WorldWideScience

Sample records for genechip wheat genome

  1. Large-scale analysis of antisense transcription in wheat using the Affymetrix GeneChip Wheat Genome Array

    Directory of Open Access Journals (Sweden)

    Settles Matthew L

    2009-05-01

    Full Text Available Abstract Background Natural antisense transcripts (NATs are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded or a different locus (trans-encoded. They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation. NATs give rise to sense-antisense transcript pairs and the number of these identified has escalated greatly with the availability of DNA sequencing resources and public databases. Traditionally, NATs were identified by the alignment of full-length cDNAs or expressed sequence tags to genome sequences, but an alternative method for large-scale detection of sense-antisense transcript pairs involves the use of microarrays. In this study we developed a novel protocol to assay sense- and antisense-strand transcription on the 55 K Affymetrix GeneChip Wheat Genome Array, which is a 3' in vitro transcription (3'IVT expression array. We selected five different tissue types for assay to enable maximum discovery, and used the 'Chinese Spring' wheat genotype because most of the wheat GeneChip probe sequences were based on its genomic sequence. This study is the first report of using a 3'IVT expression array to discover the expression of natural sense-antisense transcript pairs, and may be considered as proof-of-concept. Results By using alternative target preparation schemes, both the sense- and antisense-strand derived transcripts were labeled and hybridized to the Wheat GeneChip. Quality assurance verified that successful hybridization did occur in the antisense-strand assay. A stringent threshold for positive hybridization was applied, which resulted in the identification of 110 sense-antisense transcript pairs, as well as 80 potentially antisense-specific transcripts. Strand-specific RT-PCR validated the microarray observations, and showed that antisense transcription is likely to be tissue specific. For the annotated sense

  2. Analysis of genome-wide gene expression in root of wheat hybrid and its parents using Barley1 GeneChip

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yinhong; NI Zhongfu; YAO Yingyin; ZHAO Jun; SUN Qixin

    2006-01-01

    Previous studies indicated that differential gene expression between hybrids and their parents is responsible for the heterosis. In this paper, we report genome-wide gene expression analysis in roots of a highly heterotic inter-specific hybrid 3338/2463 and its parental inbreds using Barley GeneChip. A total of 1187 genes displayed difference in gene expressions between hybrid 3338/2463 and its parents, and they can be clustered into eight differential expression patterns. Further analysis revealed that among these 1187 genes, 975genes showed high sequence similarity to the GenBank entries, and represented diverse functional categories, such as metabolism, cell growth and maintenance, signal transduction, response to stress, transcription regulation and others. Fourteen genes were selected for RT-PCR analysis and expression patterns of 9 (64.29%) genes were confirmed. Remarkably, 380 differentially expressed genes could be mapped on the Chinese Spring deletion bins, and with the number of genes in seven homoeologous groups being 158, 148, 121, 140,132, 94 and 127 respectively. It is concluded that a combination of systematic identification of differentially expressed genes with comparative mapping would provide further insight into understanding of molecular basis of heterosis.

  3. GeneChip Resequencing of the Smallpox Virus Genome Can Identify Novel Strains: a Biodefense Application▿

    Science.gov (United States)

    Sulaiman, Irshad M.; Tang, Kevin; Osborne, John; Sammons, Scott; Wohlhueter, Robert M.

    2007-01-01

    We developed a set of seven resequencing GeneChips, based on the complete genome sequences of 24 strains of smallpox virus (variola virus), for rapid characterization of this human-pathogenic virus. Each GeneChip was designed to analyze a divergent segment of approximately 30,000 bases of the smallpox virus genome. This study includes the hybridization results of 14 smallpox virus strains. Of the 14 smallpox virus strains hybridized, only 7 had sequence information included in the design of the smallpox virus resequencing GeneChips; similar information for the remaining strains was not tiled as a reference in these GeneChips. By use of variola virus-specific primers and long-range PCR, 22 overlapping amplicons were amplified to cover nearly the complete genome and hybridized with the smallpox virus resequencing GeneChip set. These GeneChips were successful in generating nucleotide sequences for all 14 of the smallpox virus strains hybridized. Analysis of the data indicated that the GeneChip resequencing by hybridization was fast and reproducible and that the smallpox virus resequencing GeneChips could differentiate the 14 smallpox virus strains characterized. This study also suggests that high-density resequencing GeneChips have potential biodefense applications and may be used as an alternate tool for rapid identification of smallpox virus in the future. PMID:17182757

  4. Wheat Landrace Genome Diversity.

    Science.gov (United States)

    Wingen, Luzie U; West, Claire; Leverington-Waite, Michelle; Collier, Sarah; Orford, Simon; Goram, Richard; Yang, Cai-Yun; King, Julie; Allen, Alexandra M; Burridge, Amanda; Edwards, Keith J; Griffiths, Simon

    2017-02-17

    Understanding the genomic complexity of bread wheat (Triticum aestivum L.) is a cornerstone in the quest to unravel the processes of domestication and the following adaptation of domesticated wheat to a wide variety of environments across the globe. Additionally, it is of importance for future improvement of the crop, particularly in the light of climate change. Focussing on the adaptation after domestication, a nested association mapping (NAM) panel of 60 segregating bi-parental populations were developed mainly involving landrace accessions from the core set of the Watkins hexaploid wheat collection optimized for genetic diversity (WINGEN et al. 2014). A modern spring elite variety, 'Paragon,' was used as common reference parent. Genetic maps were constructed following identical rules to make them comparable. In total, 1,611 linkage groups were identified, based on recombination from an estimated 126,300 crossover events over the whole NAM panel. A consensus map, named landrace consensus map (LRC) was constructed and contained 2,498 genetic loci. These newly developed genetics tools were used to investigate the rules underlying genome fluidity or rigidity, e.g. by comparing at marker distances and marker orders. In general, marker order was highly correlated, which provides support for strong synteny between bread wheat accessions. However, many exceptional cases of incongruent linkage groups and increased marker distances were also found. Segregation distortion was detected for many markers, sometimes as hot-spots present in different populations. Furthermore, evidence for translocations in at least 36 of the maps was found. These translocations fell, in general, into many different translocation classes, but a few translocation classes were found in several accessions, the most frequent one being the well known T5B:7B translocation. Loci involved in recombination rate, which is an interesting trait for plant breeding, were identified by QTL analyses using the

  5. A diploid wheat TILLING resource for wheat functional genomics

    Directory of Open Access Journals (Sweden)

    Rawat Nidhi

    2012-11-01

    Full Text Available Abstract Background Triticum monococcum L., an A genome diploid einkorn wheat, was the first domesticated crop. As a diploid, it is attractive genetic model for the study of gene structure and function of wheat-specific traits. Diploid wheat is currently not amenable to reverse genetics approaches such as insertion mutagenesis and post-transcriptional gene silencing strategies. However, TILLING offers a powerful functional genetics approach for wheat gene analysis. Results We developed a TILLING population of 1,532 M2 families using EMS as a mutagen. A total of 67 mutants were obtained for the four genes studied. Waxy gene mutation frequencies are known to be 1/17.6 - 34.4 kb DNA in polyploid wheat TILLING populations. The T. monococcum diploid wheat TILLING population had a mutation frequency of 1/90 kb for the same gene. Lignin biosynthesis pathway genes- COMT1, HCT2, and 4CL1 had mutation frequencies of 1/86 kb, 1/92 kb and 1/100 kb, respectively. The overall mutation frequency of the diploid wheat TILLING population was 1/92 kb. Conclusion The mutation frequency of a diploid wheat TILLING population was found to be higher than that reported for other diploid grasses. The rate, however, is lower than tetraploid and hexaploid wheat TILLING populations because of the higher tolerance of polyploids to mutations. Unlike polyploid wheat, most mutants in diploid wheat have a phenotype amenable to forward and reverse genetic analysis and establish diploid wheat as an attractive model to study gene function in wheat. We estimate that a TILLING population of 5, 520 will be needed to get a non-sense mutation for every wheat gene of interest with 95% probability.

  6. Genome-wide loss of heterozygosity and copy number alteration in esophageal squamous cell carcinoma using the Affymetrix GeneChip Mapping 10 K array

    Directory of Open Access Journals (Sweden)

    Goldstein Alisa M

    2006-11-01

    Full Text Available Abstract Background Esophageal squamous cell carcinoma (ESCC is a common malignancy worldwide. Comprehensive genomic characterization of ESCC will further our understanding of the carcinogenesis process in this disease. Results Genome-wide detection of chromosomal changes was performed using the Affymetrix GeneChip 10 K single nucleotide polymorphism (SNP array, including loss of heterozygosity (LOH and copy number alterations (CNA, for 26 pairs of matched germ-line and micro-dissected tumor DNA samples. LOH regions were identified by two methods – using Affymetrix's genotype call software and using Affymetrix's copy number alteration tool (CNAT software – and both approaches yielded similar results. Non-random LOH regions were found on 10 chromosomal arms (in decreasing order of frequency: 17p, 9p, 9q, 13q, 17q, 4q, 4p, 3p, 15q, and 5q, including 20 novel LOH regions (10 kb to 4.26 Mb. Fifteen CNA-loss regions (200 kb to 4.3 Mb and 36 CNA-gain regions (200 kb to 9.3 Mb were also identified. Conclusion These studies demonstrate that the Affymetrix 10 K SNP chip is a valid platform to integrate analyses of LOH and CNA. The comprehensive knowledge gained from this analysis will enable improved strategies to prevent, diagnose, and treat ESCC.

  7. Quantification of genetic relationships among A genomes of wheats.

    Science.gov (United States)

    Brandolini, A; Vaccino, P; Boggini, G; Ozkan, H; Kilian, B; Salamini, F

    2006-04-01

    The genetic relationships of A genomes of Triticum urartu (Au) and Triticum monococcum (Am) in polyploid wheats are explored and quantified by AFLP fingerprinting. Forty-one accessions of A-genome diploid wheats, 3 of AG-genome wheats, 19 of AB-genome wheats, 15 of ABD-genome wheats, and 1 of the D-genome donor Ae. tauschii have been analysed. Based on 7 AFLP primer combinations, 423 bands were identified as potentially A genome specific. The bands were reduced to 239 by eliminating those present in autoradiograms of Ae. tauschii, bands interpreted as common to all wheat genomes. Neighbour-joining analysis separates T. urartu from T. monococcum. Triticum urartu has the closest relationship to polyploid wheats. Triticum turgidum subsp. dicoccum and T. turgidum subsp. durum lines are included in tightly linked clusters. The hexaploid spelts occupy positions in the phylogenetic tree intermediate between bread wheats and T. turgidum. The AG-genome accessions cluster in a position quite distant from both diploid and other polyploid wheats. The estimates of similarity between A genomes of diploid and polyploid wheats indicate that, compared with Am, Au has around 20% higher similarity to the genomes of polyploid wheats. Triticum timo pheevii AG genome is molecularly equidistant from those of Au and Am wheats.

  8. Genome interplay in the grain transcriptome of hexaploid bread wheat.

    Science.gov (United States)

    Pfeifer, Matthias; Kugler, Karl G; Sandve, Simen R; Zhan, Bujie; Rudi, Heidi; Hvidsten, Torgeir R; Mayer, Klaus F X; Olsen, Odd-Arne

    2014-07-18

    Allohexaploid bread wheat (Triticum aestivum L.) provides approximately 20% of calories consumed by humans. Lack of genome sequence for the three homeologous and highly similar bread wheat genomes (A, B, and D) has impeded expression analysis of the grain transcriptome. We used previously unknown genome information to analyze the cell type-specific expression of homeologous genes in the developing wheat grain and identified distinct co-expression clusters reflecting the spatiotemporal progression during endosperm development. We observed no global but cell type- and stage-dependent genome dominance, organization of the wheat genome into transcriptionally active chromosomal regions, and asymmetric expression in gene families related to baking quality. Our findings give insight into the transcriptional dynamics and genome interplay among individual grain cell types in a polyploid cereal genome. Copyright © 2014, American Association for the Advancement of Science.

  9. Acc homoeoloci and the evolution of wheat genomes

    Science.gov (United States)

    We analyzed the DNA sequences of BACs from many wheat libraries containing the Acc-1 and Acc-2 loci, encoding the plastid and cytosolic forms of the enzyme acetyl-CoA carboxylase, to gain understanding of the evolution of these genes and the origin of the three genomes in modern hexaploid wheat. Mor...

  10. Thermodynamic scaling behavior in genechips

    Directory of Open Access Journals (Sweden)

    Van Hummelen Paul

    2009-01-01

    Full Text Available Abstract Background Affymetrix Genechips are characterized by probe pairs, a perfect match (PM and a mismatch (MM probe differing by a single nucleotide. Most of the data preprocessing algorithms neglect MM signals, as it was shown that MMs cannot be used as estimators of the non-specific hybridization as originally proposed by Affymetrix. The aim of this paper is to study in detail on a large number of experiments the behavior of the average PM/MM ratio. This is taken as an indicator of the quality of the hybridization and, when compared between different chip series, of the quality of the chip design. Results About 250 different GeneChip hybridizations performed at the VIB Microarray Facility for Homo sapiens, Drosophila melanogaster, and Arabidopsis thaliana were analyzed. The investigation of such a large set of data from the same source minimizes systematic experimental variations that may arise from differences in protocols or from different laboratories. The PM/MM ratios are derived theoretically from thermodynamic laws and a link is made with the sequence of PM and MM probe, more specifically with their central nucleotide triplets. Conclusion The PM/MM ratios subdivided according to the different central nucleotides triplets follow qualitatively those deduced from the hybridization free energies in solution. It is shown also that the PM and MM histograms are related by a simple scale transformation, in agreement with what is to be expected from hybridization thermodynamics. Different quantitative behavior is observed on the different chip organisms analyzed, suggesting that some organism chips have superior probe design compared to others.

  11. Genomic dissection of drought resistance in durum wheat x wild emmer wheat recombinant inbreed line population.

    Science.gov (United States)

    Peleg, Zvi; Fahima, Tzion; Krugman, Tamar; Abbo, Shahal; Yakir, Dan; Korol, Abraham B; Saranga, Yehoshua

    2009-07-01

    Drought is the major factor limiting wheat productivity worldwide. The gene pool of wild emmer wheat, Triticum turgidum ssp. dicoccoides, harbours a rich allelic repertoire for morpho-physiological traits conferring drought resistance. The genetic and physiological bases of drought responses were studied here in a tetraploid wheat population of 152 recombinant inbreed lines (RILs), derived from a cross between durum wheat (cv. Langdon) and wild emmer (acc# G18-16), under contrasting water availabilities. Wide genetic variation was found among RILs for all studied traits. A total of 110 quantitative trait loci (QTLs) were mapped for 11 traits, with LOD score range of 3.0-35.4. Several QTLs showed environmental specificity, accounting for productivity and related traits under water-limited (20 QTLs) or well-watered conditions (15 QTLs), and in terms of drought susceptibility index (22 QTLs). Major genomic regions controlling productivity and related traits were identified on chromosomes 2B, 4A, 5A and 7B. QTLs for productivity were associated with QTLs for drought-adaptive traits, suggesting the involvement of several strategies in wheat adaptation to drought stress. Fifteen pairs of QTLs for the same trait were mapped to seemingly homoeologous positions, reflecting synteny between the A and B genomes. The identified QTLs may facilitate the use of wild alleles for improvement of drought resistance in elite wheat cultivars.

  12. Specific patterns of gene space organisation revealed in wheat by using the combination of barley and wheat genomic resources

    Directory of Open Access Journals (Sweden)

    Waugh Robbie

    2010-12-01

    Full Text Available Abstract Background Because of its size, allohexaploid nature and high repeat content, the wheat genome has always been perceived as too complex for efficient molecular studies. We recently constructed the first physical map of a wheat chromosome (3B. However gene mapping is still laborious in wheat because of high redundancy between the three homoeologous genomes. In contrast, in the closely related diploid species, barley, numerous gene-based markers have been developed. This study aims at combining the unique genomic resources developed in wheat and barley to decipher the organisation of gene space on wheat chromosome 3B. Results Three dimensional pools of the minimal tiling path of wheat chromosome 3B physical map were hybridised to a barley Agilent 15K expression microarray. This led to the fine mapping of 738 barley orthologous genes on wheat chromosome 3B. In addition, comparative analyses revealed that 68% of the genes identified were syntenic between the wheat chromosome 3B and barley chromosome 3 H and 59% between wheat chromosome 3B and rice chromosome 1, together with some wheat-specific rearrangements. Finally, it indicated an increasing gradient of gene density from the centromere to the telomeres positively correlated with the number of genes clustered in islands on wheat chromosome 3B. Conclusion Our study shows that novel structural genomics resources now available in wheat and barley can be combined efficiently to overcome specific problems of genetic anchoring of physical contigs in wheat and to perform high-resolution comparative analyses with rice for deciphering the organisation of the wheat gene space.

  13. Genetic Variance in Cadmium Tolerance and Accumulation in Wheat Materials Differing in Ploidy and Genome at Seedling Stage

    DEFF Research Database (Denmark)

    Ci, D; Jiang, D; Wollenweber, B;

    2010-01-01

    Cadmium (Cd) tolerance and accumulation in wheat varieties differing in ploidy and genome were investigated at seedling stage under controlled environmental conditions. The wheat varieties included six diploid, eight tetraploid, seven hexaploid and three octoploid species together with wheat rela...

  14. Wild emmer genome architecture and diversity elucidate wheat evolution and domestication.

    Science.gov (United States)

    Avni, Raz; Nave, Moran; Barad, Omer; Baruch, Kobi; Twardziok, Sven O; Gundlach, Heidrun; Hale, Iago; Mascher, Martin; Spannagl, Manuel; Wiebe, Krystalee; Jordan, Katherine W; Golan, Guy; Deek, Jasline; Ben-Zvi, Batsheva; Ben-Zvi, Gil; Himmelbach, Axel; MacLachlan, Ron P; Sharpe, Andrew G; Fritz, Allan; Ben-David, Roi; Budak, Hikmet; Fahima, Tzion; Korol, Abraham; Faris, Justin D; Hernandez, Alvaro; Mikel, Mark A; Levy, Avraham A; Steffenson, Brian; Maccaferri, Marco; Tuberosa, Roberto; Cattivelli, Luigi; Faccioli, Primetta; Ceriotti, Aldo; Kashkush, Khalil; Pourkheirandish, Mohammad; Komatsuda, Takao; Eilam, Tamar; Sela, Hanan; Sharon, Amir; Ohad, Nir; Chamovitz, Daniel A; Mayer, Klaus F X; Stein, Nils; Ronen, Gil; Peleg, Zvi; Pozniak, Curtis J; Akhunov, Eduard D; Distelfeld, Assaf

    2017-07-07

    Wheat (Triticum spp.) is one of the founder crops that likely drove the Neolithic transition to sedentary agrarian societies in the Fertile Crescent more than 10,000 years ago. Identifying genetic modifications underlying wheat's domestication requires knowledge about the genome of its allo-tetraploid progenitor, wild emmer (T. turgidum ssp. dicoccoides). We report a 10.1-gigabase assembly of the 14 chromosomes of wild tetraploid wheat, as well as analyses of gene content, genome architecture, and genetic diversity. With this fully assembled polyploid wheat genome, we identified the causal mutations in Brittle Rachis 1 (TtBtr1) genes controlling shattering, a key domestication trait. A study of genomic diversity among wild and domesticated accessions revealed genomic regions bearing the signature of selection under domestication. This reference assembly will serve as a resource for accelerating the genome-assisted improvement of modern wheat varieties. Copyright © 2017, American Association for the Advancement of Science.

  15. Genomic Prediction of Gene Bank Wheat Landraces

    Directory of Open Access Journals (Sweden)

    José Crossa

    2016-07-01

    Full Text Available This study examines genomic prediction within 8416 Mexican landrace accessions and 2403 Iranian landrace accessions stored in gene banks. The Mexican and Iranian collections were evaluated in separate field trials, including an optimum environment for several traits, and in two separate environments (drought, D and heat, H for the highly heritable traits, days to heading (DTH, and days to maturity (DTM. Analyses accounting and not accounting for population structure were performed. Genomic prediction models include genotype × environment interaction (G × E. Two alternative prediction strategies were studied: (1 random cross-validation of the data in 20% training (TRN and 80% testing (TST (TRN20-TST80 sets, and (2 two types of core sets, “diversity” and “prediction”, including 10% and 20%, respectively, of the total collections. Accounting for population structure decreased prediction accuracy by 15–20% as compared to prediction accuracy obtained when not accounting for population structure. Accounting for population structure gave prediction accuracies for traits evaluated in one environment for TRN20-TST80 that ranged from 0.407 to 0.677 for Mexican landraces, and from 0.166 to 0.662 for Iranian landraces. Prediction accuracy of the 20% diversity core set was similar to accuracies obtained for TRN20-TST80, ranging from 0.412 to 0.654 for Mexican landraces, and from 0.182 to 0.647 for Iranian landraces. The predictive core set gave similar prediction accuracy as the diversity core set for Mexican collections, but slightly lower for Iranian collections. Prediction accuracy when incorporating G × E for DTH and DTM for Mexican landraces for TRN20-TST80 was around 0.60, which is greater than without the G × E term. For Iranian landraces, accuracies were 0.55 for the G × E model with TRN20-TST80. Results show promising prediction accuracies for potential use in germplasm enhancement and rapid introgression of exotic germplasm

  16. Genome-wide Association Analysis of Kernel Weight in Hard Winter Wheat

    Science.gov (United States)

    Wheat kernel weight is an important and heritable component of wheat grain yield and a key predictor of flour extraction. Genome-wide association analysis was conducted to identify genomic regions associated with kernel weight and kernel weight environmental response in 8 trials of 299 hard winter ...

  17. Rapid development of PCR-based genome-specific repetitive DNA junction markers in wheat

    Science.gov (United States)

    In hexaploid wheat (Triticum aestivum L.) (AABBDD, C=17,000Mb), repeat DNA accounts for ~ 90% of the genome of which transposable elements (TEs) constitute 60-80 %. Despite the dynamic evolution of TEs, our previous study indicated that the majority of TEs between the homologous wheat genomes are co...

  18. Genomics as the key to unlocking the polyploid potential of wheat.

    Science.gov (United States)

    Borrill, Philippa; Adamski, Nikolai; Uauy, Cristobal

    2015-12-01

    Polyploidy has played a central role in plant genome evolution and in the formation of new species such as tetraploid pasta wheat and hexaploid bread wheat. Until recently, the high sequence conservation between homoeologous genes, together with the large genome size of polyploid wheat, had hindered genomic analyses in this important crop species. In the past 5 yr, however, the advent of next-generation sequencing has radically changed the wheat genomics landscape. Here, we review a series of advances in genomic resources and tools for functional genomics that are shifting the paradigm of what is possible in wheat molecular genetics and breeding. We discuss how understanding the relationship between homoeologues can inform approaches to modulate the response of quantitative traits in polyploid wheat; we also argue that functional redundancy has 'locked up' a wide range of phenotypic variation in wheat. We explore how genomics provides key tools to inform targeted manipulation of multiple homoeologues, thereby allowing researchers and plant breeders to unlock the full polyploid potential of wheat.

  19. Molecular verification of the integration of Tripsacum dactyloides DNA into wheat genome through wide hybridization

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    RAPD and RFLP analyses of double haploid lines which derived from hybridization between hexaploid wheat (Triticum aestivum L.2n=42) and eastern gamagrass (Tripsacum dactyloides L.2n=4x=72) are reported.Two of the 340 Operon primers have been screened,which stably amplified Tripsacum dactyloides (male parent) specific bands in the double haploid lines.These results confirm the fact that Tripsacum dactyloides DNA has been integrated into wheat genome by sexual hybridization at molecular level.This idea has been further testified by RFLP analysis.Application and potentials of transferring Tripsacum dactyloides DNA into wheat genome by sexual hybridization in wheat breeding are discussed.

  20. Meiotic homoeologous recombination-based alien gene introgression in the genomics era of wheat

    Science.gov (United States)

    Wheat (Triticum spp.) has a narrow genetic basis due to its allopolyploid origin. However, wheat has numerous wild relatives usable for expanding genetic variability of its genome through meiotic homoeologous recombination. Traditionally, laborious cytological analyses have been employed to detect h...

  1. Wild emmer genome architecture and diversity elucidate wheat evolution and domestication

    Science.gov (United States)

    Wheat (Triticum spp.) is one of the founder crops that likely drove the Neolithic transition to sedentary agrarian societies in the Fertile Crescent over 10,000 years ago. Identifying genetic modifications underlying wheat's domestication requires knowledge of the genome of its allo-tetraploid proge...

  2. Heat stress-responsive transcriptome analysis in heat susceptible and tolerant wheat (Triticum aestivum L. by using Wheat Genome Array

    Directory of Open Access Journals (Sweden)

    Peng Huiru

    2008-09-01

    Full Text Available Abstract Background Wheat is a major crop in the world, and the high temperature stress can reduce the yield of wheat by as much as 15%. The molecular changes in response to heat stress are poorly understood. Using GeneChip® Wheat Genome Array, we analyzed genome-wide gene expression profiles in the leaves of two wheat genotypes, namely, heat susceptible 'Chinese Spring' (CS and heat tolerant 'TAM107' (TAM. Results A total of 6560 (~10.7% probe sets displayed 2-fold or more changes in expression in at least one heat treatment (false discovery rate, FDR, α = 0.001. Except for heat shock protein (HSP and heat shock factor (HSF genes, these putative heat responsive genes encode transcription factors and proteins involved in phytohormone biosynthesis/signaling, calcium and sugar signal pathways, RNA metabolism, ribosomal proteins, primary and secondary metabolisms, as well as proteins related to other stresses. A total of 313 probe sets were differentially expressed between the two genotypes, which could be responsible for the difference in heat tolerance of the two genotypes. Moreover, 1314 were differentially expressed between the heat treatments with and without pre-acclimation, and 4533 were differentially expressed between short and prolonged heat treatments. Conclusion The differences in heat tolerance in different wheat genotypes may be associated with multiple processes and mechanisms involving HSPs, transcription factors, and other stress related genes. Heat acclimation has little effects on gene expression under prolonged treatments but affects gene expression in wheat under short-term heat stress. The heat stress responsive genes identified in this study will facilitate our understanding of molecular basis for heat tolerance in different wheat genotypes and future improvement of heat tolerance in wheat and other cereals.

  3. Genome merger: from sequence rearrangements in triticale to their elimination in wheat-rye addition lines.

    Science.gov (United States)

    Bento, Miguel; Gustafson, Perry; Viegas, Wanda; Silva, Manuela

    2010-08-01

    Genetic and epigenetic modifications resulting from different genomes adjusting to a common nuclear environment have been observed in polyploids. Sequence restructuring within genomes involving retrotransposon/microsatellite-rich regions has been reported in triticale. The present study uses inter-retrotransposon amplified polymorphisms (IRAP) and retrotransposon microsatellite amplified polymorphisms (REMAP) to assess genome rearrangements in wheat-rye addition lines obtained by the controlled backcrossing of octoploid triticale to hexaploid wheat followed by self-fertilization. The comparative analysis of IRAP and REMAP banding profiles, involving a complete set of wheat-rye addition lines, and their parental species revealed in those lines the presence of wheat-origin bands absent in triticale, and the absence of rye-origin and triticale-specific bands. The presence in triticale x wheat backcrosses (BC) of rye-origin bands that were absent in the addition lines demonstrated that genomic rearrangement events were not a direct consequence of backcrossing, but resulted from further genome structural rearrangements in the BC plant progeny. PCR experiments using primers designed from different rye-origin sequences showed that the absence of a rye-origin band in wheat-rye addition lines results from sequence elimination rather than restrict changes on primer annealing sites, as noted in triticale. The level of genome restructuring events evaluated in all seven wheat-rye addition lines, compared to triticale, indicated that the unbalanced genome merger situation observed in the addition lines induced a new round of genome rearrangement, suggesting that the lesser the amount of rye chromatin introgressed into wheat the larger the outcome of genome reshuffling.

