels of anaerobic glycolysis. Thus, the study indicates that anaerobic glycolysis, in addition to occurring in ischemic or stunned myocardium (as has been shown in recent PET studies), occurs normally in specific cardiac regions, despite the presence of abundant oxygen
Directory of Open Access Journals (Sweden)
Wyatt B Potter
Full Text Available Tuberous sclerosis complex (TSC is a multisystem genetic disease that manifests with mental retardation, tumor formation, autism, and epilepsy. Heightened signaling through the mammalian target of rapamycin (mTOR pathway is involved in TSC pathology, however it remains unclear how other signaling pathways are perturbed and contribute to disease symptoms. Reduced long-term depression (LTD was recently reported in TSC mutant mice. We find that although reduced LTD is a feature of the juvenile mutant hippocampus, heightened expression of metabotropic glutamate receptor 5 and constitutively activated Erk signaling in the adult hippocampus drives wild-type levels of LTD. Increased mGluR5 and Erk results in a novel mTOR-independent LTD in CA1 hippocampus of adult mice, and contributes to the development of epileptiform bursting activity in the TSC2(+/- CA3 region of the hippocampus. Inhibition of mGluR5 or Erk signaling restores appropriate mTOR-dependence to LTD, and significantly reduces epileptiform bursting in TSC2(+/- hippocampal slices. We also report that adult TSC2(+/- mice exhibit a subtle perseverative behavioral phenotype that is eliminated by mGluR5 antagonism. These findings highlight the potential of modulating the mGluR5-Erk pathway in a developmental stage-specific manner to treat TSC.
Gluing operation and form factors of local operators in N = 4 Super Yang-Mills theory
Bolshov, A. E.
2018-04-01
The gluing operation is an effective way to get form factors of both local and non-local operators starting from different representations of on-shell scattering amplitudes. In this paper it is shown how it works on the example of form factors of operators from stress-tensor operator supermultiplet in Grassmannian and spinor helicity representations.
DEFF Research Database (Denmark)
Pøhlsgaard, Jacob; Frydenvang, Karla Andrea; Madsen, Ulf
2011-01-01
Ionotropic glutamate receptors (iGluRs) constitute a family of ligand-gated ion channels that are essential for mediating fast synaptic transmission in the central nervous system. These receptors play an important role for the development and function of the nervous system, and are essential...... in learning and memory. However, iGluRs are also implicated in or have causal roles for several brain disorders, e.g. epilepsy, Alzheimer's disease, Parkinson's disease and schizophrenia. Their involvement in neurological diseases has stimulated widespread interest in their structure and function. Since...
The tetrapeptide Arg-Leu-Tyr-Glu inhibits VEGF-induced angiogenesis
International Nuclear Information System (INIS)
Baek, Yi-Yong; Lee, Dong-Keon; So, Ju-Hoon; Kim, Cheol-Hee; Jeoung, Dooil; Lee, Hansoo; Choe, Jongseon; Won, Moo-Ho; Ha, Kwon-Soo; Kwon, Young-Guen; Kim, Young-Myeong
2015-01-01
Kringle 5, derived from plasminogen, is highly capable of inhibiting angiogenesis. Here, we have designed and synthesized 10 tetrapeptides, based on the amino acid properties of the core tetrapeptide Lys-Leu-Tyr-Asp (KLYD) originating from anti-angiogenic kringle 5 of human plasminogen. Of these, Arg-Leu-Tyr-Glu (RLYE) effectively inhibited vascular endothelial growth factor (VEGF)-induced endothelial cell proliferation, migration and tube formation, with an IC 50 of 0.06–0.08 nM, which was about ten-fold lower than that of the control peptide KLYD (0.79 nM), as well as suppressed developmental angiogenesis in a zebrafish model. Furthermore, this peptide effectively inhibited the cellular events that precede angiogenesis, such as ERK and eNOS phosphorylation and nitric oxide production, in endothelial cells stimulated with VEGF. Collectively, these data demonstrate that RLYE is a potent anti-angiogenic peptide that targets the VEGF signaling pathway. - Highlights: • The tetrapeptide RLYE inhibited VEGF-induced angiogenesis in vitro. • RLYE also suppressed neovascularization in a zebrafish model. • Its effect was correlated with inhibition of VEGF-induced ERK and eNOS activation. • RLYE may be used as a therapeutic drug for angiogenesis-related diseases
The tetrapeptide Arg-Leu-Tyr-Glu inhibits VEGF-induced angiogenesis
Energy Technology Data Exchange (ETDEWEB)
Baek, Yi-Yong; Lee, Dong-Keon [Department of Molecular and Cellular Biochemistry, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of); So, Ju-Hoon; Kim, Cheol-Hee [Department of Biology, Chungnam National University, Daejeon, 305-764 (Korea, Republic of); Jeoung, Dooil [Department of Biochemistry, College of Natural Sciences, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of); Lee, Hansoo [Department of Life Sciences, College of Natural Sciences, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of); Choe, Jongseon [Department of Immunology, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of); Won, Moo-Ho [Department of Neurobiology, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of); Ha, Kwon-Soo [Department of Molecular and Cellular Biochemistry, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of); Kwon, Young-Guen [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul, 120-752 (Korea, Republic of); Kim, Young-Myeong, E-mail: ymkim@kangwon.ac.kr [Department of Molecular and Cellular Biochemistry, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do, 200-702 (Korea, Republic of)
2015-08-07
Kringle 5, derived from plasminogen, is highly capable of inhibiting angiogenesis. Here, we have designed and synthesized 10 tetrapeptides, based on the amino acid properties of the core tetrapeptide Lys-Leu-Tyr-Asp (KLYD) originating from anti-angiogenic kringle 5 of human plasminogen. Of these, Arg-Leu-Tyr-Glu (RLYE) effectively inhibited vascular endothelial growth factor (VEGF)-induced endothelial cell proliferation, migration and tube formation, with an IC{sub 50} of 0.06–0.08 nM, which was about ten-fold lower than that of the control peptide KLYD (0.79 nM), as well as suppressed developmental angiogenesis in a zebrafish model. Furthermore, this peptide effectively inhibited the cellular events that precede angiogenesis, such as ERK and eNOS phosphorylation and nitric oxide production, in endothelial cells stimulated with VEGF. Collectively, these data demonstrate that RLYE is a potent anti-angiogenic peptide that targets the VEGF signaling pathway. - Highlights: • The tetrapeptide RLYE inhibited VEGF-induced angiogenesis in vitro. • RLYE also suppressed neovascularization in a zebrafish model. • Its effect was correlated with inhibition of VEGF-induced ERK and eNOS activation. • RLYE may be used as a therapeutic drug for angiogenesis-related diseases.
Fouad Fanous; Jeremy May; Terry Wipf; Michael Ritter
2010-01-01
Over the past few years the United States Department of Agriculture (USDA), Forest Products Laboratory (FPL), and the Federal Highway Administration (FHWA) have supported several research programs. This paper is a result of a study sponsored by FPL, with the objective of determining how truckloads are distributed to the deck panels of a longitudinal glued-laminated...
Chapman, A G; Talebi, A; Yip, P K; Meldrum, B S
2001-07-20
The metabotropic Group III agonist, (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid (ACPT-1), selective for the mGlu(4alpha) receptor, suppresses sound-induced seizures in DBA/2 mice following its intracerebroventricular (i.c.v.) administration (ED(50) 5.6 [2.9-10.7], nmol i.c.v., 15 min, clonic phase) and in genetically epilepsy-prone (GEP) rats following focal administration into the inferior colliculus (ED(50) 0.08 [0.01-0.50], nmol, 60 min, clonic phase). ACPT-1 also protects against clonic seizures induced in DBA/2 mice by the Group I agonist, (RS)-3,5-dihydroxyphenylglycine (3,5-DHPG) (ED(50) 0.60 [0.29-1.2], nmol i.c.v.) and by the Group III antagonist, (RS)-alpha-methylserine-O-phosphate (MSOP) (ED(50) 49.3 [37.9-64.1], nmol i.c.v.). Another Group III agonist, (RS)-4-phosphonophenyl-glycine (PPG), preferentially activating the mGlu(8) receptor, previously shown to protect against sound-induced seizures in DBA/2 mice and GEP rats, also protects against seizures induced in DBA/2 by 3,5-DHPG (ED(50) 3.7 [2.4-5.7], nmol i.c.v.) and by the Group III antagonist, MSOP (ED(50) 40.2 [21.0-77.0], nmol i.c.v.). At very high doses (500 nmol i.c.v. and above), Group III antagonists have pro-convulsant and convulsant activity. The anticonvulsant protection against sound-induced seizures in DBA/2 mice provided by a fully protective dose (20 nmol, i.c.v.) of the mGlu(4) receptor agonist ACPT-1, is partially reversed by the co-administration of the Group III antagonists, MSOP, (RS)-alpha-methyl-4-phosphonophenylglycine (MPPG) or (S)-2-amino-2-methyl-4-phosphonobutanoic acid (MAP4), in the 20-50 nmol dose range. At doses of 50-200 nmol, MPPG and MAP4 cause further reversal of the ACPT-1 anticonvulsant protection, while the MSOP effect on ACPT-1 protection is abolished at higher doses. In contrast, the anticonvulsant protection against sound-induced seizures in DBA/2 mice provided by a fully protective dose (20 nmol, i.c.v.) of the mGlu(8) receptor agonist PPG, is not
International Nuclear Information System (INIS)
1992-12-01
This report describes preliminary probabilistic sensitivity analyses of long term gas and brine migration at the Waste Isolation Pilot Plant (WIPP). Because gas and brine are potential transport media for organic compounds and heavy metals, understanding two-phase flow in the repository and the surrounding Salado Formation is essential to evaluating long-term compliance with 40 CFR 268.6, which is the portion of the Land Disposal Restrictions of the Hazardous and Solid Waste Amendments to the Resource Conservation and Recovery Act that states the conditions for disposal of specified hazardous wastes. Calculations described here are designed to provide guidance to the WIPP Project by identifying important parameters and helping to recognize processes not yet modeled that may affect compliance. Based on these analyses, performance is sensitive to shaft-seal permeabilities, parameters affecting gas generation, and the conceptual model used for the disturbed rock zone surrounding the excavation. Brine migration is less likely to affect compliance with 40 CFR 268.6 than gas migration. However, results are preliminary, and additional iterations of uncertainty and sensitivity analyses will be required to provide the confidence needed for a defensible compliance evaluation. Specifically, subsequent analyses will explicitly include effects of salt creep and, when conceptual and computational models are available, pressure-dependent fracturing of anhydrite marker beds
Vanis-Vatrenjak, Selma; Mesic, Amira; Abdagic, Ines; Mujezinovic, Djenita; Zvizdic, Zlatan
2015-08-01
Knowledge of anatomic, physiological, biochemical and physical characteristics of children of all age groups, the existing illness and possible pathological response of the organism to the existing situation, require a pediatric anesthesiologist to participate in the preparation of a child for surgical treatment, to choose the best anesthesia technique and medications, and manipulative techniques to enable the scheduled surgical treatment with minimum anesthesia risks. The aim of this clinical study was to prove reliability and quality of propofol or sevoflurane general anesthesia in children in the age group of 1-14 years from the ASA I group and in the elective surgical treatments in duration of 60 minutes, based on preoperative and postoperative levels of laboratory findings (transaminases, blood sugar, urea and creatinine). the study included 160 patients randomized in two groups based on different approaches: total intravenous anesthesia was used for the propofol group (n=80) (TIVA) and the inhalation technique was used for the sevoflurane group (n=80). statistical evaluation of the obtained results indicates stability of laboratory findings in the immediate postoperative course (after 24 hours) in respect to the preoperative period. Based on the Mann Whitney test (P), preoperative and postoperative blood sugar levels in the sevoflurane vs. propofol group were P=0.152 vs. 0.021; creatinine levels P=0.113 vs. 0.325; urea levels P= 0.016 vs. 0.900; AST levels P=0,031 vs. 0,268 and ALT levels P=0.021 vs. 0.058. Level of significance was Psecurity and quality of general anesthesia in children age group 1-14 years, from the ASA I group. All analyzed laboratory levels in the postoperative course remained in their referential values in both groups of participants.
Glucosamine-Based Supramolecular Nanotubes for Human Mesenchymal Cell Therapy.
Talloj, Satish Kumar; Cheng, Bill; Weng, Jen-Po; Lin, Hsin-Chieh
2018-04-23
Herein, we demonstrate an example of glucosamine-based supramolecular hydrogels that can be used for human mesenchymal cell therapy. We designed and synthesized a series of amino acid derivatives based on a strategy of capping d-glucosamine moiety at the C-terminus and fluorinated benzyl group at the N-terminus. From a systematic study on chemical structures, we discovered that the glucosamine-based supramolecular hydrogel [pentafluorobenzyl (PFB)-F-Glu] self-assembled with one-dimensional nanotubular structures at physiological pH. The self-assembly of a newly discovered PFB-F-Glu motif is attributed to the synergistic effect of π-π stacking and extensive intermolecular hydrogen bonding network in aqueous medium. Notably, PFB-F-Glu nanotubes are proven to be nontoxic to human mesenchymal stem cells (hMSCs) and have been shown to enhance hMSC proliferation while maintaining their pluripotency. Retaining of pluripotency capabilities provides potentially unlimited source of undifferentiated cells for the treatment of future cell therapies. Furthermore, hMSCs cultured on PFB-F-Glu are able to secrete paracrine factors that downregulate profibrotic gene expression in lipopolysaccharide-treated human skin fibroblasts, which demonstrates that PFB-F-Glu nanotubes have the potential to be used for wound healing applications. Overall, this article addresses the importance of chemical design to generate supramolecular biomaterials for stem cell therapy.
Zhou, Jun; Luo, Yi; Zhang, Jie-Ting; Li, Ming-Xing; Wang, Can-Ming; Guan, Xin-Lei; Wu, Peng-Fei; Hu, Zhuang-Li; Jin, You; Ni, Lan; Wang, Fang; Chen, Jian-Guo
2015-11-01
Posttraumatic stress disorder (PTSD) is a mental disorder with enhanced retention of fear memory and has profound impact on quality of life for millions of people worldwide. The β-adrenoceptor antagonist propranolol has been used in preclinical and clinical studies for the treatment of PTSD, but the mechanisms underlying its potential efficacy on fear memory retention remain to be elucidated. We investigated the action of propranolol on the retention of conditioned fear memory, the surface expression of glutamate receptor GluA1 subunits of AMPA receptors and synaptic adaptation in the lateral amygdala (LA) of rats. Propranolol attenuated reactivation-induced strengthening of fear retention while reducing enhanced surface expression of GluA1 subunits and restoring the impaired long-term depression in LA. These effects of propranolol were mediated by antagonizing reactivation-induced enhancement of adrenergic signalling, which activates PKA and calcium/calmodulin-dependent protein kinase II and then regulates the trafficking of AMPA receptors via phosphorylation of GluA1 subunits at the C-terminus. Both i.p. injection and intra-amygdala infusion of propranolol attenuated reactivation-induced enhancement of fear retention. Reactivation strengthens fear retention by increasing the level of noradrenaline and promotes the surface expression of GluA1 subunits and the excitatory synaptic transmission in LA. These findings uncover one mechanism underlying the efficiency of propranolol on retention of fear memories and suggest that β-adrenoceptor antagonists, which act centrally, may be more suitable for the treatment of PTSD. © 2015 The British Pharmacological Society.
Directory of Open Access Journals (Sweden)
Amit A Negandhi
Full Text Available In this study, 27 genetic polymorphisms that were previously reported to be associated with clinical outcomes in colorectal cancer patients were investigated in relation to overall survival (OS and disease free survival (DFS in colorectal cancer patients from Newfoundland.The discovery and validation cohorts comprised of 532 and 252 patients, respectively. Genotypes of 27 polymorphisms were first obtained in the discovery cohort and survival analyses were performed assuming the co-dominant genetic model. Polymorphisms associated with disease outcomes in the discovery cohort were then investigated in the validation cohort.When adjusted for sex, age, tumor stage and microsatellite instability (MSI status, four polymorphisms were independent predictors of OS in the discovery cohort MTHFR Glu429Ala (HR: 1.72, 95%CI: 1.04-2.84, p = 0.036, ERCC5 His46His (HR: 1.78, 95%CI: 1.15-2.76, p = 0.01, SERPINE1 -675indelG (HR: 0.52, 95%CI: 0.32-0.84, p = 0.008, and the homozygous deletion of GSTM1 gene (HR: 1.4, 95%CI: 1.03-1.92, p = 0.033. In the validation cohort, the MTHFR Glu429Ala polymorphism was associated with shorter OS (HR: 1.71, 95%CI: 1.18-2.49, p = 0.005, although with a different genotype than the discovery cohort (CC genotype in the discovery cohort and AC genotype in the validation cohort. When stratified based on treatment with 5-Fluorouracil (5-FU-based regimens, this polymorphism was associated with reduced OS only in patients not treated with 5-FU. In the DFS analysis, when adjusted for other variables, the TT genotype of the ERCC5 His46His polymorphism was associated with shorter DFS in both cohorts (discovery cohort: HR: 1.54, 95%CI: 1.04-2.29, p = 0.032 and replication cohort: HR: 1.81, 95%CI: 1.11-2.94, p = 0.018.In this study, associations of the MTHFR Glu429Ala polymorphism with OS and the ERCC5 His46His polymorphism with DFS were identified in two colorectal cancer patient cohorts. Our results also suggest
Pattern-oriented Agent-based Monte Carlo simulation of Cellular Redox Environment
DEFF Research Database (Denmark)
Tang, Jiaowei; Holcombe, Mike; Boonen, Harrie C.M.
/CYSS) and mitochondrial redox couples. Evidence suggests that both intracellular and extracellular redox can affect overall cell redox state. How redox is communicated between extracellular and intracellular environments is still a matter of debate. Some researchers conclude based on experimental data...... cells. Biochimica Et Biophysica Acta-General Subjects, 2008. 1780(11): p. 1271-1290. 5. Jones, D.P., Redox sensing: orthogonal control in cell cycle and apoptosis signalling. J Intern Med, 2010. 268(5): p. 432-48. 6. Pogson, M., et al., Formal agent-based modelling of intracellular chemical interactions...
Florida creativity index scores, conservatism, and openness in 268 U.S. regions.
McCann, Stewart J H
2011-02-01
This study assessed whether Florida's Creativity Index (2002) scores for 268 U.S. regions were related to levels of conservatism and openness in the states in which the regions were situated. State conservatism was measured as the percentage voting for Bush in 2000. State openness z scores were taken from a survey of 619,397 residents (Rentfrow, Gosling, & Potter, 2008). Creativity scores correlated negatively with conservatism (r = -.22) and positively with openness (r = .23). Regression showed that the two predictors accounted jointly (7%) and separately for significant variance in the Creativity Index. The findings contribute evidence for the construct validity of Florida's composite Creativity Index and some, albeit moderate to weak, support of the Rentfrow, et al. conclusion that state-aggregated openness reflects the unconventionality, tolerance, and creativity of a state.
Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect
International Nuclear Information System (INIS)
Wang Hu; Wang Jizheng; Zheng Weiyue; Wang Xiaojian; Wang Shuxia; Song Lei; Zou Yubao; Yao Yan; Hui Rutai
2006-01-01
Dilated cardiomyopathy is a form of heart muscle disease characterized by impaired systolic function and ventricular dilation. The mutations in lamin A/C gene have been linked to dilated cardiomyopathy. We screened genetic mutations in a large Chinese family of 50 members including members with dilated cardiomyopathy and found a Glu82Lys substitution mutation in the rod domain of the lamin A/C protein in eight family members, three of them have been diagnosed as dilated cardiomyopathy, one presented with heart dilation. The pathogenic mechanism of lamin A/C gene defect is poorly understood. Glu82Lys mutated lamin A/C and wild type protein was transfected into HEK293 cells. The mutated protein was not properly localized at the inner nuclear membrane and the emerin protein, which interacts with lamin A/C, was also aberrantly distributed. The nuclear membrane structure was disrupted and heterochromatin was aggregated aberrantly in the nucleus of the HEK293 cells stably transfected with mutated lamin A/C gene as determined by transmission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Milicevic Sephton, Selena; Mueller Herde, Adrienne; Keller, Claudia; Ruedisuehli, Sonja; Schibli, Roger; Kraemer, Stefanie D.; Ametamey, Simon M. [Center for Radiopharmaceutical Sciences of ETH, PSI and USZ, Zurich (Switzerland); Mu, Linjing [University Hospital Zuerich, Department of Nuclear Medicine, Zuerich (Switzerland); Auberson, Yves [Novartis Institutes for Biomedical Research, Novartis Pharma AG, Basel (Switzerland)
2015-01-15
A novel, {sup 18}F-labelled metabotropic glutamate receptor subtype 5 (mGlu{sub 5}) derivative of [{sup 11}C]ABP688 ([{sup 11}C]1), [{sup 18}F]PSS232 ([{sup 18}F]5), was evaluated in vitro and in vivo for its potential as a PET agent and was used in test-retest reliability studies The radiosynthesis of [{sup 18}F]5 was accomplished via a one-step reaction using a mesylate precursor. In vitro stability was determined in PBS and plasma, and with liver microsomal enzymes. Metabolite studies were performed using rat brain extracts, blood and urine. In vitro autoradiography was performed on horizontal slices of rat brain using 1 and 8, antagonists for mGlu{sub 5} and mGlu{sub 1}, respectively. Small-animal PET, biodistribution, and test-retest studies were performed in Wistar rats. In vivo, dose-dependent displacement studies were performed using 6 and blocking studies with 7. [{sup 18}F]5 was obtained in decay-corrected maximal radiochemical yield of 37 % with a specific activity of 80 - 400 GBq/μmol. Treatment with rat and human microsomal enzymes in vitro for 60 min resulted in 20 % and 4 % of hydrophilic radiometabolites, respectively. No hydrophilic decomposition products or radiometabolites were found in PBS or plasma. In vitro autoradiography on rat brain slices showed a heterogeneous distribution consistent with the known distribution of mGlu{sub 5} with high binding to hippocampal and cortical regions, and negligible radioactivity in the cerebellum. Similar distribution of radioactivity was found in PET images. Under displacement conditions with 6, reduced [{sup 18}F]5 binding was found in all brain regions except the cerebellum. 7 reduced binding in the striatum by 84 % on average. Test-retest studies were reproducible with a variability ranging from 6.8 % to 8.2 %. An extended single-dose toxicity study in Wistar rats showed no compound-related adverse effects. The new mGlu{sub 5} radiotracer, [{sup 18}F]5, showed specific and selective in vitro and in vivo
Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition
Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro
2017-01-01
Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases ?-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 (GluR2) expression in cortical neurons and enhances neuronal vulnerability ...
Cleva, Richard M.; Hicks, Megan P.; Gass, Justin T.; Wischerath, Kelly C.; Plasters, Elizabeth T.; Widholm, John J.; Olive, M. Foster
2011-01-01
Extinction of classically and instrumentally conditioned behaviors, such as conditioned fear and drug-seeking behavior, is a process of active learning, and recent studies indicate that potentiation of glutamatergic transmission facilitates extinction learning. In this study we investigated the effects of the type 5 metabotropic glutamate receptors (mGluR5) positive allosteric modulator 3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB) on the extinction of cocaine-seeking behavior in ...
Hoffman, Ann N; Parga, Alejandro; Paode, Pooja R; Watterson, Lucas R; Nikulina, Ella M; Hammer, Ronald P; Conrad, Cheryl D
2015-04-01
The chronically stressed brain may present a vulnerability to develop maladaptive fear-related behaviors in response to a traumatic event. In rodents, chronic stress leads to amygdala hyperresponsivity and dendritic hypertrophy and produces a post traumatic stress disorder (PTSD)-like phenotype that includes exaggerated fear learning following Pavlovian fear conditioning and resistance to extinction. It is unknown whether chronic stress-induced enhanced fear memories are vulnerable to disruption via reconsolidation blockade, as a novel therapeutic approach for attenuating exaggerated fear memories. We used a chronic stress procedure in a rat model (wire mesh restraint for 6h/d/21d) to create a vulnerable brain that leads to a PTSD-like phenotype. We then examined freezing behavior during acquisition, reactivation and after post-reactivation rapamycin administration (i.p., 40mg/kg) in a Pavlovian fear conditioning paradigm to determine its effects on reconsolidation as well as the subsequent functional activation of limbic structures using zif268 mRNA. Chronic stress increased amygdala zif268 mRNA during fear memory retrieval at reactivation. Moreover, these enhanced fear memories were unaffected by post reactivation rapamycin to disrupt long-term fear memory. Also, post-reactivation long term memory processing was also associated with increased amygdala (LA and BA), and decreased hippocampal CA1 zif268 mRNA expression. These results suggest potential challenges for reconsolidation blockade as an effective approach in treating exaggerated fear memories, as in PTSD. Our findings also support chronic stress manipulations combined with fear conditioning as a useful preclinical approach to study a PTSD-like phenotype. Copyright © 2015 Elsevier Inc. All rights reserved.
Sikandar, Shafaq; Gustavsson, Ynette; Marino, Marc J; Dickenson, Anthony H; Yaksh, Tony L; Sorkin, Linda S; Ramachandran, Roshni
2016-07-01
Increasing evidence suggests that botulinum neurotoxins (BoNTs) delivered into the skin and muscle in certain human and animal pain states may exert antinociceptive efficacy though their uptake and transport to central afferent terminals. Cleavage of soluble N-methylaleimide-sensitive attachment protein receptor by BoNTs can impede vesicular mediated neurotransmitter release as well as transport/insertion of channel/receptor subunits into plasma membranes, an effect that can reduce activity-evoked facilitation. Here, we explored the effects of intraplantar botulinum toxin- B (BoNT-B) on peripheral inflammation and spinal nociceptive processing in an inflammatory model of pain. C57BL/6 mice (male) received unilateral intraplantar BoNT (1 U, 30 μL) or saline prior to intraplantar carrageenan (20 μL, 2%) or intrathecal N-methyl-D-aspartate (NMDA), substance P or saline (5 μL). Intraplantar carrageenan resulted in edema and mechanical allodynia in the injected paw and increased phosphorylation of a glutamate subunit (pGluA1ser845) and a serine/threonine-specific protein kinase (pAktser473) in spinal dorsal horn along with an increased incidence of spinal c-Fos positive cells. Pre-treatment with intraplantar BoNT-B reduced carrageenan evoked: (i) allodynia, but not edema; (ii) pGluA1 and pAkt and (iii) c-Fos expression. Further, intrathecal NMDA and substance P each increased dorsal horn levels of pGluA1 and pAkt. Intraplantar BoNT-B inhibited NMDA, but not substance P evoked phosphorylation of GluA1 and Akt. These results suggest that intraplantar toxin is transported centrally to block spinal activation and prevent phosphorylation of a glutamate receptor subunit and a kinase, which otherwise contribute to facilitated states. © 2016 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Espejo, Pablo Javier; Ortiz, Vanesa; Martijena, Irene Delia; Molina, Victor Alejandro
2016-10-01
Consolidated memories can enter into a labile state after reactivation followed by a restabilization process defined as reconsolidation. This process can be interfered with Midazolam (MDZ), a positive allosteric modulator of the GABA-A receptor. The present study has evaluated the influence of prior stress on MDZ's interfering effect. We also assessed the influence of both systemic and intra-basolateral amygdala (BLA) infusion of d-cycloserine (DCS), a partial agonist of the NMDA receptors, on the MDZ effect in previously stressed rats. Furthermore, we analyzed the effect of stress on the expression of Zif-268 and the GluN2B sites, two molecular markers of the labilization/reconsolidation process, following reactivation. The results revealed that prior stress resulted into a memory trace that was insensitive to the MDZ impairing effect. Both systemic and intra-BLA DCS administration previous to reactivation restored MDZ's disruptive effect on memory reconsolidation in stressed animals. Further, reactivation enhanced Zif-268 expression in the BLA in control unstressed rats, whereas no elevation was observed in stressed animals. In agreement with the behavioral findings, DCS restored the increased level of Zif-268 expression in the BLA in stressed animals. Moreover, memory reactivation in unstressed animals elevated GluN2B expression in the BLA, thus suggesting that this effect is involved in memory destabilization, whereas stressed animals did not reveal any changes. These findings are consistent with resistance to the MDZ effect in these rats, indicating that stress exposure prevents the onset of destabilization following reactivation. In summary, prior stress limited both the occurrence of the reactivation-induced destabilization and restabilization. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hobbs, D A; George, T W; Lovegrove, J A
2014-12-01
Our objective was to investigate whether the presence of Glu298Asp polymorphism in the endothelial NO synthase (eNOS) gene differentially affects the postprandial blood pressure response to dietary nitrate-rich beetroot bread. A randomised, single-blind, controlled, crossover acute pilot study was performed in 14 healthy men (mean age: 34±9 years) who were retrospectively genotyped for Glu298Asp polymorphism (7GG; T carriers 7). Volunteers were randomised to receive 200 g beetroot-enriched bread (1.1 mmol nitrate) or control bread (no beetroot; 0.01 mmol nitrate) on two separate occasions 10 days apart. Baseline and incremental area under the curve of blood pressure and NOx (nitrate/nitrite) were measured for a 6-h postprandial period. A treatment × genotype interaction was observed for diastolic blood pressure (Pconsumption of beetroot bread compared with control bread. No significant differences were observed in the GG group. The beneficial diastolic blood pressure reduction was observed only in the T carriers of the Glu298Asp polymorphism in the eNOS gene after consumption of nitrate-rich beetroot bread. These data require confirmation in a larger population group.