  4. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    Directory of Open Access Journals (Sweden)

    McGuire Patrick E

    2010-12-01

    Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large

  5. Modelling background intensity in Affymetrix Genechips

    CERN Document Server

    Kroll, K M; Carlon, E

    2008-01-01

    DNA microarrays are devices that are able, in principle, to detect and quantify the presence of specific nucleic acid sequences in complex biological mixtures. The measurement consists in detecting fluorescence signals from several spots on the microarray surface onto which different probe sequences are grafted. One of the problems of the data analysis is that the signal contains a noisy background component due to non-specific binding. This paper presents a physical model for background estimation in Affymetrix Genechips. It combines two different approaches. The first is based on the sequence composition, specifically its sequence dependent hybridization affinity. The second is based on the strong correlation of intensities from locations which are the physical neighbors of a specific spot on the chip. Both effects are incorporated in a background functional which contains 24 free parameters, fixed by minimization on a training data set. In all data analyzed the sequence specific parameters, obtained by min...

  6. Accelerated evolution of the mitochondrial genome in an alloplasmic line of durum wheat

    Science.gov (United States)

    Wheat is not only an important crop but also an excellent plant species for nuclear mitochondrial interaction studies. To investigate the level of sequence changes introduced into the mitochondrial genome under the alloplasmic conditions, three mitochondrial genomes of Triticum-Aegilops species w...

  7. Complete Genome Sequences of the Endophytic Streptomyces Strains EN16, EN23, and EN27, Isolated from Wheat Plants

    Science.gov (United States)

    Araujo, Ricardo; Adetutu, Eric; Tobe, Shanan S.; Mallya, Sandeep; Paul, Bobby; Satyamoorthy, Kapaettu

    2016-01-01

    The complete genome sequences of three endophytic Streptomyces species were compared. Strains EN16, EN23, and EN27 were isolated from surface-sterilized roots of wheat plants from South Australia. In field trials, these strains are effective in suppressing fungal root diseases of wheat when added as spore coatings to wheat seed. PMID:27932645

  8. Use of a recombination-deficient phage lambda system to construct wheat genomic libraries.

    Science.gov (United States)

    Murray, M G; Kennard, W C; Drong, R F; Slightom, J L

    1984-10-01

    The poor cloning efficiency of wheat (Triticum aestivum cv. Yamhill) DNA in conventional cloning vectors has previously prevented the preparation of complete genomic libraries. We show here that while wheat DNA does not clone efficiently using the vector Ch4A, it can be cloned efficiently using Ch32. Ch32 clones are red- gam+ and therefore can be propagated on recombination-deficient hosts. These results suggest that instability of wheat sequences in conventional lambda vector systems has frustrated previous attempts to prepare libraries.

  9. A high-density, SNP-based consensus map of tetraploid wheat as a bridge to integrate durum and bread wheat genomics and breeding

    Science.gov (United States)

    Consensus linkage maps are important tools in crop genomics. We have assembled a high-density tetraploid wheat consensus map by integrating 13 datasets from independent biparental populations involving durum wheat cultivars (Triticum turgidum ssp. durum), cultivated emmer (T. turgidum ssp. dicoccum...

  10. Genome-wide characterization of JASMONATE-ZIM DOMAIN transcription repressors in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Wang, Yukun; Qiao, Linyi; Bai, Jianfang; Wang, Peng; Duan, Wenjing; Yuan, Shaohua; Yuan, Guoliang; Zhang, Fengting; Zhang, Liping; Zhao, Changping

    2017-02-13

    The JASMONATE-ZIM DOMAIN (JAZ) repressor family proteins are jasmonate co-receptors and transcriptional repressor in jasmonic acid (JA) signaling pathway, and they play important roles in regulating the growth and development of plants. Recently, more and more researches on JAZ gene family are reported in many plants. Although the genome sequencing of common wheat (Triticum aestivum L.) and its relatives is complete, our knowledge about this gene family remains vacant. Fourteen JAZ genes were identified in the wheat genome. Structural analysis revealed that the TaJAZ proteins in wheat were as conserved as those in other plants, but had structural characteristics. By phylogenetic analysis, all JAZ proteins from wheat and other plants were clustered into 11 sub-groups (G1-G11), and TaJAZ proteins shared a high degree of similarity with some JAZ proteins from Aegliops tauschii, Brachypodium distachyon and Oryza sativa. The Ka/Ks ratios of TaJAZ genes ranged from 0.0016 to 0.6973, suggesting that the TaJAZ family had undergone purifying selection in wheat. Gene expression patterns obtained by quantitative real-time PCR (qRT-PCR) revealed differential temporal and spatial regulation of TaJAZ genes under multifarious abiotic stress treatments of high salinity, drought, cold and phytohormone. Among these, TaJAZ7, 8 and 12 were specifically expressed in the anther tissues of the thermosensitive genic male sterile (TGMS) wheat line BS366 and normal control wheat line Jing411. Compared with the gene expression patterns in the normal wheat line Jing411, TaJAZ7, 8 and 12 had different expression patterns in abnormally dehiscent anthers of BS366 at the heading stage 6, suggesting that specific up- or down-regulation of these genes might be associated with the abnormal anther dehiscence in TGMS wheat line. This study analyzed the size and composition of the JAZ gene family in wheat, and investigated stress responsive and differential tissue-specific expression profiles of each

  11. Comparative genome analysis of wheat blue dwarf phytoplasma, an obligate pathogen that causes wheat blue dwarf disease in China.

    Directory of Open Access Journals (Sweden)

    Wang Chen

    Full Text Available Wheat blue dwarf (WBD disease is an important disease that has caused heavy losses in wheat production in northwestern China. This disease is caused by WBD phytoplasma, which is transmitted by Psammotettix striatus. Until now, no genome information about WBD phytoplasma has been published, seriously restricting research on this obligate pathogen. In this paper, we report a new sequencing and assembling strategy for phytoplasma genome projects. This strategy involves differential centrifugation, pulsed-field gel electrophoresis, whole genome amplification, shotgun sequencing, de novo assembly, screening of contigs from phytoplasma and the connection of phytoplasma contigs. Using this scheme, the WBD phytoplasma draft genome was obtained. It was comprised of six contigs with a total size of 611,462 bp, covering ∼94% of the chromosome. Five-hundred-twenty-five protein-coding genes, two operons for rRNA genes and 32 tRNA genes were identified. Comparative genome analyses between WBD phytoplasma and other phytoplasmas were subsequently carried out. The results showed that extensive arrangements and inversions existed among the WBD, OY-M and AY-WB phytoplasma genomes. Most protein-coding genes in WBD phytoplasma were found to be homologous to genes from other phytoplasmas; only 22 WBD-specific genes were identified. KEGG pathway analysis indicated that WBD phytoplasma had strongly reduced metabolic capabilities. However, 46 transporters were identified, which were involved with dipeptides/oligopeptides, spermidine/putrescine, cobalt and Mn/Zn transport, and so on. A total of 37 secreted proteins were encoded in the WBD phytoplasma chromosome and plasmids. Of these, three secreted proteins were similar to the reported phytoplasma virulence factors TENGU, SAP11 and SAP54. In addition, WBD phytoplasma possessed several proteins that were predicted to play a role in its adaptation to diverse environments. These results will provide clues for research on

  12. [Genetics and Genomics of Wheat: Storage Proteins, Ecological Plasticity, and Immunity].

    Science.gov (United States)

    Novoselskaya-Dragovich, A Yu

    2015-05-01

    Recent advances in genetics and genetic research methods made it possible to explain the large polymorphism observed among storage proteins of wheat weevil (gliadins and glutenins), to determine their genetic control mechanism, and to develop a system for the identification of wheat genotypes on the basis of multiple allelism. This system has extremely high sensitivity and efficiency, which makes it possible to conduct studies to determine the purity and authenticity of wheat varieties, the dynamics of alleles diversity in time and space, the phylogenetics, etc., through the use of an extensive database on the allelic composition of gliadin loci. An investigation of the molecular structure of genes controlling the synthesis of storage proteins and their organization on chromosomes, as well as an analysis of wheat genome structure, revealed the molecular mechanisms of variability in the wheat genome and its reorganization in response to changes in environmental conditions and cultivation technologies. The multilevel genetic system of protection against pathogens and adverse environmental factors that developed in the course of wheat evolution continues to astound researchers' imagination with new resistance genes and novel types of antimicrobial peptides having been discovered and sequenced in recent years and the diversity of their structures and mechanisms of action in response to pathogens. An analysis of gene sequences involved in wheat domestication, namely, those that define ecological plasticity, i. e. the type of plant development (Vrn genes), and those responsible for spikelet traits (Q genes), which ensured the successful cultivation of wheat by humans, revealed that the basis for these features are specific mutations.

  13. REARRANGEMENT IN THE B-GENOME FROM DIPLOID PROGENITOR TO WHEAT ALLOPOLYPOLID

    Directory of Open Access Journals (Sweden)

    Salina E.A.

    2012-08-01

    Full Text Available Three key periods that were accompanied by considerable rearrangements in the B genome of wheat and its progenitor can be considered. The first period covers the period from the divergence of diploid Triticum and Aegilops species from their common progenitor (2.5–6 million years ago to formation of the tetraploid T. diccocoides (about 500 thousand years ago. Significant genomic rearrangements in the diploid progenitor of the B genome, Ae. speltoides (SS genome, involved a considerable amplification of repeated DNA sequences, which led to an increase in the number of heterochromatin blocks on chromosomes relative to other diploid Aegilops and Triticum species. Our analysis has demonstrated that during this period the Spelt1 repeats intensively amplified as well as several mobile elements proliferated, in particular, the genome-specific gypsy LTR-retrotransposon Fatima and CACTA DNA-transposon Caspar. The second period in the B-genome evolution was associated with the emergence of tetraploid (BBAA genome and its subsequent evolution. The third most important event leading to the next rearrangement of the B genome took place relatively recently, 7000–9500 years ago, being associated with the emergence of hexaploid wheat with the genomic formula BBAADD. The evolution of the B/S genome involved intergenomic and intragenomic translocations and chromosome inversions. So far, five rearrangements in the B-genome chromosomes of polyploid wheats has been observed and described; the majority of them took place during the formation and evolution of tetraploid species. The mapping of the S-genome chromosomes and comparison with the B-genome chromosome maps have demonstrated that individual rearrangements pre-existed in Ae. speltoides; moreover, Ae. speltoides is polymorphic for these rearrangements.Chromosome 5B is nearly 870 Mbp (5BL = 580 Mbp and 5BS = 290 Mbp and is known to carry important genes controlling the key aspects of wheat biology, in

  14. A 4-gigabase physical map unlocks the structure and evolution of the complex genome of Aegilops tauschii, the wheat D-genome progenitor

    Science.gov (United States)

    The current limitations in genome sequencing technology require the construction of physical maps for high-quality draft sequences of large plant genomes, such as that of Aegilops tauschii, the wheat D-genome progenitor. To construct a physical map of the Ae. tauschii genome, we fingerprinted 461,70...

  15. Identification and Characterization of Reverse Transcriptase Domain of Transcriptionally Active Retrotransposons in Wheat Genomes

    Institute of Scientific and Technical Information of China (English)

    Yi-Miao TANG; You-Zhi MA; Lian-Cheng LI; Xing-Guo YE

    2005-01-01

    To clarify activation characterization of wheat (Triticum aestivum L.) retrotransposons, transcriptionally active Ty1-copia retrotransposons were found in wheat by using RT-PCR to amplify the RT domain. Sequence analysis of random RT-PCR clones reveals that Ty1-copia retrotransposons are highly heterogeneous and can be divided into at least four groups, which are tentatively named TaRT-1 to TaRT-4.Dot blot hybridization indicates that TaRT- 1 exists in the wheat genome as multiple copies (at 30 000 copies/a hexaploid genome (ABD)). Northern blot hybridization showed that TaRT-1 is only expressed at a low level under normal conditions in seedlings, but at a high level when induced by powdery mildew fungus, jasmonic acid (JA) and salicylic acid (SA). These results suggest that the TaRT-1 expression is highly sensitive to biotic and abiotic stresses.

  16. Genome Variation Within Triticale in Comparison to its Wheat and Rye Progenitors

    Science.gov (United States)

    Genome variation in the intergeneric wheat-rye hybrid triticale (X Triticosecale Wittmack) has been a puzzle to scientists and plant breeders since the first triticale was synthesized. The existence of unexplained genetic variation in triticale as compared to the parents has been a hindrance to bre...

  17. Physical mapping resources for large plant genomes: radiation hybrids for wheat D-genome progenitor Aegilops tauschii

    Directory of Open Access Journals (Sweden)

    Kumar Ajay

    2012-11-01

    Full Text Available Abstract Background Development of a high quality reference sequence is a daunting task in crops like wheat with large (~17Gb, highly repetitive (>80% and polyploid genome. To achieve complete sequence assembly of such genomes, development of a high quality physical map is a necessary first step. However, due to the lack of recombination in certain regions of the chromosomes, genetic mapping, which uses recombination frequency to map marker loci, alone is not sufficient to develop high quality marker scaffolds for a sequence ready physical map. Radiation hybrid (RH mapping, which uses radiation induced chromosomal breaks, has proven to be a successful approach for developing marker scaffolds for sequence assembly in animal systems. Here, the development and characterization of a RH panel for the mapping of D-genome of wheat progenitor Aegilops tauschii is reported. Results Radiation dosages of 350 and 450 Gy were optimized for seed irradiation of a synthetic hexaploid (AABBDD wheat with the D-genome of Ae. tauschii accession AL8/78. The surviving plants after irradiation were crossed to durum wheat (AABB, to produce pentaploid RH1s (AABBD, which allows the simultaneous mapping of the whole D-genome. A panel of 1,510 RH1 plants was obtained, of which 592 plants were generated from the mature RH1 seeds, and 918 plants were rescued through embryo culture due to poor germination (1 seeds. This panel showed a homogenous marker loss (2.1% after screening with SSR markers uniformly covering all the D-genome chromosomes. Different marker systems mostly detected different lines with deletions. Using markers covering known distances, the mapping resolution of this RH panel was estimated to be cM/cR ratio of 1:5.2 and 15 distinct bins. Additionally, with this small set of lines, almost all the tested ESTs could be mapped. A set of 399 most informative RH lines with an average deletion frequency of ~10% were identified for developing high density marker

  18. Organelles genome stability of wheat plantlets produced by anther ...

    African Journals Online (AJOL)

    Yomi

    2012-03-15

    Mar 15, 2012 ... detected between doubled haploid plantlets and parental plants at the level of ctDNA and mtDNA organization. ... 2009). In breeding programmes of wheat cultivars, in vitro ... employed in releasing several barley cultivars (Muñoz- ..... Cuthbert JL, Somers DJ, Brûlé-Babel AL, Brown PD, Crow GH (2008).

  19. Spontaneous and divergent hexaploid triticales derived from common wheat × rye by complete elimination of D-genome chromosomes.

    Directory of Open Access Journals (Sweden)

    Hao Li

    Full Text Available Hexaploid triticale could be either synthesized by crossing tetraploid wheat with rye, or developed by crossing hexaploid wheat with a hexaploid triticale or an octoploid triticale.Here two hexaploid triticales with great morphologic divergence derived from common wheat cultivar M8003 (Triticum aestivum L. × Austrian rye (Secale cereale L. were reported, exhibiting high resistance for powdery mildew and stripe rust and potential for wheat improvement. Sequential fluorescence in situ hybridization (FISH and genomic in situ hybridization (GISH karyotyping revealed that D-genome chromosomes were completely eliminated and the whole A-genome, B-genome and R-genome chromosomes were retained in both lines. Furthermore, plentiful alterations of wheat chromosomes including 5A and 7B were detected in both triticales and additionally altered 5B, 7A chromosome and restructured chromosome 2A was assayed in N9116H and N9116M, respectively, even after selfing for several decades. Besides, meiotic asynchrony was displayed and a variety of storage protein variations were assayed, especially in the HMW/LMW-GS region and secalins region in both triticales.This study confirms that whole D-genome chromosomes could be preferentially eliminated in the hybrid of common wheat × rye, "genome shock" was accompanying the allopolyploidization of nascent triticales, and great morphologic divergence might result from the genetic variations. Moreover, new hexaploid triticale lines contributing potential resistance resources for wheat improvement were produced.

  20. Linkage disequilibrium and genome-wide association mapping in tetraploid wheat (Triticum turgidum L.).

    Science.gov (United States)

    Laidò, Giovanni; Marone, Daniela; Russo, Maria A; Colecchia, Salvatore A; Mastrangelo, Anna M; De Vita, Pasquale; Papa, Roberto

    2014-01-01

    Association mapping is a powerful tool for the identification of quantitative trait loci through the exploitation of the differential decay of linkage disequilibrium (LD) between marker loci and genes of interest in natural and domesticated populations. Using a sample of 230 tetraploid wheat lines (Triticum turgidum ssp), which included naked and hulled accessions, we analysed the pattern of LD considering 26 simple sequence repeats and 970 mostly mapped diversity array technology loci. In addition, to validate the potential for association mapping in durum wheat, we evaluated the same genotypes for plant height, heading date, protein content, and thousand-kernel weight. Molecular and phenotypic data were used to: (i) investigate the genetic and phenotypic diversity; (ii) study the dynamics of LD across the durum wheat genome, by investigating the patterns of LD decay; and (iii) test the potential of our panel to identify marker-trait associations through the analysis of four quantitative traits of major agronomic importance. Moreover, we compared and validated the association mapping results with outlier detection analysis based on population divergence. Overall, in tetraploid wheat, the pattern of LD is extremely population dependent and is related to the domestication and breeding history of durum wheat. Comparing our data with several other studies in wheat, we confirm the position of many major genes and quantitative trait loci for the traits considered. Finally, the analysis of the selection signature represents a very useful complement to validate marker-trait associations.

  1. Genetic compensation abilities of Aegilops speltoides chromosomes for homoeologous B-genome chromosomes of polyploid wheat in disomic S(B) chromosome substitution lines

    Science.gov (United States)

    The S genome of Aegilops speltoides is closely related to the B and G genomes of polyploid wheats. However, little work has been reported on the genetic relationships between the S-genome and B-genome chromosomes of polyploid wheat. Here we report the isolation of a set of disomic substitutions (DS)...

  2. Population- and genome-specific patterns of linkage disequilibrium and SNP variation in spring and winter wheat (Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Campbell Kim

    2010-12-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here, we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD and population structure in a panel of 478 spring and winter wheat cultivars (Triticum aestivum from 17 populations across the United States and Mexico. Results Most of the wheat oligo pool assay (OPA SNPs that were polymorphic within the complete set of 478 cultivars were also polymorphic in all subpopulations. Higher levels of genetic differentiation were observed among wheat lines within populations than among populations. A total of nine genetically distinct clusters were identified, suggesting that some of the pre-defined populations shared significant proportion of genetic ancestry. Estimates of population structure (FST at individual loci showed a high level of heterogeneity across the genome. In addition, seven genomic regions with elevated FST were detected between the spring and winter wheat populations. Some of these regions overlapped with previously mapped flowering time QTL. Across all populations, the highest extent of significant LD was observed in the wheat D-genome, followed by lower LD in the A- and B-genomes. The differences in the extent of LD among populations and genomes were mostly driven by differences in long-range LD ( > 10 cM. Conclusions Genome- and population-specific patterns of genetic differentiation and LD were discovered in the populations of wheat cultivars from different geographic regions. Our study demonstrated that the estimates of population structure between spring and winter wheat lines can identify genomic regions harboring candidate genes involved in the regulation of growth habit. Variation in LD suggests that breeding and selection had a different impact on each wheat genome both within and

  3. Genetic Nature of Elemental Contents in Wheat Grains and Its Genomic Prediction: Toward the Effective Use of Wheat Landraces from Afghanistan

    Science.gov (United States)

    Yamaoka, Shuhei; Yoshimura, Kazusa; Kondou, Youichi; Onogi, Akio; Matsui, Minami; Iwata, Hiroyoshi; Ban, Tomohiro

    2017-01-01

    Profiling elemental contents in wheat grains and clarifying the underlying genetic systems are important for the breeding of biofortified crops. Our objective was to evaluate the genetic potential of 269 Afghan wheat landraces for increasing elemental contents in wheat cultivars. The contents of three major (Mg, K, and P) and three minor (Mn, Fe, and Zn) elements in wheat grains were measured by energy dispersive X-ray fluorescence spectrometry. Large variations in elemental contents were observed among landraces. Marker-based heritability estimates were low to moderate, suggesting that the elemental contents are complex quantitative traits. Genetic correlations between two locations (Japan and Afghanistan) and among the six elements were estimated using a multi-response Bayesian linear mixed model. Low-to-moderate genetic correlations were observed among major elements and among minor elements respectively, but not between major and minor elements. A single-response genome-wide association study detected only one significant marker, which was associated with Zn, suggesting it will be difficult to increase the elemental contents of wheat by conventional marker-assisted selection. Genomic predictions for major elemental contents were moderately or highly accurate, whereas those for minor elements were mostly low or moderate. Our results indicate genomic selection may be useful for the genetic improvement of elemental contents in wheat. PMID:28072876

  4. Isolation and sequence analysis of the wheat B genome subtelomeric DNA

    Directory of Open Access Journals (Sweden)

    Huneau Cecile

    2009-09-01

    Full Text Available Abstract Background Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. Results The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119 737 bp was annotated. It is composed of 33% transposable elements (TEs, 8.2% Spelt52 (namely, the subfamily Spelt52.2 and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11 666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0. Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Conclusion Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat

  5. Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes

    Science.gov (United States)

    Liang, Zhen; Chen, Kunling; Li, Tingdong; Zhang, Yi; Wang, Yanpeng; Zhao, Qian; Liu, Jinxing; Zhang, Huawei; Liu, Cuimin; Ran, Yidong; Gao, Caixia

    2017-01-01

    Substantial efforts are being made to optimize the CRISPR/Cas9 system for precision crop breeding. The avoidance of transgene integration and reduction of off-target mutations are the most important targets for optimization. Here, we describe an efficient genome editing method for bread wheat using CRISPR/Cas9 ribonucleoproteins (RNPs). Starting from RNP preparation, the whole protocol takes only seven to nine weeks, with four to five independent mutants produced from 100 immature wheat embryos. Deep sequencing reveals that the chance of off-target mutations in wheat cells is much lower in RNP mediated genome editing than in editing with CRISPR/Cas9 DNA. Consistent with this finding, no off-target mutations are detected in the mutant plants. Because no foreign DNA is used in CRISPR/Cas9 RNP mediated genome editing, the mutants obtained are completely transgene free. This method may be widely applicable for producing genome edited crop plants and has a good prospect of being commercialized. PMID:28098143

  6. Comparisons of Copy Number, Genomic Structure, and Conserved Motifs for α-Amylase Genes from Barley, Rice, and Wheat

    Directory of Open Access Journals (Sweden)

    Qisen Zhang

    2017-10-01

    Full Text Available Barley is an important crop for the production of malt and beer. However, crops such as rice and wheat are rarely used for malting. α-amylase is the key enzyme that degrades starch during malting. In this study, we compared the genomic properties, gene copies, and conserved promoter motifs of α-amylase genes in barley, rice, and wheat. In all three crops, α-amylase consists of four subfamilies designated amy1, amy2, amy3, and amy4. In wheat and barley, members of amy1 and amy2 genes are localized on chromosomes 6 and 7, respectively. In rice, members of amy1 genes are found on chromosomes 1 and 2, and amy2 genes on chromosome 6. The barley genome has six amy1 members and three amy2 members. The wheat B genome contains four amy1 members and three amy2 members, while the rice genome has three amy1 members and one amy2 member. The B genome has mostly amy1 and amy2 members among the three wheat genomes. Amy1 promoters from all three crop genomes contain a GA-responsive complex consisting of a GA-responsive element (CAATAAA, pyrimidine box (CCTTTT and TATCCAT/C box. This study has shown that amy1 and amy2 from both wheat and barley have similar genomic properties, including exon/intron structures and GA-responsive elements on promoters, but these differ in rice. Like barley, wheat should have sufficient amy activity to degrade starch completely during malting. Other factors, such as high protein with haze issues and the lack of husk causing Lauting difficulty, may limit the use of wheat for brewing.

  7. A Catalog of Regulatory Sequences for Trait Gene for the Genome Editing of Wheat

    Science.gov (United States)

    Makai, Szabolcs; Tamás, László; Juhász, Angéla

    2016-01-01

    Wheat has been cultivated for 10000 years and ever since the origin of hexaploid wheat it has been exempt from natural selection. Instead, it was under the constant selective pressure of human agriculture from harvest to sowing during every year, producing a vast array of varieties. Wheat has been adopted globally, accumulating variation for genes involved in yield traits, environmental adaptation and resistance. However, one small but important part of the wheat genome has hardly changed: the regulatory regions of both the x- and y-type high molecular weight glutenin subunit (HMW-GS) genes, which are alone responsible for approximately 12% of the grain protein content. The phylogeny of the HMW-GS regulatory regions of the Triticeae demonstrates that a genetic bottleneck may have led to its decreased diversity during domestication and the subsequent cultivation. It has also highlighted the fact that the wild relatives of wheat may offer an unexploited genetic resource for the regulatory region of these genes. Significant research efforts have been made in the public sector and by international agencies, using wild crosses to exploit the available genetic variation, and as a result synthetic hexaploids are now being utilized by a number of breeding companies. However, a newly emerging tool of genome editing provides significantly improved efficiency in exploiting the natural variation in HMW-GS genes and incorporating this into elite cultivars and breeding lines. Recent advancement in the understanding of the regulation of these genes underlines the needs for an overview of the regulatory elements for genome editing purposes. PMID:27766102

  8. Predicting Hybrid Performances for Quality Traits through Genomic-Assisted Approaches in Central European Wheat

    KAUST Repository

    Liu, Guozheng

    2016-07-06

    Bread-making quality traits are central targets for wheat breeding. The objectives of our study were to (1) examine the presence of major effect QTLs for quality traits in a Central European elite wheat population, (2) explore the optimal strategy for predicting the hybrid performance for wheat quality traits, and (3) investigate the effects of marker density and the composition and size of the training population on the accuracy of prediction of hybrid performance. In total 135 inbred lines of Central European bread wheat (Triticum aestivum L.) and 1,604 hybrids derived from them were evaluated for seven quality traits in up to six environments. The 135 parental lines were genotyped using a 90k single-nucleotide polymorphism array. Genome-wide association mapping initially suggested presence of several quantitative trait loci (QTLs), but cross-validation rather indicated the absence of major effect QTLs for all quality traits except of 1000-kernel weight. Genomic selection substantially outperformed marker-assisted selection in predicting hybrid performance. A resampling study revealed that increasing the effective population size in the estimation set of hybrids is relevant to boost the accuracy of prediction for an unrelated test population.

  9. Predicting Hybrid Performances for Quality Traits through Genomic-Assisted Approaches in Central European Wheat.

    Directory of Open Access Journals (Sweden)

    Guozheng Liu

    Full Text Available Bread-making quality traits are central targets for wheat breeding. The objectives of our study were to (1 examine the presence of major effect QTLs for quality traits in a Central European elite wheat population, (2 explore the optimal strategy for predicting the hybrid performance for wheat quality traits, and (3 investigate the effects of marker density and the composition and size of the training population on the accuracy of prediction of hybrid performance. In total 135 inbred lines of Central European bread wheat (Triticum aestivum L. and 1,604 hybrids derived from them were evaluated for seven quality traits in up to six environments. The 135 parental lines were genotyped using a 90k single-nucleotide polymorphism array. Genome-wide association mapping initially suggested presence of several quantitative trait loci (QTLs, but cross-validation rather indicated the absence of major effect QTLs for all quality traits except of 1000-kernel weight. Genomic selection substantially outperformed marker-assisted selection in predicting hybrid performance. A resampling study revealed that increasing the effective population size in the estimation set of hybrids is relevant to boost the accuracy of prediction for an unrelated test population.

  10. Genomic Distribution of Quantitative Trait Loci for Yield and Yield-related Traits in Common Wheat

    Institute of Scientific and Technical Information of China (English)

    Li-Yi Zhang; Dong-Cheng Liu; Xiao-Li Guo; Wen-Long Yang; Jia-Zhu Sun; Dao-Wen Wang; Aimin Zhang

    2010-01-01

    A major objective of quantitative trait locus(QTL)studies is to find genes/markers that can be used in breeding programs via marker assisted selection(MAS).We surveyed the QTLs for yield and yield related traits and their genomic distributions in common wheat(Triticum aestivum L.)in the available published reports.We then carried out a meta-QTL(MQTL)analysis to identify the major and consistent QTLs for these traits.In total,55 MQTLs were identified,of which 12 significant MQTLs were located on wheat chromosomes 1A,1B,2A,2D,3B,4A,4B,4D and 5A.Our study showed that the genetic control of yield and its components in common wheat involved the important genes such as Rht and Vrn.Furthermore,several significant MQTLs were found in the chromosomal regions corresponding to several rice genomic locations containing important QTLs for yield related traits.Our results demonstrate that meta-QTL analysis is a powerful tool for confirming the major and stable QTLs and refining their chromosomal positions in common wheat,which may be useful for improving the MAS efficiency of yield related traits.

  11. Genomic and genie sequence variation in synthetic hexaploid wheat(AABBDD)as compared to their parental species

    Institute of Scientific and Technical Information of China (English)

    Lihong Nie; Zongfu Han; Lahu Lu; Yingyin Yao; Qixin Sun; Zhongfu Ni

    2008-01-01

    In order to understand the genomic changes during the evolution of hexaploid wheat,two sets of synthetic hexaploid wheat from hybridization between maternal tetraploid wheat (AABB) and paternal diploid goat grass(DD)were used for DNA-AFLP and single strand conformation polymorphism (SSCP) analysis to determine the genomic and genie variation in the synthetic hexaploid wheat.Results indicated that more DNA sequences from paternal diploid species wen eliminated in the synthetic hexaploid wheat than from maternal tetraploid wheat,suggesting that genome from parental species of lower ploidity tends to be eliminated preferentially.However,sequence variation detected by SSCP procedure was much lower than those detected by DNA-AFLP.which indicated that much less variation in the genie regions occurred in the synthetic hexaploid wheat.and sequence variations detected by DNA-AFLP could be derived mostly from non-coding regions and repetitive sequences.Our results also indicated that sequence variation in 4 genes can be detected in hybrid F1.which suggested that this type of sequence variation could be resulted from distant hybridization.It was interesting to note that 3 out of the 4 genes were mapped and clustered on the long alTll of chromosome 2D,which indicated that variation in genic sequences in synthetic hexaploid wheat might not be a randomized process.

  12. Genetic diversity revealed by genomic-SSR and EST-SSR markers among common wheat, spelt and compactum

    Institute of Scientific and Technical Information of China (English)

    YANG Xinquan; LIU Peng; HAN Zongfu; NI Zhongfu; SUN Qixin

    2005-01-01

    In this study, two SSR molecular markers, named genomic-SSR and EST-SSR, are used to measure the genetic diversity among three hexaploid wheat populations, which include 28 common wheat ( Triticum aestivum L. ), 13 spelt ( Triticum spelta L. ),and 11 compactum ( Triticum compactum Host. ). The results show that common wheat has the highest genetic polymorphism, followed by spelt and then compactum. The mean genetic distance between the populations is higher than that within a population, and similar tendency is detected for individual genomes A, B and D. Therefore, spelt and compactum can be used as potential germplasms for wheat breeding, especially for enriching the genetic variation in genome D. As compared with spelt, the genetic diversity between common wheat and compactum is much smaller, indicating a closer consanguine relationship between these two species. Although the polymorphism revealed by EST-SSR is lower than that by genomic-SSR, it can effectively differentiate diverse genotypes as well. Together with our present results, it is concluded that EST-SSR marker is an ideal marker for assessing the genetic diversity in wheat. Meanwhile, the origin and evolution of hexaploid wheat is also analyzed and discussed.

  13. Discovery and mapping of single feature polymorphisms in wheat using Affymetrix arrays

    Directory of Open Access Journals (Sweden)

    Hu Shengwa

    2009-05-01

    Full Text Available Abstract Background Wheat (Triticum aestivum L. is a staple food crop worldwide. The wheat genome has not yet been sequenced due to its huge genome size (~17,000 Mb and high levels of repetitive sequences; the whole genome sequence may not be expected in the near future. Available linkage maps have low marker density due to limitation in available markers; therefore new technologies that detect genome-wide polymorphisms are still needed to discover a large number of new markers for construction of high-resolution maps. A high-resolution map is a critical tool for gene isolation, molecular breeding and genomic research. Single feature polymorphism (SFP is a new microarray-based type of marker that is detected by hybridization of DNA or cRNA to oligonucleotide probes. This study was conducted to explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome. Results Six wheat varieties of diverse origins (Ning 7840, Clark, Jagger, Encruzilhada, Chinese Spring, and Opata 85 were analyzed for significant probe by variety interactions and 396 probe sets with SFPs were identified. A subset of 164 unigenes was sequenced and 54% showed polymorphism within probes. Microarray analysis of 71 recombinant inbred lines from the cross Ning 7840/Clark identified 955 SFPs and 877 of them were mapped together with 269 simple sequence repeat markers. The SFPs were randomly distributed within a chromosome but were unevenly distributed among different genomes. The B genome had the most SFPs, and the D genome had the least. Map positions of a selected set of SFPs were validated by mapping single nucleotide polymorphism using SNaPshot and comparing with expressed sequence tags mapping data. Conclusion The Affymetrix array is a cost-effective platform for SFP discovery and SFP mapping in wheat. The new high-density map constructed in this study will be a useful tool for genetic and genomic research in wheat.

  14. GENOMIC APPROACHES FOR IMPROVEMENT OF DROUGHT ADAPTATION IN WHEAT

    Directory of Open Access Journals (Sweden)

    Dénes Dudits

    2008-09-01

    Full Text Available Breeding for yield stability under water limited conditions plays an essential role in the reduction of economic and social consequences of global climate changes. We show that two exotic drought resistant genotypes (Kobomughi and Plainsmann differ in root growth rate, root/shoot ratio, and adaptation to low soil water content. These genotypes exhibit characteristic transcript profiles as shown by barley macroarray studies using 10500 unigenes. Reprogramming of gene expression primarily occurred during the 1-2 weeks of water stress, and 6,1% of tested genes were up-regulated in roots of the more adaptive Plainsmann plants. The time course for expression of gene clusters from Kobomughi genotype revealed a prompt and transient gene activation that can help the survival of plants through function of various defense mechanisms. The aldo-keto reductases (AKRs can detoxify lipid peroxidation products (4-hydroxynon-2-enal and glycolysis-derived reactive aldehydes (metylglyoxal that contribute significantly to cellular damages caused by variety of environmental stresses such as drought, high light intensity, UV-B irradiation, cold. Overproduction of AKRs in transgenic tobacco or wheat plants provides considerable stress tolerance and resistance to methylglyoxal. Several transgenic wheat genotypes have been produced with production of elevated level of AKR enzyme. The drought tolerance of these materials was tested by a complex stress diagnostic system, that integrates imaging of plants and monitoring the leaf temperature and fluorescence induction. Based on these parameters, we can conclude that this transgenic strategy that is based on detoxification of lipid aldehyde can result in improved stress adaptation and reduced yield loss.

  15. Novel definition files for human GeneChips based on GeneAnnot

    Directory of Open Access Journals (Sweden)

    Ferrari Sergio

    2007-11-01

    Full Text Available Abstract Background Improvements in genome sequence annotation revealed discrepancies in the original probeset/gene assignment in Affymetrix microarray and the existence of differences between annotations and effective alignments of probes and transcription products. In the current generation of Affymetrix human GeneChips, most probesets include probes matching transcripts from more than one gene and probes which do not match any transcribed sequence. Results We developed a novel set of custom Chip Definition Files (CDF and the corresponding Bioconductor libraries for Affymetrix human GeneChips, based on the information contained in the GeneAnnot database. GeneAnnot-based CDFs are composed of unique custom-probesets, including only probes matching a single gene. Conclusion GeneAnnot-based custom CDFs solve the problem of a reliable reconstruction of expression levels and eliminate the existence of more than one probeset per gene, which often leads to discordant expression signals for the same transcript when gene differential expression is the focus of the analysis. GeneAnnot CDFs are freely distributed and fully compliant with Affymetrix standards and all available software for gene expression analysis. The CDF libraries are available from http://www.xlab.unimo.it/GA_CDF, along with supplementary information (CDF libraries, installation guidelines and R code, CDF statistics, and analysis results.

  16. GeneChip analyses point to novel pathogenetic mechanisms in mantle cell lymphoma.

    Science.gov (United States)

    Vater, Inga; Wagner, Florian; Kreuz, Markus; Berger, Hilmar; Martín-Subero, José I; Pott, Christiane; Martinez-Climent, Jose A; Klapper, Wolfram; Krause, Kristina; Dyer, Martin J S; Gesk, Stefan; Harder, Lana; Zamo, Alberto; Dreyling, Martin; Hasenclever, Dirk; Arnold, Norbert; Siebert, Reiner

    2009-02-01

    The translocation t(11;14)(q13;q32) is the genetic hallmark of mantle cell lymphoma (MCL) but is not sufficient for inducing lymphomagenesis. Here we performed genome-wide 100K GeneChip Mapping in 26 t(11;14)-positive MCL and six MCL cell lines. Partial uniparental disomy (pUPD) was shown to be a recurrent chromosomal event not only in MCL cell lines but also in primary MCL. Remarkably, pUPD affected recurrent targets of deletion like 11q, 13q and 17p. Moreover, we identified 12 novel regions of recurrent gain and loss as well as 12 high-level amplifications and eight homozygously deleted regions hitherto undescribed in MCL. Interestingly, GeneChip analyses identified different genes, encoding proteins involved in microtubule dynamics, such as MAP2, MAP6 and TP53, as targets for chromosomal aberration in MCL. Further investigation, including mutation analyses, fluorescence in situ hybridisation as well as epigenetic and expression studies, revealed additional aberrations frequently affecting these genes. In total, 19 of 20 MCL cases, which were subjected to genetic and epigenetic analyses, and five of six MCL cell lines harboured at least one aberration in MAP2, MAP6 or TP53. These findings provide evidence that alterations of microtubule dynamics might be one of the critical events in MCL lymphomagenesis contributing to chromosomal instability.

  17. Analysis of Triticum boeoticum and Triticum urartu seed defensins: To the problem of the origin of polyploid wheat genomes.

    Science.gov (United States)

    Odintsova, Tatyana I; Korostyleva, Tatyana V; Odintsova, Margarita S; Pukhalsky, Vitaliy A; Grishin, Eugene V; Egorov, Tsezi A

    2008-06-01

    The origin of polyploid wheat genomes has been the subject of numerous studies and is the key problem in wheat phylogeny. Different diploid species have been supposed to donate genomes to tetraploid and hexaploid wheat species. To shed light on phylogenetic relationships between the presumable A genome donors and hexaploid wheat species we have applied a new approach: the comparison of defensins from diploid Triticum species, Triticum boeoticum Boiss. and Triticum urartu Thum. ex Gandil., with previously characterized Triticum kiharae defensins [T.I. Odintsova et al., Biochimie 89 (2007) 605-612]. Defensins were isolated by acidic extraction of seeds followed by three-step chromatographic separation. Isolated defensins were identified by molecular masses using MALDI-TOF mass spectrometry and N-terminal sequencing. For the first time, we have shown that T. urartu defensins are more similar to those of the hexaploid wheat than T. boeoticum defensins, although variation among samples collected in different regions of the world was revealed. Our results clearly demonstrate that T. urartu of the Asian origin contributed the A genome to polyploid wheat species.

  18. RNA-guided genome editing for target gene mutations in wheat.

    Science.gov (United States)

    Upadhyay, Santosh Kumar; Kumar, Jitesh; Alok, Anshu; Tuli, Rakesh

    2013-12-09

    The clustered, regularly interspaced, short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system has been used as an efficient tool for genome editing. We report the application of CRISPR-Cas-mediated genome editing to wheat (Triticum aestivum), the most important food crop plant with a very large and complex genome. The mutations were targeted in the inositol oxygenase (inox) and phytoene desaturase (pds) genes using cell suspension culture of wheat and in the pds gene in leaves of Nicotiana benthamiana. The expression of chimeric guide RNAs (cgRNA) targeting single and multiple sites resulted in indel mutations in all the tested samples. The expression of Cas9 or sgRNA alone did not cause any mutation. The expression of duplex cgRNA with Cas9 targeting two sites in the same gene resulted in deletion of DNA fragment between the targeted sequences. Multiplexing the cgRNA could target two genes at one time. Target specificity analysis of cgRNA showed that mismatches at the 3' end of the target site abolished the cleavage activity completely. The mismatches at the 5' end reduced cleavage, suggesting that the off target effects can be abolished in vivo by selecting target sites with unique sequences at 3' end. This approach provides a powerful method for genome engineering in plants.

  19. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA.

    Science.gov (United States)

    Zhang, Yi; Liang, Zhen; Zong, Yuan; Wang, Yanpeng; Liu, Jinxing; Chen, Kunling; Qiu, Jin-Long; Gao, Caixia

    2016-08-25

    Editing plant genomes is technically challenging in hard-to-transform plants and usually involves transgenic intermediates, which causes regulatory concerns. Here we report two simple and efficient genome-editing methods in which plants are regenerated from callus cells transiently expressing CRISPR/Cas9 introduced as DNA or RNA. This transient expression-based genome-editing system is highly efficient and specific for producing transgene-free and homozygous wheat mutants in the T0 generation. We demonstrate our protocol to edit genes in hexaploid bread wheat and tetraploid durum wheat, and show that we are able to generate mutants with no detectable transgenes. Our methods may be applicable to other plant species, thus offering the potential to accelerate basic and applied plant genome-engineering research.

  20. The Evolution of Orphan Regions in Genomes of a Fungal Pathogen of Wheat

    Directory of Open Access Journals (Sweden)

    Clémence Plissonneau

    2016-10-01

    Full Text Available Fungal plant pathogens rapidly evolve virulence on resistant hosts through mutations in genes encoding proteins that modulate the host immune responses. The mutational spectrum likely includes chromosomal rearrangements responsible for gains or losses of entire genes. However, the mechanisms creating adaptive structural variation in fungal pathogen populations are poorly understood. We used complete genome assemblies to quantify structural variants segregating in the highly polymorphic fungal wheat pathogen Zymoseptoria tritici. The genetic basis of virulence in Z. tritici is complex, and populations harbor significant genetic variation for virulence; hence, we aimed to identify whether structural variation led to functional differences. We combined single-molecule real-time sequencing, genetic maps, and transcriptomics data to generate a fully assembled and annotated genome of the highly virulent field isolate 3D7. Comparative genomics analyses against the complete reference genome IPO323 identified large chromosomal inversions and the complete gain or loss of transposable-element clusters, explaining the extensive chromosomal-length polymorphisms found in this species. Both the 3D7 and IPO323 genomes harbored long tracts of sequences exclusive to one of the two genomes. These orphan regions contained 296 genes unique to the 3D7 genome and not previously known for this species. These orphan genes tended to be organized in clusters and showed evidence of mutational decay. Moreover, the orphan genes were enriched in genes encoding putative effectors and included a gene that is one of the most upregulated putative effector genes during wheat infection. Our study showed that this pathogen species harbored extensive chromosomal structure polymorphism that may drive the evolution of virulence.

  1. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-02-01

    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  2. Impact of the D genome and quantitative trait loci on quantitative traits in a spring durum by spring bread wheat cross

    Science.gov (United States)

    Desirable agronomic traits are similar for common hexaploid (6X) bread wheat (Triticum aestivum, 2n = 6x = 42, genome, AABBDD) and tetraploid (4X) durum wheat (Triticum turgidum durum, 2n = 4x = 28, genome, AABB). However, they are genetically isolated from each other due to an unequal number of ge...

  3. Genome-wide analysis of complex wheat gliadins, the dominant carriers of celiac disease epitopes.

    Science.gov (United States)

    Wang, Da-Wei; Li, Da; Wang, Junjun; Zhao, Yue; Wang, Zhaojun; Yue, Guidong; Liu, Xin; Qin, Huanju; Zhang, Kunpu; Dong, Lingli; Wang, Daowen

    2017-03-16

    Gliadins, specified by six compound chromosomal loci (Gli-A1/B1/D1 and Gli-A2/B2/D2) in hexaploid bread wheat, are the dominant carriers of celiac disease (CD) epitopes. Because of their complexity, genome-wide characterization of gliadins is a strong challenge. Here, we approached this challenge by combining transcriptomic, proteomic and bioinformatic investigations. Through third-generation RNA sequencing, full-length transcripts were identified for 52 gliadin genes in the bread wheat cultivar Xiaoyan 81. Of them, 42 were active and predicted to encode 25 α-, 11 γ-, one δ- and five ω-gliadins. Comparative proteomic analysis between Xiaoyan 81 and six newly-developed mutants each lacking one Gli locus indicated the accumulation of 38 gliadins in the mature grains. A novel group of α-gliadins (the CSTT group) was recognized to contain very few or no CD epitopes. The δ-gliadins identified here or previously did not carry CD epitopes. Finally, the mutant lacking Gli-D2 showed significant reductions in the most celiac-toxic α-gliadins and derivative CD epitopes. The insights and resources generated here should aid further studies on gliadin functions in CD and the breeding of healthier wheat.

  4. Genome-Wide Association of Stem Water Soluble Carbohydrates in Bread Wheat

    Science.gov (United States)

    Dong, Yan; Liu, Jindong; Zhang, Yan; Geng, Hongwei; Rasheed, Awais; Xiao, Yonggui; Cao, Shuanghe; Fu, Luping; Yan, Jun; Wen, Weie; Zhang, Yong; Jing, Ruilian; Xia, Xianchun; He, Zhonghu

    2016-01-01

    Water soluble carbohydrates (WSC) in stems play an important role in buffering grain yield in wheat against biotic and abiotic stresses; however, knowledge of genes controlling WSC is very limited. We conducted a genome-wide association study (GWAS) using a high-density 90K SNP array to better understand the genetic basis underlying WSC, and to explore marker-based breeding approaches. WSC was evaluated in an association panel comprising 166 Chinese bread wheat cultivars planted in four environments. Fifty two marker-trait associations (MTAs) distributed across 23 loci were identified for phenotypic best linear unbiased estimates (BLUEs), and 11 MTAs were identified in two or more environments. Liner regression showed a clear dependence of WSC BLUE scores on numbers of favorable (increasing WSC content) and unfavorable alleles (decreasing WSC), indicating that genotypes with higher numbers of favorable or lower numbers of unfavorable alleles had higher WSC content. In silico analysis of flanking sequences of trait-associated SNPs revealed eight candidate genes related to WSC content grouped into two categories based on the type of encoding proteins, namely, defense response proteins and proteins triggered by environmental stresses. The identified SNPs and candidate genes related to WSC provide opportunities for breeding higher WSC wheat cultivars. PMID:27802269

  5. Genome-wide analysis of complex wheat gliadins, the dominant carriers of celiac disease epitopes

    Science.gov (United States)

    Wang, Da-Wei; Li, Da; Wang, Junjun; Zhao, Yue; Wang, Zhaojun; Yue, Guidong; Liu, Xin; Qin, Huanju; Zhang, Kunpu; Dong, Lingli; Wang, Daowen

    2017-01-01

    Gliadins, specified by six compound chromosomal loci (Gli-A1/B1/D1 and Gli-A2/B2/D2) in hexaploid bread wheat, are the dominant carriers of celiac disease (CD) epitopes. Because of their complexity, genome-wide characterization of gliadins is a strong challenge. Here, we approached this challenge by combining transcriptomic, proteomic and bioinformatic investigations. Through third-generation RNA sequencing, full-length transcripts were identified for 52 gliadin genes in the bread wheat cultivar Xiaoyan 81. Of them, 42 were active and predicted to encode 25 α-, 11 γ-, one δ- and five ω-gliadins. Comparative proteomic analysis between Xiaoyan 81 and six newly-developed mutants each lacking one Gli locus indicated the accumulation of 38 gliadins in the mature grains. A novel group of α-gliadins (the CSTT group) was recognized to contain very few or no CD epitopes. The δ-gliadins identified here or previously did not carry CD epitopes. Finally, the mutant lacking Gli-D2 showed significant reductions in the most celiac-toxic α-gliadins and derivative CD epitopes. The insights and resources generated here should aid further studies on gliadin functions in CD and the breeding of healthier wheat. PMID:28300172

  6. A Whole Genome DArTseq and SNP Analysis for Genetic Diversity Assessment in Durum Wheat from Central Fertile Crescent

    Science.gov (United States)

    Shahid, Muhammad Qasim; Çiftçi, Vahdettin; E. Sáenz de Miera, Luis; Aasim, Muhammad; Nadeem, Muhammad Azhar; Aktaş, Husnu; Özkan, Hakan; Hatipoğlu, Rüştü

    2017-01-01

    Until now, little attention has been paid to the geographic distribution and evaluation of genetic diversity of durum wheat from the Central Fertile Crescent (modern-day Turkey and Syria). Turkey and Syria are considered as primary centers of wheat diversity, and thousands of locally adapted wheat landraces are still present in the farmers’ small fields. We planned this study to evaluate the genetic diversity of durum wheat landraces from the Central Fertile Crescent by genotyping based on DArTseq and SNP analysis. A total of 39,568 DArTseq and 20,661 SNP markers were used to characterize the genetic characteristic of 91 durum wheat land races. Clustering based on Neighbor joining analysis, principal coordinate as well as Bayesian model implemented in structure, clearly showed that the grouping pattern is not associated with the geographical distribution of the durum wheat due to the mixing of the Turkish and Syrian landraces. Significant correlation between DArTseq and SNP markers was observed in the Mantel test. However, we detected a non-significant relationship between geographical coordinates and DArTseq (r = -0.085) and SNP (r = -0.039) loci. These results showed that unconscious farmer selection and lack of the commercial varieties might have resulted in the exchange of genetic material and this was apparent in the genetic structure of durum wheat in Turkey and Syria. The genomic characterization presented here is an essential step towards a future exploitation of the available durum wheat genetic resources in genomic and breeding programs. The results of this study have also depicted a clear insight about the genetic diversity of wheat accessions from the Central Fertile Crescent. PMID:28099442

  7. High-throughput mining of E-genome-specific SNPs for characterizing Thinopyrum elongatum introgressions in common wheat.

    Science.gov (United States)

    Lou, Haijuan; Dong, Lingli; Zhang, Kunpu; Wang, Da-Wei; Zhao, Maolin; Li, Yiwen; Rong, Chaowu; Qin, Huanju; Zhang, Aimin; Dong, Zhenying; Wang, Daowen

    2017-02-09

    Diploid Thinopyrum elongatum (EE, 2n = 2x = 14) and related polyploid species constitute an important gene pool for improving Triticeae grain and forage crops. However, the genomic and molecular marker resources are generally poor for these species. To aid the genetic, molecular, breeding and ecological studies involving Thinopyrum species, we developed a strategy for mining and validating E-genome-specific SNPs using Th. elongatum and common wheat (Triticum aestivum, AABBDD, 2n = 6x = 42) as experimental materials. By comparing the transcriptomes between Chinese Spring (CS, a common wheat variety) and the CS-Th. elongatum octoploid, 35,193 candidate SNPs between E genome genes and their common wheat orthologs were computed. Through comparative genomic analysis, these SNPs were putatively assigned to the seven individual E genome chromosomes. Among 420 randomly selected SNPs, 373 could be validated. Thus, approximately 89% of the mined SNPs may be authentic with respect to their polymorphism and chromosomal location. Using 14 such SNPs as molecular markers, complex E genome introgressions were reliably identified in 78 common wheat-Th. elongatum hybrids, and the structural feature of a novel recombinant chromosome formed by 6E and 7E was revealed. Finally, based on testing 33 SNPs assigned to chromosome 3E in multiple genotypes of Th. elongatum, Pseudoroegneria stipifolia (carrying the St genome related to E) and common wheat, we suggest that some of the SNP markers may also be applicable for genetic studies within and among the Thinopyrum species (populations) carrying E and/or St genomes in the future. © 2017 John Wiley & Sons Ltd.

  8. Whole genome association mapping of plant height in winter wheat (Triticum aestivum L..

    Directory of Open Access Journals (Sweden)

    Christine D Zanke

    Full Text Available The genetic architecture of plant height was investigated in a set of 358 recent European winter wheat varieties plus 14 spring wheat varieties based on field data in eight environments. Genotyping of diagnostic markers revealed the Rht-D1b mutant allele in 58% of the investigated varieties, while the Rht-B1b mutant was only present in 7% of the varieties. Rht-D1 was significantly associated with plant height by using a mixed linear model and employing a kinship matrix to correct for population stratification. Further genotyping data included 732 microsatellite markers, resulting in 770 loci, of which 635 markers were placed on the ITMI map plus a set of 7769 mapped SNP markers genotyped with the 90 k iSELECT chip. When Bonferroni correction was applied, a total of 153 significant marker-trait associations (MTAs were observed for plant height and the SSR markers (-log10 (P-value ≥ 4.82 and 280 (-log10 (P-value ≥ 5.89 for the SNPs. Linear regression between the most effective markers and the BLUEs for plant height indicated additive effects for the MTAs of different chromosomal regions. Analysis of syntenic regions in the rice genome revealed closely linked rice genes related to gibberellin acid (GA metabolism and perception, i.e. GA20 and GA2 oxidases orthologous to wheat chromosomes 1A, 2A, 3A, 3B, 5B, 5D and 7B, ent-kaurenoic acid oxidase orthologous to wheat chromosome 7A, ent-kaurene synthase on wheat chromosome 2B, as well as GA-receptors like DELLA genes orthologous to wheat chromosomes 4B, 4D and 7A and genes of the GID family orthologous to chromosomes 2B and 5B. The data indicated that besides the widely used GA-insensitive dwarfing genes Rht-B1 and Rht-D1 there is a wide spectrum of loci available that could be used for modulating plant height in variety development.