Fatemi, S Hossein; Folsom, Timothy D
2015-09-01
Gamma-aminobutyric acid (GABA) is the main inhibitory neurotransmitter in the brain. GABAergic receptor abnormalities have been documented in several major psychiatric disorders including schizophrenia, mood disorders, and autism. Abnormal expression of mRNA and protein for multiple GABA receptors has also been observed in multiple brain regions leading to alterations in the balance between excitatory/inhibitory signaling in the brain with potential profound consequences for normal cognition and maintenance of mood and perception. Altered expression of GABAA receptor subunits has been documented in fragile X mental retardation 1 (FMR1) knockout mice, suggesting that loss of its protein product, fragile X mental retardation protein (FMRP), impacts GABAA subunit expression. Recent postmortem studies from our laboratory have shown reduced expression of FMRP in the brains of subjects with schizophrenia, bipolar disorder, major depression, and autism. FMRP acts as a translational repressor and, under normal conditions, inhibits metabotropic glutamate receptor 5 (mGluR5)-mediated signaling. In fragile X syndrome (FXS), the absence of FMRP is hypothesized to lead to unregulated mGluR5 signaling, ultimately resulting in the behavioral and intellectual impairments associated with this disorder. Our laboratory has identified changes in mGluR5 expression in autism, schizophrenia, and mood disorders. In the current review article, we discuss our postmortem data on GABA receptors, FMRP, and mGluR5 levels and compare our results with other laboratories. Finally, we discuss the interactions between these molecules and the potential for new therapeutic interventions that target these interconnected signaling systems. Copyright © 2014 Elsevier B.V. All rights reserved.
Eisenberg, Azaria Solomon; Juszczak, Laura J
2013-07-05
Molecular dynamics (MD), coupled with fluorescence data for charged dipeptides of tryptophanyl glutamic acid (Trp-Glu), reveal a detailed picture of how specific conformation affects fluorescence. Fluorescence emission spectra and time-resolved emission measurements have been collected for all four charged species. MD simulations 20 to 30 ns in length have also been carried out for the Trp-Glu species, as simulation provides aqueous phase conformational data that can be correlated with the fluorescence data. The calculations show that each dipeptide species is characterized by a similar set of six, discrete Chi 1, Chi 2 dihedral angle pairs. The preferred Chi 1 angles--60°, 180°, and 300°--play the significant role in positioning the terminal amine relative to the indole ring. A Chi 1 angle of 60° results in the arching of the backbone over the indole ring and no interaction of the ring with the terminal amine. Chi 1 values of 180° and 300° result in an extension of the backbone away from the indole ring and a NH3 cation-π interaction with indole. This interaction is believed responsible for charge transfer quenching. Two fluorescence lifetimes and their corresponding amplitudes correlate with the Chi 1 angle probability distribution for all four charged Trp-Glu dipeptides. Fluorescence emission band maxima are also consistent with the proposed pattern of terminal amine cation quenching of fluorescence. Copyright © 2013 Wiley Periodicals, Inc.
O'Brien, J.T.; Prell, J.S.; Berden, G.; Oomens, J.; Williams, E.R.
2010-01-01
Interactions of halide anions (Cl-, Br-, and I-) with glutamic acid (Glu), histidine (His), and arginine (Arg) and their effects on stabilizing the zwitterionic form of these amino acids were investigated using infrared multiple photon dissociation (IRMPD) spectroscopy between 850 and 1900 cm(-1)
DEFF Research Database (Denmark)
Brehm, Lotte; Greenwood, Jeremy R; Hansen, Kasper B
2003-01-01
)propionic acid (AMPA) but inactive at NMDA receptors. However, 4-AHCP was found to be much weaker than AMPA as an inhibitor of [(3)H]AMPA binding and to have limited effect in a [(3)H]kainic acid binding assay using rat cortical membranes. To shed light on the mechanism(s) underlying this quite enigmatic......, activated cloned AMPA receptor subunits GluR1o, GluR3o, and GluR4o with EC(50) values in the range 4.5-15 microM and the coexpressed kainate-preferring subunits GluR6 + KA2 (EC(50) = 6.4 microM). Compound 6, but not 7, proved to be a very potent agonist (EC(50) = 0.13 microM) at the kainate-preferring GluR5...... subunit, equipotent with (S)-2-amino-3-(5-tert-butyl-3-hydroxyisothiazol-4-yl)propionic acid [(S)-Thio-ATPA, 4] and almost 4 times more potent than (S)-2-amino-3-(5-tert-butyl-3-hydroxyisoxazol-4-yl)propionic acid [(S)-ATPA, 3]. Compound 6 thus represents a new structural class of GluR5 agonists...
Directory of Open Access Journals (Sweden)
LaQuia A. Vinson
2016-08-01
Full Text Available The purpose of this study was to determine if differences in behavior exist following dental treatment under hospital-based general anesthesia (HBGA or office-based general anesthesia (OBGA in the percentage of patients exhibiting positive behavior and in the mean Frankl scores at recall visits. This retrospective study examined records of a pediatric dental office over a 4 year period. Patients presenting before 48 months of age for an initial exam who were diagnosed with early childhood caries were included in the study. Following an initial exam, patients were treated under HBGA or OBGA. Patients were followed to determine their behavior at 6-, 12- and 18-month recall appointments. Fifty-four patients received treatment under HBGA and 26 were treated under OBGA. OBGA patients were significantly more likely to exhibit positive behavior at the 6- and 12-month recall visits p = 0.038 & p = 0.029. Clinicians should consider future behavior when determining general anesthesia treatment modalities in children with early childhood caries presenting to their office.
Energy Technology Data Exchange (ETDEWEB)
NONE
1970-11-13
By Resolution GC(XIV)/RES/268 the General Conference requested the Board of Governors to arrange for the preparation of a supplement to the Board's annual report to the General Conference for 1969-70 which, together with that report, constitutes the Agency's report to the General Assembly of the United Nations for that year. The present document contains the supplement, which deals briefly with some developments in the Agency's work during the period 1 July to 1 October 1970.
International Nuclear Information System (INIS)
1970-01-01
By Resolution GC(XIV)/RES/268 the General Conference requested the Board of Governors to arrange for the preparation of a supplement to the Board's annual report to the General Conference for 1969-70 which, together with that report, constitutes the Agency's report to the General Assembly of the United Nations for that year. The present document contains the supplement, which deals briefly with some developments in the Agency's work during the period 1 July to 1 October 1970.
Cook, J L; Khan, K M; Kiss, Z S; Griffiths, L
2000-08-01
Anterior knee pain is a common presenting complaint amongst adolescent athletes. We hypothesised that patellar tendinopathy may occur at a younger age than is generally recognised. Thus, we studied the patellar tendons in 134 elite 14- to 18-year-old female (n=64) and male (n=70) basketball players and 29 control swimmers (17 female, 12 male) clinically and with ultrasonography. We found that of 268 tendons, 19 (7%) had current patellar tendinopathy on clinical grounds (11% in males, 2% in females). Twenty-six percent of the basketball players' patellar tendons contained an ultrasonographic hypoechoic region. Ultrasonographic abnormality was more prevalent in the oldest tertile of players (17-18 years) than the youngest tertile (14-15.9 years). Of tendons categorised clinically as 'Never patellar tendinopathy', 22% had an ultrasonographic hypoechoic region nevertheless. This study indicates that patellar tendinopathy can occur in 14- to 18-year-old basketball players. Ultrasonographic tendon abnormality is 3 times as common as clinical symptoms.
International Nuclear Information System (INIS)
Manalo, Allan; Aravinthan, Thiru
2012-01-01
Highlights: ► Fibre Model Analysis is used to examine the flexural behaviour of sandwich beams. ► Theoretical prediction using FMA is in good agreement with the experiment. ► Using the constituent materials in FMA predicted accurately the beam’s behaviour. ► FMA can be used for analysing sandwich beams with high-strength core in flexure. -- Abstract: The behaviour of glued composite sandwich beams in flexure was investigated with a view of using this material for structural and civil engineering applications. The building block of this glue-laminated beam is a new generation composite sandwich structure made up of glass fibre reinforced polymer skins and a high strength phenolic core material. A simplified Fibre Model Analysis (FMA) usually used to analyse a concrete beam section is adopted to theoretically describe the flexural behaviour of the innovative sandwich beam structure. The analysis included the flexural behaviour of the glued sandwich beams in the flatwise and the edgewise positions. The FMA accounted for the non-linear behaviour of the phenolic core in compression, the cracking of the core in tension and the linear elastic behaviour of the fibre composite skin. The results of the FMA showed a good agreement with the experimental data showing the efficiency and practical applications of the simplified FMA in analysing and designing sandwich structures with high strength core material.
Huerta-Viga, Adriana; Amirjalayer, Saeed; Domingos, Sérgio R; Meuzelaar, Heleen; Rupenyan, Alisa; Woutersen, Sander
2015-06-07
Salt bridges play an important role in protein folding and in supramolecular chemistry, but they are difficult to detect and characterize in solution. Here, we investigate salt bridges between glutamate (Glu(-)) and arginine (Arg(+)) using two-dimensional infrared (2D-IR) spectroscopy. The 2D-IR spectrum of a salt-bridged dimer shows cross peaks between the vibrational modes of Glu(-) and Arg(+), which provide a sensitive structural probe of Glu(-)⋯Arg(+) salt bridges. We use this probe to investigate a β-turn locked by a salt bridge, an α-helical peptide whose structure is stabilized by salt bridges, and a coiled coil that is stabilized by intra- and intermolecular salt bridges. We detect a bidentate salt bridge in the β-turn, a monodentate one in the α-helical peptide, and both salt-bridge geometries in the coiled coil. To our knowledge, this is the first time 2D-IR has been used to probe tertiary side chain interactions in peptides, and our results show that 2D-IR spectroscopy is a powerful method for investigating salt bridges in solution.
Directory of Open Access Journals (Sweden)
Neugebauer Volker
2010-12-01
Full Text Available Abstract Neuroplasticity in the central nucleus of the amygdala (CeA, particularly its latero-capsular division (CeLC, is an important contributor to the emotional-affective aspects of pain. Previous studies showed synaptic plasticity of excitatory transmission to the CeLC in different pain models, but pain-related changes of inhibitory transmission remain to be determined. The CeLC receives convergent excitatory inputs from the parabrachial nucleus in the brainstem and from the basolateral amygdala (BLA. In addition, feedforward inhibition of CeA neurons is driven by glutamatergic projections from the BLA area to a cluster of GABAergic neurons in the intercalated cell masses (ITC. Using patch-clamp in rat brain slices we measured monosynaptic excitatory postsynaptic currents (EPSCs and polysynaptic inhibitory currents (IPSCs that were evoked by electrical stimulation in the BLA. In brain slices from arthritic rats, input-output functions of excitatory synaptic transmission were enhanced whereas inhibitory synaptic transmission was decreased compared to control slices from normal untreated rats. A non-NMDA receptor antagonist (NBQX blocked the EPSCs and reduced the IPSCs, suggesting that non-NMDA receptors mediate excitatory transmission and also contribute to glutamate-driven feed-forward inhibition of CeLC neurons. IPSCs were blocked by a GABAA receptor antagonist (bicuculline. Bicuculline increased EPSCs under normal conditions but not in slices from arthritic rats, which indicates a loss of GABAergic control of excitatory transmission. A metabotropic glutamate receptor subtype 1 (mGluR1 antagonist (LY367385 reversed both the increase of excitatory transmission and the decrease of inhibitory transmission in the arthritis pain model but had no effect on basal synaptic transmission in control slices from normal rats. The inhibitory effect of LY367385 on excitatory transmission was blocked by bicuculline suggesting the involvement of a GABAergic
Roles of Asp179 and Glu270 in ADP-Ribosylation of Actin by Clostridium perfringens Iota Toxin.
Directory of Open Access Journals (Sweden)
Alexander Belyy
Full Text Available Clostridium perfringens iota toxin is a binary toxin composed of the enzymatically active component Ia and receptor binding component Ib. Ia is an ADP-ribosyltransferase, which modifies Arg177 of actin. The previously determined crystal structure of the actin-Ia complex suggested involvement of Asp179 of actin in the ADP-ribosylation reaction. To gain more insights into the structural requirements of actin to serve as a substrate for toxin-catalyzed ADP-ribosylation, we engineered Saccharomyces cerevisiae strains, in which wild type actin was replaced by actin variants with substitutions in residues located on the Ia-actin interface. Expression of the actin mutant Arg177Lys resulted in complete resistance towards Ia. Actin mutation of Asp179 did not change Ia-induced ADP-ribosylation and growth inhibition of S. cerevisiae. By contrast, substitution of Glu270 of actin inhibited the toxic action of Ia and the ADP-ribosylation of actin. In vitro transcribed/translated human β-actin confirmed the crucial role of Glu270 in ADP-ribosylation of actin by Ia.
Observations of interstellar ultraviolet extinction from the S2/68 experiment in the TD-1 satellite
International Nuclear Information System (INIS)
Nandy, K.; Thompson, G.I.; Carnochan, D.J.; Wilson, R.
1978-01-01
The galactic distribution of the agents which cause the extinction bump near 2200 A and the ultraviolet colour excess E(1550-2740) within 2 kpc of the Sun in the galactic plane have been studied from the observations obtained with the S2/68 experiment in the TD-1 satellite. The mean reddening-distance relation in the galactic plane has been obtained for different longitudes. The study of the extinction parameter with galactic latitude shows a strong concentration of the dust towards the galactic plane with a scale height of 110 pc. (author)
Nakaya, Yuka; Tsuboi, Yoshiyuki; Okada-Ogawa, Akiko; Shinoda, Masamichi; Kubo, Asako; Chen, Jui Yen; Noma, Noboru; Batbold, Dulguun; Imamura, Yoshiki; Sessle, Barry J; Iwata, Koichi
2016-01-01
Dry mouth is known to cause severe pain in the intraoral structures, and many dry mouth patients have been suffering from intraoral pain. In development of an appropriate treatment, it is crucial to study the mechanisms underlying intraoral pain associated with dry mouth, yet the detailed mechanisms are not fully understood. To evaluate the mechanisms underlying pain related to dry mouth, the dry-tongue rat model was developed. Hence, the mechanical or heat nocifensive reflex, the phosphorylated extracellular signal-regulated kinase and phosphorylated GluR1-IR immunohistochemistries, and the single neuronal activity were examined in the trigeminal spinal subnucleus caudalis of dry-tongue rats. The head-withdrawal reflex threshold to mechanical, but not heat, stimulation of the tongue was significantly decreased on day 7 after tongue drying. The mechanical, but not heat, responses of trigeminal spinal subnucleus caudalis nociceptive neurons were significantly enhanced in dry-tongue rats compared to sham rats on day 7. The number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells was also significantly increased in the trigeminal spinal subnucleus caudalis following noxious stimulation of the tongue in dry-tongue rats compared to sham rats on day 7. The decrement of the mechanical head-withdrawal reflex threshold (HWT) was reversed during intracisternal administration of the mitogen-activated protein kinase kinase 1 inhibitor, PD98059. The trigeminal spinal subnucleus caudalis neuronal activities and the number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells following noxious mechanical stimulation of dried tongue were also significantly decreased following intracisternal administration of PD98059 compared to vehicle-administrated rats. Increased number of the phosphorylated GluR1-IR cells was observed in the trigeminal spinal subnucleus caudalis of dry-tongue rats, and the number of phosphorylated GluR1-IR cells
Comparison of taurine, GABA, Glu, and Asp as scavengers of malondialdehyde in vitro and in vivo
Deng, Yan; Wang, Wei; Yu, Pingfeng; Xi, Zhijiang; Xu, Lijian; Li, Xiaolong; He, Nongyue
2013-04-01
The purpose of this study is to determine if amino acid neurotransmitters such as gamma-aminobutyric acid (GABA), taurine, glutamate (Glu), and aspartate (Asp) can scavenge activated carbonyl toxicants. In vitro, direct reaction between malondialdehyde (MDA) and amino acids was researched using different analytical methods. The results indicated that scavenging activated carbonyl function of taurine and GABA is very strong and that of Glu and Asp is very weak in pathophysiological situations. The results provided perspective into the reaction mechanism of taurine and GABA as targets of activated carbonyl such as MDA in protecting nerve terminals. In vivo, we studied the effect of taurine and GABA as antioxidants by detecting MDA concentration and superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities. It was shown that MDA concentration was decreased significantly, and the activities of SOD and GSH-Px were increased significantly in the cerebral cortex and hippocampus of acute epileptic state rats, after the administration of taurine and GABA. The results indicated that the peripherally administered taurine and GABA can scavenge free radicals and protect the tissue against activated carbonyl in vivo and in vitro.
McIlhinney, R A; Molnár, E
1996-04-01
To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.
Carreira, Junko Matsuzaki
2011-01-01
This study investigated children's motivation for learning English as a foreign language (EFL) and intrinsic motivation for learning in general. The participants were 268 third-sixth graders in a public school in Japan. Data were collected using two questionnaires, one measuring motivation for learning EFL and the other investigating intrinsic…
Reed, Carson W; McGowan, Kevin M; Spearing, Paul K; Stansley, Branden J; Roenfanz, Hanna F; Engers, Darren W; Rodriguez, Alice L; Engelberg, Eileen M; Luscombe, Vincent B; Loch, Matthew T; Remke, Daniel H; Rook, Jerri M; Blobaum, Anna L; Conn, P Jeffrey; Niswender, Colleen M; Lindsley, Craig W
2017-12-14
Herein, we report the structure-activity relationships within a series of mGlu 7 NAMs based on an N -(2-(1 H -1,2,4-triazol-1-yl)-5-(trifluoromethoxy)phenyl)benzamide core with excellent CNS penetration ( K p 1.9-5.8 and K p,uu 0.4-1.4). Analogues in this series displayed steep SAR. Of these, VU6010608 ( 11a ) emerged with robust efficacy in blocking high frequency stimulated long-term potentiation in electrophysiology studies.
In vitro and in vivo evaluation of [11C]MPEPy as a potential PET ligand for mGlu5 receptors
International Nuclear Information System (INIS)
Severance, Alin J.; Parsey, Ramin V.; Kumar, J.S. Dileep; Underwood, Mark D.; Arango, Victoria; Majo, Vattoly J.; Prabhakaran, Jaya; Simpson, Norman R.; Heertum, Ronald L. van; Mann, J. John
2006-01-01
Excessive activation via the metabotropic glutamate receptor subtype 5 (mGluR 5 ) has been implicated in depression, neuropathic pain and other psychiatric, neurological and neurodegenerative diseases. A mGluR 5 radioligand for in vivo quantification by positron emission tomography (PET) would facilitate studies of the role of this receptor in disease and treatment. 3-Methoxy-5-pyridin-2-ylethynylpyridine (MPEPy), a selective and high-affinity antagonist at the mGluR 5 receptor was selected as a candidate ligand; a recent publication by Yu et al. [Nucl Med Biol 32 (2005) 631-640] presented initial micro-PET results for [ 11 C]MPEPy with enthusiasm. Building on their efforts, we report as unique contributions (1) an improved chemical synthesis method, (2) the first data using human tissue, (3) phosphor images for rat brain preparations, (4) a novel comparison of anesthetic agents and (5) in vivo data in baboon. In vitro phosphor imaging studies of this ligand using human and rat brain tissue demonstrated high specific binding in the hippocampus, striatum and cortex with minimal specific binding in the cerebellum. In contrast, in vivo micro-PET studies in rats using urethane anesthesia, PET studies in baboons using isoflurane anesthesia and ex vivo micro-PET studies in unanesthetized rats each showed little specific binding in the brain. Despite the promising in vitro results, the low signal-to-noise ratio found in vivo does not justify the use of [ 11 C]MPEPy as a PET radiotracer in humans
Tabanor, Kayann; Lee, Phil; Kiptoo, Paul; Choi, In-Young; Sherry, Erica B.; Eagle, Cheyenne Sun; Williams, Todd D.; Siahaan, Teruna J.
2015-01-01
Successful treatment and diagnosis of neurological diseases depend on reliable delivery of molecules across the blood-brain barrier (BBB), which restricts penetration of pharmaceutical drugs and diagnostic agents into the brain. Thus, developing new non-invasive strategies to improve drug delivery across the BBB is critically needed. This study was aimed at evaluating the activity of HAV6 peptide (Ac-SHAVSS-NH2) in improving brain delivery of camptothecin-glutamate (CPT-Glu) conjugate and gadolinium-diethylenetriaminepentaacetate (Gd-DTPA) contrast agent in Sprague-Dawley rats. Brain delivery of both CPT-Glu and Gd-DTPA was evaluated in an in situ rat brain perfusion model in the presence and absence of HAV6 peptide (1.0 mM). Gd-DTPA (0.6 mmol/kg) was intravenously (i.v.) administered with and without HAV6 peptide (0.019 mmol/kg) in rats. The detection and quantification of CPT-Glu and Gd-DTPA in the brain were carried out by LC-MS/MS and quantitative magnetic resonance imaging (MRI), respectively. Rats perfused with CPT-Glu in combination with HAV6 had significantly higher deposition of drug in the brain compared to CPT-Glu alone. MRI results also showed that administration of Gd-DTPA in the presence of HAV6 peptide led to significant accumulation of Gd-DTPA in various regions of the brain in both the in situ rat brain perfusion and in vivo studies. All observations taken together indicate that HAV6 peptide can disrupt the BBB and enhance delivery of small molecules into the brain. PMID:26705088
Tabanor, Kayann; Lee, Phil; Kiptoo, Paul; Choi, In-Young; Sherry, Erica B; Eagle, Cheyenne Sun; Williams, Todd D; Siahaan, Teruna J
2016-02-01
Successful treatment and diagnosis of neurological diseases depend on reliable delivery of molecules across the blood-brain barrier (BBB), which restricts penetration of pharmaceutical drugs and diagnostic agents into the brain. Thus, developing new noninvasive strategies to improve drug delivery across the BBB is critically needed. This study was aimed at evaluating the activity of HAV6 peptide (Ac-SHAVSS-NH2) in improving brain delivery of camptothecin-glutamate (CPT-Glu) conjugate and gadolinium-diethylenetriaminepentaacetate (Gd-DTPA) contrast agent in Sprague-Dawley rats. Brain delivery of both CPT-Glu and Gd-DTPA was evaluated in an in situ rat brain perfusion model in the presence and absence of HAV6 peptide (1.0 mM). Gd-DTPA (0.6 mmol/kg) was intravenously (iv) administered with and without HAV6 peptide (0.019 mmol/kg) in rats. The detection and quantification of CPT-Glu and Gd-DTPA in the brain were carried out by LC-MS/MS and quantitative magnetic resonance imaging (MRI), respectively. Rats perfused with CPT-Glu in combination with HAV6 had significantly higher deposition of drug in the brain compared to CPT-Glu alone. MRI results also showed that administration of Gd-DTPA in the presence of HAV6 peptide led to significant accumulation of Gd-DTPA in various regions of the brain in both the in situ rat brain perfusion and in vivo studies. All observations taken together indicate that HAV6 peptide can disrupt the BBB and enhance delivery of small molecules into the brain.
DEFF Research Database (Denmark)
Andersson, Therese; Duckworth, Joshua K; Fritz, Nicolas
2011-01-01
levels, that in turn exerted a concentration-dependent inhibition of BMP4-mediated mesenchymal differentiation of NSCs. Instead, BMP4 exposure of NSCs induced neuronal differentiation in mesenchyme-preventing conditions, whereas treatment with recombinant noggin alone did not. Wnt signaling is known...... to be essential for the development of neurons derived from the dorsal telencephalon, and co-stimulation of NSCs with BMP4+Wnt3a resulted in a synergistic effect yielding significantly increased number of mature neurons compared to stimulation with each factor alone. Thus whereas only a subset of BMP4-induced...... neurons derived from telencephalic NSCs, responded to glutamate receptor (GluR) agonists, over 80% of BMP4+Wnt3a-induced neurons responded appropriately to GluR-agonists. Our results increase the understanding of the role for BMP4 in differentiation of telencephalic multipotent progenitors, and reveal...
DEFF Research Database (Denmark)
Bjerrum, Lars; Gahrn-Hansen, Bente; Grinsted, Per
2009-01-01
Objective. To investigate whether short-term treatment with pivmecillinam was more effective than sulfamethizole in patients with acute uncomplicated urinary tract infection (UTI). Design. Randomized controlled trial. Setting. General practice, Denmark. Subjects. Patients (n =167) with uncomplica......Objective. To investigate whether short-term treatment with pivmecillinam was more effective than sulfamethizole in patients with acute uncomplicated urinary tract infection (UTI). Design. Randomized controlled trial. Setting. General practice, Denmark. Subjects. Patients (n =167......) with uncomplicated UTI confirmed by positive urine phase-contrast microscopy. Main outcome measures. Drug efficacy based on clinical and bacteriological cure. Results. Urinary symptoms disappeared first in patients treated with pivmecillinam, but after five days there was no significant difference in clinical cure...... in 68.8% of patients randomized to pivmecillinam and in 77.9% randomized to sulfamethizole (difference -9.2%, CI -24.7%; 6.3%). Some 26.8% of patients randomized to pivmecillinam experienced a new UTI within 6 months after treatment compared with 18.4% of patients randomized to sulfamethizole...
Radiosynthesis of [18F]FEt-Tyr-urea-Glu ([18F]FEtTUG) as a new PSMA ligand
International Nuclear Information System (INIS)
Al-Momani, E.; Malik, N.; Machulla, H.J.; Reske, S.N.; Solbach, C.
2013-01-01
An efficient radiosynthesis of [ 18 F]FEt-Tyr-urea-Glu ([ 18 F]FEtTUG) as a new ligand for prostate specific membrane antigen (PSMA) was developed by use of [ 18 F]fluoroethyltosylate as labeling precursor. The corresponding fluoroethyl-tyrosine-urea-glutamate peptide was prepared as reference standard for HPLC control and identified and characterized by standard procedures (MS, NMR). The labeling conditions were optimized with respect to reaction time, reaction temperature, base and solvent. The maximal radiochemical yield of [ 18 F]FEtTUG (77 ± 0.8 %) was obtained within a reaction time of 15 min at a reaction temperature of 80 deg C using 10 M NaOH (18 equiv. related to precursor) in 80 % aqueous acetonitrile. The total preparation time including radiosynthesis, hydrolysis, HPLC purification and formulation was 70 min (EOB). The radiochemical purity was ≥98 %. (author)
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Down-selection of one or more Maglev projects for... Procedures For Financial Assistance § 268.21 Down-selection of one or more Maglev projects for further study... completion of Phase III of the Maglev Deployment Program, FRA will down-select one or more projects to...
Energy Technology Data Exchange (ETDEWEB)
Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)
2011-06-15
Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)
International Nuclear Information System (INIS)
Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.
2011-01-01
Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)
Directory of Open Access Journals (Sweden)
Peter R Kufahl
2012-11-01
Full Text Available Recent studies have implicated glutamate neurotransmission as an important substrate for the extinction of conditioned behaviors, including responding for drug reinforcement. Positive allosteric modulation of the type-5 metabotropic glutamate receptor (mGluR5 in particular has emerged as a treatment strategy for the enhancement of extinction of drug-motivated behaviors. Here, we investigated the effects of the mGluR5 positive allosteric modulator CDPPB, a compound known for its cognitive enhancing effects in rodents, on extinction learning in rats with different histories of methamphetamine (METH training. Rats were trained to self-administer METH under two conditions: 16 daily sessions of short access (90 min/day, ShA, or 8 daily sessions of short access followed by 8 sessions of long access (6 hr/day, LgA. Control rats self-administered sucrose pellets in daily 30 min sessions. Next, rats were administered vehicle or 30 mg/kg CDPPB prior to 7 consecutive daily extinction sessions, subjected to additional extinction sessions to re-establish a post-treatment baseline, and then tested for reinstatement of behavior in the presence of METH- or sucrose-paired cues. Rats were then subjected to a second series of extinction sessions, preceded by vehicle or 30 mg/kg CDPPB, and an additional test for cue-triggered reinstatement. CDPPB treatment resulted in a more rapid extinction of responding on the active lever, especially in the early sessions of the first extinction sequence. However, treatment effects were minimal during subsequent cue reinstatement tests and nonexistent during the second series of extinction sessions. Rats with histories of ShA, LgA and sucrose training expressed similar behavioral sensitivities to CDPPB, with LgA rats demonstrating a modestly higher treatment effect. Positive allosteric modulation of mGluR5 may therefore have some beneficial effects on efforts to facilitate extinction learning and reduce methamphetamine seeking.
DEFF Research Database (Denmark)
Banke, Tue G.; Toft, Anna Karina; Lundbye, Camilla Johanne
The Fragile X Syndrome (FXS) animal model, the Fmr1 knock-out (KO) mouse, has demonstrated an increased mGluR5-mediated long-term depression (LTD). However, surprisingly little information exists about other ion channels/receptors and their effects on FXS, including NMDA receptors (NMDAR). Here we....... Furthermore, in this model it appears that NR2B activation stimulates PKC, while NR2A activation halts or reverses this effect. In addition, in the KO mice, the coupling between specific NMDAR subunits and mGluR-LTD activity through PKC seems defective in an age-dependent manner. These findings suggest strong...
DEFF Research Database (Denmark)
Alcaide, Anna; Marconi, Laura; Marek, Ales
2016-01-01
The kainic acid receptors belong to the class of ionotropic glutamate receptors and comprise five subunits named GluK1-5. Radioligands are essential tools for use in binding assays aimed at ligand-receptor structure-activity-relationship studies. Previous work has led to the synthesis of GluK1...... radioligands [H-3]SYM2081, [H-3]-UBP310 and [H-3]-ATPA, however all strategies were work-intensive and thus not attractive. Herein, we report the synthesis of [H-3]-NF608 and subsequent pharmacological evaluation at homomeric recombinant rat GluK1 receptors. Binding affinities of a series of standard GluK1...... ligands were shown to be in line with previously reported affinities obtained by use of already reported radioligands....
Czech Academy of Sciences Publication Activity Database
Vrajová, M.; Šťastný, František; Horáček, J.; Lochman, J.; Šerý, O.; Peková, S.; Klaschka, Jan; Höschl, C.
2010-01-01
Roč. 35, č. 7 (2010), s. 994-1002 ISSN 0364-3190 Grant - others:GA MZd(CZ) NR9324 Institutional research plan: CEZ:AV0Z50110509; CEZ:AV0Z10300504 Keywords : schizophrenia * hippocampus * GluN1 subunit of NMDA receptor * splice variants * laterality Subject RIV: FL - Psychiatry, Sexuology Impact factor: 2.608, year: 2010
Non-self-adjoint Hamiltonians defined by generalized Riesz bases
Energy Technology Data Exchange (ETDEWEB)
Inoue, H., E-mail: h-inoue@math.kyushu-u.ac.jp [Graduate School of Mathematics, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Takakura, M., E-mail: mayumi@fukuoka-u.ac.jp [Department of Applied Mathematics, Fukuoka University, Fukuoka 814-0180 (Japan)
2016-08-15
Bagarello, Inoue, and Trapani [J. Math. Phys. 55, 033501 (2014)] investigated some operators defined by the Riesz bases. These operators connect with quasi-Hermitian quantum mechanics, and its relatives. In this paper, we introduce a notion of generalized Riesz bases which is a generalization of Riesz bases and investigate some operators defined by the generalized Riesz bases by changing the frameworks of the operators defined in the work of Bagarello, Inoue, and Trapani.
Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish
2011-01-01
Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032
International Nuclear Information System (INIS)
Farmanzadeh, Davood; Ghazanfary, Samereh
2014-01-01
Graphical abstract: - Highlights: • Solvation energies show that the BNNTs/amino acids complex stabilizes in presence of solvent. • The adsorption process is sensitive to the external electric field. • The electric field is a suitable method for adsorption and storage of amino acids on BNNTs. - Abstract: The interaction of Glu (Glutamic acid), Lys (Lysine), Gly (Glycine) and Ser (Serine) amino acids with different polarities and (9, 0) zigzag single-wall boron nitride nanotubes (BNNTs) with various lengths in the presence and absence of external electric field (EF) in gas and solvent phases, are studied using density functional theory. It is found that interaction of Glu, Lys, Gly and Ser amino acids with BNNTs in both phases is energetically favorable. From solvation energy calculations, it can be seen that the BNNTs/amino acid complex dissolution in water is spontaneous. The adsorption energies and quantum molecular descriptors changed in the presence of external EF. Therefore, the study of BNNTs/amino acid complex under influence of external electric field is very important in proposing or designing new drug delivery systems in the presence of external EF. Results indicate that Glu, Lys, Gly and Ser amino acids can be adsorbed considerably on the BNNTs in the existence of external electric field. Our results showed that the BNNTs can act as a suitable drug delivery vehicle of Glu, Lys, Gly and Ser amino acids within biological systems and strength of adsorption and rate of drug release can be controlled by the external EF
Butow, B J; Gale, K R; Ikea, J; Juhász, A; Bedö, Z; Tamás, L; Gianibelli, M C
2004-11-01
Increased expression of the high molecular weight glutenin subunit (HMW-GS) Bx7 is associated with improved dough strength of wheat (Triticum aestivum L.) flour. Several cultivars and landraces of widely different genetic backgrounds from around the world have now been found to contain this so-called 'over-expressing' allelic form of the Bx7 subunit encoded by Glu-B1al. Using three methods of identification, SDS-PAGE, RP-HPLC and PCR marker analysis, as well as pedigree information, we have traced the distribution and source of this allele from a Uruguayan landrace, Americano 44D, in the mid-nineteenth century. Results are supported by knowledge of the movement of wheat lines with migrants. All cultivars possessing the Glu-B1al allele can be identified by the following attributes: (1) the elution of the By sub-unit peak before the Dx sub-unit peak by RP-HPLC, (2) high expression levels of Bx7 (>39% Mol% Bx), (3) a 43 bp insertion in the matrix-attachment region (MAR) upstream of the gene promoter relative to Bx7 and an 18 bp nucleotide duplication in the coding region of the gene. Evidence is presented indicating that these 18 and 43 bp sequence insertions are not causal for the high expression levels of Bx7 as they were also found to be present in a small number of hexaploid species, including Chinese Spring, and species expressing Glu-B1ak and Glu-B1a alleles. In addition, these sequence inserts were found in different isolates of the tetraploid wheat, T. turgidum, indicating that these insertion/deletion events occurred prior to hexaploidization.
Directory of Open Access Journals (Sweden)
M. M. Menezes
2013-01-01
Full Text Available Metabotropic glutamate 2/3 (mGlu2/3 receptors have emerged as potential therapeutic targets due to the ability of mGlu2/3 receptor agonists to modulate excitatory transmission at specific synapses. LY354740 and LY379268 are selective and potent mGlu2/3 receptor agonists that show both anxiolytic- and antipsychotic-like effects in animal models. We compared the efficacy of LY354740 and LY379268 in attenuating restraint-stress-induced expression of the immediate early gene c-Fos in the rat prelimbic (PrL and infralimbic (IL cortex. LY354740 (10 and 30 mg/kg, i.p. showed statistically significant and dose-related attenuation of stress-induced increase in c-Fos expression, in the rat cortex. By contrast, LY379268 had no effect on restraint-stress-induced c-Fos upregulation (0.3–10 mg/kg, i.p.. Because both compounds inhibit serotonin 2A receptor (5-HT2AR-induced c-Fos expression, we hypothesize that LY354740 and LY379268 have different in vivo properties and that 5-HT2AR activation and restraint stress induce c-Fos through distinct mechanisms.
A general model for membrane-based separation processes
DEFF Research Database (Denmark)
Soni, Vipasha; Abildskov, Jens; Jonsson, Gunnar Eigil
2009-01-01
behaviour will play an important role. In this paper, modelling of membrane-based processes for separation of gas and liquid mixtures are considered. Two general models, one for membrane-based liquid separation processes (with phase change) and another for membrane-based gas separation are presented....... The separation processes covered are: membrane-based gas separation processes, pervaporation and various types of membrane distillation processes. The specific model for each type of membrane-based process is generated from the two general models by applying the specific system descriptions and the corresponding...
DEFF Research Database (Denmark)
Mathiesen, Jesper Mosolff; Svendsen, Nannette; Bräuner-Osborne, Hans
2003-01-01
We have identified 2-methyl-6-(2-phenylethenyl)pyridine (SIB-1893) and 2-methyl-6-phenylethynyl pyridine hydrochloride (MPEP) as positive allosteric modulators for the hmGluR4. SIB-1893 and MPEP enhanced the potency and efficacy of L-2-amino-4-phophonobutyrate (L-AP4) in guanosine 5'-O-(3-[(35)S...
International Nuclear Information System (INIS)
Patel, Shil; Hamill, Terence G.; Connolly, Brett; Jagoda, Elaine; Li Wenping; Gibson, Raymond E.
2007-01-01
Binding of [ 18 F]3-fluoro-5-[(pyridin-3-yl)ethynyl]benzonitrile ([ 18 F]F-PEB) was evaluated in membranes and tissue sections prepared from rat, rhesus and human brain. Saturation equilibrium binding experiments with frozen brain cortex and caudate-putamen membranes of young adult rhesus and human and with cortex and striatum from rat yielded data indicative of specific high-affinity binding (K D =0.1-0.15 nM, n≥3) to a saturable site previously shown to be metabotropic glutamate receptor 5 (mGluR5; Patel S, Ndubizu O, Hamill T, Chaudhary A, Burns HD, Hargreaves RJ, Gibson RE. Screening cascade and development of potential positron emission tomography radiotracers for mGluR5: in vitro and in vivo characterization. Mol Imaging Biol 2005;7:314-323). High-affinity binding of [ 18 F]F-PEB was also detected in cerebellum membranes from rat, rhesus and human. The density of binding sites (B max ) measured using [ 18 F]F-PEB followed the rank order cortex∼caudate-putamen/striatum>cerebellum for all three species, with the cerebellum B max being significantly lower than that observed in the other regions. Receptor autoradiography studies in tissue sections confirmed that the regional distribution of [ 18 F]F-PEB in mammalian central nervous system is consistent with that of mGluR5 and that a small but specific mGluR5 signal is observed in rhesus and human cerebellum. A small and quantifiable specific signal could also be observed in rat cerebellum using this radiotracer. Immunohistochemical analysis in brain sections revealed a rank order of staining in rhesus and human brain of cortex∼caudate-putamen>cerebellum. Rat brain immunohistochemistry followed the same rank order, although the staining in the cerebellum was significantly lower. Using a 'no-wash' wipe assay, the development of a specific signal within 20 min of incubation of tissue brain sections (>60% in the cortex and striatum; 36-49% in the cerebellum) from all three species confirmed previous in vivo
Falck, Evamaria; Begrow, Frank; Verspohl, Eugen J; Wünsch, Bernhard
2014-06-01
Structural modification of the GluN2B selective NMDA receptor antagonist ifenprodil led to the 3-benzazepine WMS-1410 with similar GluN2B affinity but higher receptor selectivity. Herein the in vitro and in vivo biotransformation of WMS-1410 is reported. Incubation of WMS-1410 with rat liver microsomes and different cofactors resulted in four hydroxylated phase I metabolites, two phase II metabolites and five combined phase I/II metabolites. With exception of catechol 4, these metabolites were also identified in the urine of a rat treated with WMS-1410. However the metabolites 7, 8 and 12 clearly show that the catechol metabolite 4 was also formed in vivo. As shown for ifenprodil the phenol of WMS-1410 represents the metabolically most reactive structural element. The biotransformation of WMS-1410 is considerably slower than the biotransformation of ifenprodil indicating a higher metabolic stability. From the viewpoint of metabolic stability the bioisosteric replacement of the phenol of WMS-1410 by a metabolically more stable moiety should be favourable. Copyright © 2014 Elsevier B.V. All rights reserved.
Lim, Chae-Seok; Hoang, Elizabeth T; Viar, Kenneth E; Stornetta, Ruth L; Scott, Michael M; Zhu, J Julius
2014-02-01
Fragile X syndrome, caused by the loss of Fmr1 gene function, is the most common form of inherited mental retardation, with no effective treatment. Using a tractable animal model, we investigated mechanisms of action of a few FDA-approved psychoactive drugs that modestly benefit the cognitive performance in fragile X patients. Here we report that compounds activating serotonin (5HT) subtype 2B receptors (5HT2B-Rs) or dopamine (DA) subtype 1-like receptors (D1-Rs) and/or those inhibiting 5HT2A-Rs or D2-Rs moderately enhance Ras-PI3K/PKB signaling input, GluA1-dependent synaptic plasticity, and learning in Fmr1 knockout mice. Unexpectedly, combinations of these 5HT and DA compounds at low doses synergistically stimulate Ras-PI3K/PKB signal transduction and GluA1-dependent synaptic plasticity and remarkably restore normal learning in Fmr1 knockout mice without causing anxiety-related side effects. These findings suggest that properly dosed and combined FDA-approved psychoactive drugs may effectively treat the cognitive impairment associated with fragile X syndrome.
A p.(Glu809Lys) Mutation in the WFS1 Gene Associated with Wolfram-like Syndrome: A Case Report.
Prochazkova, Dagmar; Hruba, Zuzana; Konecna, Petra; Skotakova, Jarmila; Fajkusova, Lenka
2016-12-01
Wolfram-like syndrome (WFSL) is a rare autosomal dominant disease characterised by congenital progressive hearing loss, diabetes mellitus, and optic atrophy. The patient was a boy with the juvenile form of diabetes mellitus and findings which clinically matched the symptoms of Wolfram syndrome. At the age of 3 1/4 years, diabetes mellitus was diagnosed in this boy who also had severe psychomotor retardation, failure to thrive, a dysmorphic face with Peters anomaly type 3 (i.e. posterior central defect with stromal opacity of the cornea, adhering stripes of the iris, and cataract with corneolenticular adhesion), congenital glaucoma, megalocornea, severe hearing impairment, a one-sided deformity of the auricle with atresia of the bony and soft external auditory canal, non-differentiable eardrum, missing os incus, hypothyreosis, and nephrocalcinosis. Molecular-genetic examinations revealed a de novo mutation p.(Glu809Lys) in the WFS1 gene. No mutations were detected in the biological parents. The mutation p.(Glu809Lys) in the WFS1 gene is associated with WFSL.
Phenotypic heterogeneity associated with a novel mutation (Gly112Glu) in the Norrie disease protein.
Allen, R C; Russell, S R; Streb, L M; Alsheikheh, A; Stone, E M
2006-02-01
To determine the molecular pathology and clinical severity of two pedigrees with a history of early retinal detachment and peripheral retinal vascular abnormalities. Longitudinal cohort study. A longitudinal clinical study and DNA analysis was performed on 49 family members of two pedigrees. Nine individuals were found to be hemizygous for a mutation at codon 112 (Gly112Glu) of the Norrie disease protein (NDP) in one pedigree. Significant phenotypic heterogeneity was found. The proband presented with a unilateral subtotal retinal detachment at the age of 3 years, and subsequently developed a slowly progressive tractional retinal detachment involving the macula in the contralateral eye at the age of 4 years. One individual had only mild peripheral retinal pigmentary changes with normal vision at the age of 79 years. The remaining seven individuals had varying degrees of peripheral retinal vascular abnormalities and anterior segment findings. Seven affected members of a second pedigree affected by a previously reported mutation, Arg74Cys, also demonstrated wide ocular phenotypic variation. A novel mutation (Gly112Glu), which represents the most carboxy located, NDP mutation reported, results in significant phenotypic heterogeneity. These data support the contention that the spectrum of ocular disease severity associated with these NDP mutations is broad. Use of terms that characterize this entity by phenotypic appearance, such as familial exudative vitreoretinopathy, do not adequately communicate the potential spectrum of severity of this disorder to affected or carrier family members.
Shaikh, Rozeena; Shahid, Syed M; Mansoor, Qaisar; Ismail, Muhammad; Azhar, Abid
2014-06-01
Diabetes mellitus (DM) has been a growing epidemic worldwide and poses a major socio-economic challenge. The leading cause of DM death is nephropathy due to end-stage renal disease (ESRD). This study aims to identify the possible association of I/D variants of the ACE gene and M268T (rs699) of the AGT gene of renin-angiotensin-aldosterone system (RAAS). Study subjects include 115 patients with DM, 110 with diabetic nephropathy (DN) and 110 controls. Fasting blood samples were collected for biochemical analyses and PCR amplification of specific regions of the ACE and AGT genes using primers. The distribution of ACE (I/D) II 28.8%, ID 35.6% and DD 35.6% while in DN II 24.5%, ID 41% and DD 34.5%. The AGT (M268T) genotypes were distributed in DM as TT 30.4%, MT 66.9% and MM 2.6% while in DN subjects TT 56.4%, MT 42.7% and MM 0.9%. Significant differences were observed in the DD genotype and D allele of the ACE gene and the TT genotype and T allele of AGT genes between diabetic patients with and without nephropathy. The study may conclude that the D allele polymorphism in the ACE gene and the T allele polymorphism in AGT gene may be considered as genetic risk factors for the development of nephropathy in diabetes. © The Author(s) 2014.
Ptushenko, Vasily V; Cherepanov, Dmitry A; Krishtalik, Lev I
2015-12-01
Continuum electrostatic calculation of the transfer energies of anions from water into aprotic solvents gives the figures erroneous by order of magnitude. This is due to the hydrogen bond disruption that suggests the necessity to reconsider the traditional approach of the purely electrostatic calculation of the transfer energy from water into protein. In this paper, the method combining the experimental estimates of the transfer energies from water into aprotic solvent and the electrostatic calculation of the transfer energies from aprotic solvent into protein is proposed. Hydrogen bonds between aprotic solvent and solute are taken into account by introducing an imaginary aprotic medium incapable to form hydrogen bonds with the solute. Besides, a new treatment of the heterogeneous intraprotein dielectric permittivity based on the microscopic protein structure and electrometric measurements is elaborated. The method accounts semi-quantitatively for the electrostatic effect of diverse charged amino acid substitutions in the donor and acceptor parts of the photosynthetic bacterial reaction center from Rhodobacter sphaeroides. Analysis of the volatile secondary acceptor site QB revealed that in the conformation with a minimal distance between quinone QB and Glu L 212 the proton uptake upon the reduction of QB is prompted by Glu L 212 in alkaline and by Asp L 213 in slightly acidic regions. This agrees with the pH dependences of protonation degrees and the proton uptake. The method of pK calculation was applied successfully also for dissociation of Asp 26 in bacterial thioredoxin. Copyright © 2015 Elsevier B.V. All rights reserved.
Three-dimensional structure of the ligand-binding core of GluR2 in complex with the agonist (S)-ATPA
DEFF Research Database (Denmark)
Lunn, Marie-Louise; Hogner, Anders; Stensbøl, Tine B
2003-01-01
Two X-ray structures of the GluR2 ligand-binding core in complex with (S)-2-amino-3-(5-tert-butyl-3-hydroxy-4-isoxazolyl)propionic acid ((S)-ATPA) have been determined with and without Zn(2+) ions. (S)-ATPA induces a domain closure of ca. 21 degrees compared to the apo form. The tert-butyl moiety...
A General Simulator for Acid-Base Titrations
de Levie, Robert
1999-07-01
General formal expressions are provided to facilitate the automatic computer calculation of acid-base titration curves of arbitrary mixtures of acids, bases, and salts, without and with activity corrections based on the Davies equation. Explicit relations are also given for the buffer strength of mixtures of acids, bases, and salts.
Guarracino, Danielle A; Gentile, Kayla; Grossman, Alec; Li, Evan; Refai, Nader; Mohnot, Joy; King, Daniel
2018-02-01
Determining the minimal sequence necessary to induce protein folding is beneficial in understanding the role of protein-protein interactions in biological systems, as their three-dimensional structures often dictate their activity. Proteins are generally comprised of discrete secondary structures, from α-helices to β-turns and larger β-sheets, each of which is influenced by its primary structure. Manipulating the sequence of short, moderately helical peptides can help elucidate the influences on folding. We created two new scaffolds based on a modestly helical eight-residue peptide, PT3, we previously published. Using circular dichroism (CD) spectroscopy and changing the possible salt-bridging residues to new combinations of Lys, Arg, Glu, and Asp, we found that our most helical improvements came from the Arg-Glu combination, whereas the Lys-Asp was not significantly different from the Lys-Glu of the parent scaffold, PT3. The marked 3 10 -helical contributions in PT3 were lessened in the Arg-Glu-containing peptide with the beginning of cooperative unfolding seen through a thermal denaturation. However, a unique and unexpected signature was seen for the denaturation of the Lys-Asp peptide which could help elucidate the stages of folding between the 3 10 and α-helix. In addition, we developed a short six-residue peptide with β-turn/sheet CD signature, again to help study minimal sequences needed for folding. Overall, the results indicate that improvements made to short peptide scaffolds by fine-tuning the salt-bridging residues can enhance scaffold structure. Likewise, with the results from the new, short β-turn motif, these can help impact future peptidomimetic designs in creating biologically useful, short, structured β-sheet-forming peptides.
Labiano, A; Vermeulen, RC; Barthel, PD; O'Dea, CP; Gallimore, JF; Baum, S; de Vries, W
Aims. Localize and study the redshifted 21 cm H I absorption known to occur in the subgalactic sized compact steep spectrum galaxies 3C 49 and 3C 268.3. Methods. We carried out European VLBI Network UHF hand spectral line observations. Results. We have detected H I absorption towards the western
Directory of Open Access Journals (Sweden)
Hongping Yu
Full Text Available In vitro benzo[a]pyrene diol epoxide (BPDE-induced DNA adducts in cultured peripheral lymphocytes have been shown to be a phenotypic biomarker of individual's DNA repair phenotype that is associated with cancer risk. In this study, we explored associations between genotypes of base-excision repair genes (PARP1 Val762Ala, APEX1 Asp148Glu, and XRCC1 Arg399Gln and in vitro BPDE-induced DNA adducts in cultured peripheral blood lymphocytes in 706 cancer-free non-Hispanic white subjects. We found that levels of BPDE-induced DNA adducts were significantly higher in ever smokers than in never smokers and that individuals with the Glu variant genotypes (i.e., Asp/Glu and Glu/Glu exhibited lower levels of BPDE-induced DNA adducts than did individuals with the common Asp/Asp homozygous genotype (median RAL levels: 32.0 for Asp/Asp, 27.0 for Asp/Glu, and 17.0 for Glu/Glu, respectively; P(trend = 0.030. Further stratified analysis showed that compared with individuals with the common APEX1-148 homozygous Asp/Asp genotype, individuals with the APEX1-148Asp/Glu genotype or the Glu/Glu genotype had a lower risk of having higher-level adducts (adjusted OR = 0.60, 95% CI: 0.36-0.98 and adjusted OR = 0.47, 95% CI: 0.26-0.86, respectively; P(trend = 0.012 among smokers. Such an effect was not observed in non-smokers. However, there was no significant interaction between the APEX1 Asp148Glu polymorphism and smoking exposure in this study population (P = 0.512. Additional genotype-phenotype analysis found that the APEX1-148Glu allele had significantly increased expression of APEX1 mRNA in 270 Epstein-Barr virus-transformed lymphoblastoid cell lines, which is likely associated with more active repair activity. Our findings suggest that the functional APEX1-148Glu allele is associated with reduced risk of having high levels of BPDE-induced DNA adducts mediated with high levels of mRNA expression.
Bentley, G A; Brange, J; Derewenda, Z; Dodson, E J; Dodson, G G; Markussen, J; Wilkinson, A J; Wollmer, A; Xiao, B
1992-12-20
The assembly of the insulin hexamer brings the six B13 glutamate side-chains at the centre into close proximity. Their mutual repulsion is unfavourable and zinc co-ordination to B10 histidine is necessary to stabilize the well known zinc-containing hexamers. Since B13 is always a carboxylic acid in all known sequences of hexamer forming insulins, it is likely to be important in the hormone's biology. The mutation of B13 Glu-->Gln leads to a stable zinc-free hexamer with somewhat reduced potency. The structures of the zinc-free B13 Gln hexamer and the 2Zn B13 insulin hexamer have been determined by X-ray analysis and refined with 2.5 A and 2.0 A diffraction data, respectively. Comparisons show that in 2Zn B13 Gln insulin, the hexamer structure (T6) is very like that of the native hormone. On the other hand, the zinc-free hexamer assumes a quaternary structure (T3/R3) seen in the native 4Zn insulin hexamer, and normally associated only with high chloride ion concentrations in the medium. The crystal structures show the B13 Gln side-chains only contact water in contrast to the B13 glutamate in 2Zn insulin. The solvation of the B13 Gln may be associated with this residue favouring helix at B1 to B8. The low potency of the B13 Gln insulin also suggests the residue influences the hormone's conformation.
Neuroprotective effects of (Val8)GLP-1-Glu-PAL in the MPTP Parkinson's disease mouse model
Zhang, YanFang; Chen, YiMei; Li, Lin; Holscher, Christian
2015-01-01
Glucagon-like peptide 1 (GLP-1) is a hormone and a growth factor. GLP-1 mimetics are currently on the market as treatments for type 2 diabetes. They also have shown neuroprotective properties in animal models of neurodegenerative disorders. In addition, the GLP-1 mimetic exendin-4 has shown protective effects in animal models of Parkinson's disease (PD), and a first clinical trial in PD patients showed promising results. (Val8)GLP-1-glu-PAL is a new GLP-1 analogue which has a longer biologica...