  9. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Institute of Scientific and Technical Information of China (English)

    Yonglong Yu; Dong Zhu; Chaoying Ma; Hui Cao; Yaping Wang; Yanhao Xu; Wenying Zhang; Yueming Yan

    2016-01-01

    Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20) during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA) was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further informa-tion about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  10. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Directory of Open Access Journals (Sweden)

    Yonglong Yu

    2016-04-01

    Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  11. Use of methylation filtration and Cot fractionation for analysis of genome composition and comparative genomics in bread wheat

    Institute of Scientific and Technical Information of China (English)

    Rajib Bandopadhyay; Sachin Rustgi; Rajat Kanti Chaudhuri; Paramjit Khurana; Jitendra Paul Khurana; Akhilesh Kumar Tyagi; Harindra Singh Balyan; Andreas Houben; Pushpendra Kumar Gupta

    2011-01-01

    We investigated the compositional and structural differences in sequences derived from different fractions of wheat genomic DNA obtained using methylation filtration and Cot fractionation. Comparative analysis of these sequences revealed large compositional and structural variations in terms of GC content, different structural elements including repeat sequences (e.g., transposable elements and simple sequence repeats),protein coding genes, and non-coding RNA genes. A correlation between methylation status [determined on the basis of selective inclusion/exclusion in methylation-filtered (MF) library]of different repeat elements and expression level was observed. The expression levels were determined by comparing MF sequences with expressed sequence tags (ESTs) available in the public domain. Only a limited overlap among MF,high Cot (HC), and ESTs was observed, suggesting that these sequences may largely either represent the low-copy non-transcribed sequences or include genes with low expression levels. Thus, these results indicated a need to study MF and HC sequences along with ESTs to fully appreciate complexity of wheat gene space.

  12. Dissecting miRNAs in Wheat D Genome Progenitor, Aegilops tauschii.

    Science.gov (United States)

    Akpinar, Bala A; Budak, Hikmet

    2016-01-01

    As the post-transcriptional regulators of gene expression, microRNAs or miRNAs comprise an integral part of understanding how genomes function. Although miRNAs have been a major focus of recent efforts, miRNA research is still in its infancy in most plant species. Aegilops tauschii, the D genome progenitor of bread wheat, is a wild diploid grass exhibiting remarkable population diversity. Due to the direct ancestry and the diverse gene pool, A. tauschii is a promising source for bread wheat improvement. In this study, a total of 87 Aegilops miRNA families, including 51 previously unknown, were computationally identified both at the subgenomic level, using flow-sorted A. tauschii 5D chromosome, and at the whole genome level. Predictions at the genomic and subgenomic levels suggested A. tauschii 5D chromosome as rich in pre-miRNAs that are highly associated with Class II DNA transposons. In order to gain insights into miRNA evolution, putative 5D chromosome miRNAs were compared to its modern ortholog, Triticum aestivum 5D chromosome, revealing that 48 of the 58 A. tauschii 5D miRNAs were conserved in orthologous T. aestivum 5D chromosome. The expression profiles of selected miRNAs (miR167, miR5205, miR5175, miR5523) provided the first experimental evidence for miR5175, miR5205 and miR5523, and revealed differential expressional changes in response to drought in different genetic backgrounds for miR167 and miR5175. Interestingly, while miR5523 coding regions were present and expressed as pre-miR5523 in both T. aestivum and A. tauschii, the expression of mature miR5523 was observed only in A. tauschii under normal conditions, pointing out to an interference at the downstream processing of pre-miR5523 in T. aestivum. Overall, this study expands our knowledge on the miRNA catalog of A. tauschii, locating a subset specifically to the 5D chromosome, with ample functional and comparative insight which should contribute to and complement efforts to develop drought tolerant

  13. Dissecting miRNAs in wheat D genome progenitor, Aegilops tauschii

    Directory of Open Access Journals (Sweden)

    Hikmet eBudak

    2016-05-01

    Full Text Available As the post-transcriptional regulators of gene expression, microRNAs or miRNAs comprise an integral part of understanding how genomes function. Although miRNAs have been a major focus of recent efforts, miRNA research is still in its infancy in most plant species. Aegilops tauschii, the D genome progenitor of bread wheat, is a wild diploid grass exhibiting remarkable population diversity. Due to the direct ancestry and the diverse gene pool, A. tauschii is a promising source for bread wheat improvement. In this study, a total of 87 Aegilops miRNA families, including 51 previously unknown, were computationally identified both at the subgenomic level, using flow-sorted A. tauschii 5D chromosome, and at the whole genome level. Predictions at the genomic and subgenomic levels suggested A. tauschii 5D chromosome as rich in pre-miRNAs that are highly associated with Class II DNA transposons. In order to gain insights into miRNA evolution, putative 5D chromosome miRNAs were compared to its modern ortholog, T. aestivum 5D chromosome, revealing that 48 of the 58 A. tauschii 5D miRNAs were conserved in orthologous T. aestivum 5D chromosome. The expression profiles of selected miRNAs (miR167, miR5205, miR5175, miR5523 provided the first experimental evidence for miR5175, miR5205 and miR5523, and revealed differential expressional changes in response to drought in different genetic backgrounds for miR167 and miR5175. Interestingly, while miR5523 coding regions were present and expressed as pre-miR5523 in both T. aestivum and A. tauschii, the expression of mature miR5523 was observed only in A. tauschii under normal conditions, pointing out to an interference at the downstream processing of pre-miR5523 in T. aestivum. Overall, this study expands our knowledge on the miRNA catalogue of Aegilops tauschii, locating a subset specifically to the 5D chromosome, with ample functional and comparative insight which should contribute to and complement efforts to

  14. The impact of Ty3-gypsy group LTR retrotransposons Fatima on B-genome specificity of polyploid wheats

    Directory of Open Access Journals (Sweden)

    Huneau Cecile

    2011-06-01

    Full Text Available Abstract Background Transposable elements (TEs are a rapidly evolving fraction of the eukaryotic genomes and the main contributors to genome plasticity and divergence. Recently, occupation of the A- and D-genomes of allopolyploid wheat by specific TE families was demonstrated. Here, we investigated the impact of the well-represented family of gypsy LTR-retrotransposons, Fatima, on B-genome divergence of allopolyploid wheat using the fluorescent in situ hybridisation (FISH method and phylogenetic analysis. Results FISH analysis of a BAC clone (BAC_2383A24 initially screened with Spelt1 repeats demonstrated its predominant localisation to chromosomes of the B-genome and its putative diploid progenitor Aegilops speltoides in hexaploid (genomic formula, BBAADD and tetraploid (genomic formula, BBAA wheats as well as their diploid progenitors. Analysis of the complete BAC_2383A24 nucleotide sequence (113 605 bp demonstrated that it contains 55.6% TEs, 0.9% subtelomeric tandem repeats (Spelt1, and five genes. LTR retrotransposons are predominant, representing 50.7% of the total nucleotide sequence. Three elements of the gypsy LTR retrotransposon family Fatima make up 47.2% of all the LTR retrotransposons in this BAC. In situ hybridisation of the Fatima_2383A24-3 subclone suggests that individual representatives of the Fatima family contribute to the majority of the B-genome specific FISH pattern for BAC_2383A24. Phylogenetic analysis of various Fatima elements available from databases in combination with the data on their insertion dates demonstrated that the Fatima elements fall into several groups. One of these groups, containing Fatima_2383A24-3, is more specific to the B-genome and proliferated around 0.5-2.5 MYA, prior to allopolyploid wheat formation. Conclusion The B-genome specificity of the gypsy-like Fatima, as determined by FISH, is explained to a great degree by the appearance of a genome-specific element within this family for Ae

  15. Genome Wide Association Mapping for Arabinoxylan Content in a Collection of Tetraploid Wheats.

    Directory of Open Access Journals (Sweden)

    Ilaria Marcotuli

    Full Text Available Arabinoxylans (AXs are major components of plant cell walls in bread wheat and are important in bread-making and starch extraction. Furthermore, arabinoxylans are components of soluble dietary fibre that has potential health-promoting effects in human nutrition. Despite their high value for human health, few studies have been carried out on the genetics of AX content in durum wheat.The genetic variability of AX content was investigated in a set of 104 tetraploid wheat genotypes and regions attributable to AX content were identified through a genome wide association study (GWAS. The amount of arabinoxylan, expressed as percentage (w/w of the dry weight of the kernel, ranged from 1.8% to 5.5% with a mean value of 4.0%. The GWAS revealed a total of 37 significant marker-trait associations (MTA, identifying 19 quantitative trait loci (QTL associated with AX content. The highest number of MTAs was identified on chromosome 5A (seven, where three QTL regions were associated with AX content, while the lowest number of MTAs was detected on chromosomes 2B and 4B, where only one MTA identified a single locus. Conservation of synteny between SNP marker sequences and the annotated genes and proteins in Brachypodium distachyon, Oryza sativa and Sorghum bicolor allowed the identification of nine QTL coincident with candidate genes. These included a glycosyl hydrolase GH35, which encodes Gal7 and a glucosyltransferase GT31 on chromosome 1A; a cluster of GT1 genes on chromosome 2B that includes TaUGT1 and cisZog1; a glycosyl hydrolase that encodes a CelC gene on chromosome 3A; Ugt12887 and TaUGT1genes on chromosome 5A; a (1,3-β-D-glucan synthase (Gsl12 gene and a glucosyl hydrolase (Cel8 gene on chromosome 7A.This study identifies significant MTAs for the AX content in the grain of tetraploid wheat genotypes. We propose that these may be used for molecular breeding of durum wheat varieties with higher soluble fibre content.

  16. Genome-wide analysis and functional characterization of candidate effector proteins potentially involved in Fusarium graminearum-wheat interactions

    Science.gov (United States)

    Fungal pathogens often produce certain small secreted cysteine-rich proteins (SSCPs) during pathogenesis that may function in triggering resistance or susceptibility in specific host plants. We have identified a total of 190 SSCPs encoded in the genome of the wheat scab fungus Fusarium graminearum a...

  17. Construction of whole genome radiation hybrid panels and map of chromosome 5A of wheat using asymmetric somatic hybridization.

    Directory of Open Access Journals (Sweden)

    Chuanen Zhou

    Full Text Available To explore the feasibility of constructing a whole genome radiation hybrid (WGRH map in plant species with large genomes, asymmetric somatic hybridization between wheat (Triticum aestivum L. and Bupleurum scorzonerifolium Willd. was performed. The protoplasts of wheat were irradiated with ultraviolet light (UV and gamma-ray and rescued by protoplast fusion using B. scorzonerifolium as the recipient. Assessment of SSR markers showed that the radiation hybrids have the average marker retention frequency of 15.5%. Two RH panels (RHPWI and RHPWII that contained 92 and 184 radiation hybrids, respectively, were developed and used for mapping of 68 SSR markers in chromosome 5A of wheat. A total of 1557 and 2034 breaks were detected in each panel. The RH map of chromosome 5A based on RHPWII was constructed. The distance of the comprehensive map was 2103 cR and the approximate resolution was estimated to be ∼501.6 kb/break. The RH panels evaluated in this study enabled us to order the ESTs in a single deletion bin or in the multiple bins cross the chromosome. These results demonstrated that RH mapping via protoplast fusion is feasible at the whole genome level for mapping purposes in wheat and the potential value of this mapping approach for the plant species with large genomes.

  18. Genome-Wide Analysis of Microsatellite Markers Based on Sequenced Database in Chinese Spring Wheat (Triticum aestivum L..

    Directory of Open Access Journals (Sweden)

    Bin Han

    Full Text Available Microsatellites or simple sequence repeats (SSRs are distributed across both prokaryotic and eukaryotic genomes and have been widely used for genetic studies and molecular marker-assisted breeding in crops. Though an ordered draft sequence of hexaploid bread wheat have been announced, the researches about systemic analysis of SSRs for wheat still have not been reported so far. In the present study, we identified 364,347 SSRs from among 10,603,760 sequences of the Chinese spring wheat (CSW genome, which were present at a density of 36.68 SSR/Mb. In total, we detected 488 types of motifs ranging from di- to hexanucleotides, among which dinucleotide repeats dominated, accounting for approximately 42.52% of the genome. The density of tri- to hexanucleotide repeats was 24.97%, 4.62%, 3.25% and 24.65%, respectively. AG/CT, AAG/CTT, AGAT/ATCT, AAAAG/CTTTT and AAAATT/AATTTT were the most frequent repeats among di- to hexanucleotide repeats. Among the 21 chromosomes of CSW, the density of repeats was highest on chromosome 2D and lowest on chromosome 3A. The proportions of di-, tri-, tetra-, penta- and hexanucleotide repeats on each chromosome, and even on the whole genome, were almost identical. In addition, 295,267 SSR markers were successfully developed from the 21 chromosomes of CSW, which cover the entire genome at a density of 29.73 per Mb. All of the SSR markers were validated by reverse electronic-Polymerase Chain Reaction (re-PCR; 70,564 (23.9% were found to be monomorphic and 224,703 (76.1% were found to be polymorphic. A total of 45 monomorphic markers were selected randomly for validation purposes; 24 (53.3% amplified one locus, 8 (17.8% amplified multiple identical loci, and 13 (28.9% did not amplify any fragments from the genomic DNA of CSW. Then a dendrogram was generated based on the 24 monomorphic SSR markers among 20 wheat cultivars and three species of its diploid ancestors showing that monomorphic SSR markers represented a promising

  19. A complete mitochondrial genome of wheat (Triticum aestivum cv. Chinese Yumai), and fast evolving mitochondrial genes in higher plants

    Indian Academy of Sciences (India)

    Peng Cui; Huitao Liu; Qiang Lin; Feng Ding; Guoyin Zhuo; Songnian Hu; Dongcheng Liu; Wenlong Yang; Kehui Zhan; Aimin Zhang; Jun Yu

    2009-12-01

    Plant mitochondrial genomes, encoding necessary proteins involved in the system of energy production, play an important role in the development and reproduction of the plant. They occupy a specific evolutionary pattern relative to their nuclear counterparts. Here, we determined the winter wheat (Triticum aestivum cv. Chinese Yumai) mitochondrial genome in a length of 452 and 526 bp by shotgun sequencing its BAC library. It contains 202 genes, including 35 known protein-coding genes, three rRNA and 17 tRNA genes, as well as 149 open reading frames (ORFs; greater than 300 bp in length). The sequence is almost identical to the previously reported sequence of the spring wheat (T. aestivum cv. Chinese Spring); we only identified seven SNPs (three transitions and four transversions) and 10 indels (insertions and deletions) between the two independently acquired sequences, and all variations were found in non-coding regions. This result confirmed the accuracy of the previously reported mitochondrial sequence of the Chinese Spring wheat. The nucleotide frequency and codon usage of wheat are common among the lineage of higher plant with a high AT-content of 58%. Molecular evolutionary analysis demonstrated that plant mitochondrial genomes evolved at different rates, which may correlate with substantial variations in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.

  20. Genome-wide associations for water-soluble carbohydrate concentration and relative maturity in wheat using SNP and DArT marker arrays

    Science.gov (United States)

    Improving water-use efficiency by incorporating drought avoidance traits into new wheat varieties is an important objective for wheat breeding in water-limited environments. This study uses genome wide association studies (GWAS) to identify candidate loci for water-soluble carbohydrate accumulation,...

  1. Chromosome arm-specific BAC end sequences permit comparative analysis of homoeologous chromosomes and genomes of polyploid wheat

    Directory of Open Access Journals (Sweden)

    Sehgal Sunish K

    2012-05-01

    Full Text Available Abstract Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4% was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from

  2. Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin

    Directory of Open Access Journals (Sweden)

    MacFarlane Amanda J

    2009-07-01

    Full Text Available Abstract Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D. Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health.

  3. Genome editing in rice and wheat using the CRISPR/Cas system.

    Science.gov (United States)

    Shan, Qiwei; Wang, Yanpeng; Li, Jun; Gao, Caixia

    2014-10-01

    Targeted genome editing nucleases, such as zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), are powerful tools for understanding gene function and for developing valuable new traits in plants. The clustered regularly interspersed short palindromic repeats (CRISPR)/Cas system has recently emerged as an alternative nuclease-based method for efficient and versatile genome engineering. In this system, only the 20-nt targeting sequence within the single-guide RNA (sgRNA) needs to be changed to target different genes. The simplicity of the cloning strategy and the few limitations on potential target sites make the CRISPR/Cas system very appealing. Here we describe a stepwise protocol for the selection of target sites, as well as the design, construction, verification and use of sgRNAs for sequence-specific CRISPR/Cas-mediated mutagenesis and gene targeting in rice and wheat. The CRISPR/Cas system provides a straightforward method for rapid gene targeting within 1-2 weeks in protoplasts, and mutated rice plants can be generated within 13-17 weeks.

  4. Genome-wide genetic dissection of supernumerary spikelet and related traits in common wheat

    Science.gov (United States)

    Branched spike or supernumerary spikelet (SS) is a naturally occurring variant in wheat and holds great potential for increasing the number of grains per spike, and ultimately, increasing wheat yield. However, detailed knowledge of the molecular basis of spike branching in common wheat is lacking. I...

  5. Genetic Diversity and Genome Wide Association Study of β-Glucan Content in Tetraploid Wheat Grains.

    Science.gov (United States)

    Marcotuli, Ilaria; Houston, Kelly; Schwerdt, Julian G; Waugh, Robbie; Fincher, Geoffrey B; Burton, Rachel A; Blanco, Antonio; Gadaleta, Agata

    2016-01-01

    Non-starch polysaccharides (NSPs) have many health benefits, including immunomodulatory activity, lowering serum cholesterol, a faecal bulking effect, enhanced absorption of certain minerals, prebiotic effects and the amelioration of type II diabetes. The principal components of the NSP in cereal grains are (1,3;1,4)-β-glucans and arabinoxylans. Although (1,3;1,4)-β-glucan (hereafter called β-glucan) is not the most representative component of wheat cell walls, it is one of the most important types of soluble fibre in terms of its proven beneficial effects on human health. In the present work we explored the genetic variability of β-glucan content in grains from a tetraploid wheat collection that had been genotyped with a 90k-iSelect array, and combined this data to carry out an association analysis. The β-glucan content, expressed as a percentage w/w of grain dry weight, ranged from 0.18% to 0.89% across the collection. Our analysis identified seven genomic regions associated with β-glucan, located on chromosomes 1A, 2A (two), 2B, 5B and 7A (two), confirming the quantitative nature of this trait. Analysis of marker trait associations (MTAs) in syntenic regions of several grass species revealed putative candidate genes that might influence β-glucan levels in the endosperm, possibly via their participation in carbon partitioning. These include the glycosyl hydrolases endo-β-(1,4)-glucanase (cellulase), β-amylase, (1,4)-β-xylan endohydrolase, xylanase inhibitor protein I, isoamylase and the glycosyl transferase starch synthase II.

  6. Genetic Diversity and Genome Wide Association Study of β-Glucan Content in Tetraploid Wheat Grains.

    Directory of Open Access Journals (Sweden)

    Ilaria Marcotuli

    Full Text Available Non-starch polysaccharides (NSPs have many health benefits, including immunomodulatory activity, lowering serum cholesterol, a faecal bulking effect, enhanced absorption of certain minerals, prebiotic effects and the amelioration of type II diabetes. The principal components of the NSP in cereal grains are (1,3;1,4-β-glucans and arabinoxylans. Although (1,3;1,4-β-glucan (hereafter called β-glucan is not the most representative component of wheat cell walls, it is one of the most important types of soluble fibre in terms of its proven beneficial effects on human health. In the present work we explored the genetic variability of β-glucan content in grains from a tetraploid wheat collection that had been genotyped with a 90k-iSelect array, and combined this data to carry out an association analysis. The β-glucan content, expressed as a percentage w/w of grain dry weight, ranged from 0.18% to 0.89% across the collection. Our analysis identified seven genomic regions associated with β-glucan, located on chromosomes 1A, 2A (two, 2B, 5B and 7A (two, confirming the quantitative nature of this trait. Analysis of marker trait associations (MTAs in syntenic regions of several grass species revealed putative candidate genes that might influence β-glucan levels in the endosperm, possibly via their participation in carbon partitioning. These include the glycosyl hydrolases endo-β-(1,4-glucanase (cellulase, β-amylase, (1,4-β-xylan endohydrolase, xylanase inhibitor protein I, isoamylase and the glycosyl transferase starch synthase II.

  7. Syntenic relationships between the U and M genomes of Aegilops, wheat and the model species Brachypodium and rice as revealed by COS markers.

    Science.gov (United States)

    Molnár, István; Šimková, Hana; Leverington-Waite, Michelle; Goram, Richard; Cseh, András; Vrána, Jan; Farkas, András; Doležel, Jaroslav; Molnár-Láng, Márta; Griffiths, Simon

    2013-01-01

    Diploid Aegilops umbellulata and Ae. comosa and their natural allotetraploid hybrids Ae. biuncialis and Ae. geniculata are important wild gene sources for wheat. With the aim of assisting in alien gene transfer, this study provides gene-based conserved orthologous set (COS) markers for the U and M genome chromosomes. Out of the 140 markers tested on a series of wheat-Aegilops chromosome introgression lines and flow-sorted subgenomic chromosome fractions, 100 were assigned to Aegilops chromosomes and six and seven duplications were identified in the U and M genomes, respectively. The marker-specific EST sequences were BLAST-ed to Brachypodium and rice genomic sequences to investigate macrosyntenic relationships between the U and M genomes of Aegilops, wheat and the model species. Five syntenic regions of Brachypodium identified genome rearrangements differentiating the U genome from the M genome and from the D genome of wheat. All of them seem to have evolved at the diploid level and to have been modified differentially in the polyploid species Ae. biuncialis and Ae. geniculata. A certain level of wheat-Aegilops homology was detected for group 1, 2, 3 and 5 chromosomes, while a clearly rearranged structure was showed for the group 4, 6 and 7 Aegilops chromosomes relative to wheat. The conserved orthologous set markers assigned to Aegilops chromosomes promise to accelerate gene introgression by facilitating the identification of alien chromatin. The syntenic relationships between the Aegilops species, wheat and model species will facilitate the targeted development of new markers specific for U and M genomic regions and will contribute to the understanding of molecular processes related to allopolyploidization.

  8. Syntenic relationships between the U and M genomes of Aegilops, wheat and the model species Brachypodium and rice as revealed by COS markers.

    Directory of Open Access Journals (Sweden)

    István Molnár

    Full Text Available Diploid Aegilops umbellulata and Ae. comosa and their natural allotetraploid hybrids Ae. biuncialis and Ae. geniculata are important wild gene sources for wheat. With the aim of assisting in alien gene transfer, this study provides gene-based conserved orthologous set (COS markers for the U and M genome chromosomes. Out of the 140 markers tested on a series of wheat-Aegilops chromosome introgression lines and flow-sorted subgenomic chromosome fractions, 100 were assigned to Aegilops chromosomes and six and seven duplications were identified in the U and M genomes, respectively. The marker-specific EST sequences were BLAST-ed to Brachypodium and rice genomic sequences to investigate macrosyntenic relationships between the U and M genomes of Aegilops, wheat and the model species. Five syntenic regions of Brachypodium identified genome rearrangements differentiating the U genome from the M genome and from the D genome of wheat. All of them seem to have evolved at the diploid level and to have been modified differentially in the polyploid species Ae. biuncialis and Ae. geniculata. A certain level of wheat-Aegilops homology was detected for group 1, 2, 3 and 5 chromosomes, while a clearly rearranged structure was showed for the group 4, 6 and 7 Aegilops chromosomes relative to wheat. The conserved orthologous set markers assigned to Aegilops chromosomes promise to accelerate gene introgression by facilitating the identification of alien chromatin. The syntenic relationships between the Aegilops species, wheat and model species will facilitate the targeted development of new markers specific for U and M genomic regions and will contribute to the understanding of molecular processes related to allopolyploidization.

  9. Coverage and characteristics of the Affymetrix GeneChip Human Mapping 100K SNP set.

    Directory of Open Access Journals (Sweden)

    2006-05-01

    Full Text Available Improvements in technology have made it possible to conduct genome-wide association mapping at costs within reach of academic investigators, and experiments are currently being conducted with a variety of high-throughput platforms. To provide an appropriate context for interpreting results of such studies, we summarize here results of an investigation of one of the first of these technologies to be publicly available, the Affymetrix GeneChip Human Mapping 100K set of single nucleotide polymorphisms (SNPs. In a systematic analysis of the pattern and distribution of SNPs in the Mapping 100K set, we find that SNPs in this set are undersampled from coding regions (both nonsynonymous and synonymous and oversampled from regions outside genes, relative to SNPs in the overall HapMap database. In addition, we utilize a novel multilocus linkage disequilibrium (LD coefficient based on information content (analogous to the information content scores commonly used for linkage mapping that is equivalent to the familiar measure r2 in the special case of two loci. Using this approach, we are able to summarize for any subset of markers, such as the Affymetrix Mapping 100K set, the information available for association mapping in that subset, relative to the information available in the full set of markers included in the HapMap, and highlight circumstances in which this multilocus measure of LD provides substantial additional insight about the haplotype structure in a region over pairwise measures of LD.

  10. Draft genome sequence of Karnal bunt pathogen (Tilletia indica) of wheat provides insights into the pathogenic mechanisms of quarantined fungus

    Science.gov (United States)

    Singh, Manoj; Pandey, Dinesh; Saharan, M. S.; Marla, Soma S.

    2017-01-01

    Karnal bunt disease in wheat is caused by hemibiotrophic fungus, Tilletia indica that has been placed as quarantine pest in more than 70 countries. Despite its economic importance, little knowledge about the molecular components of fungal pathogenesis is known. In this study, first time the genome sequence of T. indica has been deciphered for unraveling the effectors’ functions of molecular pathogenesis of Karnal bunt disease. The T. indica genome was sequenced employing hybrid approach of PacBio Single Molecule Real Time (SMRT) and Illumina HiSEQ 2000 sequencing platforms. The genome was assembled into 10,957 contigs (N50 contig length 3 kb) with total size of 26.7 Mb and GC content of 53.99%. The number of predicted putative genes were 11,535, which were annotated with Gene Ontology databases. Functional annotation of Karnal bunt pathogen genome and classification of identified effectors into protein families revealed interesting functions related to pathogenesis. Search for effectors’ genes using pathogen host interaction database identified 135 genes. The T. indica genome sequence and putative genes involved in molecular pathogenesis would further help in devising novel and effective disease management strategies including development of resistant wheat genotypes, novel biomarkers for pathogen detection and new targets for fungicide development. PMID:28152050

  11. Genomic in situ hybridization analysis of Thinopyrum chromatin in a wheat-Th. intermedium partial amphiploid and six derived chromosome addition lines

    Science.gov (United States)

    Chen; Conner; Laroche; Ji; Armstrong; Fedak

    1999-12-01

    The genomic origin of alien chromosomes present in a wheat-Thinopyrum intermedium partial amphiploid TAF46 (2n = 8x = 56) and six derived chromosome addition lines were analyzed by genomic in situ hybridization (GISH) using S genomic DNA from Pseudoroegneria strigosa (2n = 2x = 14, SS) as a probe. The GISH analysis clearly showed that the chromosome complement of the partial amphiploid TAF46 consists of an entire wheat genome plus one synthetic genome consisting of a mixture of six S genome chromosomes and eight J (=E) genome chromosomes derived from Th. intermedium (2n = 6x = 42, JJJ(s)J(s)SS). There were no Js genome chromosomes present in TAF46. The J genome chromosomes present in TAF46 displayed a unique GISH hybridization pattern with the S genomic DNA probe, in which S genome DNA strongly hybridized at the terminal regions and weakly hybridized over the remaining parts of the chromosomes. This provides a diagnostic marker for distinguishing J genome chromosomes from Js or S genome or wheat ABD genome chromosomes. The genomic origin of the alien chromosomes present in the six derived chromosome addition lines were identified by their characteristic GISH hybridization patterns with S genomic DNA probe. GISH analysis showed that addition lines L1, L2, L3, and L5 carried one pair of J genome chromosomes, while addition lines L4 and L7 each carried one pair of S genome chromosomes. GISH patterns detected by the S genome probe on addition line of L1 were identical to those of the J genome chromosomes present in the partial amphiploid TAF46, suggesting that these chromosomes were not structurally altered when they were transferred from TAF46 to addition lines.