Kubota, Akihiro; Tajima, Takashi; Narukawa, Shinya; Yamazato, Masamizu; Fukaura, Hikoaki; Takahashi, Yukitoshi; Tanaka, Keiko; Shimizu, Jun; Nomura, Kyoichi
2012-01-01
A 36-year-old man presented with cognitive impairment and disturbance of short-term memory functions with character change. Cerebrospinal fluid analysis revealed no abnormalities; however, brain MRI revealed high-signal intensity from bilateral hippocampus lesions on fluid attenuated inversion recovery (FLAIR) images and T(2) weighted images. The 18F-fluorodeoxyglucose PET demonstrated high glucose uptake in the bilateral hippocampus lesions. He was diagnosed as limbic encephalitis, and was administered high-dose intravenous methylprednisolone and immune adsorption plasma therapy followed by intravenous immunoglobulin therapy. MRI abnormalities improved after treatment but recent memory disturbance remained. Ma2 antibody, NMDA-receptor antibody, and GluRε2 antibody were positive. Eleven months atter the onset of disease, the tumor was identified in left testicle by ultrasound and removed the tumor. The pathological findings were seminoma. We experienced a case of paraneoplastic limbic encephalitis associated with seminoma with short-term memory disturbance. The occurrence of paraneoplastic limbic encephalitis with antibodies against cell membrane (NMDA-receptor antibody and GluRε2 antibody) and intracellular (Ma2 antibody) is rare even in the literature.
DEFF Research Database (Denmark)
Ormarsson, Sigurdur; Steinnes, Jan Roar
2014-01-01
There is a need of more advanced analysis for studying how the long-term behaviour of glued laminated timber structures is affected by creep and by cyclic variations in climate. A beam theory is presented able to simulate the overall hygro-mechanical and visco-elastic behaviour of (inhomogeneous)...... that occurs to have a significant effect on deformations, section forces and stress distributions within the frame structures that were studied....
Kokane, Saurabh S; Gong, Kerui; Jin, Jianhui; Lin, Qing
2017-09-01
Ketamine is a commonly used anesthetic among pediatric patients due to its high efficacy. However, it has been demonstrated by several preclinical studies that, widespread accelerated programmed death of neurons (neuroapoptosis) occurs due to prolonged or repeated exposure to ketamine specifically in the neonatal brain. Therefore, an emphasis on understanding the molecular mechanisms underlying this selective vulnerability of the neonatal brain to ketamine-induced neuroapoptosis becomes important in order to identify potential therapeutic targets, which would help prevent or at least ameliorate this neuroapoptosis. In this study, we demonstrated that repeated ketamine administration (6 injections of 20mg/kg dose given over 12h time period) in neonatal (postnatal day 7; PND 7) Sprague-Dawley rats induced a progressive increase in N-methyl-d-aspartate receptor (NMDAR)-mediated excitatory postsynaptic currents (EPSCs) in the neurons of the anterior cingulate cortex (ACC) for up to 6h after the last ketamine dose. Specifically, we observed that the increased EPSCs were largely mediated by GluN2B-containing NMDARs in the neurons of the ACC. Along with increased synaptic transmission, there was also a significant increase in the expression of the GluN2B-containing NMDARs as well. Taken together, these results showed that after repeated exposure to ketamine, the synaptic transmission mediated by GluN2B-containing NMDARs was significantly increased in the neonatal brain. This was significant as it showed for the first time that ketamine had subunit-specific effects on GluN2B-containing NMDARs, potentially implicating the involvement of these subunits in the increased vulnerability of immature neurons of the neonatal brain to ketamine-induced neuroapoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.
GluN2B/CaMKII mediates CFA-induced hyperalgesia via HDAC4-modified spinal COX2 transcription.
Lai, Cheng-Yuan; Hsieh, Ming-Chun; Ho, Yu-Cheng; Chen, Gin-Den; Chou, Dylan; Ruan, Ting; Lee, An-Sheng; Wang, Hsueh-Hsiao; Chau, Yat-Pang; Peng, Hsien-Yu; Lai, Cheng-Hung
2018-06-01
Histone deacetylase 4 (HDAC4), which actively shuttles between the nucleus and cytoplasm, is an attractive candidate for a repressor mechanism in epigenetic modification. However, the potential role of HDAC4-dependent epigenetics in the neural plasticity underlying the development of inflammatory pain has not been well established. By injecting complete Freund's adjuvant (CFA) into the hind-paw of Sprague-Dawley rats (200-250 g), we found animals displayed behavioral hyperalgesia was accompanied with HDAC4 phosphorylation and cytoplasmic redistribution in the dorsal horn neurons. Cytoplasmic HDAC4 retention led to its uncoupling with the COX2 promoter, hence prompting spinal COX2 transcription and expression in the dorsal horn. Moreover, the GluN2B-bearing N-methyl-d-aspartate receptor (GluN2B-NMDAR)/calmodulin-dependent protein kinase II (CaMKII) acted as an upstream cascade to facilitate HDAC4 phosphorylation/redistribution-associated spinal COX2 expression after inflammatory insults. The results of this pilot study demonstrated that the development and/or maintenance of inflammatory pain involved the spinal HDAC4-dependent epigenetic mechanisms. Our findings open up a new avenue for the development of a novel medical strategy for the relief of inflammatory pain. Copyright © 2018 Elsevier Ltd. All rights reserved.
Black hole based tests of general relativity
International Nuclear Information System (INIS)
Yagi, Kent; Stein, Leo C
2016-01-01
General relativity has passed all solar system experiments and neutron star based tests, such as binary pulsar observations, with flying colors. A more exotic arena for testing general relativity is in systems that contain one or more black holes. Black holes are the most compact objects in the Universe, providing probes of the strongest-possible gravitational fields. We are motivated to study strong-field gravity since many theories give large deviations from general relativity only at large field strengths, while recovering the weak-field behavior. In this article, we review how one can probe general relativity and various alternative theories of gravity by using electromagnetic waves from a black hole with an accretion disk, and gravitational waves from black hole binaries. We first review model-independent ways of testing gravity with electromagnetic/gravitational waves from a black hole system. We then focus on selected examples of theories that extend general relativity in rather simple ways. Some important characteristics of general relativity include (but are not limited to) (i) only tensor gravitational degrees of freedom, (ii) the graviton is massless, (iii) no quadratic or higher curvatures in the action, and (iv) the theory is four-dimensional. Altering a characteristic leads to a different extension of general relativity: (i) scalar–tensor theories, (ii) massive gravity theories, (iii) quadratic gravity, and (iv) theories with large extra dimensions. Within each theory, we describe black hole solutions, their properties, and current and projected constraints on each theory using black hole based tests of gravity. We close this review by listing some of the open problems in model-independent tests and within each specific theory. (paper)
Czech Academy of Sciences Publication Activity Database
Szczurowska, Ewa; Ergang, Peter; Kubová, Hana; Druga, Rastislav; Salaj, M.; Mareš, Pavel
2016-01-01
Roč. 283, Part A (2016), s. 97-109 ISSN 0014-4886 R&D Projects: GA ČR(CZ) GA15-16605S; GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:67985823 Keywords : development * pilocarpine * status epilepticus * LiCl * AMPA * GluA2 * subunit * expression * GRIA2A Subject RIV: FH - Neurology Impact factor: 4.706, year: 2016
Energy Technology Data Exchange (ETDEWEB)
Patel, Shil [Department of Research Imaging, Merck Research Laboratories, West Point, PA 19486 (United States)], E-mail: shailendra_patel@merck.com; Hamill, Terence G.; Connolly, Brett; Jagoda, Elaine; Li Wenping; Gibson, Raymond E. [Department of Research Imaging, Merck Research Laboratories, West Point, PA 19486 (United States)
2007-11-15
Binding of [{sup 18}F]3-fluoro-5-[(pyridin-3-yl)ethynyl]benzonitrile ([{sup 18}F]F-PEB) was evaluated in membranes and tissue sections prepared from rat, rhesus and human brain. Saturation equilibrium binding experiments with frozen brain cortex and caudate-putamen membranes of young adult rhesus and human and with cortex and striatum from rat yielded data indicative of specific high-affinity binding (K{sub D}=0.1-0.15 nM, n{>=}3) to a saturable site previously shown to be metabotropic glutamate receptor 5 (mGluR5; Patel S, Ndubizu O, Hamill T, Chaudhary A, Burns HD, Hargreaves RJ, Gibson RE. Screening cascade and development of potential positron emission tomography radiotracers for mGluR5: in vitro and in vivo characterization. Mol Imaging Biol 2005;7:314-323). High-affinity binding of [{sup 18}F]F-PEB was also detected in cerebellum membranes from rat, rhesus and human. The density of binding sites (B{sub max}) measured using [{sup 18}F]F-PEB followed the rank order cortex{approx}caudate-putamen/striatum>cerebellum for all three species, with the cerebellum B{sub max} being significantly lower than that observed in the other regions. Receptor autoradiography studies in tissue sections confirmed that the regional distribution of [{sup 18}F]F-PEB in mammalian central nervous system is consistent with that of mGluR5 and that a small but specific mGluR5 signal is observed in rhesus and human cerebellum. A small and quantifiable specific signal could also be observed in rat cerebellum using this radiotracer. Immunohistochemical analysis in brain sections revealed a rank order of staining in rhesus and human brain of cortex{approx}caudate-putamen>cerebellum. Rat brain immunohistochemistry followed the same rank order, although the staining in the cerebellum was significantly lower. Using a 'no-wash' wipe assay, the development of a specific signal within 20 min of incubation of tissue brain sections (>60% in the cortex and striatum; 36-49% in the cerebellum
Directory of Open Access Journals (Sweden)
Đurić Tamara
2013-01-01
Full Text Available Nitric oxide inhibits adhesion of thrombocytes, proliferation and migration of smooth muscle cells and restricts oxidation of atherogenic low-density lipoproteins. Therefore, decreased production or activity of NO may play a role in the initiation, progression or complications of atherosclerosis. The aim of this study was to estimate the effect of Glu298Asp eNOS gene polymorphism on the individual risk for development of complicated carotid atherosclerotic plaque in patients from Serbia with advanced carotid atherosclerosis (CA who had undergone endarterectomy. The study population included 233 patients. eNOS G894T gene polymorphism was identified by PCR and RFLP methods. Multivariate logistic regression analysis showed that Asp298Asp is an independent risk factor for the presence of complicated plaques in CA patients. Patients who were homozygous for the Asp298 allele had an adjusted OR of 4.36 for the development of complicated plaques compared to those that carry the Glu298 allele. Further validation and replication studies are needed. [Projekat Ministarstva nauke Republike Srbije, br. OI175085
DEFF Research Database (Denmark)
Hald, Helle; Ahring, Philip Kiær; Timmermann, Daniel Brunicardi
2009-01-01
Ionotropic glutamate receptors (iGluRs) mediate fast excitatory neurotransmission. Upon glutamate application, 2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid receptors undergo rapid and almost complete desensitization that can be attenuated by positive allosteric modulators. The molecu......Ionotropic glutamate receptors (iGluRs) mediate fast excitatory neurotransmission. Upon glutamate application, 2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid receptors undergo rapid and almost complete desensitization that can be attenuated by positive allosteric modulators......) in micromolar: 10 (CTZ), 26 (NS1493), 43 (NS5206), and 48 (NS5217)]. The four modulators divide into three groups according to efficacy and desensitization kinetics: (1) CTZ increases the peak current efficacy twice as much as the three analogues and nearly completely blocks receptor desensitization; (2) NS5206...... and NS5217 have low efficacy and only attenuate desensitization partially; (3) NS1493 has low efficacy but nearly completely blocks receptor desensitization. A hydrophobic substituent at the 3-position of the 1,1-dioxo-3,4-dihydro-2H-benzo[e][1,2,4]thiadiazine ring system is important for compound...
Generalized SMO algorithm for SVM-based multitask learning.
Cai, Feng; Cherkassky, Vladimir
2012-06-01
Exploiting additional information to improve traditional inductive learning is an active research area in machine learning. In many supervised-learning applications, training data can be naturally separated into several groups, and incorporating this group information into learning may improve generalization. Recently, Vapnik proposed a general approach to formalizing such problems, known as "learning with structured data" and its support vector machine (SVM) based optimization formulation called SVM+. Liang and Cherkassky showed the connection between SVM+ and multitask learning (MTL) approaches in machine learning, and proposed an SVM-based formulation for MTL called SVM+MTL for classification. Training the SVM+MTL classifier requires the solution of a large quadratic programming optimization problem which scales as O(n(3)) with sample size n. So there is a need to develop computationally efficient algorithms for implementing SVM+MTL. This brief generalizes Platt's sequential minimal optimization (SMO) algorithm to the SVM+MTL setting. Empirical results show that, for typical SVM+MTL problems, the proposed generalized SMO achieves over 100 times speed-up, in comparison with general-purpose optimization routines.
Directory of Open Access Journals (Sweden)
Luisa Juana Bernal
2014-03-01
Full Text Available The blackberry (Rubus glaucus Benth and thebilberry (Vaccinium meridionale Swartz are natural sourcesof antioxidants; they are known for their preventive role against degenerative diseases. In this study, the aromatic profile was evaluated using an electronic nose, including the antioxidant properties and the vitamin C, phenolic and anthocyanin contents during three stages of blackberry and bilberry ripening. A completely random statistical design was followed and the results presented differences in the aromatic profile: a higher anthocyanin content (1.59 mg of cyn-3-glu g-1 in the bilberry and 0.26 mg of cyn-3-glu g-1 in the blackberry and total phenols (5.57 mg of caffeic acid g-1 bilberry and 2.68 mg caffeic acid g-1 blackberry. The behavior of the evaluated properties was independent in each of the fruits. / Los frutos como la mora (Rubus glaucus Benth y el agraz (Vaccinium meridionale Swartz son fuentes naturales de sustancias antioxidantes reconocidas por su papel preventivo en el desarrollo de enfermedades degenerativas. En este estudio se evaluó el perfil aromático por medio de nariz electrónica, las propiedades antioxidantes y el contenido de vitamina C, fenoles y antocianinas totales, durante tres estados de maduración de mora y agraz. El diseño estadístico que se siguió fue completamente aleatorio y los resultados muestran que las frutas en el último estado de madurez evaluado se diferencian por su perfil aromático, un contenido mayor de antocianinas (1,59 y 0,26 mg cyn-3-glu g-1 en agraz y mora, respectivamente y fenoles totales (5,57 y 2,68 mg ácido caféico g-1 en agraz y mora, respectivamente. El comportamiento de las propiedades evaluadas es independiente en cada una de las frutas.
Kosowicz, Jerzy; Mikołajczak, Renata; Czepczyński, Rafał; Ziemnicka, Katarzyna; Gryczyńska, Maria; Sowiński, Jerzy
2007-10-01
Somatostatin and gastrin receptors are overexpressed in medullary thyroid carcinoma (MTC) cells; hence, both of them are potential targets for peptide receptor scintigraphy and radiotherapy. Therefore, the aim of our study was to assess the clinical value of two technetium-99m-labeled peptides, a new gastrin analog, the EDDA/HYNIC-(D)Glu-octagastrin and a somatostatin analog, EDDA/HYNIC-Tyr(3)-octreotide (EDDA/HYNIC-TOC) for scintigraphy in patients with MTC to detect recurrences and metastases and select patients for peptide receptor radiotherapy. Thirty (30) patients, 20 females and 10 males, 22-83 years of age (mean, 52.7) with the diagnosis of MTC in different stages of the disease (preoperative, postsurgery, remission, recurrence, or metastatic disease) were included in this study. Before surgery, in all patients serum calcitonin concentrations were elevated. The diagnosis of MTC was confirmed in all cases by histopathology of the removed tumor and immunohistochemical staining giving positive reactions for calcitonin and chromogranin A. Imaging studies using (99m)Tc-EDDA/HYNIC-TOC and a new minigastrin analog, (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin, were performed in each patient and the results compared with each other and with other imaging methods. Scans of the whole body, head, neck, and chest were performed 2 and 4 hours after injections of the tracer, 500-600 MBq in each case, using a double-head Varicam (Elscint, Israel) gamma camera. (99m)Tc-EDDA/HYNIC-TOC detected somatostatin receptor-positive lesions in 20 patients with MTC, whereas (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin displayed gastrin receptors in 11 patients. In 9 cases, the scans were positive in both methods, although in 2 cases different pathologic foci were visualized. In 12 cases, only (99m)Tc-EDDA/HYNIC-TOC scintigraphy was positive, whereas in 3 other cases only (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin revealed pathologic lesions. Scintigraphy using (99m)Tc-HYNIC-TOC permits the visualization
Directory of Open Access Journals (Sweden)
Flávio F Barbosa
2013-08-01
Full Text Available Episodic memory reflects the capacity to recollect what, where and when a specific event happened in an integrative manner. Animal studies have suggested that the medial temporal lobe and the medial pre-frontal cortex are important for episodic-like memory formation. The goal of present study was to evaluate whether there are different patterns of expression of the immediate early genes c-Fos and Zif-268 in these cortical areas after rats are exposed to object recognition tasks with different cognitive demands. Male rats were randomly assigned to five groups: home cage control (CTR-HC, empty open field (CTR-OF, open field with one object (CTR-OF + Obj, novel object recognition task (OR and episodic-like memory task (ELM and were killed one hour after the last behavioral procedure. Rats were able to discriminate the objects in the OR task. In the ELM task, rats showed spatial (but not temporal discrimination of the objects. We found an increase in the c-Fos expression in the dorsal dentate gyrus (DG and in the perirhinal cortex (PRh in the OR and ELM groups. The OR group also presented an increase of c-Fos expression in the medial prefrontal cortex (mPFC. Additionally, the OR and ELM groups had increased expression of Zif-268 in the mPFC. Moreover, Zif-268 was increased in the dorsal CA1 and perirhinal cortex only in the ELM group. In conclusion, the pattern of activation was different in tasks with different cognitive demands. Accordingly, correlation tests suggest the engagement of different neural networks in the object recognition tasks used. Specifically, perirhinal-dentate gyrus co-activation was detected after the what-where memory retrieval, but not after the novel object recognition task. Both regions correlated with the respective behavioral outcome. These findings can be helpful in the understanding of the neural networks underlying memory tasks with different cognitive demands.
Czech Academy of Sciences Publication Activity Database
Vrajová, M.; Horáček, J.; Klaschka, Jan
2010-01-01
Roč. 14, Suppl. 2 (2010), s. 10-11 ISSN 1211-7579 R&D Projects: GA MŠk(CZ) 1M0517 Institutional research plan: CEZ:AV0Z10300504 Keywords : schizophrenia * hippocampus * GluN1 C2 subunit of NMDA receptor Subject RIV: FL - Psychiatry, Sexuology
Energy Technology Data Exchange (ETDEWEB)
McIntosh, Lawrence P., E-mail: mcintosh@chem.ubc.ca; Naito, Daigo; Baturin, Simon J.; Okon, Mark; Joshi, Manish D. [University of British Columbia, Department of Biochemistry and Molecular Biology, Department of Chemistry, and Michael Smith Laboratories, Life Sciences Centre (Canada); Nielsen, Jens E. [University College Dublin, School of Biomolecular and Biomedical Science, Centre for Synthesis and Chemical Biology, UCD Conway Institute (Ireland)
2011-09-15
NMR-monitored pH titration curves of proteins provide a rich source of structural and electrostatic information. Although relatively straightforward to measure, interpreting pH-dependent chemical shift changes to obtain site-specific acid dissociation constants (pK{sub A} values) is challenging. In order to analyze the biphasic titrations exhibited by the side chain {sup 13}C{sup {gamma}} nuclei of the nucleophilic Glu78 and general acid/base Glu172 in Bacillus circulans xylanase, we have revisited the formalism for the ionization equilibria of two coupled acidic residues. In general, fitting NMR-monitored pH titration curves for such a system will only yield the two macroscopic pK{sub A} values that reflect the combined effects of both deprotonation reactions. However, through the use of mutations complemented with ionic strength-dependent measurements, we are able to extract the four microscopic pK{sub Ai} values governing the branched acid/base equilibria of Glu78 and Glu172 in BcX. These data, confirmed through theoretical calculations, help explain the pH-dependent mechanism of this model GH11 xylanase by demonstrating that the kinetically determined pK{sub A} values and hence catalytic roles of these two residues result from their electrostatic coupling.
International Nuclear Information System (INIS)
McIntosh, Lawrence P.; Naito, Daigo; Baturin, Simon J.; Okon, Mark; Joshi, Manish D.; Nielsen, Jens E.
2011-01-01
NMR-monitored pH titration curves of proteins provide a rich source of structural and electrostatic information. Although relatively straightforward to measure, interpreting pH-dependent chemical shift changes to obtain site-specific acid dissociation constants (pK A values) is challenging. In order to analyze the biphasic titrations exhibited by the side chain 13 C γ nuclei of the nucleophilic Glu78 and general acid/base Glu172 in Bacillus circulans xylanase, we have revisited the formalism for the ionization equilibria of two coupled acidic residues. In general, fitting NMR-monitored pH titration curves for such a system will only yield the two macroscopic pK A values that reflect the combined effects of both deprotonation reactions. However, through the use of mutations complemented with ionic strength-dependent measurements, we are able to extract the four microscopic pK Ai values governing the branched acid/base equilibria of Glu78 and Glu172 in BcX. These data, confirmed through theoretical calculations, help explain the pH-dependent mechanism of this model GH11 xylanase by demonstrating that the kinetically determined pK A values and hence catalytic roles of these two residues result from their electrostatic coupling.
Directory of Open Access Journals (Sweden)
Tuan Anh Pham
2016-03-01
Full Text Available Hybrid nanoparticle (NP structures containing organic building units such as polymers, peptides, DNA and proteins have great potential in biosensor and electronic applications. The nearly free modification of the polymer chain, the variation of the protein and DNA sequence and the implementation of functional moieties provide a great platform to create inorganic structures of different morphology, resulting in different optical and magnetic properties. Nevertheless, the design and modification of a protein structure with functional groups or sequences for the assembly of biohybrid materials is not trivial. This is mainly due to the sensitivity of its secondary, tertiary and quaternary structure to the changes in the interaction (e.g., hydrophobic, hydrophilic, electrostatic, chemical groups between the protein subunits and the inorganic material. Here, we use hemolysin coregulated protein 1 (Hcp1 from Pseudomonas aeruginosa as a building and gluing unit for the formation of biohybrid structures by implementing cysteine anchoring points at defined positions on the protein rim (Hcp1_cys3. We successfully apply the Hcp1_cys3 gluing unit for the assembly of often linear, hybrid structures of plasmonic gold (Au NP, magnetite (Fe3O4 NP, and cobalt ferrite nanoparticles (CoFe2O4 NP. Furthermore, the assembly of Au NPs into linear structures using Hcp1_cys3 is investigated by UV–vis spectroscopy, TEM and cryo-TEM. One key parameter for the formation of Au NP assembly is the specific ionic strength in the mixture. The resulting network-like structure of Au NPs is characterized by Raman spectroscopy, showing surface-enhanced Raman scattering (SERS by a factor of 8·104 and a stable secondary structure of the Hcp1_cys3 unit. In order to prove the catalytic performance of the gold hybrid structures, they are used as a catalyst in the reduction reaction of 4-nitrophenol showing similar catalytic activity as the pure Au NPs. To further extend the
Timmins, Amy; de Visser, Sam P.
2017-01-01
Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM) study on wildtype and mutant structures. In a previous study (Timmins et al., 2017) we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD) study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter. PMID:29170737
International Nuclear Information System (INIS)
DuBois, Jonathan M.; Porras-Betancourt, Manuel; Massarweh, Gassan; Soucy, Jean-Paul; Kobayashi, Eliane; Rousset, Olivier G.; Rowley, Jared; Reader, Andrew J.; Labbe, Aurelie; Rosa-Neto, Pedro
2016-01-01
Metabotropic glutamate receptor type 5 (mGluR5) is a G protein-coupled receptor that has been implicated in several psychiatric and neurological diseases. The radiopharmaceutical [ 11 C]ABP688 allows for in vivo quantification of mGluR5 availability using positron emission tomography (PET). In this study, we aimed to detail the regional distribution of [ 11 C]ABP688 binding potential (BP ND ) and the existence of age/sex effects in healthy individuals. Thirty-one healthy individuals aged 20 to 77 years (men, n = 18, 45.3 ± 18.2 years; females, n = 13, 41.5 ± 19.6 years) underwent imaging with [ 11 C]ABP688 using the high-resolution research tomograph (HRRT). We developed an advanced partial volume correction (PVC) method using surface-based analysis in order to accurately estimate the regional variation of radioactivity. BP ND was calculated using the simplified reference tissue model, with the cerebellum as the reference region. Surface-based and volume-based analyses were performed for 39 cortical and subcortical regions of interest per hemisphere. We found the highest [ 11 C]ABP688 BP ND in the lateral prefrontal and anterior cingulate cortices. The lowest [ 11 C]ABP688 BP ND was observed in the pre- and post-central gyri as well as the occipital lobes and the thalami. No sex effect was observed. Associations between age and [ 11 C]ABP688 BP ND without PVC were observed in the right amygdala and left putamen, but were not significant after multiple comparisons correction. The present results highlight complexities underlying brain adaptations during the aging process, and support the notion that certain aspects of neurotransmission remain stable during the adult life span. (orig.)
Gass, J T; McGonigal, J T; Chandler, L J
2017-02-01
Alcoholism is a chronic relapsing disorder characterized by periods of heavy alcohol consumption and unsuccessful attempts at abstinence. Relapse is one of the most problematic aspects in the treatment of alcoholism and is triggered by ethanol-associated cues. Extinction-based cue exposure therapies have proven ineffective in the treatment of alcoholism. However, positive allosteric modulation of mGlu5 with CDPPB enhances the extinction learning of alcohol-seeking behavior. The current study investigated the impact of chronic alcohol exposure on the extinction of ethanol-seeking behavior. Adult Wistar rats were trained to self-administer alcohol with a light/tone stimulus serving as the alcohol cue. After training, one group of rats was exposed to chronic intermittent ethanol (CIE) daily for a period of 2 weeks to induce ethanol dependence. Control rats were exposed to air for the same period of time. Both groups were then retrained to self-administer ethanol and subsequently tested for changes in extinction learning. CIE exposed rats consumed more ethanol compared to their pre-CIE levels and to control rats. During extinction training, CIE rats responded significantly more on the previously active lever and required more sessions to reach extinction criteria compared to control rats. Treatment with CDPPB facilitated extinction in control rats and attenuated the increased resistance to extinction in CIE-exposed rats. These results demonstrate that chronic ethanol exposure not only alters ethanol intake, but also the extinction of ethanol-seeking behaviors. The ability to attenuate deficits through modulation of mGlu5 provides a potential target for pharmacological manipulation that could ultimately reduce relapse in alcoholics. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kang, S; Brange, J; Burch, A; Vølund, A; Owens, D R
1991-11-01
The subcutaneous absorption and resulting changes in plasma insulin or analogue, glucose, C-peptide, and blood intermediary metabolite concentrations after subcutaneous bolus injection of three soluble human insulin analogues (AspB9GluB27, monomeric; AspB28, mixture of monomers and dimers; and AspB10, dimeric) and soluble human insulin were evaluated. Fasting healthy male volunteers (n = 7) were studied on five occasions 1 wk apart randomly receiving 0.6 nmol.kg-1 s.c. 125I-labeled AspB10 or soluble human insulin (Novolin R, Novo, Copenhagen); 1st study and 0.6 nmol.kg-1 s.c. 125I-labeled AspB28, AspB9GluB27 or soluble human insulin (2nd study). Residual radioactivity at the injection site was measured over 8 h with frequent venous sampling for plasma immunoreactive insulin or analogue, glucose, C-peptide, and blood intermediary metabolite concentrations. The three analogues were absorbed 2-3 times faster than human insulin. The mean +/- SE time to 50% residual radioactivity was 94 +/- 6 min for AspB10 compared with 184 +/- 10 min for human insulin (P less than 0.001), 83 +/- 8 min for AspB28 (P less than 0.005), and 63 +/- 9 min for AspB9GluB27 (P less than 0.001) compared with 182 +/- 21 min for human insulin. delta Peak plasma insulin analogue levels were significantly higher after each analogue than after human insulin (P less than 0.005). With all three analogues, the mean hypoglycemic nadir occurred earlier at 61-65 min postinjection compared with 201-210 min for the reference human insulins (P less than 0.005). The magnitude of the hypoglycemic nadir was greater after AspB9GluB27 (P less than 0.05) and AspB28 (P less than 0.001) compared with human insulin. There was a significantly faster onset and offset of responses in C-peptide and intermediary metabolite levels after the analogues than after human insulin (P less than 0.05). The rapid absorption and biological actions of these analogues offer potential therapeutic advantages over the current short
Chen, Y.; Sun, A.; Wang, M.; Zhu, Z.; Ouwerkerk, P.B.F.
2014-01-01
Glutelins are the most abundant storage proteins in rice grain and can make up to 80 % of total protein content. The promoter region of GluB-1, one of the glutelin genes in rice, has been intensively used as a model to understand regulation of seed-storage protein accumulation. In this study, we
Long, Georgina V; Trefzer, Uwe; Davies, Michael A; Kefford, Richard F; Ascierto, Paolo A; Chapman, Paul B; Puzanov, Igor; Hauschild, Axel; Robert, Caroline; Algazi, Alain; Mortier, Laurent; Tawbi, Hussein; Wilhelm, Tabea; Zimmer, Lisa; Switzky, Julie; Swann, Suzanne; Martin, Anne-Marie; Guckert, Mary; Goodman, Vicki; Streit, Michael; Kirkwood, John M; Schadendorf, Dirk
2012-11-01
Brain metastases are common in patients with metastatic melanoma and median overall survival from their diagnosis is typically 17-22 weeks. We assessed dabrafenib in patients with Val600Glu or Val600Lys BRAF-mutant melanoma metastatic to the brain. We undertook a multicentre, open-label, phase 2 trial in 24 centres in six countries. We enrolled patients with histologically confirmed Val600Glu or Val600Lys BRAF-mutant melanoma and at least one asymptomatic brain metastasis (≥5 mm and ≤40 mm in diameter). Eligible patients were aged 18 years or older, had an Eastern Cooperative Oncology Group performance status of 0 or 1, and had adequate organ function. Patients were split into two cohorts: those in cohort A had not received previous local treatment for brain metastases and those in cohort B had progressive brain metastases after previous local treatments. Patients received 150 mg oral dabrafenib twice a day until disease progression, death, or unacceptable adverse events. The primary endpoint was the proportion of patients with Val600Glu BRAF-mutant melanoma who achieved an overall intracranial response, which was defined as a complete response or partial response assessed with a modified form of Response Evaluation Criteria in Solid Tumors (RECIST 1.1). We included patients who received at least one dose of dabrafenib in efficacy and safety analyses. This study is registered with ClinicalTrials.gov, number NCT01266967. Between Feb 2, 2011, and Aug 5, 2011, we enrolled 172 patients: 89 (52%) in cohort A and 83 (48%) in cohort B. 139 (81%) had Val600Glu BRAF-mutant melanoma. 29 (39·2%, 95% CI 28·0-51·2) of 74 patients with Val600Glu BRAF-mutant melanoma in cohort A achieved an overall intracranial response, as did 20 (30·8%, 19·9-43·4) of 65 in cohort B. One (6·7%, 0·2-31·9) of 15 patients with Val600Lys BRAF-mutant melanoma achieved an overall intracranial response in cohort A, as did four (22·2%, 6·4-47·6) of 18 such patients in cohort B. Treatment
Bae, Ji-Eun; Kim, In Jung; Nam, Ki Hyun
2017-11-04
Many fluorescent proteins (FPs) exhibit fluorescence quenching at a low pH. This pH-induced non-fluorescent state of an FP serves as a useful indicator of the cellular pH. ZsYellow is widely used as an optical marker in molecular biology, but its pH-induced non-fluorescent state has not been characterized. Here, we report the pH-dependent spectral properties of ZsYellow, which exhibited the pH-induced non-fluorescence state at a pH below 4.0. We determined the crystal structures of ZsYellow at pH 3.5 (non-fluorescence state) and 8.0 (fluorescence state), which revealed the cis-configuration of the chromophore without pH-induced isomerization. In the non-fluorescence state, Arg95, which is involved in stabilization of the exited state of the chromophore, was found to more loosely interact with the carbonyl oxygen atom of the chromophore when compared to the interaction at pH 8.0. In the fluorescence state, Glu221, which is involved in the hydrogen bonding network around the chromophore, stably interacted with Gln42 and His202. By contrast, in the non-fluorescence state, the protonated conserved Glu221 residue exhibited a large conformational change and was separated from His202 by 5.46 Å, resulting in breakdown of the hydrogen bond network. Our results provide insight into the critical role of the conserved Glu221 residue for generating the pH-induced non-fluorescent state. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Amy Timmins
2017-11-01
Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.
Energy Technology Data Exchange (ETDEWEB)
DuBois, Jonathan M.; Porras-Betancourt, Manuel; Massarweh, Gassan; Soucy, Jean-Paul; Kobayashi, Eliane [McGill University, Department of Neurology and Neurosurgery, Montreal Neurological Institute, Montreal, Quebec (Canada); Rousset, Olivier G. [Johns Hopkins University, The Russell H. Morgan Department of Radiology and Radiological Science, Baltimore, MD (United States); Rowley, Jared [McGill University, Translational Neuroimaging Laboratory, McGill Center for Studies in Aging, Douglas Mental Health University Institute, Montreal (Canada); Reader, Andrew J. [McGill University, PET Unit, McConnell Brain Imaging Center, Montreal Neurological Institute, Montreal (Canada); King' s College London, St. Thomas' Hospital, Division of Imaging Sciences and Biomedical Engineering, London (United Kingdom); Labbe, Aurelie [McGill University, Department of Epidemiology, Biostatistics and Occupational health, Montreal (Canada); Douglas Mental Health University Institute / Douglas Institut Universitaire en Sante Mentale, Department of Psychiatry, Montreal (Canada); Rosa-Neto, Pedro [McGill University, Department of Neurology and Neurosurgery, Montreal Neurological Institute, Montreal, Quebec (Canada); McGill University, Translational Neuroimaging Laboratory, McGill Center for Studies in Aging, Douglas Mental Health University Institute, Montreal (Canada)
2016-01-15
Metabotropic glutamate receptor type 5 (mGluR5) is a G protein-coupled receptor that has been implicated in several psychiatric and neurological diseases. The radiopharmaceutical [{sup 11}C]ABP688 allows for in vivo quantification of mGluR5 availability using positron emission tomography (PET). In this study, we aimed to detail the regional distribution of [{sup 11}C]ABP688 binding potential (BP{sub ND}) and the existence of age/sex effects in healthy individuals. Thirty-one healthy individuals aged 20 to 77 years (men, n = 18, 45.3 ± 18.2 years; females, n = 13, 41.5 ± 19.6 years) underwent imaging with [{sup 11}C]ABP688 using the high-resolution research tomograph (HRRT). We developed an advanced partial volume correction (PVC) method using surface-based analysis in order to accurately estimate the regional variation of radioactivity. BP{sub ND} was calculated using the simplified reference tissue model, with the cerebellum as the reference region. Surface-based and volume-based analyses were performed for 39 cortical and subcortical regions of interest per hemisphere. We found the highest [{sup 11}C]ABP688 BP{sub ND} in the lateral prefrontal and anterior cingulate cortices. The lowest [{sup 11}C]ABP688 BP{sub ND} was observed in the pre- and post-central gyri as well as the occipital lobes and the thalami. No sex effect was observed. Associations between age and [{sup 11}C]ABP688 BP{sub ND} without PVC were observed in the right amygdala and left putamen, but were not significant after multiple comparisons correction. The present results highlight complexities underlying brain adaptations during the aging process, and support the notion that certain aspects of neurotransmission remain stable during the adult life span. (orig.)
DEFF Research Database (Denmark)
Jensen, H K; Jensen, T G; Jensen, L G
1994-01-01
acid residue 119 in the third repeat of the cysteine-rich ligand binding domain of the mature LDL receptor. Disruption of LDL receptor function by the Glu119-Lys mutation was confirmed by site-directed mutagenesis and expression in COS-7 cells. By Western blotting the mutation was found to affect...
International Nuclear Information System (INIS)
Díaz, G A; Cruz, R A; Chávez, A M
2013-01-01
Bamboo is considered one of the best timber resources in the world because for its mechanical properties and high sustainability; this research aims to improve the mechanical properties of the laminated glued bamboo Guadua Angustifolia Kunth (GAK) for use as structural elements, starting from de very manufacture process; this is important because it is possible to observe variations in the flexural strength and the elastic modulus in GAK samples taken from different heights and thickness of the culm. In order to analyze the influence of these final mechanical properties variations in the laminated, the height of the culm where samples are extracted (cepa, basa and sobrebasa) it is taken as a variable from where different types of laminated were manufactured, seeking to make optimal the configuration based in the transversal section area and the material strength. Three assemblies were designed varying the overlap of the adhesion lines and it concluded that the highest strength average values were obtained in the laminated composites manufactured with samples taken from the bottom of the culm (basa), which is possible because in these elements there are less adhesion lines than the other ones (middle, top and mixed) or the better matching of themselves
Generalized multiscale finite element method for elasticity equations
Chung, Eric T.
2014-10-05
In this paper, we discuss the application of generalized multiscale finite element method (GMsFEM) to elasticity equation in heterogeneous media. We consider steady state elasticity equations though some of our applications are motivated by elastic wave propagation in subsurface where the subsurface properties can be highly heterogeneous and have high contrast. We present the construction of main ingredients for GMsFEM such as the snapshot space and offline spaces. The latter is constructed using local spectral decomposition in the snapshot space. The spectral decomposition is based on the analysis which is provided in the paper. We consider both continuous Galerkin and discontinuous Galerkin coupling of basis functions. Both approaches have their cons and pros. Continuous Galerkin methods allow avoiding penalty parameters though they involve partition of unity functions which can alter the properties of multiscale basis functions. On the other hand, discontinuous Galerkin techniques allow gluing multiscale basis functions without any modifications. Because basis functions are constructed independently from each other, this approach provides an advantage. We discuss the use of oversampling techniques that use snapshots in larger regions to construct the offline space. We provide numerical results to show that one can accurately approximate the solution using reduced number of degrees of freedom.
General Base-General Acid Catalysis in Human Histone Deacetylase 8.
Gantt, Sister M Lucy; Decroos, Christophe; Lee, Matthew S; Gullett, Laura E; Bowman, Christine M; Christianson, David W; Fierke, Carol A
2016-02-09
Histone deacetylases (HDACs) regulate cellular processes such as differentiation and apoptosis and are targeted by anticancer therapeutics in development and in the clinic. HDAC8 is a metal-dependent class I HDAC and is proposed to use a general acid-base catalytic pair in the mechanism of amide bond hydrolysis. Here, we report site-directed mutagenesis and enzymological measurements to elucidate the catalytic mechanism of HDAC8. Specifically, we focus on the catalytic function of Y306 and the histidine-aspartate dyads H142-D176 and H143-D183. Additionally, we report X-ray crystal structures of four representative HDAC8 mutants: D176N, D176N/Y306F, D176A/Y306F, and H142A/Y306F. These structures provide a useful framework for understanding enzymological measurements. The pH dependence of kcat/KM for wild-type Co(II)-HDAC8 is bell-shaped with two pKa values of 7.4 and 10.0. The upper pKa reflects the ionization of the metal-bound water molecule and shifts to 9.1 in Zn(II)-HDAC8. The H142A mutant has activity 230-fold lower than that of wild-type HDAC8, but the pKa1 value is not altered. Y306F HDAC8 is 150-fold less active than the wild-type enzyme; crystal structures show that Y306 hydrogen bonds with the zinc-bound substrate carbonyl, poised for transition state stabilization. The H143A and H142A/H143A mutants exhibit activity that is >80000-fold lower than that of wild-type HDAC8; the buried D176N and D176A mutants have significant catalytic effects, with more subtle effects caused by D183N and D183A. These enzymological and structural studies strongly suggest that H143 functions as a single general base-general acid catalyst, while H142 remains positively charged and serves as an electrostatic catalyst for transition state stabilization.
EVALUATION OF STRENGTH TO SHEAR AND DELAMINATION IN GLUED LAMINATED WOOD
Directory of Open Access Journals (Sweden)
Carlito Calil Neto
2014-12-01
Full Text Available The Glued Laminated Wood has a large range of applications. In Brazil, its employment as cross-piece poles for overhead electrical power has attracted the attention of companies in the industry, motivated by the potential use of this material. Among the factors that influence the mechanical performance of Glulam solutions stand out efficiency and affinity of the adhesives to the species of wood used, the type of treatment and moisture content of wood veneer, motivating the development of new research on this topic. This research aimed to investigate, by Design of Experiments (DOE, the influence of wood (pinus, teca, eucalipto, adhesive (Purbond; Cascophen and treatment (CCA, CCB, CCBS in the variable responses shear strength and delamination, consisting in the same combination factors evaluated in ANEEL/EESC-PD220-07 project: Head Crosshead Glulam Series. The results of the statistical analysis showed that the species factor expressed significant effect for both response variables evaluated, did not occur with adhesive and treatment factors. Moisture content was significant in the wood evaluated when analyzed the shear strength, and the teca wood showed the highest shear strength and also relating to the delamination.
Directory of Open Access Journals (Sweden)
Rakesh Rai
2015-01-01
Full Text Available In the present communication, we have investigated effects of the CDRI-08, a well characterized extract of Bacopa monnieri, on expression of the GluN2B subunit of NMDAR in various brain regions of the scopolamine-induced amnesic mice. Our behavioral data reveal that scopolamine-treated amnesic mice exhibit significant decline in the spatial memory compared to the normal control mice. Our RT-PCR and immunoblotting data revealed that the scopolamine treatment resulted in a significant downregulation of the NMDAR GluN2B subunit expression in prefrontal cortex and hippocampus. Our enzyme assay data revealed that scopolamine caused a significant increase in the acetylcholinesterase activity in both the brain regions. Further, oral administration of the CDRI-08 to scopolamine-treated amnesic mice restored the spatial memory which was found to be associated with significant upregulation of the GluN2B subunit expression and decline in the acetylcholinesterase activity in prefrontal cortex as well as hippocampus towards their levels in the normal control mice. Our study provides the evidence for the mechanism underlying role of the Bacopa monnieri extract (CDRI-08 in restoring spatial memory in amnesic mice, which may have therapeutic implications.
Advances in heuristically based generalized perturbation theory
International Nuclear Information System (INIS)
Gandini, A.
1994-01-01
A distinctive feature of heuristically based generalized perturbation theory methodology consists in the systematic use of importance conservation concepts. As well known, this use leads to fundamental reciprocity relationship. Instead, the alternative variational and differential one approaches make a consistent use of the properties and adjoint functions. The equivalence between the importance and the adjoint functions have been demonstrated in important cases. There are some instances, however, in which the commonly known operator governing the adjoint function are not adequate. In this paper ways proposed to generalize this rules, as adopted with the heuristic generalized perturbation theory methodology, are illustrated. When applied to the neutron/nuclide field characterizing the core evolution in a power reactor system, in which also an intensive control variable (ρ) is defined, these rules leas to an orthogonality relationship connected to this same control variable. A set of ρ-mode eigenfunctions may be correspondingly defined and an extended concept of reactivity (generalizing that commonly associated with the multiplication factor) proposed as more directly indicative of the controllability of a critical reactor system. (author). 25 refs
Ohara-Nemoto, Yuko; Shimoyama, Yu; Kimura, Shigenobu; Kon, Asako; Haraga, Hiroshi; Ono, Toshio; Nemoto, Takayuki K
2011-11-04
Porphyromonas gingivalis and Porphyromonas endodontalis, asaccharolytic black-pigmented anaerobes, are predominant pathogens of human chronic and periapical periodontitis, respectively. They incorporate di- and tripeptides from the environment as carbon and energy sources. In the present study we cloned a novel dipeptidyl peptidase (DPP) gene of P. endodontalis ATCC 35406, designated as DPP11. The DPP11 gene encoded 717 amino acids with a molecular mass of 81,090 Da and was present as a 75-kDa form with an N terminus of Asp(22). A homology search revealed the presence of a P. gingivalis orthologue, PGN0607, that has been categorized as an isoform of authentic DPP7. P. gingivalis DPP11 was exclusively cell-associated as a truncated 60-kDa form, and the gene ablation retarded cell growth. DPP11 specifically removed dipeptides from oligopeptides with the penultimate N-terminal Asp and Glu and has a P2-position preference to hydrophobic residues. Optimum pH was 7.0, and the k(cat)/K(m) value was higher for Asp than Glu. Those activities were lost by substitution of Ser(652) in P. endodontalis and Ser(655) in P. gingivalis DPP11 to Ala, and they were consistently decreased with increasing NaCl concentration. Arg(670) is a unique amino acid completely conserved in all DPP11 members distributed in the genera Porphyromonas, Bacteroides, and Parabacteroides, whereas this residue is converted to Gly in all authentic DPP7 members. Substitution analysis suggested that Arg(670) interacts with an acidic residue of the substrate. Considered to preferentially utilize acidic amino acids, DPP11 ensures efficient degradation of oligopeptide substrates in these Gram-negative anaerobic rods.
Ohara-Nemoto, Yuko; Shimoyama, Yu; Kimura, Shigenobu; Kon, Asako; Haraga, Hiroshi; Ono, Toshio; Nemoto, Takayuki K.
2011-01-01
Porphyromonas gingivalis and Porphyromonas endodontalis, asaccharolytic black-pigmented anaerobes, are predominant pathogens of human chronic and periapical periodontitis, respectively. They incorporate di- and tripeptides from the environment as carbon and energy sources. In the present study we cloned a novel dipeptidyl peptidase (DPP) gene of P. endodontalis ATCC 35406, designated as DPP11. The DPP11 gene encoded 717 amino acids with a molecular mass of 81,090 Da and was present as a 75-kDa form with an N terminus of Asp22. A homology search revealed the presence of a P. gingivalis orthologue, PGN0607, that has been categorized as an isoform of authentic DPP7. P. gingivalis DPP11 was exclusively cell-associated as a truncated 60-kDa form, and the gene ablation retarded cell growth. DPP11 specifically removed dipeptides from oligopeptides with the penultimate N-terminal Asp and Glu and has a P2-position preference to hydrophobic residues. Optimum pH was 7.0, and the kcat/Km value was higher for Asp than Glu. Those activities were lost by substitution of Ser652 in P. endodontalis and Ser655 in P. gingivalis DPP11 to Ala, and they were consistently decreased with increasing NaCl concentration. Arg670 is a unique amino acid completely conserved in all DPP11 members distributed in the genera Porphyromonas, Bacteroides, and Parabacteroides, whereas this residue is converted to Gly in all authentic DPP7 members. Substitution analysis suggested that Arg670 interacts with an acidic residue of the substrate. Considered to preferentially utilize acidic amino acids, DPP11 ensures efficient degradation of oligopeptide substrates in these Gram-negative anaerobic rods. PMID:21896480
Mazumder, Muhammed Khairujjaman; Borah, Anupom
2014-12-01
Hyperactivation of GluN2B subunit containing N-methyl-d-aspartate receptors (NMDARs) significantly contributes to the development of several neurodegenerative diseases through a process called excitotoxicity. NMDARs are voltage-gated Ca2+ channels which when activated lead to excessive influx of Ca2+ into neurons thereby exacerbating several calcium-dependent pathways that cause oxidative stress and apoptosis. Several drugs are presently in use to counter the NMDAR-mediated excitotoxic events among which Ifenprodil and its derivatives are GluN2B selective allosteric antagonists. Certain non-steroidal anti-inflammatory drugs (NSAIDs) have also been reported to inhibit NMDARs and the resultant pathologies. Meanwhile, Piroxicam, which is a NSAID, has been reported to be protective in cerebral ischemia-induced neurodegeneration through various pathways. Since Piroxicam has more number of interacting groups as compared to other NSAIDs and also has structural similarities with Ifenprodil, we thought it prudent that Piroxicam may inhibit NMDARs similar to Ifenprodil. By using molecular docking as a tool, we validated the hypothesis and hereby report for the first time that Piroxicam can inhibit GluN2B containing NMDARs through allosteric mode similar to the well known selective antagonist--Ifenprodil; and thus can be a therapeutic drug for the prevention of excitotoxic neurodegeneration. Copyright © 2014 Elsevier Ltd. All rights reserved.
Glutamate metabotropic receptors as targets for drug therapy in epilepsy.
Moldrich, Randal X; Chapman, Astrid G; De Sarro, Giovambattista; Meldrum, Brian S
2003-08-22
Metabotropic glutamate (mGlu) receptors have multiple actions on neuronal excitability through G-protein-linked modifications of enzymes and ion channels. They act presynaptically to modify glutamatergic and gamma-aminobutyric acid (GABA)-ergic transmission and can contribute to long-term changes in synaptic function. The recent identification of subtype-selective agonists and antagonists has permitted evaluation of mGlu receptors as potential targets in the treatment of epilepsy. Agonists acting on group I mGlu receptors (mGlu1 and mGlu5) are convulsant. Antagonists acting on mGlu1 or mGlu5 receptors are anticonvulsant against 3,5-dihydroxyphenylglycine (DHPG)-induced seizures and in mouse models of generalized motor seizures and absence seizures. The competitive, phenylglycine mGlu1/5 receptor antagonists generally require intracerebroventricular administration for potent anticonvulsant efficacy but noncompetitive antagonists, e.g., (3aS,6aS)-6a-naphthalen-2-ylmethyl-5-methyliden-hexahydrocyclopenta[c]furan-1-on (BAY36-7620), 2-methyl-6-(phenylethynyl)pyridine hydrochloride (MPEP), and 2-methyl-6-(2-phenylethenyl)pyridine (SIB-1893) block generalized seizures with systemic administration. Agonists acting on group II mGlu receptors (mGlu2, mGlu3) to reduce glutamate release are anticonvulsant, e.g., 2R,4R-aminopyrrolidine-2,4-dicarboxylate [(2R,4R)-APDC], (+)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylic acid (LY354740), and (-)-2-oxa-4-aminobicyclo[3.1.0]hexane-4,6-dicarboxylate (LY379268). The classical agonists acting on group III mGlu receptors such as L-(+)-2-amino-4-phosphonobutyric acid, and L-serine-O-phosphate are acutely proconvulsant with some anticonvulsant activity. The more recently identified agonists (R,S)-4-phosphonophenylglycine [(R,S)-PPG] and (S)-3,4-dicarboxyphenylglycine [(S)-3,4-DCPG] and (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid [ACPT-1] are all anticonvulsant without proconvulsant effects. Studies in animal models of kindling
Chiaraluce, R.; Florio, R.; Angelaccio, S.; Gianese, G.; Lieshout, van J.F.T.; Oost, van der J.; Consalvi, V.
2007-01-01
The thermodynamic stability of family 16 endo-ß-1,3-glucanase (EC 3.2.1.39) from the hyperthermophilic archaeon Pyrococcus furiosus is decreased upon single (D287A, E53A) and double (E53A/D287A) mutation of Asp287 and Glu53. In accordance with the homology model prediction, both carboxylic acids are
Lim, Chae-Seok; Hoang, Elizabeth T.; Viar, Kenneth E.; Stornetta, Ruth L.; Scott, Michael M.; Zhu, J. Julius
2014-01-01
Fragile X syndrome, caused by the loss of Fmr1 gene function, is the most common form of inherited mental retardation. Lim et al. find that compounds activating serotonin (5HT) subtype 2B receptors or dopamine (DA) subtype 1-like receptors and those inhibiting 5HT2A-Rs or D2-Rs enhance Ras signaling, GluA1-dependent synaptic plasticity, and learning in Fmr1 knockout mice. Combining 5HT and DA compounds at low doses synergistically restored normal learning. This suggests that properly dosed an...
A General Attribute and Rule Based Role-Based Access Control Model
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
Growing numbers of users and many access control policies which involve many different resource attributes in service-oriented environments bring various problems in protecting resource. This paper analyzes the relationships of resource attributes to user attributes in all policies, and propose a general attribute and rule based role-based access control(GAR-RBAC) model to meet the security needs. The model can dynamically assign users to roles via rules to meet the need of growing numbers of users. These rules use different attribute expression and permission as a part of authorization constraints, and are defined by analyzing relations of resource attributes to user attributes in many access policies that are defined by the enterprise. The model is a general access control model, and can support many access control policies, and also can be used to wider application for service. The paper also describes how to use the GAR-RBAC model in Web service environments.
Ngomba, R.T.; Biagioni, F.; Casciato, S.; Willems-van Bree, P.C.M.; Battaglia, G.; Bruno, V.; Nicoletti, F.; Luijtelaar, E.L.J.M. van
2005-01-01
We examined the expression and function of group-II metabotropic glutamate (mGlu) receptors in an animal model of absence seizures using genetically epileptic WAG/Rij rats, which develop spontaneous non-convulsive seizures after 2-3 months of age. Six-month-old WAG/Rij rats showed an increased
Directory of Open Access Journals (Sweden)
Abdallah Ahnaou
Full Text Available Improvement of cognitive impairments represents a high medical need in the development of new antipsychotics. Aberrant EEG gamma oscillations and reductions in the P1/N1 complex peak amplitude of the auditory evoked potential (AEP are neurophysiological biomarkers for schizophrenia that indicate disruption in sensory information processing. Inhibition of phosphodiesterase (i.e. PDE10A and activation of metabotropic glutamate receptor (mGluR2 signaling are believed to provide antipsychotic efficacy in schizophrenia, but it is unclear whether this occurs with cognition-enhancing potential. The present study used the auditory paired click paradigm in passive awake Sprague Dawley rats to 1 model disruption of AEP waveforms and oscillations as observed in schizophrenia by peripheral administration of amphetamine and the N-methyl-D-aspartate (NMDA antagonist phencyclidine (PCP; 2 confirm the potential of the antipsychotics risperidone and olanzapine to attenuate these disruptions; 3 evaluate the potential of mGluR2 agonist LY404039 and PDE10 inhibitor PQ-10 to improve AEP deficits in both the amphetamine and PCP models. PCP and amphetamine disrupted auditory information processing to the first click, associated with suppression of the P1/N1 complex peak amplitude, and increased cortical gamma oscillations. Risperidone and olanzapine normalized PCP and amphetamine-induced abnormalities in AEP waveforms and aberrant gamma/alpha oscillations, respectively. LY404039 increased P1/N1 complex peak amplitudes and potently attenuated the disruptive effects of both PCP and amphetamine on AEPs amplitudes and oscillations. However, PQ-10 failed to show such effect in either models. These outcomes indicate that modulation of the mGluR2 results in effective restoration of abnormalities in AEP components in two widely used animal models of psychosis, whereas PDE10A inhibition does not.