  12. Comparison between linear and non-parametric regression models for genome-enabled prediction in wheat.

    Science.gov (United States)

    Pérez-Rodríguez, Paulino; Gianola, Daniel; González-Camacho, Juan Manuel; Crossa, José; Manès, Yann; Dreisigacker, Susanne

    2012-12-01

    In genome-enabled prediction, parametric, semi-parametric, and non-parametric regression models have been used. This study assessed the predictive ability of linear and non-linear models using dense molecular markers. The linear models were linear on marker effects and included the Bayesian LASSO, Bayesian ridge regression, Bayes A, and Bayes B. The non-linear models (this refers to non-linearity on markers) were reproducing kernel Hilbert space (RKHS) regression, Bayesian regularized neural networks (BRNN), and radial basis function neural networks (RBFNN). These statistical models were compared using 306 elite wheat lines from CIMMYT genotyped with 1717 diversity array technology (DArT) markers and two traits, days to heading (DTH) and grain yield (GY), measured in each of 12 environments. It was found that the three non-linear models had better overall prediction accuracy than the linear regression specification. Results showed a consistent superiority of RKHS and RBFNN over the Bayesian LASSO, Bayesian ridge regression, Bayes A, and Bayes B models.

  13. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  14. Genome Wide Association Mapping for Arabinoxylan Content in a Collection of Tetraploid Wheats

    OpenAIRE

    2015-01-01

    Background Arabinoxylans (AXs) are major components of plant cell walls in bread wheat and are important in bread-making and starch extraction. Furthermore, arabinoxylans are components of soluble dietary fibre that has potential health-promoting effects in human nutrition. Despite their high value for human health, few studies have been carried out on the genetics of AX content in durum wheat. Results The genetic variability of AX content was investigated in a set of 104 tetraploid wheat gen...

  15. Sequencing of chloroplast genomes from wheat, barley, rye and their relatives provides a detailed insight into the evolution of the Triticeae tribe.

    Directory of Open Access Journals (Sweden)

    Christopher P Middleton

    Full Text Available Using Roche/454 technology, we sequenced the chloroplast genomes of 12 Triticeae species, including bread wheat, barley and rye, as well as the diploid progenitors and relatives of bread wheat Triticum urartu, Aegilops speltoides and Ae. tauschii. Two wild tetraploid taxa, Ae. cylindrica and Ae. geniculata, were also included. Additionally, we incorporated wild Einkorn wheat Triticum boeoticum and its domesticated form T. monococcum and two Hordeum spontaneum (wild barley genotypes. Chloroplast genomes were used for overall sequence comparison, phylogenetic analysis and dating of divergence times. We estimate that barley diverged from rye and wheat approximately 8-9 million years ago (MYA. The genome donors of hexaploid wheat diverged between 2.1-2.9 MYA, while rye diverged from Triticum aestivum approximately 3-4 MYA, more recently than previously estimated. Interestingly, the A genome taxa T. boeoticum and T. urartu were estimated to have diverged approximately 570,000 years ago. As these two have a reproductive barrier, the divergence time estimate also provides an upper limit for the time required for the formation of a species boundary between the two. Furthermore, we conclusively show that the chloroplast genome of hexaploid wheat was contributed by the B genome donor and that this unknown species diverged from Ae. speltoides about 980,000 years ago. Additionally, sequence alignments identified a translocation of a chloroplast segment to the nuclear genome which is specific to the rye/wheat lineage. We propose the presented phylogeny and divergence time estimates as a reference framework for future studies on Triticeae.

  16. Genomics-based marker discovery and diagnostic assay development for wheat blast

    Science.gov (United States)

    Wheat blast has emerged as a major threat to wheat production in South America. While originally restricted to Brazil the disease has since been observed in the neighboring countries of Argentina, Bolivia, and Paraguay and there is growing concern that the pathogen, Magnaporthe oryzae Triticum patho...

  17. Genomic analysis and tools for the Septoria nodorum blotch susceptibility gene Snn2 in wheat

    Science.gov (United States)

    Septoria nodorum blotch of wheat is caused by Parastagonospora nodorum and leads to significant yield losses as well as reductions in grain quality and grain weight. The wheat Snn2 gene confers sensitivity to the necrotrophic effector SnTox2 of P. nodorum. A compatible Snn2-SnTox2 interaction is imp...

  18. Genomic Selection for Processing and End-Use Quality Traits in the CIMMYT Spring Bread Wheat Breeding Program

    Directory of Open Access Journals (Sweden)

    Sarah D. Battenfield

    2016-07-01

    Full Text Available Wheat ( L. cultivars must possess suitable end-use quality for release and consumer acceptability. However, breeding for quality traits is often considered a secondary target relative to yield largely because of amount of seed needed and expense. Without testing and selection, many undesirable materials are advanced, expending additional resources. Here, we develop and validate whole-genome prediction models for end-use quality phenotypes in the CIMMYT bread wheat breeding program. Model accuracy was tested using forward prediction on breeding lines ( = 5520 tested in unbalanced yield trials from 2009 to 2015 at Ciudad Obregon, Sonora, Mexico. Quality parameters included test weight, 1000-kernel weight, hardness, grain and flour protein, flour yield, sodium dodecyl sulfate sedimentation, Mixograph and Alveograph performance, and loaf volume. In general, prediction accuracy substantially increased over time as more data was available to train the model. Reflecting practical implementation of genomic selection (GS in the breeding program, forward prediction accuracies ( for quality parameters were assessed in 2015 and ranged from 0.32 (grain hardness to 0.62 (mixing time. Increased selection intensity was possible with GS since more entries can be genotyped than phenotyped and expected genetic gain was 1.4 to 2.7 times higher across all traits than phenotypic selection. Given the limitations in measuring many lines for quality, we conclude that GS is a powerful tool to facilitate early generation selection for end-use quality in wheat, leaving larger populations for selection on yield during advanced testing and leading to better gain for both quality and yield in bread wheat breeding programs.

  19. Variation in Dehydration Tolerance, ABA Sensitivity and Related Gene Expression Patterns in D-Genome Progenitor and Synthetic Hexaploid Wheat Lines

    Directory of Open Access Journals (Sweden)

    Yumeto Kurahashi

    2009-06-01

    Full Text Available The wild wheat Aegilops tauschii Coss. has extensive natural variation available for breeding of common wheat. Drought stress tolerance is closely related to abscisic acid (ABA sensitivity. In this study, 17 synthetic hexaploid wheat lines, produced by crossing the tetraploid wheat cultivar Langdon with 17 accessions of Ae. tauschii, were used for comparative analysis of natural variation in drought tolerance and ABA sensitivity. Ae. tauschii showed wide natural variation, with weak association between the traits. Drought-sensitive accessions of Ae. tauschii exhibited significantly less ABA sensitivity. D-genome variations observed at the diploid genome level were not necessarily reflected in synthetic wheats. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from drought-sensitive accessions. Moreover, synthetic wheats with high drought tolerance showed significantly higher ABA sensitivity than drought-sensitive synthetic lines. In the hexaploid genetic background, therefore, weak association of ABA sensitivity with drought tolerance wasobserved. To study differences in gene expression patterns between stress-tolerant and -sensitive lines, levels of two Cor/Lea and three transcription factor gene transcripts were compared. The more tolerant accession of Ae. tauschii tended to accumulate more abundant transcripts of the examined genes than the sensitive accession under stress conditions. The expression patterns in the synthetic wheats seemed to be additive for parental lines exposed to drought and ABA treatments. However, the transcript levels of transcription factor genes in the synthetic wheats did not necessarily correspond to the postulated levels based on expression in parental lines. Allopolyploidization altered the expression levels of the stress-responsive genes in synthetic wheats.

  20. Genome-wide linkage mapping of QTL for black point reaction in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Liu, Jindong; He, Zhonghu; Wu, Ling; Bai, Bin; Wen, Weie; Xie, Chaojie; Xia, Xianchun

    2016-11-01

    Nine QTL for black point resistance in wheat were identified using a RIL population derived from a Linmai 2/Zhong 892 cross and 90K SNP assay. Black point, discoloration of the embryo end of the grain, downgrades wheat grain quality leading to significant economic losses to the wheat industry. The availability of molecular markers will accelerate improvement of black point resistance in wheat breeding. The aims of this study were to identify quantitative trait loci (QTL) for black point resistance and tightly linked molecular markers, and to search for candidate genes using a high-density genetic linkage map of wheat. A recombinant inbred line (RIL) population derived from the cross Linmai 2/Zhong 892 was evaluated for black point reaction during the 2011-2012, 2012-2013 and 2013-2014 cropping seasons, providing data for seven environments. A high-density linkage map was constructed by genotyping the RILs with the wheat 90K single nucleotide polymorphism (SNP) chip. Composite interval mapping detected nine QTL on chromosomes 2AL, 2BL, 3AL, 3BL, 5AS, 6A, 7AL (2) and 7BS, designated as QBp.caas-2AL, QBp.caas-2BL, QBp.caas-3AL, QBp.caas-3BL, QBp.caas-5AS, QBp.caas-6A, QBp.caas-7AL.1, QBp.caas-7AL.2 and QBp.caas-7BS, respectively. All resistance alleles, except for QBp.caas-7AL.1 from Linmai 2, were contributed by Zhong 892. QBp.caas-3BL, QBp.caas-5AS, QBp.caas-7AL.1, QBp.caas-7AL.2 and QBp.caas-7BS probably represent new loci for black point resistance. Sequences of tightly linked SNPs were used to survey wheat and related cereal genomes identifying three candidate genes for black point resistance. The tightly linked SNP markers can be used in marker-assisted breeding in combination with the kompetitive allele specific PCR technique to improve black point resistance.

  1. Whole-genome and chromosome evolution associated with host adaptation and speciation of the wheat pathogen Mycosphaerella graminicola.

    Directory of Open Access Journals (Sweden)

    Eva H Stukenbrock

    2010-12-01

    Full Text Available The fungus Mycosphaerella graminicola has been a pathogen of wheat since host domestication 10,000-12,000 years ago in the Fertile Crescent. The wheat-infecting lineage emerged from closely related Mycosphaerella pathogens infecting wild grasses. We use a comparative genomics approach to assess how the process of host specialization affected the genome structure of M. graminicola since divergence from the closest known progenitor species named M. graminicola S1. The genome of S1 was obtained by Illumina sequencing resulting in a 35 Mb draft genome sequence of 32X. Assembled contigs were aligned to the previously sequenced M. graminicola genome. The alignment covered >90% of the non-repetitive portion of the M. graminicola genome with an average divergence of 7%. The sequenced M. graminicola strain is known to harbor thirteen essential chromosomes plus eight dispensable chromosomes. We found evidence that structural rearrangements significantly affected the dispensable chromosomes while the essential chromosomes were syntenic. At the nucleotide level, the essential and dispensable chromosomes have evolved differently. The average synonymous substitution rate in dispensable chromosomes is considerably lower than in essential chromosomes, whereas the average non-synonymous substitution rate is three times higher. Differences in molecular evolution can be related to different transmission and recombination patterns, as well as to differences in effective population sizes of essential and dispensable chromosomes. In order to identify genes potentially involved in host specialization or speciation, we calculated ratios of synonymous and non-synonymous substitution rates in the >9,500 aligned protein coding genes. The genes are generally under strong purifying selection. We identified 43 candidate genes showing evidence of positive selection, one encoding a potential pathogen effector protein. We conclude that divergence of these pathogens was

  2. New insights into the origin of the B genome of hexaploid wheat: Evolutionary relationships at the SPA genomic region with the S genome of the diploid relative Aegilops speltoides

    Directory of Open Access Journals (Sweden)

    Charmet Gilles

    2008-11-01

    Full Text Available Abstract Background Several studies suggested that the diploid ancestor of the B genome of tetraploid and hexaploid wheat species belongs to the Sitopsis section, having Aegilops speltoides (SS, 2n = 14 as the closest identified relative. However molecular relationships based on genomic sequence comparison, including both coding and non-coding DNA, have never been investigated. In an attempt to clarify these relationships, we compared, in this study, sequences of the Storage Protein Activator (SPA locus region of the S genome of Ae. speltoides (2n = 14 to that of the A, B and D genomes co-resident in the hexaploid wheat species (Triticum aestivum, AABBDD, 2n = 42. Results Four BAC clones, spanning the SPA locus of respectively the A, B, D and S genomes, were isolated and sequenced. Orthologous genomic regions were identified as delimited by shared non-transposable elements and non-coding sequences surrounding the SPA gene and correspond to 35 268, 22 739, 43 397 and 53 919 bp for the A, B, D and S genomes, respectively. Sequence length discrepancies within and outside the SPA orthologous regions are the result of non-shared transposable elements (TE insertions, all of which inserted after the progenitors of the four genomes divergence. Conclusion On the basis of conserved sequence length as well as identity of the shared non-TE regions and the SPA coding sequence, Ae speltoides appears to be more evolutionary related to the B genome of T. aestivum than the A and D genomes. However, the differential insertions of TEs, none of which are conserved between the two genomes led to the conclusion that the S genome of Ae. speltoides has diverged very early from the progenitor of the B genome which remains to be identified.

  3. Optimizing Training Population Data and Validation of Genomic Selection for Economic Traits in Soft Winter Wheat

    Directory of Open Access Journals (Sweden)

    Amber Hoffstetter

    2016-09-01

    Full Text Available Genomic selection (GS is a breeding tool that estimates breeding values (GEBVs of individuals based solely on marker data by using a model built using phenotypic and marker data from a training population (TP. The effectiveness of GS increases as the correlation of GEBVs and phenotypes (accuracy increases. Using phenotypic and genotypic data from a TP of 470 soft winter wheat lines, we assessed the accuracy of GS for grain yield, Fusarium Head Blight (FHB resistance, softness equivalence (SE, and flour yield (FY. Four TP data sampling schemes were tested: (1 use all TP data, (2 use subsets of TP lines with low genotype-by-environment interaction, (3 use subsets of markers significantly associated with quantitative trait loci (QTL, and (4 a combination of 2 and 3. We also correlated the phenotypes of relatives of the TP to their GEBVs calculated from TP data. The GS accuracy within the TP using all TP data ranged from 0.35 (FHB to 0.62 (FY. On average, the accuracy of GS from using subsets of data increased by 54% relative to using all TP data. Using subsets of markers selected for significant association with the target trait had the greatest impact on GS accuracy. Between-environment prediction accuracy was also increased by using data subsets. The accuracy of GS when predicting the phenotypes of TP relatives ranged from 0.00 to 0.85. These results suggest that GS could be useful for these traits and GS accuracy can be greatly improved by using subsets of TP data.

  4. Impact of transgene genome location on gene migration from herbicide-resistant wheat (Triticum aestivum L.) to jointed goatgrass (Aegilops cylindrica Host).

    Science.gov (United States)

    Rehman, Maqsood; Hansen, Jennifer L; Mallory-Smith, Carol A; Zemetra, Robert S

    2017-08-01

    Wheat (Triticum aestivum) (ABD) and jointed goatgrass (Aegilops cylindrica) (CD) can cross and produce hybrids that can backcross to either parent. Such backcrosses can result in progeny with chromosomes and/or chromosome segments retained from wheat. Thus, a herbicide resistance gene could migrate from wheat to jointed goatgrass. In theory, the risk of gene migration from herbicide-resistant wheat to jointed goatgrass is more likely if the gene is located on the D genome and less likely if the gene is located on the A or B genome of wheat. BC1 populations (jointed goatgrass as a recurrent parent) were analyzed for chromosome numbers and transgene transmission rates under sprayed and non-sprayed conditions. Transgene retention in the non-sprayed BC1 generation for the A, B and D genomes was 84, 60 and 64% respectively. In the sprayed populations, the retention was 81, 59 and 74% respectively. The gene transmission rates were higher than the expected 50% or less under sprayed and non-sprayed conditions, possibly owing to meiotic chromosome restitution and/or chromosome non-disjunction. Such high transmission rates in the BC1 generation negates the benefits of gene placement for reducing the potential of gene migration from wheat to jointed goatgrass. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  5. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  6. Molecular mechanisms of HMW glutenin subunits from 1S(l genome of Aegilops longissima positively affecting wheat breadmaking quality.

    Directory of Open Access Journals (Sweden)

    Shunli Wang

    Full Text Available A wheat cultivar "Chinese Spring" chromosome substitution line CS-1S(l(1B, in which the 1B chromosome was substituted by 1S(l from Aegilops longissima, was developed and found to possess superior dough and breadmaking quality. The molecular mechanism of its super quality conformation is studied in the aspects of high molecular glutenin genes, protein accumulation patterns, glutenin polymeric proteins, protein bodies, starch granules, and protein disulfide isomerase (PDI and PDI-like protein expressions. Results showed that the introduced HMW-GS 1S(l×2.3* and 1S(ly16* in the substitution line possesses long repetitive domain, making both be larger than any known x- and y-type subunits from B genome. The introduced subunit genes were also found to have a higher level of mRNA expressions during grain development, resulting in more HMW-GS accumulation in the mature grains. A higher abundance of PDI and PDI-like proteins was observed which possess a known function of assisting disulfide bond formation. Larger HMW-GS deposited in protein bodies were also found in the substitution line. The CS substitution line is expected to be highly valuable in wheat quality improvement since the novel HMW-GS are located on chromosome 1S(l, making it possible to combine with the known superior D×5+Dy10 subunits encoded by Glu-D1 for developing high quality bread wheat.

  7. Cross-genome map based dissection of a nitrogen use efficiency ortho-metaQTL in bread wheat unravels concerted cereal genome evolution.

    Science.gov (United States)

    Quraishi, Umar Masood; Abrouk, Michael; Murat, Florent; Pont, Caroline; Foucrier, Séverine; Desmaizieres, Gregory; Confolent, Carole; Rivière, Nathalie; Charmet, Gilles; Paux, Etienne; Murigneux, Alain; Guerreiro, Laurent; Lafarge, Stéphane; Le Gouis, Jacques; Feuillet, Catherine; Salse, Jerome

    2011-03-01

    Monitoring nitrogen use efficiency (NUE) in plants is becoming essential to maintain yield while reducing fertilizer usage. Optimized NUE application in major crops is essential for long-term sustainability of agriculture production. Here, we report the precise identification of 11 major chromosomal regions controlling NUE in wheat that co-localise with key developmental genes such as Ppd (photoperiod sensitivity), Vrn (vernalization requirement), Rht (reduced height) and can be considered as robust markers from a molecular breeding perspective. Physical mapping, sequencing, annotation and candidate gene validation of an NUE metaQTL on wheat chromosome 3B allowed us to propose that a glutamate synthase (GoGAT) gene that is conserved structurally and functionally at orthologous positions in rice, sorghum and maize genomes may contribute to NUE in wheat and other cereals. We propose an evolutionary model for the NUE locus in cereals from a common ancestral region, involving species specific shuffling events such as gene deletion, inversion, transposition and the invasion of repetitive elements.

  8. Comparative analysis of mitochondrial genomes between a wheat K-type cytoplasmic male sterility (CMS line and its maintainer line

    Directory of Open Access Journals (Sweden)

    Liu Dongcheng

    2011-03-01

    Full Text Available Abstract Background Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS, a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA, and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. Results The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi CMS line, Ks3, was assembled into a master circle (MC molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs, and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38% and repeats (> 100 bp, 29 units as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. Conclusion The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of

  9. Genome-wide identification and expression characterization of ABCC-MRP transporters in hexaploid wheat

    Directory of Open Access Journals (Sweden)

    Kaushal Kumar Bhati

    2015-07-01

    Full Text Available The ABCC multidrug resistance associated proteins (ABCC-MRP, a subclass of ABC transporters are involved in multiple physiological processes that include cellular homeostasis, metal detoxification and transport of glutathione-conjugates. Although they are well studied in humans, yeast and Arabidopsis, limited efforts have been made to address their possible role in crop like wheat. In the present work, eighteen wheat ABCC-MRP proteins were identified that showed the uniform distribution with families of rice and Arabidopsis. Organ specific quantitative expression analysis of wheat ABCC genes indicated significantly higher accumulation in roots (TaABCC2, TaABCC3, and TaABCC11 and TaABCC12, stem (TaABCC1, leaves (TaABCC16 and TaABCC17, flag leaf (TaABCC14 and TaABCC15 and seeds (TaABCC6, TaABCC8, TaABCC12, TaABCC13 and TaABCC17 implicating their role in the respective tissues. Differential transcript expression patterns were observed for TaABCC genes during grain maturation speculating their role during seed development. Hormone treatment experiments indicated that some of the ABCC genes could be transcriptionally regulated during seed development. In the presence of Cd or hydrogen peroxide, distinct molecular expression of wheat ABCC genes was observed in the wheat seedlings, suggesting their possible role during heavy metal generated oxidative stress. Functional characterization of the wheat transporter, TaABCC13 a homolog of maize LPA1 confirms its role in glutathione-mediated detoxification pathway and is able to utilize adenine biosynthetic intermediates as a substrate. This is the first comprehensive inventory of wheat ABCC-MRP gene subfamily.

  10. Genome-wide identification and expression characterization of ABCC-MRP transporters in hexaploid wheat.

    Science.gov (United States)

    Bhati, Kaushal K; Sharma, Shivani; Aggarwal, Sipla; Kaur, Mandeep; Shukla, Vishnu; Kaur, Jagdeep; Mantri, Shrikant; Pandey, Ajay K

    2015-01-01

    The ABCC multidrug resistance associated proteins (ABCC-MRP), a subclass of ABC transporters are involved in multiple physiological processes that include cellular homeostasis, metal detoxification, and transport of glutathione-conjugates. Although they are well-studied in humans, yeast, and Arabidopsis, limited efforts have been made to address their possible role in crop like wheat. In the present work, 18 wheat ABCC-MRP proteins were identified that showed the uniform distribution with sub-families from rice and Arabidopsis. Organ-specific quantitative expression analysis of wheat ABCC genes indicated significantly higher accumulation in roots (TaABCC2, TaABCC3, and TaABCC11 and TaABCC12), stem (TaABCC1), leaves (TaABCC16 and TaABCC17), flag leaf (TaABCC14 and TaABCC15), and seeds (TaABCC6, TaABCC8, TaABCC12, TaABCC13, and TaABCC17) implicating their role in the respective tissues. Differential transcript expression patterns were observed for TaABCC genes during grain maturation speculating their role during seed development. Hormone treatment experiments indicated that some of the ABCC genes could be transcriptionally regulated during seed development. In the presence of Cd or hydrogen peroxide, distinct molecular expression of wheat ABCC genes was observed in the wheat seedlings, suggesting their possible role during heavy metal generated oxidative stress. Functional characterization of the wheat transporter, TaABCC13 a homolog of maize LPA1 confirms its role in glutathione-mediated detoxification pathway and is able to utilize adenine biosynthetic intermediates as a substrate. This is the first comprehensive inventory of wheat ABCC-MRP gene subfamily.

  11. Finished genome of the fungal wheat pathogen Mycosphaerella graminicola reveals dispensome structure, chromosome plasticity, and stealth pathogenesis.

    Directory of Open Access Journals (Sweden)

    Stephen B Goodwin

    2011-06-01

    Full Text Available The plant-pathogenic fungus Mycosphaerella graminicola (asexual stage: Septoria tritici causes septoria tritici blotch, a disease that greatly reduces the yield and quality of wheat. This disease is economically important in most wheat-growing areas worldwide and threatens global food production. Control of the disease has been hampered by a limited understanding of the genetic and biochemical bases of pathogenicity, including mechanisms of infection and of resistance in the host. Unlike most other plant pathogens, M. graminicola has a long latent period during which it evades host defenses. Although this type of stealth pathogenicity occurs commonly in Mycosphaerella and other Dothideomycetes, the largest class of plant-pathogenic fungi, its genetic basis is not known. To address this problem, the genome of M. graminicola was sequenced completely. The finished genome contains 21 chromosomes, eight of which could be lost with no visible effect on the fungus and thus are dispensable. This eight-chromosome dispensome is dynamic in field and progeny isolates, is different from the core genome in gene and repeat content, and appears to have originated by ancient horizontal transfer from an unknown donor. Synteny plots of the M. graminicola chromosomes versus those of the only other sequenced Dothideomycete, Stagonospora nodorum, revealed conservation of gene content but not order or orientation, suggesting a high rate of intra-chromosomal rearrangement in one or both species. This observed "mesosynteny" is very different from synteny seen between other organisms. A surprising feature of the M. graminicola genome compared to other sequenced plant pathogens was that it contained very few genes for enzymes that break down plant cell walls, which was more similar to endophytes than to pathogens. The stealth pathogenesis of M. graminicola probably involves degradation of proteins rather than carbohydrates to evade host defenses during the biotrophic

  12. Smallpox virus resequencing GeneChips can also rapidly ascertain species status for some zoonotic non-variola orthopoxviruses.

    Science.gov (United States)

    Sulaiman, Irshad M; Sammons, Scott A; Wohlhueter, Robert M

    2008-04-01

    We recently developed a set of seven resequencing GeneChips for the rapid sequencing of Variola virus strains in the WHO Repository of the Centers for Disease Control and Prevention. In this study, we attempted to hybridize these GeneChips with some known non-Variola orthopoxvirus isolates, including monkeypox, cowpox, and vaccinia viruses, for rapid detection.

  13. Physical mapping of a large plant genome using global high-information-content-fingerprinting: the distal region of the wheat ancestor Aegilops tauschii chromosome 3DS

    Directory of Open Access Journals (Sweden)

    You Frank M

    2010-06-01

    Full Text Available Abstract Background Physical maps employing libraries of bacterial artificial chromosome (BAC clones are essential for comparative genomics and sequencing of large and repetitive genomes such as those of the hexaploid bread wheat. The diploid ancestor of the D-genome of hexaploid wheat (Triticum aestivum, Aegilops tauschii, is used as a resource for wheat genomics. The barley diploid genome also provides a good model for the Triticeae and T. aestivum since it is only slightly larger than the ancestor wheat D genome. Gene co-linearity between the grasses can be exploited by extrapolating from rice and Brachypodium distachyon to Ae. tauschii or barley, and then to wheat. Results We report the use of Ae. tauschii for the construction of the physical map of a large distal region of chromosome arm 3DS. A physical map of 25.4 Mb was constructed by anchoring BAC clones of Ae. tauschii with 85 EST on the Ae. tauschii and barley genetic maps. The 24 contigs were aligned to the rice and B. distachyon genomic sequences and a high density SNP genetic map of barley. As expected, the mapped region is highly collinear to the orthologous chromosome 1 in rice, chromosome 2 in B. distachyon and chromosome 3H in barley. However, the chromosome scale of the comparative maps presented provides new insights into grass genome organization. The disruptions of the Ae. tauschii-rice and Ae. tauschii-Brachypodium syntenies were identical. We observed chromosomal rearrangements between Ae. tauschii and barley. The comparison of Ae. tauschii physical and genetic maps showed that the recombination rate across the region dropped from 2.19 cM/Mb in the distal region to 0.09 cM/Mb in the proximal region. The size of the gaps between contigs was evaluated by comparing the recombination rate along the map with the local recombination rates calculated on single contigs. Conclusions The physical map reported here is the first physical map using fingerprinting of a complete

  14. Fine mapping of Hch1, the causal D-genome gene for hybrid chlorosis in interspecific crosses between tetraploid wheat and Aegilops tauschii.