Dietz, Birte; Manahan-Vaughan, Denise
2017-03-15
Long-term potentiation (LTP) and long-term depression (LTD) are key cellular processes that support memory formation. Whereas increases of synaptic strength by means of LTP may support the creation of a spatial memory 'engram', LTD appears to play an important role in refining and optimising experience-dependent encoding. A differentiation in the role of hippocampal subfields is apparent. For example, LTD in the dentate gyrus (DG) is enabled by novel learning about large visuospatial features, whereas in area CA1, it is enabled by learning about discrete aspects of spatial content, whereby, both discrete visuospatial and olfactospatial cues trigger LTD in CA1. Here, we explored to what extent local audiospatial cues facilitate information encoding in the form of LTD in these subfields. Coupling of low frequency afferent stimulation (LFS) with discretely localised, novel auditory tones in the sonic hearing, or ultrasonic range, facilitated short-term depression (STD) into LTD (>24 h) in CA1, but not DG. Re-exposure to the now familiar audiospatial configuration ca. 1 week later failed to enhance STD. Reconfiguration of the same audiospatial cues resulted anew in LTD when ultrasound, but not non-ultrasound cues were used. LTD facilitation that was triggered by novel exposure to spatially arranged tones, or to spatial reconfiguration of the same tones were both prevented by an antagonism of the metabotropic glutamate receptor, mGlu5. These data indicate that, if behaviourally salient enough, the hippocampus can use audiospatial cues to facilitate LTD that contributes to the encoding and updating of spatial representations. Effects are subfield-specific, and require mGlu5 activation, as is the case for visuospatial information processing. These data reinforce the likelihood that LTD supports the encoding of spatial features, and that this occurs in a qualitative and subfield-specific manner. They also support that mGlu5 is essential for synaptic encoding of spatial
DEFF Research Database (Denmark)
Darmer, D; Schmutzler, C; Diekhoff, D
1991-01-01
Neuropeptides containing the carboxylterminal sequence Arg-Phe-NH2 are found throughout the animal kingdom and are important substances mediating neuronal communication. Here, we have cloned the cDNA coding for the precursor protein of the sea anemone neuropeptide (Antho-RFamide) less than Glu...... harbors four other putative neuropeptides that are much less related to Antho-RFamide. This report shows that the biosynthetic machinery for neuropeptides in coelenterates, the lowest animal group having a nervous system, is already very efficient and similar to that of higher invertebrates...
Complexity analysis based on generalized deviation for financial markets
Li, Chao; Shang, Pengjian
2018-03-01
In this paper, a new modified method is proposed as a measure to investigate the correlation between past price and future volatility for financial time series, known as the complexity analysis based on generalized deviation. In comparison with the former retarded volatility model, the new approach is both simple and computationally efficient. The method based on the generalized deviation function presents us an exhaustive way showing the quantization of the financial market rules. Robustness of this method is verified by numerical experiments with both artificial and financial time series. Results show that the generalized deviation complexity analysis method not only identifies the volatility of financial time series, but provides a comprehensive way distinguishing the different characteristics between stock indices and individual stocks. Exponential functions can be used to successfully fit the volatility curves and quantify the changes of complexity for stock market data. Then we study the influence for negative domain of deviation coefficient and differences during the volatile periods and calm periods. after the data analysis of the experimental model, we found that the generalized deviation model has definite advantages in exploring the relationship between the historical returns and future volatility.
Catches, Justin S; Xu, Jian; Contractor, Anis
2012-03-17
There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4(-/-) mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4(-/-) mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4(-/-) mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. Copyright © 2011 Elsevier B.V. All rights reserved.
Implementing evidence-based medicine in general practice: a focus group based study
Directory of Open Access Journals (Sweden)
Aertgeerts Bert
2005-09-01
Full Text Available Abstract Background Over the past years concerns are rising about the use of Evidence-Based Medicine (EBM in health care. The calls for an increase in the practice of EBM, seem to be obstructed by many barriers preventing the implementation of evidence-based thinking and acting in general practice. This study aims to explore the barriers of Flemish GPs (General Practitioners to the implementation of EBM in routine clinical work and to identify possible strategies for integrating EBM in daily work. Methods We used a qualitative research strategy to gather and analyse data. We organised focus groups between September 2002 and April 2003. The focus group data were analysed using a combined strategy of 'between-case' analysis and 'grounded theory approach'. Thirty-one general practitioners participated in four focus groups. Purposeful sampling was used to recruit participants. Results A basic classification model documents the influencing factors and actors on a micro-, meso- as well as macro-level. Patients, colleagues, competences, logistics and time were identified on the micro-level (the GPs' individual practice, commercial and consumer organisations on the meso-level (institutions, organisations and health care policy, media and specific characteristics of evidence on the macro-level (policy level and international scientific community. Existing barriers and possible strategies to overcome these barriers were described. Conclusion In order to implement EBM in routine general practice, an integrated approach on different levels needs to be developed.
Generalized Empirical Likelihood-Based Focused Information Criterion and Model Averaging
Directory of Open Access Journals (Sweden)
Naoya Sueishi
2013-07-01
Full Text Available This paper develops model selection and averaging methods for moment restriction models. We first propose a focused information criterion based on the generalized empirical likelihood estimator. We address the issue of selecting an optimal model, rather than a correct model, for estimating a specific parameter of interest. Then, this study investigates a generalized empirical likelihood-based model averaging estimator that minimizes the asymptotic mean squared error. A simulation study suggests that our averaging estimator can be a useful alternative to existing post-selection estimators.
Computer-based, Jeopardy™-like game in general chemistry for engineering majors
Ling, S. S.; Saffre, F.; Kadadha, M.; Gater, D. L.; Isakovic, A. F.
2013-03-01
We report on the design of Jeopardy™-like computer game for enhancement of learning of general chemistry for engineering majors. While we examine several parameters of student achievement and attitude, our primary concern is addressing the motivation of students, which tends to be low in a traditionally run chemistry lectures. The effect of the game-playing is tested by comparing paper-based game quiz, which constitutes a control group, and computer-based game quiz, constituting a treatment group. Computer-based game quizzes are Java™-based applications that students run once a week in the second part of the last lecture of the week. Overall effectiveness of the semester-long program is measured through pretest-postest conceptual testing of general chemistry. The objective of this research is to determine to what extent this ``gamification'' of the course delivery and course evaluation processes may be beneficial to the undergraduates' learning of science in general, and chemistry in particular. We present data addressing gender-specific difference in performance, as well as background (pre-college) level of general science and chemistry preparation. We outline the plan how to extend such approach to general physics courses and to modern science driven electives, and we offer live, in-lectures examples of our computer gaming experience. We acknowledge support from Khalifa University, Abu Dhabi
Allocation base of general production costs as optimization of prime costs
Directory of Open Access Journals (Sweden)
Levytska I.O.
2017-03-01
Full Text Available Qualified management aimed at optimizing financial results is the key factor in today's society. Effective management decisions depend on the necessary information about the costs of production process in all its aspects – their structure, types, accounting policies of reflecting costs. General production costs, the so-called indirect costs that are not directly related to the production process, but provide its functioning in terms of supporting structural divisions and create the necessary conditions of production, play a significant role in calculating prime costs of goods (works, services. However, the accurate estimate of prime costs of goods (works, services should be determined with the value of indirect costs (in other words, general production costs, and properly determined with the base of their allocation. The choice of allocation base of general production costs is the significant moment, depending on the nature of business, which must guarantee fair distribution regarding to the largest share of direct expenses in the total structure of production costs. The study finds the essence of general production costs based on the analysis of key definitions of leading Ukrainian economists. The optimal allocation approach of general production costs is to calculate these costs as direct production costs within each subsidiary division (department separately without selecting a base as the main one to the their total amount.
General practice-based clinical trials in Germany - a problem analysis
Directory of Open Access Journals (Sweden)
Hummers-Pradier Eva
2012-11-01
Full Text Available Abstract Background In Germany, clinical trials and comparative effectiveness studies in primary care are still very rare, while their usefulness has been recognised in many other countries. A network of researchers from German academic general practice has explored the reasons for this discrepancy. Methods Based on a comprehensive literature review and expert group discussions, problem analyses as well as structural and procedural prerequisites for a better implementation of clinical trials in German primary care are presented. Results In Germany, basic biomedical science and technology is more reputed than clinical or health services research. Clinical trials are funded by industry or a single national programme, which is highly competitive, specialist-dominated, exclusive of pilot studies, and usually favours innovation rather than comparative effectiveness studies. Academic general practice is still not fully implemented, and existing departments are small. Most general practitioners (GPs work in a market-based, competitive setting of small private practices, with a high case load. They have no protected time or funding for research, and mostly no research training or experience. Good Clinical Practice (GCP training is compulsory for participation in clinical trials. The group defined three work packages to be addressed regarding clinical trials in German general practice: (1 problem analysis, and definition of (2 structural prerequisites and (3 procedural prerequisites. Structural prerequisites comprise specific support facilities for general practice-based research networks that could provide practices with a point of contact. Procedural prerequisites consist, for example, of a summary of specific relevant key measures, for example on a web platform. The platform should contain standard operating procedures (SOPs, templates, checklists and other supporting materials for researchers. Conclusion All in all, our problem analyses revealed that
Directory of Open Access Journals (Sweden)
Lisette Blanco
2011-01-01
Full Text Available Aunque la manipulación farmacológica de los sistemas glutamatérgico y colinérgico se ha tratado en modelos experimentales de enfermedad de Parkinson (EP, pocos autores han realizado estudios de esta temática a nivel del núcleo pedunculopontino (NPP. El presente trabajo aborda los cambios en las concentraciones extracelulares (CE de glutamato (Glu y ácido δ-amino butírico (GABA en el NPP de ratas hemiparkinsonizadas por inyección de 6-hidroxidopamina (6-OHDA y sometidas a la infusión local de MK-801 (10 mol/L o (- nicotina (10mM. La infusión se realizó mediante microdiálisis cerebral y la determinación de las CE de los neurotransmisores se realizó a través de cromatografía líquida de alta resolución acoplada a detección de fluorescencia. La infusión de MK-801 en el NPP produjo una disminución significativa de las CE de Glu (p
Rohof, W. O.; Aronica, E.; Beaumont, H.; Troost, D.; Boeckxstaens, G. E.
2012-01-01
Background Transient lower esophageal sphincter relaxations (TLESRs) are the predominant mechanisms underlying gastro-esophageal reflux. TLESRs are mediated by a vago-vagal reflex, which can be blocked by interaction with metabotropic Glutamate Receptor 5 (mGluR5), ?-aminobutyric acid type B
Work history and mortality risks in 90,268 US radiological technologists.
Liu, Jason J; Freedman, D Michal; Little, Mark P; Doody, Michele M; Alexander, Bruce H; Kitahara, Cari M; Lee, Terrence; Rajaraman, Preetha; Miller, Jeremy S; Kampa, Diane M; Simon, Steven L; Preston, Dale L; Linet, Martha S
2014-12-01
There have been few studies of work history and mortality risks in medical radiation workers. We expanded by 11 years and more outcomes our previous study of mortality risks and work history, a proxy for radiation exposure. Using Cox proportional hazards models, we estimated mortality risks according to questionnaire work history responses from 1983 to 1989 through 2008 by 90,268 US radiological technologists. We controlled for potential confounding by age, birth year, smoking history, body mass index, race and gender. There were 9566 deaths (3329 cancer and 3020 circulatory system diseases). Mortality risks increased significantly with earlier year began working for female breast (p trend=0.01) and stomach cancers (p trend=0.01), ischaemic heart (p trend=0.03) and cerebrovascular diseases (p trend=0.02). The significant trend with earlier year first worked was strongly apparent for breast cancer during baseline through 1997, but not 1998-2008. Risks were similar in the two periods for circulatory diseases. Radiological technologists working ≥5 years before 1950 had elevated mortality from breast cancer (HR=2.05, 95% CI 1.27 to 3.32), leukaemia (HR=2.57, 95% CI 0.96 to 6.68), ischaemic heart disease (HR=1.13, 95% CI 0.96 to 1.33) and cerebrovascular disease (HR=1.28, 95% CI 0.97 to 1.69). No other work history factors were consistently associated with mortality risks from specific cancers or circulatory diseases, or other conditions. Radiological technologists who began working in early periods and for more years before 1950 had increased mortality from a few cancers and some circulatory system diseases, likely reflecting higher occupational radiation exposures in the earlier years. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Uncertainty Analysis of Few Group Cross Sections Based on Generalized Perturbation Theory
International Nuclear Information System (INIS)
Han, Tae Young; Lee, Hyun Chul; Noh, Jae Man
2014-01-01
In this paper, the methodology of the sensitivity and uncertainty analysis code based on GPT was described and the preliminary verification calculations on the PMR200 pin cell problem were carried out. As a result, they are in a good agreement when compared with the results by TSUNAMI. From this study, it is expected that MUSAD code based on GPT can produce the uncertainty of the homogenized few group microscopic cross sections for a core simulator. For sensitivity and uncertainty analyses for general core responses, a two-step method is available and it utilizes the generalized perturbation theory (GPT) for homogenized few group cross sections in the first step and stochastic sampling method for general core responses in the second step. The uncertainty analysis procedure based on GPT in the first step needs the generalized adjoint solution from a cell or lattice code. For this, the generalized adjoint solver has been integrated into DeCART in our previous work. In this paper, MUSAD (Modues of Uncertainty and Sensitivity Analysis for DeCART) code based on the classical perturbation theory was expanded to the function of the sensitivity and uncertainty analysis for few group cross sections based on GPT. First, the uncertainty analysis method based on GPT was described and, in the next section, the preliminary results of the verification calculation on a VHTR pin cell problem were compared with the results by TSUNAMI of SCALE 6.1
Directory of Open Access Journals (Sweden)
Tabolacci Elisabetta
2012-03-01
Full Text Available Abstract Background Fragile X syndrome (FXS, the leading cause of inherited mental retardation, is due to expansion and methylation of a CGG sequence in the FMR1 gene, which result in its silencing and consequent absence of FMRP protein. This absence causes loss of repression of metabotropic glutamate receptor 5 (mGluR5-mediated pathways resulting in the behavioral and cognitive impairments associated with FXS. In a randomized, double-blind trial it was recently demonstrated a beneficial effect of AFQ056, a selective inhibitor of metabotrobic glutamate receptor type 5 (mGluR5, on fully methylated FXS patients respect to partially methylated FXS ones. Methods To determine whether AFQ056 may have secondary effects on the methylation and transcription of FMR1, here we treated three FXS lymphoblastoid cell lines and one normal control male line. A quantitative RT-PCR was performed to assess transcriptional reactivation of the FMR1 gene. To assess the methylation status of the FMR1 gene promoter it was carried out a bisulphite sequencing analysis. Results Both FMR1-mRNA levels and DNA methylation were unmodified with respect to untreated controls. Conclusions These results demonstrate that the AFQ056 effect on fully methylated FXS patients is not due to a secondary effect on DNA methylation and consequent transcriptional activation of FMR1.
The role of Glu259 in Escherichia coli elongation factor Tu in ternary complex formation
DEFF Research Database (Denmark)
Nautrup Pedersen, Gitte; Rattenborg, Thomas; Knudsen, Charlotte Rohde
1998-01-01
Determination of the crystal structure of the ternary complex formed between elongation factor Tu:GTP and aminoacylated tRNA revealed three regions of interaction between elongation factor Tu and tRNA. The structure indicates that the conserved glutamic acid at position 271 in Thermus aquaticus EF-Tu...... could be involved in the binding of the 3' CCA-Phe end of the aminoacylated tRNA. Therefore, the corresponding residue, Glu259, of Escherichia coli EF-Tu was mutated into alanine, aspartic acid, glutamine and tyrosine, in order to substantiate the crystallographic structural evidence and to obtain...... of interaction with tRNA, while mutation to tyrosine abolished completely the interaction with tRNA. Finally, mutation to glutamine resulted in an elongation factor Tu variant behaving like the wild type. In conclusion, the environment around the site binding the CCA-Phe end of the tRNA is very restricted...
Oxygen binding properties of hemoglobin from the white rhinoceros (beta 2-GLU) and the tapir.
Baumann, R; Mazur, G; Braunitzer, G
1984-04-01
The beta-chain of rhinoceros hemoglobin contains glutamic acid at position beta 2, and important site for the binding of organic phosphates. We have investigated the oxygen binding properties of this hemoglobin and its interaction with ATP, 2,3-diphosphoglycerate, CO2 and chloride. The results show that the presence of GLU at position beta 2 nearly abolishes the effect of organic phosphates and CO2, whereas the oxygen-linked binding of chloride is not affected. Thus rhinoceros hemoglobin has only protons and chloride anions as major allosteric effectors for the control of its oxygen affinity. From the results obtained with hemoglobin solutions it can be calculated that the blood oxygen affinity of the rhinoceros must be rather high with a P50 of about 20 torr at pH 7.4 and 37 degrees C, which conforms with observations obtained for other large mammals.
Effects of the mGluR5 antagonist MPEP on ethanol withdrawal induced anxiety-like syndrome in rats.
Kumar, Jaya; Hapidin, Hermizi; Bee, Yvonne-Tee Get; Ismail, Zalina
2013-11-26
Abstinence from chronic ethanol consumption leads to the manifestation of a variety of symptoms attributed to central nervous system hyperexcitability, such as increased irritability, anxiety, and restlessness. Recent studies have demonstrated the importance of metabotropic glutamate receptor 5 (mGluR5) in addictive behaviours. This study investigates the effects of the mGluR5 antagonist 2-methyl-6-(phenylethynyl)-pyridine (MPEP) on ethanol withdrawal induced anxiety using two behavioural paradigms. Male Wistar rats were fed a Modified Liquid Diet (MLD) containing low fat cow milk, sucrose, and maltodextrin with a gradual introduction of 2.4%, 4.8% and 7.2% ethanol for 20 days. Six hours into ethanol withdrawal, the rats were intraperitoneally injected with normal saline and MPEP (2.5, 5.0, 10, 20, 30 mg/kg) and were assessed for ethanol withdrawal induced anxiety-like syndrome using an automated elevated plus maze and an open field. MPEP at 10 mg/kg significantly attenuated ethanol withdrawal induced anxiety without any compromising effects on locomotor activities. Despite reversing several indices of ethanol withdrawal induced anxiety in both the elevated plus maze and the open field, low doses of MPEP (2.5, 5 mg/kg) significantly compromised the locomotor activities of ethanol withdrawn rats. High doses of MPEP (20 and 30 mg/kg) significantly attenuated withdrawal anxiety when tested in the elevated plus maze but not in the open field. Administration of MPEP (2.5, 5, 10, 20, 30 mg/kg) has no significant compromising effect on the locomotor activities of ethanol naïve rats. Despite significantly reducing withdrawal anxiety in both behavioural paradigms at 10 mg/kg, the compromising effects of low and high doses of MPEP must be further explored along with the therapeutic efficiency of this drug for relieving withdrawal induced anxiety.
Buurma, NJ; Blandamer, MJ; Engberts, JBFN; Buurma, Niklaas J.
The reactivity of 1-benzoyl-3-phenyl-1,2,4-triazole (1a) was studied in the presence of a range of weak bases in aqueous solution. A change in mechanism is observed from general-base catalysed hydrolysis to nucleophilic substitution and general-base catalysed nucleophilic substitution. A slight
Lu, Wanjun; Guo, Huirong; Chou, I.-Ming; Burruss, R.C.; Li, Lanlan
2013-01-01
Accurate values of diffusion coefficients for carbon dioxide in water and brine at reservoir conditions are essential to our understanding of transport behavior of carbon dioxide in subsurface pore space. However, the experimental data are limited to conditions at low temperatures and pressures. In this study, diffusive transfer of carbon dioxide in water at pressures up to 45 MPa and temperatures from 268 to 473 K was observed within an optical capillary cell via time-dependent Raman spectroscopy. Diffusion coefficients were estimated by the least-squares method for the measured variations in carbon dioxide concentration in the cell at various sample positions and time. At the constant pressure of 20 MPa, the measured diffusion coefficients of carbon dioxide in water increase with increasing temperature from 268 to 473 K. The relationship between diffusion coefficient of carbon dioxide in water [D(CO2) in m2/s] and temperature (T in K) was derived with Speedy–Angell power-law approach as: D(CO2)=D0[T/Ts-1]m where D0 = 13.942 × 10−9 m2/s, Ts = 227.0 K, and m = 1.7094. At constant temperature, diffusion coefficients of carbon dioxide in water decrease with pressure increase. However, this pressure effect is rather small (within a few percent).
Nikolaeva, L. S.; Semenov, A. N.
2018-02-01
The anticoagulant activity of high-molecular-weight heparin is increased by developing a new highly active heparin complex with glutamate using the thermodynamic model of chemical equilibria based on pH-metric data. The anticoagulant activity of the developed complexes is estimated in the pH range of blood plasma according to the drop in the calculated equilibrium Ca2+ concentration associated with the formation of mixed ligand complexes of Ca2+ ions, heparin (Na4hep), and glutamate (H2Glu). A thermodynamic model is calculated by mathematically modelling chemical equilibria in the CaCl2-Na4hep-H2Glu-H2O-NaCl system in the pH range of 2.30 ≤ pH ≤ 10.50 in diluted saline that acts as a background electrolyte (0.154 M NaCl) at 37°C and initial concentrations of the main components of ν × 10-3 M, where n ≤ 4. The thermodynamic model is used to determine the main complex of the monomeric unit of heparin with glutamate (HhepGlu5-) and the most stable mixed ligand complex of Ca2+ with heparin and glutamate (Ca2hepGlu2-) in the pH range of blood plasma (6.80 ≤ pH ≤ 7.40). It is concluded that the Ca2hepGlu2- complex reduces the Ca2+ concentration 107 times more than the Ca2+ complex with pure heparin. The anticoagulant effect of the developed HhepGlu5- complex is confirmed in vitro and in vivo via coagulation tests on the blood plasma of laboratory rats. Additional antithrombotic properties of the developed complex are identified. The new highly active anticoagulant, HhepGlu5- complex with additional antithrombotic properties, is patented.
International Nuclear Information System (INIS)
Wildgoose, P.; Kisiel, W.; Berkner, K.L.
1990-01-01
Coagulation factor VII circulates in blood as a single-chain zymogen of a serine protease and is converted to its activated two-chain form, factor VIIa, by cleavage of an internal peptide bond located at Arg 152 -Ile 153 . Previous studies using serine protease active-site inhibitors suggest that zymogen factor VII may possess sufficient proteolytic activity to initiate the extrinsic pathway of blood coagulation. In order to assess the putative intrinsic proteolytic activity of single-chain factor VII, the authors have constructed a site-specific mutant of recombinant human factor VII in which arginine-152 has been replaced with a glutamic acid residue. Mutant factor VII was purified in a single step from culture supernatants of baby hamster kidney cells transfected with a plasmid containing the sequence for Arg 152 → Glu factor VII using a calcium-dependent, murine anti-factor VII monoclonal antibody column. The clotting activity of mutant factor VII was completely inhibited following incubation with dansyl-Glu-Gly-Arg chloromethyl ketone, suggesting that the apparent clotting activity of mutant factor VII was due to a contaminating serine protease. Immunoblots of mutant factor VII with human factor IXa revealed no cleavage, whereas incubation of mutant factor VII with human factor Xa resulted in cleavage of mutant factor VII and the formation of a lower molecular weight degradation product migrating at M r ∼40 000. The results are consistent with the proposal that zymogen factor VII possesses no intrinsic proteolytic activity toward factor X or factor IX
Problem-Based Learning in a General Psychology Course.
Willis, Sandra A.
2002-01-01
Describes the adoption of problem-based learning (PBL) techniques in a general psychology course. States that the instructor used a combination of techniques, including think-pair-share, lecture/discussion, and PBL. Notes means and standard deviations for graded components of PBL format versus lecture/discussion format. (Contains 18 references.)…
Metabotropic glutamate receptor type 1 autoimmunity: Clinical features and treatment outcomes.
Lopez-Chiriboga, A Sebastian; Komorowski, Lars; Kümpfel, Tania; Probst, Christian; Hinson, Shannon R; Pittock, Sean J; McKeon, Andrew
2016-03-15
To describe retrospectively the clinical associations of immunoglobulin G (IgG) targeting metabotropic glutamate receptor 1 (mGluR1-IgG). Specimens of 9 patients evaluated on a service basis in the Mayo Clinic Neuroimmunology Laboratory by tissue-based immunofluorescence assay (IFA) yielded a robust, synaptic immunostaining pattern consistent with mGluR1-IgG (serum, 9; CSF, 2 available). Transfected HEK293 cell-based assay (CBA) confirmed mGluR1 specificity in all 11 specimens. A further 2 patients were detected in Germany primarily by CBA. The median symptom onset age for the 11 patients was 58 years (range 33-81 years); 6 were male. All 9 Mayo Clinic patients had subacute onset of cerebellar ataxia, 4 had dysgeusia, 1 had psychiatric symptoms, and 1 had cognitive impairment. All were evaluated for malignancy, but only 1 was affected (cutaneous T-cell lymphoma). One developed ataxia post-herpes zoster infection. Head MRIs were generally atrophic or normal-appearing, and CSF was inflammatory in just 1 of 5 tested, though mGluR1-IgG was detected in both specimens submitted. Five patients improved (attributable to immunotherapy in 4, spontaneously in 1), 3 stabilized (attributable to immunotherapy in 2, cancer therapy in 1), and 1 progressively declined (untreated). The 2 German patients had ataxia, but fulfilled multiple sclerosis diagnostic criteria (1 relapsing-remitting, 1 progressive). However, both had histories of hematologic malignancy (acute lymphocytic leukemia and mantle cell lymphoma), and had mGluR1-IgG detected in serum by CBA (weakly positive on tissue-based IFA). mGluR1 autoimmunity represents a treatable form of cerebellar ataxia. Dysgeusia may be a diagnostic clue. Paraneoplastic, parainfectious, or idiopathic causes may occur. © 2016 American Academy of Neurology.
Metabotropic glutamate receptor type 1 autoimmunity
Lopez-Chiriboga, A. Sebastian; Komorowski, Lars; Kümpfel, Tania; Probst, Christian; Hinson, Shannon R.; Pittock, Sean J.
2016-01-01
Objective: To describe retrospectively the clinical associations of immunoglobulin G (IgG) targeting metabotropic glutamate receptor 1 (mGluR1-IgG). Methods: Specimens of 9 patients evaluated on a service basis in the Mayo Clinic Neuroimmunology Laboratory by tissue-based immunofluorescence assay (IFA) yielded a robust, synaptic immunostaining pattern consistent with mGluR1-IgG (serum, 9; CSF, 2 available). Transfected HEK293 cell-based assay (CBA) confirmed mGluR1 specificity in all 11 specimens. A further 2 patients were detected in Germany primarily by CBA. Results: The median symptom onset age for the 11 patients was 58 years (range 33–81 years); 6 were male. All 9 Mayo Clinic patients had subacute onset of cerebellar ataxia, 4 had dysgeusia, 1 had psychiatric symptoms, and 1 had cognitive impairment. All were evaluated for malignancy, but only 1 was affected (cutaneous T-cell lymphoma). One developed ataxia post–herpes zoster infection. Head MRIs were generally atrophic or normal-appearing, and CSF was inflammatory in just 1 of 5 tested, though mGluR1-IgG was detected in both specimens submitted. Five patients improved (attributable to immunotherapy in 4, spontaneously in 1), 3 stabilized (attributable to immunotherapy in 2, cancer therapy in 1), and 1 progressively declined (untreated). The 2 German patients had ataxia, but fulfilled multiple sclerosis diagnostic criteria (1 relapsing-remitting, 1 progressive). However, both had histories of hematologic malignancy (acute lymphocytic leukemia and mantle cell lymphoma), and had mGluR1-IgG detected in serum by CBA (weakly positive on tissue-based IFA). Conclusions: mGluR1 autoimmunity represents a treatable form of cerebellar ataxia. Dysgeusia may be a diagnostic clue. Paraneoplastic, parainfectious, or idiopathic causes may occur. PMID:26888994
Czech Academy of Sciences Publication Activity Database
Vyklický, Vojtěch; Krausová, Barbora; Černý, Jiří; Ladislav, Marek; Smejkalová, Tereza; Kysilov, Bohdan; Kořínek, Miloslav; Danačíková, Šárka; Horák, Martin; Chodounská, Hana; Kudová, Eva; Vyklický ml., Ladislav
2018-01-01
Roč. 11, Apr 6 (2018), č. článku 110. ISSN 1662-5099 R&D Projects: GA ČR(CZ) GA17-02300S; GA ČR(CZ) GJ16-03913Y; GA TA ČR(CZ) TE01020028; GA MZd(CZ) NV15-29370A; GA MŠk(CZ) LQ1604 Institutional support: RVO:67985823 ; RVO:61388963 Keywords : NMDA receptor * GluN2B * de novo missense mutations * neuropsychiatric disorder * neurosteroids Subject RIV: FH - Neurology OBOR OECD: Neurosciences (including psychophysiology Impact factor: 5.076, year: 2016
Generalized double-humped logistic map-based medical image encryption
Directory of Open Access Journals (Sweden)
Samar M. Ismail
2018-03-01
Full Text Available This paper presents the design of the generalized Double Humped (DH logistic map, used for pseudo-random number key generation (PRNG. The generalized parameter added to the map provides more control on the map chaotic range. A new special map with a zooming effect of the bifurcation diagram is obtained by manipulating the generalization parameter value. The dynamic behavior of the generalized map is analyzed, including the study of the fixed points and stability ranges, Lyapunov exponent, and the complete bifurcation diagram. The option of designing any specific map is made possible through changing the general parameter increasing the randomness and controllability of the map. An image encryption algorithm is introduced based on pseudo-random sequence generation using the proposed generalized DH map offering secure communication transfer of medical MRI and X-ray images. Security analyses are carried out to consolidate system efficiency including: key sensitivity and key-space analyses, histogram analysis, correlation coefficients, MAE, NPCR and UACI calculations. System robustness against noise attacks has been proved along with the NIST test ensuring the system efficiency. A comparison between the proposed system with respect to previous works is presented.
deBacker, Julian; Hawken, Emily R; Normandeau, Catherine P; Jones, Andrea A; Di Prospero, Cynthia; Mechefske, Elysia; Gardner Gregory, James; Hayton, Scott J; Dumont, Éric C
2015-01-01
Drugs of abuse have detrimental effects on homeostatic synaptic plasticity in the motivational brain network. Bidirectional plasticity at excitatory synapses helps keep neural circuits within a functional range to allow for behavioral flexibility. Therefore, impaired bidirectional plasticity of excitatory synapses may contribute to the behavioral hallmarks of addiction, yet this relationship remains unclear. Here we tracked excitatory synaptic strength in the oval bed nucleus of the stria terminalis (ovBNST) using whole-cell voltage-clamp recordings in brain slices from rats self-administering sucrose or cocaine. In the cocaine group, we measured both a persistent increase in AMPA to NMDA ratio (A:N) and slow decay time of NMDA currents throughout the self-administration period and after withdrawal from cocaine. In contrast, the sucrose group exhibited an early increase in A:N ratios (acquisition) that returned toward baseline values with continued self-administration (maintenance) and after withdrawal. The sucrose rats also displayed a decrease in NMDA current decay time with continued self-administration (maintenance), which normalized after withdrawal. Cocaine self-administering rats exhibited impairment in NMDA-dependent long-term depression (LTD) that could be rescued by GluN2B-containing NMDA receptor blockade. Sucrose self-administering rats demonstrated no impairment in NMDA-dependent LTD. During the maintenance period of self-administration, in vivo (daily intraperitoneally for 5 days) pharmacologic blockade of GluN2B-containing NMDA receptors did not reduce lever pressing for cocaine. However, in vivo GluN2B blockade did normalize A:N ratios in cocaine self-administrating rats, and dissociated the magnitude of ovBNST A:N ratios from drug-seeking behavior after protracted withdrawal. Altogether, our data demonstrate when and how bidirectional plasticity at ovBNST excitatory synapses becomes dysfunctional with cocaine self-administration and that NMDA
Generalization of information-based concepts in forecast verification
Tödter, J.; Ahrens, B.
2012-04-01
This work deals with information-theoretical methods in probabilistic forecast verification. Recent findings concerning the Ignorance Score are shortly reviewed, then the generalization to continuous forecasts is shown. For ensemble forecasts, the presented measures can be calculated exactly. The Brier Score (BS) and its generalizations to the multi-categorical Ranked Probability Score (RPS) and to the Continuous Ranked Probability Score (CRPS) are the prominent verification measures for probabilistic forecasts. Particularly, their decompositions into measures quantifying the reliability, resolution and uncertainty of the forecasts are attractive. Information theory sets up the natural framework for forecast verification. Recently, it has been shown that the BS is a second-order approximation of the information-based Ignorance Score (IGN), which also contains easily interpretable components and can also be generalized to a ranked version (RIGN). Here, the IGN, its generalizations and decompositions are systematically discussed in analogy to the variants of the BS. Additionally, a Continuous Ranked IGN (CRIGN) is introduced in analogy to the CRPS. The applicability and usefulness of the conceptually appealing CRIGN is illustrated, together with an algorithm to evaluate its components reliability, resolution, and uncertainty for ensemble-generated forecasts. This is also directly applicable to the more traditional CRPS.
Quality aspects of Dutch general practice based data : A conceptual approach
van den Dungen, C.; Hoeymans, N.; Schellevis, F.G.; van Oers, J.A.M.
2013-01-01
Background. General practice–based data, collected within general practice registration networks (GPRNs), are widely used in research. The quality of the data is important but the recording criteria about what type of information is collected and how this information should be recorded differ
Improving Generalization Based on l1-Norm Regularization for EEG-Based Motor Imagery Classification
Directory of Open Access Journals (Sweden)
Yuwei Zhao
2018-05-01
Full Text Available Multichannel electroencephalography (EEG is widely used in typical brain-computer interface (BCI systems. In general, a number of parameters are essential for a EEG classification algorithm due to redundant features involved in EEG signals. However, the generalization of the EEG method is often adversely affected by the model complexity, considerably coherent with its number of undetermined parameters, further leading to heavy overfitting. To decrease the complexity and improve the generalization of EEG method, we present a novel l1-norm-based approach to combine the decision value obtained from each EEG channel directly. By extracting the information from different channels on independent frequency bands (FB with l1-norm regularization, the method proposed fits the training data with much less parameters compared to common spatial pattern (CSP methods in order to reduce overfitting. Moreover, an effective and efficient solution to minimize the optimization object is proposed. The experimental results on dataset IVa of BCI competition III and dataset I of BCI competition IV show that, the proposed method contributes to high classification accuracy and increases generalization performance for the classification of MI EEG. As the training set ratio decreases from 80 to 20%, the average classification accuracy on the two datasets changes from 85.86 and 86.13% to 84.81 and 76.59%, respectively. The classification performance and generalization of the proposed method contribute to the practical application of MI based BCI systems.
DEFF Research Database (Denmark)
Kolbæk, Morten; Tan, Zheng-Hua; Jensen, Jesper
2017-01-01
In this paper, we study aspects of single microphone speech enhancement (SE) based on deep neural networks (DNNs). Specifically, we explore the generalizability capabilities of state-of-the-art DNN-based SE systems with respect to the background noise type, the gender of the target speaker...... general. Finally, we compare how a DNN-based SE system trained to be noise type general, speaker general, and SNR general performs relative to a state-of-the-art short-time spectral amplitude minimum mean square error (STSA-MMSE) based SE algorithm. We show that DNN-based SE systems, when trained...... a state-of-the-art STSA-MMSE based SE method, when tested using a range of unseen speakers and noise types. Finally, a listening test using several DNN-based SE systems tested in unseen speaker conditions show that these systems can improve SI for some SNR and noise type configurations but degrade SI...
Managing corneal foreign bodies in office-based general practice.
Fraenkel, Alison; Lee, Lawrence R; Lee, Graham A
2017-03-01
Patients with a corneal foreign body may first present to their general practitioner (GP). Safe and efficacious management of these presentations avoids sight-threatening and eye-threatening complications. Removal of a simple, superficial foreign body without a slit lamp is within The Royal Australian College of General Practitioners' (RACGP's) curriculum and scope of practice. Knowing the rele-vant procedural skills and indications for referral is equally important. The objective of this article is to provide an evidence-based and expert-based guide to the management of corneal foreign bodies in the GP's office. History is key to identifying patient characteristics and mechanisms of ocular injury that are red flags for referral. Examination tech-niques and methods of superficial foreign body removal without a slit lamp are outlined, as well as the procedural threshold for referral to an ophthalmologist.
Generalized perturbation theory based on the method of cyclic characteristics
Energy Technology Data Exchange (ETDEWEB)
Assawaroongruengchot, M.; Marleau, G. [Institut de Genie Nucleaire, Departement de Genie Physique, Ecole Polytechnique de Montreal, 2900 Boul. Edouard-Montpetit, Montreal, Que. H3T 1J4 (Canada)
2006-07-01
A GPT algorithm for estimation of eigenvalues and reaction-rate ratios is developed for the neutron transport problems in 2D fuel assemblies with isotropic scattering. In our study the GPT formulation is based on the integral transport equations. The mathematical relationship between the generalized flux importance and generalized source importance functions is applied to transform the generalized flux importance transport equations into the integro-differential forms. The resulting adjoint and generalized adjoint transport equations are then solved using the method of cyclic characteristics (MOCC). Because of the presence of negative adjoint sources, a biasing/decontamination scheme is applied to make the generalized adjoint functions positive in such a way that it can be used for the multigroup re-balance technique. To demonstrate the efficiency of the algorithms, perturbative calculations are performed on a 17 x 17 PWR lattice. (authors)
Generalized perturbation theory based on the method of cyclic characteristics
International Nuclear Information System (INIS)
Assawaroongruengchot, M.; Marleau, G.
2006-01-01
A GPT algorithm for estimation of eigenvalues and reaction-rate ratios is developed for the neutron transport problems in 2D fuel assemblies with isotropic scattering. In our study the GPT formulation is based on the integral transport equations. The mathematical relationship between the generalized flux importance and generalized source importance functions is applied to transform the generalized flux importance transport equations into the integro-differential forms. The resulting adjoint and generalized adjoint transport equations are then solved using the method of cyclic characteristics (MOCC). Because of the presence of negative adjoint sources, a biasing/decontamination scheme is applied to make the generalized adjoint functions positive in such a way that it can be used for the multigroup re-balance technique. To demonstrate the efficiency of the algorithms, perturbative calculations are performed on a 17 x 17 PWR lattice. (authors)
Clinical TVA-based studies: a general review
Directory of Open Access Journals (Sweden)
Thomas eHabekost
2015-03-01
Full Text Available In combination with whole report and partial report tasks, the Theory of Visual Attention (TVA can be used to estimate individual differences in five basic attentional parameters: The visual processing speed, the storage capacity of visual short-term memory, the perceptual threshold, the efficiency of top-down selectivity, and the spatial bias of attentional weighting. TVA-based assessment has been used in about 30 studies to investigate attentional deficits in a range of neurological and psychiatric conditions: (a neglect and simultanagnosia, (b reading disturbances, (c aging and neurodegenerative diseases, and most recently (d neurodevelopmental disorders. The article introduces TVA based assessment, discusses its methodology and psychometric properties, and reviews the progress made in each of the four research fields. The empirical results demonstrate the general usefulness of TVA-based assessment for many types of clinical neuropsychological research. The method’s most important qualities are cognitive specificity and theoretical grounding, but it is also characterized by good reliability and sensitivity to minor deficits. The review concludes by pointing to promising new areas for clinical TVA-based research.
LaCrosse, Amber L.; Burrows, Brian T.; Angulo, Rachel M.; Conrad, Phoebe R.; Himes, Sarah M.; Mathews, Nordia; Wegner, Scott A.; Taylor, Sara B.; Olive, M. Foster
2014-01-01
Rationale Positive allosteric modulators (PAMs) of type 5 metabotropic glutamate receptors (mGluR5) exert pro-cognitive effects in animal models of various neuropsychiatric diseases. However, few studies to date have examined ability of mGluR5 PAMs to reverse cognitive deficits in operant delayed matching/non-matching-to-sample (DMS/DNMS) tasks. Objectives To determine the ability of the mGluR5 PAM 3-cyano-N-1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB) to reverse set-shifting deficits induced by the NMDA receptor antagonist MK-801. Methods Male Sprague-Dawley rats were initially trained to lever press for sucrose reinforcement under either DMS or DNMS conditions. Following successful acquisition of the task, reinforcement conditions were reversed (DNMS→DMS or DMS→DNMS). In Experiment 1, rats were treated daily prior to each session with either vehicle/vehicle, vehicle/MK-801 (0.06 mg/kg) simultaneously, CDPPB (20 mg/kg)/MK-801 simultaneously, or CDPPB 30 min prior to MK-801. In Experiment 2, rats were treated with either vehicle/vehicle, vehicle/MK-801, or CDPPB 30 min prior to MK-801 only prior to sessions that followed task reversal. Results In Experiment 1, no group differences in initial task acquisition were observed. Rats treated with vehicle+MK−801 showed significant set-shifting impairments following task reversal, which were partially attenuated by simultaneous administration of CDPPB/MK-801, and completely precluded by administration of CDPPB 30 min prior to MK-801. In Experiment 2, MK-801 did not impair reversal learning and no other group differences were observed. Conclusions MK-801 induced deficits in operant set-shifting ability were prevented by pretreatment with CDPPB. MK-801 did not produce deficits in initial task learning or when treatment was initiated following task reversal. PMID:24973895
DEFF Research Database (Denmark)
Schwöbel, Babett; Alifrangis, Michael; Salanti, Ali
2003-01-01
, we developed a detection method for the diagnostic of codon 268 polymorphisms as a potential atovaquone/proguanil resistance marker. A nested PCR with 3 different pairs of primers for the second round was designed. Each product was digested with restriction enzymes, capable to distinguish the wild...
Percutaneous Treatment of Iatrogenic Pseudoaneurysms by Cyanoacrylate-Based Wall-Gluing
Energy Technology Data Exchange (ETDEWEB)
Del Corso, Andrea, E-mail: adelcorso2000@hotmail.com [Universita di Pisa, Division of General and Vascular Surgery, Ospedale Cisanello (Italy); Vergaro, Giuseppe [Fondazione G. Monasterio CNR-Regione Toscana, Division of Cardiovascular Medicine (Italy)
2013-06-15
Purpose. Although the majority of iatrogenic pseudoaneurysms (PSAs) are amenable to ultrasound (US)-guided thrombin injection, patients with those causing neuropathy, claudication, significant venous compression, or soft tissue necrosis are considered poor candidates for this option and referred to surgery. We aimed to test the effectiveness and feasibility of a novel percutaneous cyanoacrylate glue (NBCA-MS)-based technique for treatment of symptomatic and asymptomatic iatrogenic PSA. Material and Methods. During a 3-year period, we prospectively enrolled 91 patients with iatrogenic PSA [total n = 94 (femoral n = 76; brachial n = 11; radial n = 6; axillary n = 1)]. PSA were asymptomatic in 66 % of cases, and 34 % presented with symptoms due to neuropathy, venous compression, and/or soft tissue necrosis. All patients signed informed consent. All patients received NBCA-MS-based percutaneous treatment. PSA chamber emptying was first obtained by US-guided compression; superior and inferior walls of the PSA chamber were then stuck together using NBCA-MS microinjections. Successfulness of the procedure was assessed immediately and at 1-day and 1-, 3-, and 12-month US follow-up. Results. PSA occlusion rate was 99 % (93 of 94 cases). After treatment, mean PSA antero-posterior diameter decrease was 67 {+-} 22 %. Neuropathy and vein compression immediately disappeared in 91 % (29 of 32) of cases. Patients with tissue necrosis (n = 6) underwent subsequent outpatient necrosectomy. No distal embolization occurred, nor was conversion to surgery necessary. Conclusion. PSA treatment by way of NBCA-MS glue injection proved to be safe and effective in asymptomatic patients as well as those with neuropathy, venous compression, or soft-tissue necrosis (currently candidates for surgery). Larger series are needed to confirm these findings.
Evaluation of a bolus/infusion protocol for 11C-ABP688, a PET tracer for mGluR5
International Nuclear Information System (INIS)
Burger, Cyrill; Deschwanden, Alexandra; Ametamey, Simon; Johayem, Anass; Mancosu, Bruno; Wyss, Matthias; Hasler, Gregor; Buck, Alfred
2010-01-01
11 C-ABP-688 is a selective tracer for the mGluR5 receptor. Its kinetics is fast and thus favourable for an equilibrium approach to determine receptor-related parameters. The purpose of this study was to test the hypothesis that the pattern of the 11 C-ABP688 uptake using a bolus-plus-infusion (B/I) protocol at early time points corresponds to the perfusion and at a later time point to the total distribution volume. Methods: A bolus and a B/I study (1 h each) was performed in five healthy male volunteers. With the B/I protocol, early and late scans were normalized to gray matter, cerebellum and white matter. The same normalization was done on the maps of the total distribution volume (Vt) and K 1 which were calculated in the study with bolus only injection and the Logan method (Vt) and a two-tissue compartment model (K 1 ). Results: There was an excellent correlation close to the identity line between the pattern of the late uptake in the B/I study and Vt of the bolus-only study for all three normalizations. The pattern of the early uptake in the B/I study correlated well with the K 1 maps, but only when normalized to gray matter and cerebellum, not to white matter. Conclusion: It is demonstrated that with a B/I protocol the 11 C-ABP688 distribution in late scans reflects the pattern of the total distribution volume and is therefore a measure for the density pattern of mGluR5. The early scans following injection are related to blood flow, although not in a fully quantitative manner. The advantage of the B/I protocol is that no arterial blood sampling is required, which is advantageous in clinical studies.
Energy Technology Data Exchange (ETDEWEB)
Wildgoose, P.; Kisiel, W. (Univ. of New Mexico, Albuquerque (USA)); Berkner, K.L. (ZymoGenetics, Inc., Seattle, WA (USA))
1990-04-03
Coagulation factor VII circulates in blood as a single-chain zymogen of a serine protease and is converted to its activated two-chain form, factor VIIa, by cleavage of an internal peptide bond located at Arg{sub 152}-Ile{sub 153}. Previous studies using serine protease active-site inhibitors suggest that zymogen factor VII may possess sufficient proteolytic activity to initiate the extrinsic pathway of blood coagulation. In order to assess the putative intrinsic proteolytic activity of single-chain factor VII, the authors have constructed a site-specific mutant of recombinant human factor VII in which arginine-152 has been replaced with a glutamic acid residue. Mutant factor VII was purified in a single step from culture supernatants of baby hamster kidney cells transfected with a plasmid containing the sequence for Arg{sub 152} {yields} Glu factor VII using a calcium-dependent, murine anti-factor VII monoclonal antibody column. The clotting activity of mutant factor VII was completely inhibited following incubation with dansyl-Glu-Gly-Arg chloromethyl ketone, suggesting that the apparent clotting activity of mutant factor VII was due to a contaminating serine protease. Immunoblots of mutant factor VII with human factor IXa revealed no cleavage, whereas incubation of mutant factor VII with human factor Xa resulted in cleavage of mutant factor VII and the formation of a lower molecular weight degradation product migrating at M{sup r}{approx}40 000. The results are consistent with the proposal that zymogen factor VII possesses no intrinsic proteolytic activity toward factor X or factor IX.
Directory of Open Access Journals (Sweden)
Ivar S. Stein
2014-08-01
Full Text Available Learning and memory as well as long-term potentiation (LTP depend on Ca2+ influx through the NMDA-type glutamate receptor (NMDAR and the resulting activation of the Ca2+ and calmodulin-dependent protein kinase (CaMKII. Ca2+ influx via the NMDAR triggers CaMKII binding to the NMDAR for enhanced CaMKII accumulation at post-synaptic sites that experience heightened activity as occurring during LTP. Previously, we generated knock-in (KI mice in which we replaced two residues in the NMDAR GluN2B subunit to impair CaMKII binding to GluN2B. Various forms of LTP at the Schaffer collateral synapses in CA1 are reduced by 50%. Nevertheless, working memory in the win-shift 8 arm maze and learning of the Morris water maze (MWM task was normal in the KI mice although recall of the task was impaired in these mice during the period of early memory consolidation. We now show that massed training in the MWM task within a single day resulted in impaired learning. However, learning and recall of the Barnes maze task and contextual fear conditioning over one or multiple days were surprisingly unaffected. The differences observed in the MWM compared to the Barnes maze and contextual fear conditioning suggest a differential involvement of CaMKII and the specific interaction with GluN2B, probably depending on varying degrees of stress, cognitive demand or even potentially different plasticity mechanisms associated with the diverse tasks.
Adaptive fuzzy bilinear observer based synchronization design for generalized Lorenz system
International Nuclear Information System (INIS)
Baek, Jaeho; Lee, Heejin; Kim, Seungwoo; Park, Mignon
2009-01-01
This Letter proposes an adaptive fuzzy bilinear observer (FBO) based synchronization design for generalized Lorenz system (GLS). The GLS can be described to TS fuzzy bilinear generalized Lorenz model (FBGLM) with their states immeasurable and their parameters unknown. We design an adaptive FBO based on TS FBGLM for synchronization. Lyapunov theory is employed to guarantee the stability of error dynamic system via linear matrix equalities (LMIs) and to derive the adaptive laws to estimate unknown parameters. Numerical example is given to demonstrate the validity of our proposed adaptive FBO approach for synchronization.
DEFF Research Database (Denmark)
Szymańska, Ewa; Chałupnik, Paulina; Szczepańska, Katarzyna
2016-01-01
A new series of carboxyaryl-substituted phenylalanines was designed, synthesized and pharmacologically characterized in vitro at native rat ionotropic glutamate receptors as well as at cloned homomeric kainate receptors GluK1-GluK3. Among them, six compounds bound to GluK1 receptor subtypes with ...
Generalized frameworks for first-order evolution inclusions based on Yosida approximations
Directory of Open Access Journals (Sweden)
Ram U. Verma
2011-04-01
Full Text Available First, general frameworks for the first-order evolution inclusions are developed based on the A-maximal relaxed monotonicity, and then using the Yosida approximation the solvability of a general class of first-order nonlinear evolution inclusions is investigated. The role the A-maximal relaxed monotonicity is significant in the sense that it not only empowers the first-order nonlinear evolution inclusions but also generalizes the existing Yosida approximations and its characterizations in the current literature.
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
DEFF Research Database (Denmark)
Butini, Stefania; Pickering, Darryl S; Morelli, Elena
2008-01-01
(S)-CPW399 ((S)-1) is a potent and excitotoxic AMPA receptor partial agonist. Modifying the cyclopentane ring of (S)-1, we developed two of the most potent and selective functional antagonists (5 and 7) for kainate receptor (KA-R) subunit iGluR5. Derivatives 5 and 7, with their unique pharmacolog...
A General Polygon-based Deformable Model for Object Recognition
DEFF Research Database (Denmark)
Jensen, Rune Fisker; Carstensen, Jens Michael
1999-01-01
We propose a general scheme for object localization and recognition based on a deformable model. The model combines shape and image properties by warping a arbitrary prototype intensity template according to the deformation in shape. The shape deformations are constrained by a probabilistic distr...
Edge detection methods based on generalized type-2 fuzzy logic
Gonzalez, Claudia I; Castro, Juan R; Castillo, Oscar
2017-01-01
In this book four new methods are proposed. In the first method the generalized type-2 fuzzy logic is combined with the morphological gra-dient technique. The second method combines the general type-2 fuzzy systems (GT2 FSs) and the Sobel operator; in the third approach the me-thodology based on Sobel operator and GT2 FSs is improved to be applied on color images. In the fourth approach, we proposed a novel edge detec-tion method where, a digital image is converted a generalized type-2 fuzzy image. In this book it is also included a comparative study of type-1, inter-val type-2 and generalized type-2 fuzzy systems as tools to enhance edge detection in digital images when used in conjunction with the morphologi-cal gradient and the Sobel operator. The proposed generalized type-2 fuzzy edge detection methods were tested with benchmark images and synthetic images, in a grayscale and color format. Another contribution in this book is that the generalized type-2 fuzzy edge detector method is applied in the preproc...
Kang, S; Creagh, F M; Peters, J R; Brange, J; Vølund, A; Owens, D R
1991-07-01
To compare postprandial glucose excursions and plasma free insulin-analogue levels after subcutaneous injection of three novel human insulin analogues (AspB10; AspB9, GluB27; and AspB28) with those after injection of soluble human insulin (Actrapid HM U-100). Six male subjects with insulin-dependent diabetes, at least 1 wk apart and after an overnight fast and basal insulin infusion, received 72 nmol (approximately 12 U) s.c. of soluble human insulin 30 min before, or 72 nmol of each of the three analogues immediately before, a standard 500-kcal meal. Mean basal glucoses were similar on the 4 study days. Compared to human insulin (6.3 +/- 0.8 mM), mean +/- SE peak incremental glucose rises were similar after analogues AspB10 (5.4 +/- 0.8 mM) and AspB9, GluB27 (5.4 +/- 0.7 mM) and significantly lower after analogue AspB28 (3.6 +/- 1.2 mM, P less than 0.02). Relative to soluble human insulin (100% +/- SE21), incremental areas under the glucose curve between 0 and 240 min were 79% +/- 34 (AspB10, NS), 70% +/- 29 (AspB9, GluB27, NS), and 43% +/- 23 (AspB28, P less than 0.02). Basal plasma free insulin levels were similar on the 4 study days. Plasma free insulin-analogue levels rose rapidly to peak 30 min after injection at 308 +/- 44 pM (AspB10); 1231 +/- 190 pM (AspB9, GluB27) and 414 +/- 42 pM (AspB28) and were significantly higher than corresponding (i.e., 30 min postmeal) plasma free insulin levels of 157 +/- 15 pM (P less than 0.02 in each case). Plasma profiles of the insulin analogues were more physiological than that of human insulin after subcutaneous injection. All three analogues given immediately before the meal are at least as effective as soluble human insulin given 30 min earlier. These analogues are promising potential candidates for short-acting insulins of the future.
Cooperation dynamics of generalized reciprocity in state-based social dilemmas
Stojkoski, Viktor; Utkovski, Zoran; Basnarkov, Lasko; Kocarev, Ljupco
2018-05-01
We introduce a framework for studying social dilemmas in networked societies where individuals follow a simple state-based behavioral mechanism based on generalized reciprocity, which is rooted in the principle "help anyone if helped by someone." Within this general framework, which applies to a wide range of social dilemmas including, among others, public goods, donation, and snowdrift games, we study the cooperation dynamics on a variety of complex network examples. By interpreting the studied model through the lenses of nonlinear dynamical systems, we show that cooperation through generalized reciprocity always emerges as the unique attractor in which the overall level of cooperation is maximized, while simultaneously exploitation of the participating individuals is prevented. The analysis elucidates the role of the network structure, here captured by a local centrality measure which uniquely quantifies the propensity of the network structure to cooperation by dictating the degree of cooperation displayed both at the microscopic and macroscopic level. We demonstrate the applicability of the analysis on a practical example by considering an interaction structure that couples a donation process with a public goods game.
Matroidal Structure of Generalized Rough Sets Based on Tolerance Relations
Directory of Open Access Journals (Sweden)
Hui Li
2014-01-01
of the generalized rough set based on the tolerance relation. The matroid can also induce a new relation. We investigate the connection between the original tolerance relation and the induced relation.