    Science.gov (United States)

    Hirao, Kana; Nishijima, Ryo; Sakaguchi, Kohei; Takumi, Shigeo

    2015-01-01

    Hybrid chlorosis, one of the reproductive barriers between tetraploid wheat and its D-genome progenitor, Aegilops tauschii, inhibits normal growth of synthetic wheat hexaploids. Hybrid chlorosis appears to be due to an epistatic interaction of two loci from the AB and D wheat genomes. Our previous study assigned the causal D-genome gene for hybrid chlorosis, Hch1, to the short arm of chromosome 7D. Here, we constructed a fine map of 7DS near Hch1 using 280 F2 individuals from a cross of two wheat synthetic lines, one showing normal growth and the other showing hybrid chlorosis. The hybrid chlorosis phenotype was controlled by a single dominant allele of the Hch1 locus in the synthetic hexaploids. Hch1 was closely linked to four new markers within 0.2 cM, and may be localized near or within the two Ae. tauschii scaffolds containing the linked markers on 7DS. Comparative analysis of the Hch1 chromosomal region for Ae. tauschii, barley and Brachypodium showed that a local inversion occurred in the region proximal to Hch1 during the divergence between barley and Ae. tauschii, and that the Hch1 region on wheat 7DS is syntenic to Brachypodium chromosome 1. These observations provide useful information for further studies toward map-based cloning of Hch1.

  15. Mapping-by-sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat.

    Science.gov (United States)

    Gardiner, Laura-Jayne; Bansept-Basler, Pauline; Olohan, Lisa; Joynson, Ryan; Brenchley, Rachel; Hall, Neil; O'Sullivan, Donal M; Hall, Anthony

    2016-08-01

    Previously we extended the utility of mapping-by-sequencing by combining it with sequence capture and mapping sequence data to pseudo-chromosomes that were organized using wheat-Brachypodium synteny. This, with a bespoke haplotyping algorithm, enabled us to map the flowering time locus in the diploid wheat Triticum monococcum L. identifying a set of deleted genes (Gardiner et al., 2014). Here, we develop this combination of gene enrichment and sliding window mapping-by-synteny analysis to map the Yr6 locus for yellow stripe rust resistance in hexaploid wheat. A 110 MB NimbleGen capture probe set was used to enrich and sequence a doubled haploid mapping population of hexaploid wheat derived from an Avalon and Cadenza cross. The Yr6 locus was identified by mapping to the POPSEQ chromosomal pseudomolecules using a bespoke pipeline and algorithm (Chapman et al., 2015). Furthermore the same locus was identified using newly developed pseudo-chromosome sequences as a mapping reference that are based on the genic sequence used for sequence enrichment. The pseudo-chromosomes allow us to demonstrate the application of mapping-by-sequencing to even poorly defined polyploidy genomes where chromosomes are incomplete and sub-genome assemblies are collapsed. This analysis uniquely enabled us to: compare wheat genome annotations; identify the Yr6 locus - defining a smaller genic region than was previously possible; associate the interval with one wheat sub-genome and increase the density of SNP markers associated. Finally, we built the pipeline in iPlant, making it a user-friendly community resource for phenotype mapping.

  16. Genome Sequences of Beet curly top Iran virus, Oat dwarf virus, Turnip curly top virus, and Wheat dwarf virus Identified in Leafhoppers

    Science.gov (United States)

    Kamali, Mehdi; Pouramini, Najmeh; Masumi, Hossain; Farkas, Kata; Kraberger, Simona

    2017-01-01

    ABSTRACT Implementation of a vector-enabled metagenomics approach resulted in the identification of various geminiviruses. We identified the genome sequences of Beet curly top Iran virus, Turnip curly top viruses, Oat dwarf viruses, the first from Iran, and Wheat dwarf virus from leafhoppers feeding on beet, parsley, pumpkin, and turnip plants. PMID:28232449

  17. Genetic and physiological architecture of early vigor in Aegilops tauschii, the D-genome of hexaploid wheat. A quantitative trait loci analysis

    NARCIS (Netherlands)

    Steege, ter M.W.; Ouden, den F.M.; Lambers, H.; Stam, P.; Peeters, A.J.M.

    2005-01-01

    Plant growth can be studied at different organizational levels, varying from cell, leaf, and shoot to the whole plant. The early growth of seedlings is important for the plant's establishment and its eventual success. Wheat (Triticum aestivum, genome AABBDD) seedlings exhibit a low early growth rate

  18. Genetic Basis for Spontaneous Hybrid Genome Doubling during Allopolyploid Speciation of Common Wheat Shown by Natural Variation Analyses of the Paternal Species

    Science.gov (United States)

    Matsuoka, Yoshihiro; Nasuda, Shuhei; Ashida, Yasuyo; Nitta, Miyuki; Tsujimoto, Hisashi; Takumi, Shigeo; Kawahara, Taihachi

    2013-01-01

    The complex process of allopolyploid speciation includes various mechanisms ranging from species crosses and hybrid genome doubling to genome alterations and the establishment of new allopolyploids as persisting natural entities. Currently, little is known about the genetic mechanisms that underlie hybrid genome doubling, despite the fact that natural allopolyploid formation is highly dependent on this phenomenon. We examined the genetic basis for the spontaneous genome doubling of triploid F1 hybrids between the direct ancestors of allohexaploid common wheat (Triticum aestivum L., AABBDD genome), namely Triticumturgidum L. (AABB genome) and Aegilopstauschii Coss. (DD genome). An Ae. tauschii intraspecific lineage that is closely related to the D genome of common wheat was identified by population-based analysis. Two representative accessions, one that produces a high-genome-doubling-frequency hybrid when crossed with a T. turgidum cultivar and the other that produces a low-genome-doubling-frequency hybrid with the same cultivar, were chosen from that lineage for further analyses. A series of investigations including fertility analysis, immunostaining, and quantitative trait locus (QTL) analysis showed that (1) production of functional unreduced gametes through nonreductional meiosis is an early step key to successful hybrid genome doubling, (2) first division restitution is one of the cytological mechanisms that cause meiotic nonreduction during the production of functional male unreduced gametes, and (3) six QTLs in the Ae. tauschii genome, most of which likely regulate nonreductional meiosis and its subsequent gamete production processes, are involved in hybrid genome doubling. Interlineage comparisons of Ae. tauschii’s ability to cause hybrid genome doubling suggested an evolutionary model for the natural variation pattern of the trait in which non-deleterious mutations in six QTLs may have important roles. The findings of this study demonstrated that the

  19. Genetic basis for spontaneous hybrid genome doubling during allopolyploid speciation of common wheat shown by natural variation analyses of the paternal species.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Matsuoka

    Full Text Available The complex process of allopolyploid speciation includes various mechanisms ranging from species crosses and hybrid genome doubling to genome alterations and the establishment of new allopolyploids as persisting natural entities. Currently, little is known about the genetic mechanisms that underlie hybrid genome doubling, despite the fact that natural allopolyploid formation is highly dependent on this phenomenon. We examined the genetic basis for the spontaneous genome doubling of triploid F1 hybrids between the direct ancestors of allohexaploid common wheat (Triticum aestivum L., AABBDD genome, namely Triticumturgidum L. (AABB genome and Aegilopstauschii Coss. (DD genome. An Ae. tauschii intraspecific lineage that is closely related to the D genome of common wheat was identified by population-based analysis. Two representative accessions, one that produces a high-genome-doubling-frequency hybrid when crossed with a T. turgidum cultivar and the other that produces a low-genome-doubling-frequency hybrid with the same cultivar, were chosen from that lineage for further analyses. A series of investigations including fertility analysis, immunostaining, and quantitative trait locus (QTL analysis showed that (1 production of functional unreduced gametes through nonreductional meiosis is an early step key to successful hybrid genome doubling, (2 first division restitution is one of the cytological mechanisms that cause meiotic nonreduction during the production of functional male unreduced gametes, and (3 six QTLs in the Ae. tauschii genome, most of which likely regulate nonreductional meiosis and its subsequent gamete production processes, are involved in hybrid genome doubling. Interlineage comparisons of Ae. tauschii's ability to cause hybrid genome doubling suggested an evolutionary model for the natural variation pattern of the trait in which non-deleterious mutations in six QTLs may have important roles. The findings of this study demonstrated

  20. High-throughput development of genome-wide locus-specific informative SSR markers in wheat

    Science.gov (United States)

    Although simple sequence repeat (SSR) markers are not new, they are still useful and often used markers in molecular mapping and marker-assisted breeding, particularly in developing countries. However, locus-specific SSR markers could be more useful and informative in wheat breeding and genetic stud...

  1. Genome structure and pathogenicity of the fungal wheat pathogen Mycosphaerella graminicola

    NARCIS (Netherlands)

    M'Barek, Ben S.

    2011-01-01

    The phytopathogenic fungus Mycosphaerella graminicola (Fuckel) J. Schröt. in Cohn (asexual stage: Zymoseptoria tritici (Desm.) Quaedvlieg & Crous) causes septoria tritici leaf blotch (STB) in wheat and is one of the most important diseases of this crop worldwide. However, STB control, mainl

  2. ConservedPrimers 2.0: a high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery.

    Science.gov (United States)

    You, Frank M; Huo, Naxin; Gu, Yong Q; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2009-10-13

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they are located in exonic sequences which are usually conserved between related species, "conserved primers". They are useful for large-scale single nucleotide polymorphism (SNP) discovery and marker development, especially in species, such as wheat, for which a large number of ESTs are available but for which genome sequences and intron/exon boundaries are not available. To date, no suitable high-throughput tool is available for this purpose. We have developed, the ConservedPrimers 2.0 pipeline, for designing intron-flanking primers for large-scale SNP discovery and marker development, and demonstrated its utility in wheat. This tool uses non-redundant wheat EST sequences, such as wheat contigs and singleton ESTs, and related genomic sequences, such as those of rice, as inputs. It aligns the ESTs to the genomic sequences to identify unique colinear exon blocks and predicts intron lengths. Intron-flanking primers are then designed based on the intron/exon information using the Primer3 core program or BatchPrimer3. Finally, a tab-delimited file containing intron-flanking primer pair sequences and their primer properties is generated for primer ordering and their PCR applications. Using this tool, 1,922 bin-mapped wheat ESTs (31.8% of the 6,045 in total) were found to have unique colinear exon blocks suitable for primer design and 1,821 primer pairs were designed from these single- or low-copy genes for PCR amplification and SNP discovery. With these primers and subsequently designed genome-specific primers, a total of 1,527 loci were found to contain one or more genome-specific SNPs. The ConservedPrimers 2.0 pipeline for designing intron-flanking primers was developed and its

  3. Genome-wide analysis of short interspersed nuclear elements SINES revealed high sequence conservation, gene association and retrotranspositional activity in wheat.

    Science.gov (United States)

    Ben-David, Smadar; Yaakov, Beery; Kashkush, Khalil

    2013-10-01

    Short interspersed nuclear elements (SINEs) are non-autonomous non-LTR retroelements that are present in most eukaryotic species. While SINEs have been intensively investigated in humans and other animal systems, they are poorly studied in plants, especially in wheat (Triticum aestivum). We used quantitative PCR of various wheat species to determine the copy number of a wheat SINE family, termed Au SINE, combined with computer-assisted analyses of the publicly available 454 pyrosequencing database of T. aestivum. In addition, we utilized site-specific PCR on 57 Au SINE insertions, transposon methylation display and transposon display on newly formed wheat polyploids to assess retrotranspositional activity, epigenetic status and genetic rearrangements in Au SINE, respectively. We retrieved 3706 different insertions of Au SINE from the 454 pyrosequencing database of T. aestivum, and found that most of the elements are inserted in A/T-rich regions, while approximately 38% of the insertions are associated with transcribed regions, including known wheat genes. We observed typical retrotransposition of Au SINE in the second generation of a newly formed wheat allohexaploid, and massive hypermethylation in CCGG sites surrounding Au SINE in the third generation. Finally, we observed huge differences in the copy numbers in diploid Triticum and Aegilops species, and a significant increase in the copy numbers in natural wheat polyploids, but no significant increase in the copy number of Au SINE in the first four generations for two of three newly formed allopolyploid species used in this study. Our data indicate that SINEs may play a prominent role in the genomic evolution of wheat through stress-induced activation. © 2013 Ben-Gurion University The Plant Journal © 2013 John Wiley & Sons Ltd.

  4. Chromosomal location of genomic SSR markers associated with yellow rust resistance in Turkish bread wheat (Triticum aestivum L.)

    Indian Academy of Sciences (India)

    F. Senturk Akfirat; F. Ertugrul; S. Hasancebi; Y. Aydin; K. Akan; Z. Mert; M. Cakir; A. Altinkut Uncuoglu

    2013-08-01

    We have previously reported Xgwm382 as a diagnostic marker for disease resistance against yellow rust in Izgi2001 × ES14 F2 population. Among the same earlier tested 230 primers, one SSR marker (Xgwm311) also amplified a fragment which is present in the resistant parent and in the resistant bulks, but absent in the susceptible parent and in the susceptible bulks. To understand the chromosome group location of these diagnostic markers, Xgwm382 and Xgwm311, in the same population, we selected 16 SSR markers mapped only in one genome of chromosome group 2 around 1–21 cM distance to these diagnostic markers based on the SSR consensus map of wheat. Out of 16 SSRs, Xwmc658 identified resistant F2 individuals as a diagnostic marker for yellow rust disease and provided the location of Xgwm382 and Xgwm311 on chromosome 2AL in our plant material.

  5. Genome-wide screening of Saccharomyces cerevisiae genes required to foster tolerance towards industrial wheat straw hydrolysates.

    Science.gov (United States)

    Pereira, Francisco B; Teixeira, Miguel C; Mira, Nuno P; Sá-Correia, Isabel; Domingues, Lucília

    2014-12-01

    The presence of toxic compounds derived from biomass pre-treatment in fermentation media represents an important drawback in second-generation bio-ethanol production technology and overcoming this inhibitory effect is one of the fundamental challenges to its industrial production. The aim of this study was to systematically identify, in industrial medium and at a genomic scale, the Saccharomyces cerevisiae genes required for simultaneous and maximal tolerance to key inhibitors of lignocellulosic fermentations. Based on the screening of EUROSCARF haploid mutant collection, 242 and 216 determinants of tolerance to inhibitory compounds present in industrial wheat straw hydrolysate (WSH) and in inhibitor-supplemented synthetic hydrolysate were identified, respectively. Genes associated to vitamin metabolism, mitochondrial and peroxisomal functions, ribosome biogenesis and microtubule biogenesis and dynamics are among the newly found determinants of WSH resistance. Moreover, PRS3, VMA8, ERG2, RAV1 and RPB4 were confirmed as key genes on yeast tolerance and fermentation of industrial WSH.

  6. Hepatic gene expression profiling using GeneChips in zebrafish exposed to 17{alpha}-methyldihydrotestosterone

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, J.L.; Thomason, R.G.; Lee, D.M.; Brill, J.L.; Price, B.B.; Carr, G.J. [Miami Valley Innovation Center, Procter and Gamble Company, P.O. Box 538707, Cincinnati, OH 45253-8707 (United States); Versteeg, D.J. [Miami Valley Innovation Center, Procter and Gamble Company, P.O. Box 538707, Cincinnati, OH 45253-8707 (United States)], E-mail: versteeg.dj@pg.com

    2008-04-28

    Concentration and time-dependent changes in hepatic gene expression were examined in adult, female zebrafish (Danio rerio) exposed to 0, 0.1, 0.7, 4.9 {mu}g/L of a model androgen, 17{alpha}-methyldihydrotestosterone (MDHT). At 24 and 168 h, fish were sacrificed and liver was extracted for gene expression analysis using custom Affymetrix GeneChip Zebrafish Genome Microarrays. In an effort to link gene expression changes to higher levels of biological organization, blood was collected for measurement of plasma steroid hormones (17{beta}-estradiol (E2), testosterone (T)) and vitellogenin (VTG) using ELISA. Body and ovary weight were also measured. A significant reduction in E2 occurred at 24 h (0.7 and 4.9 {mu}g/L) and 168 h (4.9 {mu}g/L) following MDHT exposure. In contrast, T was significantly increased at 24 h (4.9 {mu}g/L) and 168 h (0.1, 0.7, 4.9 {mu}g/L). 171 and 575 genes were significantly affected in a concentration-dependent manner at either 24 or 168 h by MDHT exposure at p {<=} 0.001 and p {<=} 0.01, respectively. Genes involved in retinoic acid metabolism (e.g. aldehyde dehydrogenase 8, member A1; retinol dehydrogenase 12), steroid biosynthesis and metabolism (e.g. hydroxysteroid (11{beta}) dehydrogenase 2; hydroxy-delta-5-steroid dehydrogenase, 3 beta-), hormone transport (e.g. sex hormone binding globulin), and regulation of cell growth and proliferation (e.g. N-myc downstream regulated gene 1; spermidinespermine N(1)-acetyltransferase) were affected by MDHT exposure. In this study, we identified genes involved in a variety of biological processes that have the potential to be used as markers of exposure to androgenic substances. Genes identified in this study provide information on the potential mode of action of strong androgens in female fish. In addition, when used for screening of EDC's, these genes may also serve as sensitive markers of exposure to androgenic compounds.

  7. Analysis of nucleotide sequence of wheat yellow mosaic virus genomic RNAs

    Institute of Scientific and Technical Information of China (English)

    于嘉林; 晏立英; 苏宁; 侯占军; 李大伟; 韩成贵; 杨莉莉; 蔡祝南; 刘仪

    1999-01-01

    Wheat yellow mosaic virus (WYMV) isolate HC was used for viral cDNA synthesis and sequencing. The results show that the viral RNA1 is 7629 nueleotides encoding a polyprotein with 2407 amino acids, from which seven putative proteins may be produced by an autolytie cleavage processing besides the viral coat protein. The RNA2 is 3639 nueleotides and codes for a polypretein of 903 amino acids, which may contain two putative non-structural proteins. Although WYMV shares a similarity in genetic organization to wheat spindle streak mosaic virus (WSSMV), the identities in their nucleotide sequences or deduced amino acid sequences are as low as 70% and 75 % respectively. Based on this result, it is confirmed that WYMV and WSSMV are different species within Bymovirus.

  8. Genome-wide fungal stress responsive miRNA expression in wheat.

    Science.gov (United States)

    Inal, Behçet; Türktaş, Mine; Eren, Hakan; Ilhan, Emre; Okay, Sezer; Atak, Mehmet; Erayman, Mustafa; Unver, Turgay

    2014-12-01

    MicroRNAs (miRNAs) are small non-coding class of RNAs. They were identified in many plants with their diverse regulatory roles in several cellular and metabolic processes. A number of miRNAs were involved in biotic and abiotic stress responses. Here, fungal stress responsive wheat miRNAs were analyzed by using miRNA-microarray strategy. Two different fungi (Fusarium culmorum and Bipolaris sorokiniana) were inoculated on resistant and sensitive wheat cultivars. A total of 87 differentially regulated miRNAs were detected in the 8 × 15 K array including all of the available plant miRNAs. Using bioinformatics tools, the target transcripts of responsive miRNAs were predicted, and related biological processes and mechanisms were assessed. A number of the miRNAs such as miR2592s, miR869.1, miR169b were highly differentially regulated showing more than 200-fold change upon fungal-inoculation. Some of the miRNAs were identified as fungal-inoculation responsive for the first time. The analyses showed that some of the differentially regulated miRNAs targeted resistance-related genes such as LRR, glucuronosyl transferase, peroxidase and Pto kinase. The comparison of the two miRNA-microarray analyses indicated that fungal-responsive wheat miRNAs were differentially regulated in pathogen- and cultivar-specific manners.

  9. Wheat - Aegilops introgressions

    Science.gov (United States)

    Aegilops is the most closely related genus to Triticum in the tribe Triticeae. Aegilops speltoides Tausch (B genome donor) and Ae. tauschii Coss. (D genome donor) contributed two of the three genomes present in common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD genomes). The Aegilops genus c...

  10. Genome Wide Single Locus Single Trait, Multi-Locus and Multi-Trait Association Mapping for Some Important Agronomic Traits in Common Wheat (T. aestivum L.).

    Science.gov (United States)

    Jaiswal, Vandana; Gahlaut, Vijay; Meher, Prabina Kumar; Mir, Reyazul Rouf; Jaiswal, Jai Prakash; Rao, Atmakuri Ramakrishna; Balyan, Harindra Singh; Gupta, Pushpendra Kumar

    2016-01-01

    Genome wide association study (GWAS) was conducted for 14 agronomic traits in wheat following widely used single locus single trait (SLST) approach, and two recent approaches viz. multi locus mixed model (MLMM), and multi-trait mixed model (MTMM). Association panel consisted of 230 diverse Indian bread wheat cultivars (released during 1910-2006 for commercial cultivation in different agro-climatic regions in India). Three years phenotypic data for 14 traits and genotyping data for 250 SSR markers (distributed across all the 21 wheat chromosomes) was utilized for GWAS. Using SLST, as many as 213 MTAs (p ≤ 0.05, 129 SSRs) were identified for 14 traits, however, only 10 MTAs (~9%; 10 out of 123 MTAs) qualified FDR criteria; these MTAs did not show any linkage drag. Interestingly, these genomic regions were coincident with the genomic regions that were already known to harbor QTLs for same or related agronomic traits. Using MLMM and MTMM, many more QTLs and markers were identified; 22 MTAs (19 QTLs, 21 markers) using MLMM, and 58 MTAs (29 QTLs, 40 markers) using MTMM were identified. In addition, 63 epistatic QTLs were also identified for 13 of the 14 traits, flag leaf length (FLL) being the only exception. Clearly, the power of association mapping improved due to MLMM and MTMM analyses. The epistatic interactions detected during the present study also provided better insight into genetic architecture of the 14 traits that were examined during the present study. Following eight wheat genotypes carried desirable alleles of QTLs for one or more traits, WH542, NI345, NI170, Sharbati Sonora, A90, HW1085, HYB11, and DWR39 (Pragati). These genotypes and the markers associated with important QTLs for major traits can be used in wheat improvement programs either using marker-assisted recurrent selection (MARS) or pseudo-backcrossing method.

  11. Genome Wide Single Locus Single Trait, Multi-Locus and Multi-Trait Association Mapping for Some Important Agronomic Traits in Common Wheat (T. aestivum L..

    Directory of Open Access Journals (Sweden)

    Vandana Jaiswal

    Full Text Available Genome wide association study (GWAS was conducted for 14 agronomic traits in wheat following widely used single locus single trait (SLST approach, and two recent approaches viz. multi locus mixed model (MLMM, and multi-trait mixed model (MTMM. Association panel consisted of 230 diverse Indian bread wheat cultivars (released during 1910-2006 for commercial cultivation in different agro-climatic regions in India. Three years phenotypic data for 14 traits and genotyping data for 250 SSR markers (distributed across all the 21 wheat chromosomes was utilized for GWAS. Using SLST, as many as 213 MTAs (p ≤ 0.05, 129 SSRs were identified for 14 traits, however, only 10 MTAs (~9%; 10 out of 123 MTAs qualified FDR criteria; these MTAs did not show any linkage drag. Interestingly, these genomic regions were coincident with the genomic regions that were already known to harbor QTLs for same or related agronomic traits. Using MLMM and MTMM, many more QTLs and markers were identified; 22 MTAs (19 QTLs, 21 markers using MLMM, and 58 MTAs (29 QTLs, 40 markers using MTMM were identified. In addition, 63 epistatic QTLs were also identified for 13 of the 14 traits, flag leaf length (FLL being the only exception. Clearly, the power of association mapping improved due to MLMM and MTMM analyses. The epistatic interactions detected during the present study also provided better insight into genetic architecture of the 14 traits that were examined during the present study. Following eight wheat genotypes carried desirable alleles of QTLs for one or more traits, WH542, NI345, NI170, Sharbati Sonora, A90, HW1085, HYB11, and DWR39 (Pragati. These genotypes and the markers associated with important QTLs for major traits can be used in wheat improvement programs either using marker-assisted recurrent selection (MARS or pseudo-backcrossing method.

  12. A wheat SIMILAR TO RCD-ONE gene enhances seedling growth and abiotic stress resistance by modulating redox homeostasis and maintaining genomic integrity.

    Science.gov (United States)

    Liu, Shuantao; Liu, Shuwei; Wang, Mei; Wei, Tiandi; Meng, Chen; Wang, Meng; Xia, Guangmin

    2014-01-01

    Plant growth inhibition is a common response to salinity. Under saline conditions, Shanrong No. 3 (SR3), a bread wheat (Triticum aestivum) introgression line, performs better than its parent wheat variety Jinan 177 (JN177) with respect to both seedling growth and abiotic stress tolerance. Furthermore, the endogenous reactive oxygen species (ROS) was also elevated in SR3 relative to JN177. The SR3 allele of sro1, a gene encoding a poly(ADP ribose) polymerase (PARP) domain protein, was identified to be crucial for both aspects of its superior performance. Unlike RADICAL-INDUCED CELL DEATH1 and other Arabidopsis thaliana SIMILAR TO RCD-ONE (SRO) proteins, sro1 has PARP activity. Both the overexpression of Ta-sro1 in wheat and its heterologous expression in Arabidopsis promote the accumulation of ROS, mainly by enhancing the activity of NADPH oxidase and the expression of NAD(P)H dehydrogenase, in conjunction with the suppression of alternative oxidase expression. Moreover, it promotes the activity of ascorbate-GSH cycle enzymes and GSH peroxidase cycle enzymes, which regulate ROS content and cellular redox homeostasis. sro1 is also found to be involved in the maintenance of genomic integrity. We show here that the wheat SRO has PARP activity; such activity could be manipulated to improve the growth of seedlings exposed to salinity stress by modulating redox homeostasis and maintaining genomic stability.

  13. A Wheat SIMILAR TO RCD-ONE Gene Enhances Seedling Growth and Abiotic Stress Resistance by Modulating Redox Homeostasis and Maintaining Genomic Integrity[C][W

    Science.gov (United States)

    Liu, Shuantao; Liu, Shuwei; Wang, Mei; Wei, Tiandi; Meng, Chen; Wang, Meng; Xia, Guangmin

    2014-01-01

    Plant growth inhibition is a common response to salinity. Under saline conditions, Shanrong No. 3 (SR3), a bread wheat (Triticum aestivum) introgression line, performs better than its parent wheat variety Jinan 177 (JN177) with respect to both seedling growth and abiotic stress tolerance. Furthermore, the endogenous reactive oxygen species (ROS) was also elevated in SR3 relative to JN177. The SR3 allele of sro1, a gene encoding a poly(ADP ribose) polymerase (PARP) domain protein, was identified to be crucial for both aspects of its superior performance. Unlike RADICAL-INDUCED CELL DEATH1 and other Arabidopsis thaliana SIMILAR TO RCD-ONE (SRO) proteins, sro1 has PARP activity. Both the overexpression of Ta-sro1 in wheat and its heterologous expression in Arabidopsis promote the accumulation of ROS, mainly by enhancing the activity of NADPH oxidase and the expression of NAD(P)H dehydrogenase, in conjunction with the suppression of alternative oxidase expression. Moreover, it promotes the activity of ascorbate-GSH cycle enzymes and GSH peroxidase cycle enzymes, which regulate ROS content and cellular redox homeostasis. sro1 is also found to be involved in the maintenance of genomic integrity. We show here that the wheat SRO has PARP activity; such activity could be manipulated to improve the growth of seedlings exposed to salinity stress by modulating redox homeostasis and maintaining genomic stability. PMID:24443520

  14. Genome-Wide Association Mapping of Yield and Grain Quality Traits in Winter Wheat Genotypes.

    Directory of Open Access Journals (Sweden)

    W Tadesse

    Full Text Available The main goal of this study was to investigate the genetic basis of yield and grain quality traits in winter wheat genotypes using association mapping approach, and identify linked molecular markers for marker assisted selection. A total of 120 elite facultative/winter wheat genotypes were evaluated for yield, quality and other agronomic traits under rain-fed and irrigated conditions for two years (2011-2012 at the Tel Hadya station of ICARDA, Syria. The same genotypes were genotyped using 3,051 Diversity Array Technologies (DArT markers, of which 1,586 were of known chromosome positions. The grain yield performance of the genotypes was highly significant both in rain-fed and irrigated sites. Average yield of the genotypes ranged from 2295 to 4038 kg/ha and 4268 to 7102 kg/ha under rain-fed and irrigated conditions, respectively. Protein content and alveograph strength (W ranged from 13.6-16.1% and 217.6-375 Jx10-4, respectively. DArT markers wPt731910 (3B, wPt4680 (4A, wPt3509 (5A, wPt8183 (6B, and wPt0298 (2D were significantly associated with yield under rain-fed conditions. Under irrigated condition, tPt4125 on chromosome 2B was significantly associated with yield explaining about 13% of the variation. Markers wPt2607 and wPt1482 on 5B were highly associated with protein content and alveograph strength explaining 16 and 14% of the variations, respectively. The elite genotypes have been distributed to many countries using ICARDA's International system for potential direct release and/or use as parents after local adaptation trials by the NARSs of respective countries. The QTLs identified in this study are recommended to be used for marker assisted selection after through validation using bi-parental populations.

  15. Genomic Regions Associated with Tolerance to Freezing Stress and Snow Mold in Winter Wheat

    Directory of Open Access Journals (Sweden)

    Erika B. Kruse

    2017-03-01

    Full Text Available Plants grown through the winter are subject to selective pressures that vary with each year’s unique conditions, necessitating tolerance of numerous abiotic and biotic stress factors. The objective of this study was to identify molecular markers in winter wheat (Triticum aestivum L. associated with tolerance of two of these stresses, freezing temperatures and snow mold—a fungal disease complex active under snow cover. A population of 155 F2:5 recombinant inbred lines from a cross between soft white wheat cultivars “Finch” and “Eltan” was evaluated for snow mold tolerance in the field, and for freezing tolerance under controlled conditions. A total of 663 molecular markers was used to construct a genetic linkage map and identify marker-trait associations. One quantitative trait locus (QTL associated with both freezing and snow mold tolerance was identified on chromosome 5A. A second, distinct, QTL associated with freezing tolerance also was found on 5A, and a third on 4B. A second QTL associated with snow mold tolerance was identified on chromosome 6B. The QTL on 5A associated with both traits was closely linked with the Fr-A2 (Frost-Resistance A2 locus; its significant association with both traits may have resulted from pleiotropic effects, or from greater low temperature tolerance enabling the plants to better defend against snow mold pathogens. The QTL on 4B associated with freezing tolerance, and the QTL on 6B associated with snow mold tolerance have not been reported previously, and may be useful in the identification of sources of tolerance for these traits.

  16. Genome-specific granule-bound starch synthase I (GBSSI) influences starch biochemical and functional characteristics in near-isogenic wheat ( Triticum aestivum L.) lines.

    Science.gov (United States)

    Ahuja, Geetika; Jaiswal, Sarita; Hucl, Pierre; Chibbar, Ravindra N

    2013-12-11

    Near-isogenic wheat ( Triticum aestivum L.) lines differing at the Waxy locus were studied for the influence of genome-specific granule-bound starch synthase I (GBSSI/Waxy; Wx-A, Wx-B, Wx-D) on starch composition, structure, and in vitro starch enzymatic hydrolysis. Grain composition, amylose concentration, amylopectin unit-chain length distribution, and starch granule size distribution varied with the loss of functional GBSSI. Amylose concentration was more severely affected in genotypes with GBSSI missing from two genomes (double nulls) than from one genome (single nulls). Unit glucan chains (DP 6-8) of amylopectin were reduced with the complete loss of GBSSI as compared to wheat starch with a full complement of GBSSI. Wx-A and Wx-B had an additive effect toward short-chain phenotype of waxy amylopectin. Loss of Wx-D isoprotein alone significantly (p starch hydrolysis as it increased the large A-type starch granule content (volume %) and reduced short chains (DP 6-8) in amylopectin. Factors such as small C-type starch granules, amylose concentration, and long chains of amylopectin (DP 23-45) also influenced wheat starch hydrolysis.

  17. Genome-Wide Linkage Mapping of QTL for Adult-Plant Resistance to Stripe Rust in a Chinese Wheat Population Linmai 2 × Zhong 892.

    Science.gov (United States)

    Liu, Jindong; He, Zhonghu; Wu, Ling; Bai, Bin; Wen, Weie; Xie, Chaojie; Xia, Xianchun

    2015-01-01

    Stripe rust is one of the most devastating diseases of wheat (Triticum aestivum) worldwide. Adult-plant resistance (APR) is an efficient approach to provide long-term protection of wheat from the disease. The Chinese winter wheat cultivar Zhong 892 has a moderate level of APR to stripe rust in the field. To determine the inheritance of the APR resistance in this cultivar, 273 F6 recombinant inbred lines (RILs) were developed from a cross between Linmai 2 and Zhong 892. The RILs were evaluated for maximum disease severity (MDS) in two sites during the 2011-2012, 2012-2013 and 2013-2014 cropping seasons, providing data for five environments. Illumina 90k SNP (single nucleotide polymorphism) chips were used to genotype the RILs and their parents. Composite interval mapping (CIM) detected eight QTL, namely QYr.caas-2AL, QYr.caas-2BL.3, QYr.caas-3AS, QYr.caas-3BS, QYr.caas-5DL, QYr.caas-6AL, QYr.caas-7AL and QYr.caas-7DS.1, respectively. All except QYr.caas-2BL.3 resistance alleles were contributed by Zhong 892. QYr.caas-3AS and QYr.caas-3BS conferred stable resistance to stripe rust in all environments, explaining 6.2-17.4% and 5.0-11.5% of the phenotypic variances, respectively. The genome scan of SNP sequences tightly linked to QTL for APR against annotated proteins in wheat and related cereals genomes identified two candidate genes (autophagy-related gene and disease resistance gene RGA1), significantly associated with stripe rust resistance. These QTL and their closely linked SNP markers, in combination with kompetitive allele specific PCR (KASP) technology, are potentially useful for improving stripe rust resistances in wheat breeding.

  18. affy - analysis of Affymetrix GeneChip data at the probe level

    DEFF Research Database (Denmark)

    Gautier, Laurent; Cope, L.; Bolstad, B.N.;

    2004-01-01

    The processing of the Affymetrix GeneChip data has been a recent focus for data analysts. Alternatives to the original procedure have been proposed and some of these new methods are widely used. Results: The affy package is an R package of functions and classes for the analysis of oligonucleotide...... arrays manufactured by Affymetrix. The package is currently in its second release, affy provides the user with extreme flexibility when carrying out an analysis and make it possible to access and manipulate probe intensity data. In this paper, we present the main classes and functions in the package...

  19. Genetic map of Triticum turgidum based on a hexaploid wheat population without genetic recombination for D genome

    Directory of Open Access Journals (Sweden)

    Zhang Li

    2012-08-01

    Full Text Available Abstract Background A synthetic doubled-haploid hexaploid wheat population, SynDH1, derived from the spontaneous chromosome doubling of triploid F1 hybrid plants obtained from the cross of hybrids Triticum turgidum ssp. durum line Langdon (LDN and ssp. turgidum line AS313, with Aegilops tauschii ssp. tauschii accession AS60, was previously constructed. SynDH1 is a tetraploidization-hexaploid doubled haploid (DH population because it contains recombinant A and B chromosomes from two different T. turgidum genotypes, while all the D chromosomes from Ae. tauschii are homogenous across the whole population. This paper reports the construction of a genetic map using this population. Results Of the 606 markers used to assemble the genetic map, 588 (97% were assigned to linkage groups. These included 513 Diversity Arrays Technology (DArT markers, 72 simple sequence repeat (SSR, one insertion site-based polymorphism (ISBP, and two high-molecular-weight glutenin subunit (HMW-GS markers. These markers were assigned to the 14 chromosomes, covering 2048.79 cM, with a mean distance of 3.48 cM between adjacent markers. This map showed good coverage of the A and B genome chromosomes, apart from 3A, 5A, 6A, and 4B. Compared with previously reported maps, most shared markers showed highly consistent orders. This map was successfully used to identify five quantitative trait loci (QTL, including two for spikelet number on chromosomes 7A and 5B, two for spike length on 7A and 3B, and one for 1000-grain weight on 4B. However, differences in crossability QTL between the two T. turgidum parents may explain the segregation distortion regions on chromosomes 1A, 3B, and 6B. Conclusions A genetic map of T. turgidum including 588 markers was constructed using a synthetic doubled haploid (SynDH hexaploid wheat population. Five QTLs for three agronomic traits were identified from this population. However, more markers are needed to increase the density and resolution of

  20. A highly conserved gene island of three genes on chromosome 3B of hexaploid wheat: diverse gene function and genomic structure maintained in a tightly linked block

    Directory of Open Access Journals (Sweden)

    Ma Wujun

    2010-05-01

    Full Text Available Abstract Background The complexity of the wheat genome has resulted from waves of retrotransposable element insertions. Gene deletions and disruptions generated by the fast replacement of repetitive elements in wheat have resulted in disruption of colinearity at a micro (sub-megabase level among the cereals. In view of genomic changes that are possible within a given time span, conservation of genes between species tends to imply an important functional or regional constraint that does not permit a change in genomic structure. The ctg1034 contig completed in this paper was initially studied because it was assigned to the Sr2 resistance locus region, but detailed mapping studies subsequently assigned it to the long arm of 3B and revealed its unusual features. Results BAC shotgun sequencing of the hexaploid wheat (Triticum aestivum cv. Chinese Spring genome has been used to assemble a group of 15 wheat BACs from the chromosome 3B physical map FPC contig ctg1034 into a 783,553 bp genomic sequence. This ctg1034 sequence was annotated for biological features such as genes and transposable elements. A three-gene island was identified among >80% repetitive DNA sequence. Using bioinformatics analysis there were no observable similarity in their gene functions. The ctg1034 gene island also displayed complete conservation of gene order and orientation with syntenic gene islands found in publicly available genome sequences of Brachypodium distachyon, Oryza sativa, Sorghum bicolor and Zea mays, even though the intergenic space and introns were divergent. Conclusion We propose that ctg1034 is located within the heterochromatic C-band region of deletion bin 3BL7 based on the identification of heterochromatic tandem repeats and presence of significant matches to chromodomain-containing gypsy LTR retrotransposable elements. We also speculate that this location, among other highly repetitive sequences, may account for the relative stability in gene order and

  1. Comparison of target labeling methods for use with Affymetrix GeneChips

    Directory of Open Access Journals (Sweden)

    Vernon Suzanne D

    2007-05-01

    Full Text Available Abstract Background Several different commercial one-cycle labeling kits are available for preparation of the target for use with the Affymetrix GeneChip platform. However, there have been no evaluations of these different kits to determine if comparable results were generated. We report on the cRNA target synthesis, labeling efficiency and hybridization results using the One-Cycle Target Labeling Assay™ (Affymetrix, the BioArray RNA Amplification and Labeling System™ (Enzo Life Sciences, and the Superscript RNA Amplification System (Invitrogen Life Technologies. Results The only notable difference between kits was in the yield of cRNA target synthesized during in vitro transcription, where the BioArray assay had to be repeated several times in order to have sufficient target. However, each kit resulted in comparable signal and detection calls when hybridized to the Affymetrix GeneChip. Conclusion These 3 one-cycle labeling kits produce comparable hybridization results. This provides users with several kit options and flexibility when using the Affymetrix system.

  2. Screening and identification of microRNA involved in unstable angina using gene-chip analysis

    Science.gov (United States)

    Li, Si; Sun, Ya-Nan; Zhou, Yun-Tao; Zhang, Chun-Lai; Lu, Feng; Liu, Jia; Shang, Xiao-Ming

    2016-01-01

    Increasing evidence has suggested that microRNA (miRNA) may play a role in the pathogenesis of cardiovascular disease, which has led to a greater understanding of the complex pathophysiological processes underlying unstable angina (UA). The present study aimed to investigate changes in the miRNA expression profiles of patients with UA using gene-chip analysis, in order to further elucidate the pathogenesis of UA. Total RNA was extracted and purified from plasma samples collected from patients with UA and healthy controls. The samples underwent microarray analysis using an Exiqon miRCURY LNA™ microRNA Array. Differentially expressed miRNAs were identified by volcano plot filtering, and were validated using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). In addition, functional annotation of the differentially expressed miRNAs involved gene ontology analyses. Among the 212 miRNAs differentially expressed between the two groups, 82 were upregulated and 130 were downregulated. Notably, the results of the RT-qPCR were consistent with the gene-chip results. The miRNAs identified in the present study may be potential novel biomarkers for the prevention and early diagnosis of UA. Furthermore, the results of the present study suggested that UA occurs as a result of complex and dynamic processes regulated by numerous factors, including multiple miRNAs.

  3. Alpha-gliadin genes from the A, B, and D genomes of wheat contain different sets of celiac disease epitopes

    NARCIS (Netherlands)

    Herpen, van T.W.J.M.; Goryunova-Svetlana, V.; Schoot, van der J.; Mitreva, M.; Salentijn, E.M.J.; Vorst, O.F.J.; Schenk, M.F.; Veelen, van P.; Koning, de F.; Soest, van L.J.M.; Vosman, B.J.; Bosch, H.J.; Gilissen, L.J.W.J.; Smulders, M.J.M.

    2006-01-01

    Background - Bread wheat (Triticum aestivum) is an important staple food. However, wheat gluten proteins cause celiac disease (CD) in 0.5 to 1% of the general population. Among these proteins, the a-gliadins contain several peptides that are associated to the disease. Results - We obtained 230 disti

  4. Chromosome Based Strategies to Decipher the Structure and Evolution of the Hexaploid Wheat Genome: Chromosome 3B, a Case Study

    Institute of Scientific and Technical Information of China (English)

    E. Paux; P. Sourdille; J. Salse; P. Leroy; J. Dolezel; M. Bernard; C. Feuillet

    2007-01-01

    @@ With 17% of all crop area, wheat is the staple food for 40% of the world's population. Improvement in bread wheat quality and yield in the context of sustainable agriculture is needed in the next decades to meet human needs by 2050.

  5. Finished Genome of the Fungal Wheat Pathogen Mycosphaerella graminicola Reveals Dispensome Structure, Chromosome Plasticity, and Stealth Pathogenesis

    NARCIS (Netherlands)

    Goodwin, S.B.; M'Barek, Ben S.; Dhillon, B.; Wittenberg, A.H.J.; Crane, C.F.; Hane, J.K.; Foster, A.J.; Lee, van der T.A.J.; Grimwood, J.; Aerts, A.; Antoniw, J.; Bailey, A.; Bluhm, B.; Bowler, J.; Bristow, J.; Burgt, van der A.; Canto-Canché, B.; Churchill, A.C.L.; Conde-Ferràez, L.; Cools, H.J.; Coutinho, P.M.; Csukai, M.; Dehal, P.; Wit, de P.J.G.M.; Donzelli, B.; Geest, van de H.C.; Ham, van R.C.H.J.; Hammond-Kosack, K.E.; Henrissat, B.; Kilian, A.; Kobayashi, A.K.; Koopmann, E.; Kourmpetis, Y.; Kuzniar, A.; Lindquist, E.; Lombard, V.; Maliepaard, C.A.; Martins, N.; Mehrabi, A.; Nap, J.P.H.; Ponomarenko, A.; Rudd, J.J.; Salamov, A.; Schmutz, J.; Schouten, H.J.; Shapiro, H.; Stergiopoulos, I.; Torriani, S.F.F.; Tu, H.; Vries, de R.P.; Waalwijk, C.; Ware, S.B.; Wiebenga, A.; Zwiers, L.H.; Oliver, R.P.; Grigoriev, I.V.; Kema, G.H.J.

    2011-01-01

    The plant-pathogenic fungus Mycosphaerella graminicola (asexual stage: Septoria tritici) causes septoria tritici blotch, a disease that greatly reduces the yield and quality of wheat. This disease is economically important in most wheat-growing areas worldwide and threatens global food production. C

  6. Genome-wide genetic dissection of supernumerary spikelet and related traits in common wheat (Triticum aestivum L.)

    Science.gov (United States)

    In wheat (Triticum aestivum L), exotic genotypes express a broad range of spike-related traits and could be used as a source of new genes to enrich the germplasm for wheat breeding programs. In the present study, a population of 163 recombinant inbred lines derived from a cross between an elite line...

  7. The development and evaluation of single cell suspension from wheat and barley as a model system; a first step towards functional genomics application

    DEFF Research Database (Denmark)

    Dong, Jing; Bowra, Steve; Vincze, Éva

    2010-01-01

    suspension culture from both species. Results We established growth conditions to allow routine culturing of somatic cells in 24 well microtiter plate format. Evaluation of the wheat and barley cell suspension as model cell system is a multi step process. As an initial step in the evaluation procedure we......Background The overall research objective was to develop single cell plant cultures as a model system to facilitate functional genomics of monocots, in particular wheat and barley. The essential first step towards achieving the stated objective was the development of a robust, viable single cell...... chose to study the impact of selected abiotic stress elicitors at the physiological, biochemical and molecular level. We report the results of osmotic stress imposed by NaCl and PEG. As proline is an important osmoprotectant of the cereal cells, colorimetric assay for proline detection was developed...

  8. Chromosomal location and comparative genomics analysis of powdery mildew resistance gene Pm51 in a putative wheat-Thinopyrum ponticum introgression line.

    Science.gov (United States)

    Zhan, Haixian; Li, Guangrong; Zhang, Xiaojun; Li, Xin; Guo, Huijuan; Gong, Wenping; Jia, Juqing; Qiao, Linyi; Ren, Yongkang; Yang, Zujun; Chang, Zhijian

    2014-01-01

    Powdery mildew (PM) is a very destructive disease of wheat (Triticum aestivum L.). Wheat-Thinopyrum ponticum introgression line CH7086 was shown to possess powdery mildew resistance possibly originating from Th. ponticum. Genomic in situ hybridization and molecular characterization of the alien introgression failed to identify alien chromatin. To study the genetics of resistance, CH7086 was crossed with susceptible genotypes. Segregation in F2 populations and F2:3 lines tested with Chinese Bgt race E09 under controlled conditions indicated that CH7086 carries a single dominant gene for powdery mildew resistance. Fourteen SSR and EST-PCR markers linked with the locus were identified. The genetic distances between the locus and the two flanking markers were 1.5 and 3.2 cM, respectively. Based on the locations of the markers by nullisomic-tetrasomic and deletion lines of 'Chinese Spring', the resistance gene was located in deletion bin 2BL-0.89-1.00. Conserved orthologous marker analysis indicated that the genomic region flanking the resistance gene has a high level of collinearity to that of rice chromosome 4 and Brachypodium chromosome 5. Both resistance specificities and tests of allelism suggested the resistance gene in CH7086 was different from previously reported powdery mildew resistance genes on 2BL, and the gene was provisionally designated PmCH86. Molecular analysis of PmCH86 compared with other genes for resistance to Bgt in the 2BL-0.89-1.00 region suggested that PmCH86 may be a new PM resistance gene, and it was therefore designated as Pm51. The closely linked flanking markers could be useful in exploiting this putative wheat-Thinopyrum translocation line for rapid transfer of Pm51 to wheat breeding programs.

  9. Genome-wide quantitative trait locus mapping identifies multiple major loci for brittle rachis and threshability in Tibetan semi-wild wheat (Triticum aestivum ssp. tibetanum Shao.

    Directory of Open Access Journals (Sweden)

    Yun-Feng Jiang

    Full Text Available Tibetan semi-wild wheat (Triticum aestivum ssp. tibetanum Shao is a semi-wild hexaploid wheat resource that is only naturally distributed in the Qinghai-Tibet Plateau. Brittle rachis and hard threshing are two important characters of Tibetan semi-wild wheat. A whole-genome linkage map of T. aestivum ssp. tibetanum was constructed using a recombinant inbred line population (Q1028×ZM9023 with 186 lines, 564 diversity array technology markers, and 117 simple sequence repeat markers. Phenotypic data on brittle rachis and threshability, as two quantitative traits, were evaluated on the basis of the number of average spike rachis fragments per spike and percent threshability in 2012 and 2013, respectively. Quantitative trait locus (QTL mapping performed using inclusive composite interval mapping analysis clearly identified four QTLs for brittle rachis and three QTLs for threshability. However, three loci on 2DS, 2DL, and 5AL showed pleiotropism for brittle rachis and threshability; they respectively explained 5.3%, 18.6%, and 18.6% of phenotypic variation for brittle rachis and 17.4%, 13.2%, and 35.2% of phenotypic variation for threshability. A locus on 3DS showed an independent effect on brittle rachis, which explained 38.7% of the phenotypic variation. The loci on 2DS and 3DS probably represented the effect of Tg and Br1, respectively. The locus on 5AL was in very close proximity to the Q gene, but was different from the predicted q in Tibetan semi-wild wheat. To our knowledge, the locus on 2DL has never been reported in common wheat but was prominent in T. aestivum ssp. tibetanum accession Q1028. It remarkably interacted with the locus on 5AL to affect brittle rachis. Several major loci for brittle rachis and threshability were identified in Tibetan semi-wild wheat, improving the understanding of these two characters and suggesting the occurrence of special evolution in Tibetan semi-wild wheat.

  10. Next generation sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Dario Cantu

    Full Text Available BACKGROUND: The wheat stripe rust fungus (Puccinia striiformis f. sp. tritici, PST is responsible for significant yield losses in wheat production worldwide. In spite of its economic importance, the PST genomic sequence is not currently available. Fortunately Next Generation Sequencing (NGS has radically improved sequencing speed and efficiency with a great reduction in costs compared to traditional sequencing technologies. We used Illumina sequencing to rapidly access the genomic sequence of the highly virulent PST race 130 (PST-130. METHODOLOGY/PRINCIPAL FINDINGS: We obtained nearly 80 million high quality paired-end reads (>50x coverage that were assembled into 29,178 contigs (64.8 Mb, which provide an estimated coverage of at least 88% of the PST genes and are available through GenBank. Extensive micro-synteny with the Puccinia graminis f. sp. tritici (PGTG genome and high sequence similarity with annotated PGTG genes support the quality of the PST-130 contigs. We characterized the transposable elements present in the PST-130 contigs and using an ab initio gene prediction program we identified and tentatively annotated 22,815 putative coding sequences. We provide examples on the use of comparative approaches to improve gene annotation for both PST and PGTG and to identify candidate effectors. Finally, the assembled contigs provided an inventory of PST repetitive elements, which were annotated and deposited in Repbase. CONCLUSIONS/SIGNIFICANCE: The assembly of the PST-130 genome and the predicted proteins provide useful resources to rapidly identify and clone PST genes and their regulatory regions. Although the automatic gene prediction has limitations, we show that a comparative genomics approach using multiple rust species can greatly improve the quality of gene annotation in these species. The PST-130 sequence will also be useful for comparative studies within PST as more races are sequenced. This study illustrates the power of NGS for

  11. Comparative genomics of Australian isolates of the wheat stem rust pathogen Puccinia graminis f. sp. tritici reveals extensive polymorphism in candidate effector genes

    Directory of Open Access Journals (Sweden)

    Narayana Mithur Upadhyaya

    2015-01-01

    Full Text Available The wheat stem rust fungus Puccinia graminis f. sp. tritici (Pgt, is one of the most destructive pathogens of wheat. In this study, a draft genome was built for a founder Australian Pgt isolate of pathotype (pt. 21-0 (collected in 1954 by next generation DNA sequencing. A combination of reference-based assembly using the genome of the previously sequenced American Pgt isolate CDL 75-36-700-3 (p7a and de novo assembly were performed resulting in a 92 Mbp reference genome for Pgt isolate 21-0. Approximately 13 Mbp of de novo assembled sequence in this genome is not present in the p7a reference assembly. This novel sequence is not specific to 21-0 as it is also present in three other Pgt rust isolates of independent origin.The new reference genome was subsequently used to build a pan-genome based on five Australian Pgt isolates. Transcriptomes from germinated urediniospores and haustoria were separately assembled for pt. 21-0 and comparison of gene expression profiles showed differential expression in ~10% of the genes each in germinated spores and haustoria. A total of 1,924 secreted proteins were predicted from the 21-0 transcriptome, of which 520 were classified as haustorial secreted proteins (HSPs. Comparison of 21-0 with two presumed clonal field derivatives of this lineage (collected in 1982 and 1984 that had evolved virulence on four additional resistance genes (Sr5, Sr11, Sr27, SrSatu identified mutations in 25 HSP effector candidates, some of which could explain their novel virulence phenotypes.

  12. Application of real-time PCR-based SNP detection for mapping of Net2, a causal D-genome gene for hybrid necrosis in interspecific crosses between tetraploid wheat and Aegilops tauschii.

    Science.gov (United States)

    Matsuda, Ryusuke; Iehisa, Julio C M; Takumi, Shigeo

    2012-01-01

    Available information on genetically assigned molecular markers is not sufficient for efficient construction of a high-density linkage map in wheat. Here, we report on application of high resolution melting (HRM) analysis using a real-time PCR apparatus to develop single nucleotide polymorphism (SNP) markers linked to a hybrid necrosis gene, Net2, located on wheat chromosome 2D. Based on genomic information on barley chromosome 2H and wheat expressed sequence tag libraries, we selected wheat cDNA sequences presumed to be located near the Net2 chromosomal region, and then found SNPs between the parental Ae. tauschii accessions of the synthetic wheat mapping population. HRM analysis of the PCR products from F(2) individuals' DNA enabled us to assign 44.4% of the SNP-representing cDNAs to chromosome 2D despite the presence of the A and B genomes. In addition, the designed SNP markers were assigned to chromosome 2D of Ae. tauschii. The order of the assigned SNP markers in synthetic hexaploid wheat was confirmed by comparison with the markers in barley and Ae. tauschii. Thus, the SNP-genotyping method based on HRM analysis is a useful tool for development of molecular markers at target loci in wheat.

  13. Transposable elements in a marginal plant population: temporal fluctuations provide new insights into genome evolution of wild diploid wheat

    Directory of Open Access Journals (Sweden)

    Belyayev Alexander

    2010-02-01

    Full Text Available Abstract Background How new forms arise in nature has engaged evolutionary biologists since Darwin's seminal treatise on the origin of species. Transposable elements (TEs may be among the most important internal sources for intraspecific variability. Thus, we aimed to explore the temporal dynamics of several TEs in individual genotypes from a small, marginal population of Aegilops speltoides. A diploid cross-pollinated grass species, it is a wild relative of the various wheat species known for their large genome sizes contributed by an extraordinary number of TEs, particularly long terminal repeat (LTR retrotransposons. The population is characterized by high heteromorphy and possesses a wide spectrum of chromosomal abnormalities including supernumerary chromosomes, heterozygosity for translocations, and variability in the chromosomal position or number of 45S and 5S ribosomal DNA (rDNA sites. We propose that variability on the morphological and chromosomal levels may be linked to variability at the molecular level and particularly in TE proliferation. Results Significant temporal fluctuation in the copy number of TEs was detected when processes that take place in small, marginal populations were simulated. It is known that under critical external conditions, outcrossing plants very often transit to self-pollination. Thus, three morphologically different genotypes with chromosomal aberrations were taken from a wild population of Ae. speltoides, and the dynamics of the TE complex traced through three rounds of selfing. It was discovered that: (i various families of TEs vary tremendously in copy number between individuals from the same population and the selfed progenies; (ii the fluctuations in copy number are TE-family specific; (iii there is a great difference in TE copy number expansion or contraction between gametophytes and sporophytes; and (iv a small percentage of TEs that increase in copy number can actually insert at novel locations and

  14. Genomic and metabolic traits endow Bacillus velezensis CC09 with a potential biocontrol agent in control of wheat powdery mildew disease.