Directory of Open Access Journals (Sweden)
Benedito Rocha Vital
2006-08-01
Full Text Available Este experimento teve como objetivo avaliar a resistência de juntas coladas formadas pelas combinações de lâminas provenientes de três posições no tronco da madeira de Eucalyptus grandis, Eucalyptus saligna e Pinus elliottii. Foram empregados adesivos à base de poliacetato de vinila de média e alta viscosidade e resorcinol-formaldeído nas gramaturas de 150 g/m², em face simples para o poliacetato de vinila de média e alta viscosidades e 300 g/m², em face dupla, para o adesivo resorcinólico. O teor médio de umidade das lâminas, no momento da colagem, foi igual a 14%. Os valores médios mais elevados de resistência ao cisalhamento foram obtidos nas juntas produzidas com madeira de Eucalyptus saligna, coladas com adesivos de poliacetato de média viscosidade e resorcinol-formaldeído. A maior porcentagem de falha profunda na madeira foi obtida em juntas de madeira de Pinus elliottii, unidas com adesivo de poliacetato de alta viscosidade, seguidas das juntas de Eucalyptus grandis e coladas com adesivo de poliacetato de média viscosidade. As combinações de lâminas oriundas das seguintes posições no tronco: medula e casca, intermediária e casca e casca e casca resultaram em linhas de cola com maiores resistências ao cisalhamento.The objective of this work was to evaluate the shear strength of glued wood joints from pith, outer and intermediary wood of Eucalyptus saligna, Eucalyptus grandis and Pinus elliottii. High and medium viscosity polyvinyl acetate and resorcinol-phenol adhesives were applied at spread rate of 150 g/m² in single line and at spread rate of 300 g/m² in double glue line for the resorcinolic adhesive. The mean wood moisture content was 14%. Higher shear strength was obtained with Eucalyptus saligna veneer glued with medium viscosity polyvinyl resorcinolic adhesive. The highest percentage of wood failure was found on Pinus elliottii veneer glued with high viscosity polyvinyl acetate adhesive followed by
Gradient-based adaptation of general gaussian kernels.
Glasmachers, Tobias; Igel, Christian
2005-10-01
Gradient-based optimizing of gaussian kernel functions is considered. The gradient for the adaptation of scaling and rotation of the input space is computed to achieve invariance against linear transformations. This is done by using the exponential map as a parameterization of the kernel parameter manifold. By restricting the optimization to a constant trace subspace, the kernel size can be controlled. This is, for example, useful to prevent overfitting when minimizing radius-margin generalization performance measures. The concepts are demonstrated by training hard margin support vector machines on toy data.
Directory of Open Access Journals (Sweden)
Sivananthaperumal Shanmugasundararaj
Full Text Available Firefly luciferase is one of the few soluble proteins that is acted upon by a wide variety of general anesthetics and alcohols; they inhibit the ATP-driven production of light. We have used time-resolved photolabeling to locate the binding sites of alcohols during the initial light output, some 200 ms after adding ATP. The photolabel 3-azioctanol inhibited the initial light output with an IC50 of 200 µM, close to its general anesthetic potency. Photoincorporation of [(3H]3-azioctanol into luciferase was saturable but weak. It was enhanced 200 ms after adding ATP but was negligible minutes later. Sequencing of tryptic digests by HPLC-MSMS revealed a similar conformation-dependence for photoincorporation of 3-azioctanol into Glu-313, a residue that lines the bottom of a deep cleft (vestibule whose outer end binds luciferin. An aromatic diazirine analog of benzyl alcohol with broader side chain reactivity reported two sites. First, it photolabeled two residues in the vestibule, Ser-286 and Ile-288, both of which are implicated with Glu-313 in the conformation change accompanying activation. Second, it photolabeled two residues that contact luciferin, Ser-316 and Ser-349. Thus, time resolved photolabeling supports two mechanisms of action. First, an allosteric one, in which anesthetics bind in the vestibule displacing water molecules that are thought to be involved in light output. Second, a competitive one, in which anesthetics bind isosterically with luciferin. This work provides structural evidence that supports the competitive and allosteric actions previously characterized by kinetic studies.
Guo, Haixun; Yang, Jianquan; Gallazzi, Fabio; Prossnitz, Eric R; Sklar, Larry A; Miao, Yubin
2009-11-01
The purpose of this study was to examine the effect of DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) position on melanoma targeting and pharmacokinetics of radiolabeled lactam bridge-cyclized alpha-melanocyte stimulating hormone (alpha-MSH) peptide. A novel lactam bridge-cyclized alpha-MSH peptide, Ac-GluGlu-CycMSH[DOTA] {Ac-Glu-Glu-c[Lys-Nle-Glu-His-DPhe-Arg-Trp-Gly-Arg-Pro-Val-Lys(DOTA)]}, was synthesized using standard 9-fluorenylmethyloxycarbonyl (Fmoc) chemistry. DOTA was directly attached to the alpha-amino group of Lys in the cyclic ring, while the N-terminus of the peptide was acetylated to generate Ac-GluGlu-CycMSH[DOTA]. The MC1 receptor binding affinity of Ac-GluGlu-CycMSH[DOTA] was determined in B16/F1 melanoma cells. Melanoma targeting and pharmacokinetic properties of Ac-GluGlu-CycMSH[DOTA]-111In were determined in B16/F1 melanoma-bearing C57 mice and compared to that of 111In-DOTA-Gly-Glu-c[Lys-Nle-Glu-His-DPhe-Arg-Trp-Gly-Arg-Pro-Val-Asp] (111In-DOTA-GlyGlu-CycMSH; DOTA was coupled to the N-terminus of the peptide). Ac-GluGlu-CycMSH[DOTA] displayed 0.6 nM MC1 receptor binding affinity in B16/F1 cells. Ac-GluGlu-CycMSH[DOTA]-111In was readily prepared with greater than 95% radiolabeling yield. Ac-GluGlu-CycMSH[DOTA]-111In exhibited high tumor uptake (11.42 +/- 2.20% ID/g 2 h postinjection) and prolonged tumor retention (9.42 +/- 2.41% ID/g 4 h postinjection) in B16/F1 melanoma-bearing C57 mice. The uptake values for nontarget organs were generally low (<1.3% ID/g) except for the kidneys 2, 4, and 24 h postinjection. DOTA position exhibited profound effect on melanoma targeting and pharmacokinetic properties of Ac-GluGlu-CycMSH[DOTA]-111In, providing a new insight into the design of lactam bridge-cyclized peptide for melanoma imaging and therapy.
Directory of Open Access Journals (Sweden)
Hosin Nazari, Sh
2010-05-01
Full Text Available Aim: One of the influential elements in the life of an individual is his or her level of self efficacy. This research aimed to study the effectiveness of abstinence-based/faith-based addiction quitting courses on general and coping self efficacy of the people who want to quit opium addiction through these courses in Tehran city. Method: In semi experimental research design 80 people who referred to abstinence-based/faith-based addiction quitting courses were selected by census method. General self efficacy questionnaire of Jerusalem and Schwartzer (1981 and coping self-efficacy questionnaire of Chesney (2006 administered among selected sample before and after treatment. Results: The results of paired t-test indicated that abstinence-based/faith-based addiction quitting courses have a significant influence on the skills of impeding negative thoughts and excitements and gaining friends’ and colleagues’ support. Conclusion: The findings of this research concur with the findings of similar researches, and indicated with appropriate strategies of training self-efficacy beliefs can be improved and boosted.
Generalized phase retrieval algorithm based on information measures
Shioya, Hiroyuki; Gohara, Kazutoshi
2006-01-01
An iterative phase retrieval algorithm based on the maximum entropy method (MEM) is presented. Introducing a new generalized information measure, we derive a novel class of algorithms which includes the conventionally used error reduction algorithm and a MEM-type iterative algorithm which is presented for the first time. These different phase retrieval methods are unified on the basis of the framework of information measures used in information theory.
International Nuclear Information System (INIS)
HAMMERS, J.S.
1999-01-01
The purpose of the test was to verify that the AN Tank Farm Encasement Leak Detector components are functionally integrated and operate in accordance with engineering design specifications The Acceptance Test Procedure HNF-4650, SN-268 Encasement Leak Detection ANA-W-LDSTA-335, was conducted between 22 June and 01 July 1999 at the 200E AN Tank Farm. The test has been completed with no open test exceptions The test was conducted prior to final engineering ''as built'' activities being completed this had no impact on the procedure or test results. All components, identified in the procedure, were found to be labeled and identified as written in the procedure
A Bidirectional Generalized Synchronization Theorem-Based Chaotic Pseudo-random Number Generator
Directory of Open Access Journals (Sweden)
Han Shuangshuang
2013-07-01
Full Text Available Based on a bidirectional generalized synchronization theorem for discrete chaos system, this paper introduces a new 5-dimensional bidirectional generalized chaos synchronization system (BGCSDS, whose prototype is a novel chaotic system introduced in [12]. Numerical simulation showed that two pair variables of the BGCSDS achieve generalized chaos synchronization via a transform H.A chaos-based pseudo-random number generator (CPNG was designed by the new BGCSDS. Using the FIPS-140-2 tests issued by the National Institute of Standard and Technology (NIST verified the randomness of the 1000 binary number sequences generated via the CPNG and the RC4 algorithm respectively. The results showed that all the tested sequences passed the FIPS-140-2 tests. The confidence interval analysis showed the statistical properties of the randomness of the sequences generated via the CPNG and the RC4 algorithm do not have significant differences.
Hanford general employee training: Computer-based training instructor's manual
Energy Technology Data Exchange (ETDEWEB)
1990-10-01
The Computer-Based Training portion of the Hanford General Employee Training course is designed to be used in a classroom setting with a live instructor. Future references to this course'' refer only to the computer-based portion of the whole. This course covers the basic Safety, Security, and Quality issues that pertain to all employees of Westinghouse Hanford Company. The topics that are covered were taken from the recommendations and requirements for General Employee Training as set forth by the Institute of Nuclear Power Operations (INPO) in INPO 87-004, Guidelines for General Employee Training, applicable US Department of Energy orders, and Westinghouse Hanford Company procedures and policy. Besides presenting fundamental concepts, this course also contains information on resources that are available to assist students. It does this using Interactive Videodisk technology, which combines computer-generated text and graphics with audio and video provided by a videodisk player.
A projection-based approach to general-form Tikhonov regularization
DEFF Research Database (Denmark)
Kilmer, Misha E.; Hansen, Per Christian; Espanol, Malena I.
2007-01-01
We present a projection-based iterative algorithm for computing general-form Tikhonov regularized solutions to the problem minx| Ax-b |2^2+lambda2| Lx |2^2, where the regularization matrix L is not the identity. Our algorithm is designed for the common case where lambda is not known a priori...
Amgoth, Chander; Dharmapuri, Gangappa; Kalle, Arunasree M.; Paik, Pradip
2016-03-01
Herein, new nanoporous capsules of the block co-polymers of MeO-PEG-NH-(L-GluA)10 and polycaprolactone (PCL) have been synthesized through a surfactant-free cost-effective self-assembled soft-templating approach for the controlled release of drugs and for therapeutic applications. The nanoporous polymer capsules are designed to be biocompatible and are capable of encapsulating anticancer drugs (e.g., doxorubicin hydrochloride (DOX) and imatinib mesylate (ITM)) with a high extent (˜279 and ˜480 ng μg-1, respectively). We have developed a nanoformulation of porous MeO-PEG-NH-(L-GluA)10-PCL capsules with DOX and ITM. The porous polymer nanoformulations have been programmed in terms of the release of anticancer drugs with a desired dose to treat the leukemia (K562) and human carcinoma cells (HepG2) in vitro and show promising IC50 values with a very high mortality of cancer cells (up to ˜96.6%). Our nanoformulation arrests the cell divisions due to ‘cellular scenescence’ and kills the cancer cells specifically. The present findings could enrich the effectiveness of idiosyncratic nanoporous polymer capsules for use in various other nanomedicinal and biomedical applications, such as for killing cancer cells, immune therapy, and gene delivery.
International Nuclear Information System (INIS)
Amgoth, Chander; Paik, Pradip; Dharmapuri, Gangappa; Kalle, Arunasree M
2016-01-01
Herein, new nanoporous capsules of the block co-polymers of MeO-PEG-NH-(L-GluA) 10 and polycaprolactone (PCL) have been synthesized through a surfactant-free cost-effective self-assembled soft-templating approach for the controlled release of drugs and for therapeutic applications. The nanoporous polymer capsules are designed to be biocompatible and are capable of encapsulating anticancer drugs (e.g., doxorubicin hydrochloride (DOX) and imatinib mesylate (ITM)) with a high extent (∼279 and ∼480 ng μg −1 , respectively). We have developed a nanoformulation of porous MeO-PEG-NH-(L-GluA) 10 -PCL capsules with DOX and ITM. The porous polymer nanoformulations have been programmed in terms of the release of anticancer drugs with a desired dose to treat the leukemia (K562) and human carcinoma cells (HepG2) in vitro and show promising IC 50 values with a very high mortality of cancer cells (up to ∼96.6%). Our nanoformulation arrests the cell divisions due to ‘cellular scenescence’ and kills the cancer cells specifically. The present findings could enrich the effectiveness of idiosyncratic nanoporous polymer capsules for use in various other nanomedicinal and biomedical applications, such as for killing cancer cells, immune therapy, and gene delivery. (paper)
Serebryany, Eugene; Takata, Takumi; Erickson, Erika; Schafheimer, Nathaniel; Wang, Yongting; King, Jonathan A
2016-06-01
Numerous mutations and covalent modifications of the highly abundant, long-lived crystallins of the eye lens cause their aggregation leading to progressive opacification of the lens, cataract. The nature and biochemical mechanisms of the aggregation process are poorly understood, as neither amyloid nor native-state polymers are commonly found in opaque lenses. The βγ-crystallin fold contains four highly conserved buried tryptophans, which can be oxidized to more hydrophilic products, such as kynurenine, upon UV-B irradiation. We mimicked this class of oxidative damage using Trp→Glu point mutants of human γD-crystallin. Such substitutions may represent a model of UV-induced photodamage-introduction of a charged group into the hydrophobic core generating "denaturation from within." The effects of Trp→Glu substitutions were highly position dependent. While each was destabilizing, only the two located in the bottom of the double Greek key fold-W42E and W130E-yielded robust aggregation of partially unfolded intermediates at 37°C and pH 7. The αB-crystallin chaperone suppressed aggregation of W130E, but not W42E, indicating distinct aggregation pathways from damage in the N-terminal vs C-terminal domain. The W130E aggregates had loosely fibrillar morphology, yet were nonamyloid, noncovalent, showed little surface hydrophobicity, and formed at least 20°C below the melting temperature of the native β-sheets. These features are most consistent with domain-swapped polymerization. Aggregation of partially destabilized crystallins under physiological conditions, as occurs in this class of point mutants, could provide a simple in vitro model system for drug discovery and optimization. © 2016 The Protein Society.
Directory of Open Access Journals (Sweden)
M. Moazeni Bistegani
2013-06-01
Full Text Available Introduction : various methods of teaching have different learning outcomes. Using a combination of teaching and training methods of training may boost education. This study compared lecture based and case based teaching as a combined approach in learning general surgery by medical students. Methods: This study was a quasi-experimental performed on two consecutive groups of 33 and 36 students who were studying general surgery course. The two styles of teaching were lecture-based and real case teaching methods. The final exam included twenty multiple choice questions. The mean scores of each group of students were collected and analyzed accordingly with descriptive tests, Fisher’s test and T-test. Results: The mean final mark of students' who received real case based education was 16.8/20 ± 1.8 and for the lecture group was 12.7± 1.7. There was a significant difference between the two groups (P <0.0001. In both groups, there were significant differences in the mean scores of questions with taxonomy two and three, but not in the questions with taxonomy one. Students' evaluation score of the teacher of the real case group increased by 1.7/20 (8.7% in the case based group compared to the lecture group. Conclusions: Case based teaching of general surgery led to a better outcome and students were more satisfied. It is recommended that case based education of surgery be encouraged.
Wang, J; Wang, F; Liu, Y; Xu, J; Lin, H; Jia, B; Zuo, W; Jiang, Y; Hu, L; Lin, F
2016-01-01
Overweight individuals are at higher risk for developing type II diabetes than the general population. We conducted this study to analyze the correlation between blood glucose and biochemical parameters, and developed a blood glucose prediction model tailored to overweight patients. A total of 346 overweight Chinese people patients ages 18-81 years were involved in this study. Their levels of fasting glucose (fs-GLU), blood lipids, and hepatic and renal functions were measured and analyzed by multiple linear regression (MLR). Based the MLR results, we developed a back propagation artificial neural network (BP-ANN) model by selecting tansig as the transfer function of the hidden layers nodes, and purelin for the output layer nodes, with training goal of 0.5×10(-5). There was significant correlation between fs-GLU with age, BMI, and blood biochemical indexes (P<0.05). The results of MLR analysis indicated that age, fasting alanine transaminase (fs-ALT), blood urea nitrogen (fs-BUN), total protein (fs-TP), uric acid (fs-BUN), and BMI are 6 independent variables related to fs-GLU. Based on these parameters, the BP-ANN model was performed well and reached high prediction accuracy when training 1 000 epoch (R=0.9987). The level of fs-GLU was predictable using the proposed BP-ANN model based on 6 related parameters (age, fs-ALT, fs-BUN, fs-TP, fs-UA and BMI) in overweight patients. © Georg Thieme Verlag KG Stuttgart · New York.
Wan, Qun; Parks, Jerry M.; Hanson, B. Leif; Fisher, Suzanne Zoe; Ostermann, Andreas; Schrader, Tobias E.; Graham, David E.; Coates, Leighton; Langan, Paul; Kovalevsky, Andrey
2015-01-01
Glycoside hydrolase (GH) enzymes apply acid/base chemistry to catalyze the decomposition of complex carbohydrates. These ubiquitous enzymes accept protons from solvent and donate them to substrates at close to neutral pH by modulating the pKa values of key side chains during catalysis. However, it is not known how the catalytic acid residue acquires a proton and transfers it efficiently to the substrate. To better understand GH chemistry, we used macromolecular neutron crystallography to directly determine protonation and ionization states of the active site residues of a family 11 GH at multiple pD (pD = pH + 0.4) values. The general acid glutamate (Glu) cycles between two conformations, upward and downward, but is protonated only in the downward orientation. We performed continuum electrostatics calculations to estimate the pKa values of the catalytic Glu residues in both the apo- and substrate-bound states of the enzyme. The calculated pKa of the Glu increases substantially when the side chain moves down. The energy barrier required to rotate the catalytic Glu residue back to the upward conformation, where it can protonate the glycosidic oxygen of the substrate, is 4.3 kcal/mol according to free energy simulations. These findings shed light on the initial stage of the glycoside hydrolysis reaction in which molecular motion enables the general acid catalyst to obtain a proton from the bulk solvent and deliver it to the glycosidic oxygen. PMID:26392527
Energy Technology Data Exchange (ETDEWEB)
Y Lin; N Yeung; Y Gao; K Miner; S Tian; H Robinson; Y Lu
2011-12-31
A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu has a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.
Expressão de zif-268 durante a aquisição, evocação e extinção de uma memória aversiva
Lemos, Nelson Alessandretti de Mello
2008-01-01
No paradigma comportamental da esquiva discriminativa, as memórias de curto e de longo prazo têm sido extensivamente estudadas tanto comportamental quanto farmacologicamente. O objetivo do presente estudo foi avaliar, usando o modelo supracitado, a expressão hipocampal de zif-268 - gene imediato dependente de cálcio implicado em processos de plasticidade sináptica - ao longo das diversas etapas da formação da memória, como aquisição, evocação e extinção. O aparato comportamental consistiu de ...
Barnieh, Lianne; Klarenbach, Scott; Gill, John S; Caulfield, Tim; Manns, Braden
2012-12-01
The acceptability of financial incentives for organ donation is contentious. This study sought to determine (1) the acceptability of expense reimbursement or financial incentives by the general public, health professionals involved with organ donation and transplantation, and those with or affected by kidney disease and (2) for the public, whether financial incentives would alter their willingness to consider donation. Web-based survey administered to members of the Canadian public, health professionals, and people with or affected by kidney disease asking questions regarding acceptability of strategies to increase living and deceased kidney donation and willingness to donate a kidney under various financial incentives. Responses were collected from 2004 members of the Canadian public October 11-18, 2011; responses from health professionals (n=339) and people with or affected by kidney disease (n=268) were collected during a 4-week period commencing October 11, 2011. Acceptability of one or more financial incentives to increase deceased and living donation was noted in >70% and 40% of all groups, respectively. Support for monetary payment for living donors was 45%, 14%, and 27% for the public, health professionals, and people with or affected by kidney disease, respectively. Overall, reimbursement of funeral expenses for deceased donors and a tax break for living donors were the most acceptable. The general public views regulated financial incentives for living and deceased donation to be acceptable. Future research needs to examine the impact of financial incentives on rates of deceased and living donors.
49 CFR Appendix E to Part 238 - General Principles of Reliability-Based Maintenance Programs
2010-10-01
... STANDARDS Pt. 238, App. E Appendix E to Part 238—General Principles of Reliability-Based Maintenance... 49 Transportation 4 2010-10-01 2010-10-01 false General Principles of Reliability-Based... the design level of safety and reliability of the equipment; (2) To restore safety and reliability to...
SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT
International Nuclear Information System (INIS)
Yamashita, M; Kokubo, M; Takahashi, R; Takayama, K; Tanabe, H; Sueoka, M; Okuuchi, N; Ishii, M; Iwamoto, Y; Tachibana, H
2016-01-01
Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and
SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT
Energy Technology Data Exchange (ETDEWEB)
Yamashita, M; Kokubo, M [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Takayama, K [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tanabe, H; Sueoka, M; Okuuchi, N [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Ishii, M; Iwamoto, Y [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)
2016-06-15
Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and
Effects of Web-Based Interactive Modules on Engineering Students' Learning Motivations
Bai, Haiyan; Aman, Amjad; Xu, Yunjun; Orlovskaya, Nina; Zhou, Mingming
2016-01-01
The purpose of this study is to assess the impact of a newly developed modules, Interactive Web-Based Visualization Tools for Gluing Undergraduate Fuel Cell Systems Courses system (IGLU), on learning motivations of engineering students using two samples (n[subscript 1] = 144 and n[subscript 2] = 135) from senior engineering classes. The…
Directory of Open Access Journals (Sweden)
Hongqi Si
2014-01-01
Full Text Available Low-molecular-weight glutenin subunits (LMW-GS are of great importance in processing quality and participate in the formation of polymers in wheat. In this study, eight new LMW-GS alleles were isolated from Chinese wheat landraces (Triticum aestivum L. and designated as Glu-A3-1a, Glu-A3-1b, Glu-B3-1a, Glu-B3-1b, Glu-B3-1c, Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c, which were located at the Glu-A3, Glu-B3, and Glu-D3 loci, respectively. Based on the proteins encoded, the number of deduced amino acids of Glu-B3 alleles was approximately 50 more than those of Glu-A3 and Glu-D3 alleles. The first cysteine of Glu-A3 and Glu-D3 alleles was located at the N-terminal domain, while that of Glu-B3 alleles was found in the repetitive domain, which may lead to the different functioning in forming disulfide bonds. All the eight genes were LMW-m types and the new allele of Glu-B3-1a which had nine cysteine residues may be the desirable LMW-GS gene for improving bread-making quality.
Lin, Phoebe; Shankar, Suma P; Duncan, Jacque; Slavotinek, Anne; Stone, Edwin M; Rutar, Tina
2010-02-01
Norrie disease (ND) is caused by mutations in the ND pseudoglioma (NDP) gene (MIM 300658) located at chromosome Xp11.4-p11.3. ND is characterized by abnormal retinal vascular development and vitreoretinal disorganization presenting at birth. Systemic manifestations include sensorineural deafness, progressive mental disorder, behavioral and psychological problems, growth failure, and seizures. Other vitreoretinopathies that are associated with NDP gene mutations include X-linked familial exudative vitreoretinopathy, Coats disease, persistent fetal vasculature, and retinopathy of prematurity. Phenotypic variability associated with NDP gene mutations has been well documented in affected male patients. However, there are limited data on signs in female carriers, with mild peripheral retinal abnormalities reported in both carrier and noncarrier females of families with NDP gene mutations. Here, we report a family harboring a single base-pair deletion, c.268delC, in the NDP gene causing a severe ND phenotype in the male proband and peripheral retinal vascular abnormalities with dragged maculae similar to those observed in familial exudative vitreoretinopathy in his carrier mother. Copyright (c) 2010 American Association for Pediatric Ophthalmology and Strabismus. Published by Mosby, Inc. All rights reserved.
An Improved Second-Order Generalized Integrator Based Quadrature Signal Generator
DEFF Research Database (Denmark)
Xin, Zhen; Wang, Xiongfei; Qin, Zian
2016-01-01
The second-order generalized integrator based quadrature signal generator (SOGI-QSG) is able to produce in-quadrature signals for many applications, such as frequency estimation, grid synchronization, and harmonic extraction. However, the SOGI-QSG is sensitive to input dc and harmonic components...
The SNEDAX Data Base, General Description and Users' Instructions
International Nuclear Information System (INIS)
Helm, F.
1996-09-01
The SNEDAX Data Base contains information on assemblies built and experiments performed in the fast neutron critical facilities SNEAK (FZK Karlsruhe), MASURCA (CEA Cadarache), ZEBRA (AEA Winfrith) and RRR (Rossendorf Ringzonenreaktor). This report describes the general scope of SNEDAX, the transfer of information from the experimental facilities, and the capabilities to produce graphics and input files for frequently used computer codes. The first part contains general information about the contents and the capabilities of the data base. The second part gives the instructions for persons who actually work with it. The contents in both parts is arranged in a similar way using as far as practical an analogous decimal coding of the sections. In the figures and the annex examples are given in the way in which the data are stored and how they are presented as graphics. The data base is described as it exists in the middle of 1996. It is recognized that there are still many improvements desirable, in particular with respect to a consistent description of the experiments, giving reasonable but not excessive amount of information. Since work in the field of fast critical experiments will be discontinued at FZK, it is planned that the further administration and improvement will be taken over by CEA Cadarache with the support of IPPE Obninsk
Generalizing Perspective-based Inspection to handle Object-Oriented Development Artifacts
Laitenberger, O.; Atkinson, C.
1998-01-01
The value of software inspection for uncovering defects early in the development lifecycle has been well documented. Of the various types of inspection methods published to date, experiments have shown perspective-based inspection to be one of the most effective, because of its enhanced coverage of the defect space. However, inspections in general, and perspective-based inspections in particular, have so far been applied predominantly in the context of conventional structured development meth...
Quantum image encryption based on generalized affine transform and logistic map
Liang, Hao-Ran; Tao, Xiang-Yang; Zhou, Nan-Run
2016-07-01
Quantum circuits of the generalized affine transform are devised based on the novel enhanced quantum representation of digital images. A novel quantum image encryption algorithm combining the generalized affine transform with logistic map is suggested. The gray-level information of the quantum image is encrypted by the XOR operation with a key generator controlled by the logistic map, while the position information of the quantum image is encoded by the generalized affine transform. The encryption keys include the independent control parameters used in the generalized affine transform and the logistic map. Thus, the key space is large enough to frustrate the possible brute-force attack. Numerical simulations and analyses indicate that the proposed algorithm is realizable, robust and has a better performance than its classical counterpart in terms of computational complexity.
Generalized model for Memristor-based Wien family oscillators
Talukdar, Abdul Hafiz Ibne
2012-07-23
In this paper, we report the unconventional characteristics of Memristor in Wien oscillators. Generalized mathematical models are developed to analyze four members of the Wien family using Memristors. Sustained oscillation is reported for all types though oscillating resistance and time dependent poles are present. We have also proposed an analytical model to estimate the desired amplitude of oscillation before the oscillation starts. These Memristor-based oscillation results, presented for the first time, are in good agreement with simulation results. © 2011 Elsevier Ltd.