    Science.gov (United States)

    Cai, Xun-Chao; Liu, Chang-Hong; Wang, Bao-Tong; Xue, Ya-Rong

    2017-03-01

    Bacillus velezensis CC09, which was isolated from healthy leaves of Cinnamomum camphora and previously identified as Bacillus amyloliquefaciens CC09, shows great potential as a new biocontrol agent, in control of many phytopathogenic diseases. To extend our understanding of the potential antifungal capacities, we did a whole genome analysis of strain CC09. Result shows that strain CC09 has a relatively large genome size (4.17Mb) with an average GC content of 46.1%, and 4021 predicted genes. Thirteen secondary metabolites encoding clusters have been identified within the genome of B. velezensis CC09 using genome mining technique. Data of comparative genomic analysis indicated that 3 of the clusters are conserved by all strains of B. velezensis, B. amyloliquefaciens and B. subtilis 168, 9 by B. velezensis and B. amyloliquefaciens, and 2 by all strains of B. velezensis. Another 2 clusters encoding NRPS (Non-Ribosomal Peptide Synthetases) and NRPS-TransATPKS (NRPS and trans-Acyl Transferase Polyketide Synthetases) respectively are observed only in 15 B. velezensis strains, which might lead to the synthesis of novel bioactive compounds and could be explored as antimicrobial agents in the future. These clusters endow B. velezensis CC09 with strong and broad antimicrobial activities, for example, in control of wheat powdery mildew disease. Moreover, our data further confirmed the taxonomy of strain CC09 is a member of B. velezensis rather than a strain of B. amyloliquefaciens based on core genome sequence analysis using phylogenomic approach.

  15. Fine mapping and genetic association analysis of Net2, the causative D-genome locus of low temperature-induced hybrid necrosis in interspecific crosses between tetraploid wheat and Aegilops tauschii.

    Science.gov (United States)

    Sakaguchi, Kouhei; Nishijima, Ryo; Iehisa, Julio Cesar Masaru; Takumi, Shigeo

    2016-10-01

    Hybrid necrosis has been observed in many interspecific hybrids from crosses between tetraploid wheat and the wheat D-genome donor Aegilops tauschii. Type II necrosis is a kind of hybrid incompatibility that is specifically characterized by low-temperature induction and growth suppression. Two complementary genes, Net1 on the AB genome and Net2 on the D genome, putatively control type II necrosis in ABD triploids and synthetic hexaploid wheat. Toward map-based cloning of Net2, a fine map around the Net2 region on 2DS was constructed in this study. Using the draft genome sequence of Ae. tauschii and the physical map of the barley genome, the Net2 locus was mapped within a 0.6 cM interval between two closely linked markers. Although local chromosomal rearrangements were observed in the Net2-corresponding region between the barley/Brachypodium and Ae. tauschii genomes, the two closely linked markers were significantly associated with type II necrosis in Ae. tauschii. These results suggest that these markers will aid efficient selection of Net2 non-carrier individuals from the Ae. tauschii population and intraspecific progeny, and could help with introgression of agriculturally important genes from Ae. tauschii to common wheat.

  16. A genome-wide association study of resistance to stripe rust (Puccinia striiformis f. sp. tritici) in a worldwide collection of hexaploid spring wheat (Triticum aestivum L.).

    Science.gov (United States)

    Maccaferri, Marco; Zhang, Junli; Bulli, Peter; Abate, Zewdie; Chao, Shiaoman; Cantu, Dario; Bossolini, Eligio; Chen, Xianming; Pumphrey, Michael; Dubcovsky, Jorge

    2015-01-20

    New races of Puccinia striiformis f. sp. tritici (Pst), the causal pathogen of wheat stripe rust, show high virulence to previously deployed resistance genes and are responsible for large yield losses worldwide. To identify new sources of resistance we performed a genome-wide association study (GWAS) using a worldwide collection of 1000 spring wheat accessions. Adult plants were evaluated under field conditions in six environments in the western United States, and seedlings were tested with four Pst races. A single-nucleotide polymorphism (SNP) Infinium 9K-assay provided 4585 SNPs suitable for GWAS. High correlations among environments and high heritabilities were observed for stripe rust infection type and severity. Greater levels of Pst resistance were observed in a subpopulation from Southern Asia than in other groups. GWAS identified 97 loci that were significant for at least three environments, including 10 with an experiment-wise adjusted Bonferroni probability resistance genes and QTL, and likely represent new resistance loci. The other seven QTL mapped close to known resistance genes and allelism tests will be required to test their relationships. In summary, this study provides an integrated view of stripe rust resistance resources in spring wheat and identifies new resistance loci that will be useful to diversify the current set of resistance genes deployed to control this devastating disease.

  17. Identification of new resistance loci to African stem rust race TTKSK in tetraploid wheats based on linkage and genome-wide association mapping

    Directory of Open Access Journals (Sweden)

    Giovanni eLaidò

    2015-12-01

    Full Text Available Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. & E. Henn. (Pgt, is one of the most destructive diseases of wheat. Races of the pathogen in the Ug99 lineage are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant

  18. Genome-wide characterization of pectin methyl esterase genes reveals members differentially expressed in tolerant and susceptible wheats in response to Fusarium graminearum.

    Science.gov (United States)

    Zega, Alessandra; D'Ovidio, Renato

    2016-11-01

    Pectin methyl esterase (PME) genes code for enzymes that are involved in structural modifications of the plant cell wall during plant growth and development. They are also involved in plant-pathogen interaction. PME genes belong to a multigene family and in this study we report the first comprehensive analysis of the PME gene family in bread wheat (Triticum aestivum L.). Like in other species, the members of the TaPME family are dispersed throughout the genome and their encoded products retain the typical structural features of PMEs. qRT-PCR analysis showed variation in the expression pattern of TaPME genes in different tissues and revealed that these genes are mainly expressed in flowering spikes. In our attempt to identify putative TaPME genes involved in wheat defense, we revealed a strong variation in the expression of the TaPME following Fusarium graminearum infection, the causal agent of Fusarium head blight (FHB). Particularly interesting was the finding that the expression profile of some PME genes was markedly different between the FHB-resistant wheat cultivar Sumai3 and the FHB-susceptible cultivar Bobwhite, suggesting a possible involvement of these PME genes in FHB resistance. Moreover, the expression analysis of the TaPME genes during F. graminearum progression within the spike revealed those genes that responded more promptly to pathogen invasion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. Genome-wide association mapping of resistance to eyespot disease (Pseudocercosporella herpotrichoides) in European winter wheat (Triticum aestivum L.) and fine-mapping of Pch1.

    Science.gov (United States)

    Zanke, Christine D; Rodemann, Bernd; Ling, Jie; Muqaddasi, Quddoos H; Plieske, Jörg; Polley, Andreas; Kollers, Sonja; Ebmeyer, Erhard; Korzun, Viktor; Argillier, Odile; Stiewe, Gunther; Zschäckel, Thomas; Ganal, Martin W; Röder, Marion S

    2017-03-01

    Genotypes with recombination events in the Triticum ventricosum introgression on chromosome 7D allowed to fine-map resistance gene Pch1, the main source of eyespot resistance in European winter wheat cultivars. Eyespot (also called Strawbreaker) is a common and serious fungal disease of winter wheat caused by the necrotrophic fungi Oculimacula yallundae and Oculimacula acuformis (former name Pseudocercosporella herpotrichoides). A genome-wide association study (GWAS) for eyespot was performed with 732 microsatellite markers (SSR) and 7761 mapped SNP markers derived from the 90 K iSELECT wheat array using a panel of 168 European winter wheat varieties as well as three spring wheat varieties and phenotypic evaluation of eyespot in field tests in three environments. Best linear unbiased estimations (BLUEs) were calculated across all trials and ranged from 1.20 (most resistant) to 5.73 (most susceptible) with an average value of 4.24 and a heritability of H (2) = 0.91. A total of 108 SSR and 235 SNP marker-trait associations (MTAs) were identified by considering associations with a -log10 (P value) ≥3.0. Significant MTAs for eyespot-score BLUEs were found on chromosomes 1D, 2A, 2D, 3D, 5A, 5D, 6A, 7A and 7D for the SSR markers and chromosomes 1B, 2A, 2B, 2D, 3B and 7D for the SNP markers. For 18 varieties (10.5%), a highly resistant phenotype was detected that was linked to the presence of the resistance gene Pch1 on chromosome 7D. The identification of genotypes with recombination events in the introgressed genomic segment from Triticum ventricosum harboring the Pch1 resistance gene on chromosome 7DL allowed the fine-mapping of this gene using additional SNP markers and a potential candidate gene Traes_7DL_973A33763 coding for a CC-NBS-LRR class protein was identified.

  20. 小麦不同部位DNA提取的比较研究%Comparative Study on Extraction of Genomic DNA from Different Parts of Wheat

    Institute of Scientific and Technical Information of China (English)

    杨培浩; 姚大年; 张文明; 周立人

    2009-01-01

    [目的] 探讨小麦不同取材部位对DNA提取质量和产率的影响.[方法] 分别以小麦的种子、根尖和幼嫩叶片为材料,采用改良CTAB法分别提取小麦3个部位的基因组DNA,用0.8%的琼脂糖凝胶电泳检测DNA质量,用紫外分光光度计分别测定3个部位的DNA在A260和A280下的吸光值,根据A260/A280的值检测DNA的浓度和纯度,并以3个部位提取的DNA为模版进行RAPD扩增.[结果] 采用小麦叶片提取DNA的产率最高,种子次之,根尖最低.3个部位提取的DNA纯度均相近, 提取叶片获得的DNA浓度最大,为 756 μg/ml;其次是种子,为233 μg/ml;根尖获得的DNA浓度最低,为90 μg/ml.小麦不同部位提取的DNA模板对RAPD扩增没有明显影响,DNA浓度都能达到扩增的要求.[结论] 小麦3个部位提取的DNA质量均较好,可以进行后续的酶切和PCR扩增等实验.%[Objective] The aim was to discuss the effect of different sampling positions of wheat on the DNA quality and yield. [Method] With seeds, root tips and young leaves of wheat as tested materials, the genome DNA from 3 parts of wheat were extracted with modified CTAB method and examined with 0.8% agarose gel electrophoresis. The absorbance value of DNA from 3 parts was measured by ultraviolet spectrophotometer at A260 and A280 and the ratio of A260/A280 was used to determine the DNA purity and the mass concn. DNA isolated from 3 parts of wheat was used as the template for RAPD amplification. [Result] The yield of DNA extracted from wheat leaves was highest, that from the seeds was second, and that from the root tips was lowest. The DNA purity extracted from 3 parts of wheat was similar. The DNA concn. isolated from wheat leaves was the largest, being 756 μg/ml, followed by that from seeds, being 233 μg/ml that from the root was the lowest, being 90 μg/ml. The DNA template extracted from different parts of wheat had no significant effect on RAPD amplification and DNA concn. could achieve the

  1. Optimizing Training Population Size and Genotyping Strategy for Genomic Prediction Using Association Study Results and Pedigree Information. A Case of Study in Advanced Wheat Breeding Lines

    Science.gov (United States)

    Jahoor, Ahmed; Orabi, Jihad; Andersen, Jeppe R.; Janss, Luc L.; Jensen, Just

    2017-01-01

    Wheat breeding programs generate a large amount of variation which cannot be completely explored because of limited phenotyping throughput. Genomic prediction (GP) has been proposed as a new tool which provides breeding values estimations without the need of phenotyping all the material produced but only a subset of it named training population (TP). However, genotyping of all the accessions under analysis is needed and, therefore, optimizing TP dimension and genotyping strategy is pivotal to implement GP in commercial breeding schemes. Here, we explored the optimum TP size and we integrated pedigree records and genome wide association studies (GWAS) results to optimize the genotyping strategy. A total of 988 advanced wheat breeding lines were genotyped with the Illumina 15K SNPs wheat chip and phenotyped across several years and locations for yield, lodging, and starch content. Cross-validation using the largest possible TP size and all the SNPs available after editing (~11k), yielded predictive abilities (rGP) ranging between 0.5–0.6. In order to explore the Training population size, rGP were computed using progressively smaller TP. These exercises showed that TP of around 700 lines were enough to yield the highest observed rGP. Moreover, rGP were calculated by randomly reducing the SNPs number. This showed that around 1K markers were enough to reach the highest observed rGP. GWAS was used to identify markers associated with the traits analyzed. A GWAS-based selection of SNPs resulted in increased rGP when compared with random selection and few hundreds SNPs were sufficient to obtain the highest observed rGP. For each of these scenarios, advantages of adding the pedigree information were shown. Our results indicate that moderate TP sizes were enough to yield high rGP and that pedigree information and GWAS results can be used to greatly optimize the genotyping strategy. PMID:28081208

  2. Alien Introgression in Wheat

    OpenAIRE

    Molnár-Láng, M.; Ceoloni, C; Doležel, J

    2015-01-01

    This book provides an overview of the latest advancements in the field of alien introgression in wheat. The discovery and wide application of molecular genetic techniques including molecular markers, in situ hybridization, and genomics has led to a surge in interspecific and intergeneric hybridization in recent decades. The work begins with the taxonomy of cereals, especially of those species which are potential gene sources for wheat improvement. The text then goes on to cover.

  3. Effects on Genome Constitution and Novel Cell Wall Formation Caused by the Addition of 5RS Rye Chromosome to Common Wheat

    Institute of Scientific and Technical Information of China (English)

    Zhi-Jun Cheng; Minoru Murata; Sodmergen; Xiao-Mei Li; Hai Nian; Jian-Min Wan

    2008-01-01

    The cytological instability of common wheat-rye addition lines was investigated in the present study. The chromosome numbers of almost all addition lines were considerably stable, but those of CS + 5R were very variable. The rye chromosome added in this line was found to be much shorter than expected. Fluorescent in situ hybridization with 5S rDNA and the centromere-specific probes clearly revealed that the short rye chromosome contains only a short arm of chromosome 5R (5RS). In this line, chromosome numbers of both 5RS and common wheat were changeable. The chromosome numbers ranged from 2n = 36 to 2n = 44 in the cells carrying two 5RS, and ranged from 2n = 31 to 2n = 44 in one 5RS cells. In addition to the chromosome instability, the multicells wrapped in a sac-like structure were frequently observed in the root meristematic tissues of CS + 5RS after the enzyme treatment for chromosome preparation. Genomic in situ hybridization with rye DNA as a probe showed that all cells in sacs investigated were at the interphase stage and contained one or two 5RS chromosomes. An electron microscopic analysis revealed that the cells of CS + 5RS, particularly in sacs, have abnormal (irregular and curved) cell walls. These results indicate that 5RS has (a) specific factor(s) influencing the cell wall development as well as the genome stability.

  4. Analysis and validation of genome-specific DNA variations in 5' flanking conserved sequences of wheat low-molecular-weight glutenin subunit genes

    Institute of Scientific and Technical Information of China (English)

    LONG; Hai; WEI; Yuming

    2006-01-01

    The thirty-three 5' flanking conserved sequences of the known low-molecular-weight subunit (LMW-GS) genes have been divided into eight clusters, which was in agreement with the classification based on the deduced N-terminal protein sequences. The DNA polymorphism between the eight clusters was obtained by sequence alignment, and a total of 34 polymorphic positions were observed in the approximately 200 bp regions, among which 18 polymorphic positions were candidate SNPs. Seven cluster-specific primer sets were designed for seven out of eight clusters containing cluster-specific bases, with which the genomic DNA of the ditelosomic lines of group 1 chromosomes of a wheat variety 'Chinese Spring' was employed to carry out chromosome assignment. The subsequent cloning and DNA sequencing of PCR fragments validated the sequences specificity of the 5' flanking conserved sequences between LMW-GS gene groups in different genomes. These results suggested that the coding and 5' flanking regions of LMW-GS genes are likely to have evolved in a concerted fashion. The seven primer sets developed in this study could be used to isolate the complete ORFs of seven groups of LMW-GS genes, respectively, and therefore possess great value for further research in the contributions of a single LMW-GS gene to wheat quality in the complex genetic background and the efficient selections of quality-related components in breeding programs.

  5. Wheat ferritins: Improving the iron content of the wheat grain

    DEFF Research Database (Denmark)

    Borg, Søren; Brinch-Pedersen, Henrik; Tauris, Birgitte

    2012-01-01

    The characterization of the full complement of wheat ferritins show that the modern hexaploid wheat genome contains two ferritin genes, TaFer1 and TaFer2, each represented by three homeoalleles and placed on chromosome 5 and 4, respectively. The two genes are differentially regulated and expresse...

  6. Genetic diversity for Russian wheat aphid resistance as determined by genome-wide association mapping and inheritance in progeny

    Science.gov (United States)

    Russian wheat aphid (RWA) is an increasing problem on barley throughout the world. Genetic resistance has been identified and used to create barley germplasm and cultivars adapted to the US. Several mapping studies have been conducted to identify loci associated with resistance, but questions remain...

  7. Genome-wide association mapping for resistance to leaf and stripe rust in winter-habit hexaploid wheat landraces

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt), and stripe rust, caused by P. striiformis f. sp. tritici (Pst), are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst re...

  8. Finished Genome of the Fungal Wheat Pathogen Mycosphaerella graminicola Reveals Dispensome Structure, Chromosome Plasticity, and Stealth Pathogenesis

    NARCIS (Netherlands)

    Goodwin, S.B.; Ben M'Barek, S.; Dhillon, B.; Wittenberg, A.H.J.; Crane, C.F.; Hane, J.K.; Foster, A.J.; van der Lee, T.A.J.; Grimwood, J.; Aerts, A.; Antoniw, J.; Bailey, A.; Bluhm, B.; Bowler, J.M.; Bristow, J.; van der Burgt, A.; Canto-Canché, B.; Churchill, A.C.L.; Conde-Ferràez, L.; Cools, H.J.; Coutinho, P.M.; Csukai, M.; Dehal, P.; de Wit, P.; Donzelli, B.; Geest, H.G.; van Ham, R.C.H.; Hammond-Kosack, K.E.; Henrissat, B.; Kilian, A.; Kobayashi, A.K.; Koopmann, E.; Kourmpetis, Y.; Kuzniar, A.; Lindquist, E.; Lombard, V.; Maliepaard, C.; Martins, N.; Mehrabi, R.; Nap, J.P.H.; Ponomarenko, A.; Rudd, J.J.; Salamov, A.; Schmutz, J.; Schouten, H.J.; Shapiro, H.; Stergiopoulos, I.; Torriani, S.F.F.; Tu, H.; de Vries, R.P.; Waalwijk, C.; Ware, S.B.; Wiebenga, A.; Zwiers, L.H.; Oliver, R.P.; Grigoriev, I.V.; Kema, G.H.J.

    2011-01-01

    The plant-pathogenic fungus Mycosphaerella graminicola causes septoria tritici blotch, one of the most economically important diseases of wheat worldwide and a potential threat to global food production. Unlike most other plant pathogens, M. graminicola has a long latent period during which it seems

  9. Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

    1986-10-01

    The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical.

  10. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  11. Genome-wide QTL mapping for wheat processing quality parameters in a Gaocheng 8901/Zhoumai 16 recombinant inbred line population

    Directory of Open Access Journals (Sweden)

    Hui Jin

    2016-07-01

    Full Text Available Dough rheological and starch pasting properties play an important role in determining processing quality in bread wheat (Triticum aestivum L.. In the present study, a recombinant inbred line (RIL population derived from a Gaocheng 8901/Zhoumai 16 cross grown in three environments was used to identify quantitative trait loci (QTLs for dough rheological and starch pasting properties evaluated by Mixograph, Rapid Visco-Analyzer (RVA and Mixolab parameters using 90K and 660K single nucleotide polymorphism (SNP chip assays. A high-density linkage map constructed with 46,961 polymorphic SNP markers from the wheat 90K and 660K SNP assays spanned a total length of 4,121 cM, with an average chromosome length of 196.2 cM and marker density of 0.09 cM/marker; 6,596 new SNP markers were anchored to the bread wheat linkage map, with 1,046 and 5,550 markers from the 90K and 660K SNP assays, respectively. Composite interval mapping identified 119 additive QTLs on 20 chromosomes except 4D; among them, 15 accounted for more than 10% of the phenotypic variation across two or three environments. Twelve QTLs for Mixograph parameters, 17 for RVA parameters and 55 for Mixolab parameters were new. Eleven QTL clusters were identified. The closely linked SNP markers can be used in marker-assisted wheat breeding in combination with the Kompetitive Allele Specific PCR (KASP technique for improvement of processing quality in bread wheat.

  12. Association analysis of genomic loci important for grain weight control in elite common wheat varieties cultivated with variable water and fertiliser supply.

    Directory of Open Access Journals (Sweden)

    Kunpu Zhang

    Full Text Available Grain weight, an essential yield component, is under strong genetic control and markedly influenced by the environment. Here, by genome-wide association analysis with a panel of 94 elite common wheat varieties, 37 loci were found significantly associated with thousand-grain weight (TGW in one or more environments differing in water and fertiliser levels. Five loci were stably associated with TGW under all 12 environments examined. Their elite alleles had positive effects on TGW. Four, two, three, and two loci were consistently associated with TGW in the irrigated and fertilised (IF, rainfed (RF, reduced nitrogen (RN, and reduced phosphorus (RP environments. The elite alleles of the IF-specific loci enhanced TGW under well-resourced conditions, whereas those of the RF-, RN-, or RP-specific loci conferred tolerance to the TGW decrease when irrigation, nitrogen, or phosphorus were reduced. Moreover, the elite alleles of the environment-independent and -specific loci often acted additively to enhance TGW. Four additional loci were found associated with TGW in specific locations, one of which was shown to contribute to the TGW difference between two experimental sites. Further analysis of 14 associated loci revealed that nine affected both grain length and width, whereas the remaining loci influenced either grain length or width, indicating that these loci control grain weight by regulating kernel size. Finally, the elite allele of Xpsp3152 frequently co-segregated with the larger grain haplotype of TaGW2-6A, suggesting probable genetic and functional linkages between Xpsp3152 and GW2 that are important for grain weight control in cereal plants. Our study provides new knowledge on TGW control in elite common wheat lines, which may aid the improvement of wheat grain weight trait in further research.

  13. Analysis of Gene Expression Responses to a Infection in Rugao Chicken Intestine Using GeneChips

    Directory of Open Access Journals (Sweden)

    D. Q. Luan

    2012-02-01

    Full Text Available Poultry products are an important source of Salmonella enterica. An effective way to reduce food poisoning due to Salmonella would be to breed chickens more resistant to infection. Unfortunately host responses to Salmonella are complex with many factors involved. To learn more about responses to Salmonella in young chickens of 2 wk old, a cDNA Microarray containing 13,319 probes was performed to compare gene expression profiles between two chicken groups under control and Salmonella infected conditions. Newly hatched chickens were orally infected with S. enterica serovar Enteritidis. Since the intestine is one of the important barriers the bacteria encounter after oral inoculation, intestine gene expression was investigated at 2 wk old. There were 588 differentially expressed genes detected, of which 276 were known genes, and of the total number 266 were up-regulated and 322 were down-regulated. Differences in gene expression between the two chicken groups were found in control as well as Salmonella infected conditions indicating a difference in the intestine development between the two chicken groups which might be linked to the difference in Salmonella susceptibility. The differential expressions of 4 genes were confirmed by quantitative real-time PCR and the results indicated that the expression changes of these genes were generally consistent with the results of GeneChips. The findings in this study have lead to the identification of novel genes and possible cellular pathways, which are host dependent.

  14. Genetic and comparative genomics mapping reveals that a powdery mildew resistance gene Ml3D232 originating from wild emmer co-segregates with an NBS-LRR analog in common wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhang, Hongtao; Guan, Haiying; Li, Jingting; Zhu, Jie; Xie, Chaojie; Zhou, Yilin; Duan, Xiayu; Yang, Tsomin; Sun, Qixin; Liu, Zhiyong

    2010-11-01

    Powdery mildew caused by Blumeria graminis f. sp. tritici is one of the most important wheat diseases worldwide and breeding for resistance using diversified disease resistance genes is the most promising approach to prevent outbreaks of powdery mildew. A powdery mildew resistance gene, originating from wild emmer wheat (Triticum turgidum var. dicoccoides) accessions collected from Israel, has been transferred into the hexaploid wheat line 3D232 through crossing and backcrossing. Inoculation results with 21 B. graminis f. sp. tritici races indicated that 3D232 is resistant to all of the powdery mildew isolates tested. Genetic analyses of 3D232 using an F(2) segregating population and F(3) families indicated that a single dominant gene, Ml3D232, confers resistance in the host seedling stage. By applying molecular markers and bulked segregant analysis (BSA), we have identified polymorphic simple sequence repeats (SSR), expressed sequence tags (EST) and derived sequence tagged site (STS) markers to determine that the Ml3D232 is located on chromosome 5BL bin 0.59-0.76. Comparative genetic analyses using mapped EST markers and genome sequences of rice and Brachypodium established co-linearity of the Ml3D232 genomic region with a 1.4 Mb genomic region on Brachypodium distachyon chromosome 4, and a 1.2 Mb contig located on the Oryza sativa chromosome 9. Our comparative approach enabled us to develop new EST-STS markers and to delimit the genomic region carrying Ml3D232 to a 0.8 cM segment that is collinear with a 558 kb region on B. distachyon. Eight EST markers, including an NBS-LRR analog, co-segregated with Ml3D232 to provide a target site for fine genetic mapping, chromosome landing and map-based cloning of the powdery mildew resistance gene. This newly developed common wheat germplasm provides broad-spectrum resistance to powdery mildew and a valuable resource for wheat breeding programs.

  15. Extraction method of large genomic DNA for wheat stripe rust%小麦条锈菌大片段基因组DNA的提取方法研究

    Institute of Scientific and Technical Information of China (English)

    庄华; 岳海梅; 郑文明; 王晓杰; 康振生

    2011-01-01

    由条锈菌Puccinia striiformis引致的小麦条锈病是小麦最重要的病害之一.由于其活体寄生的特点,对小麦条锈菌的遗传学和分子生物学研究十分有限,大片段核DNA的提取研究还未见报道.高分子量基因组DNA是开展大片段基因组文库构建、基因组分析以及基因组重建的重要基础,通过系统建立和优化小麦条锈菌大片段基因组DNA的分离方法,成功获得分子量大于1Mb高质量的病菌基因组DNA.%The stripe rust caused by Puccinia striiformis is one of the most important diseases of wheat. Because of its parasitic living characteristics, studies on genetics and molecular biology of the rust is largely limited. Extraction of large fragments of nuclear DNA from P. Striiformis has not been reported, but high molecular weight genomic DNA is very important to construct a large fragment genomic library, and perform sequencing and analysis of genome. In this study, we systematically established and optimized a method of separating large genomic DNA of wheat stripe rust, and over 1Mb of genomic DNA in molecular weight was observed by pulse electrophoresis, indicating that high quality of the genomic DNA was obtained successfully, and could be used for constructing large fragment genomic library and further genomic sequencing of wheat stripe rust.

  16. Complete Genome Sequence of Herbaspirillum hiltneri N3 (DSM 17495), Isolated from Surface-Sterilized Wheat Roots

    Science.gov (United States)

    Saizaki, Paula M.; Coimbra, Nilson A. R.; Weiss, Vinicius A.; Faoro, Helisson; Sfeir, Michelle Z. T.; Baura, Valter A.; Monteiro, Rose A.; Chubatsu, Leda S.; Souza, Emanuel M.; Pedrosa, Fabio O.; Raittz, Roberto T.; Marchaukoski, Jeroniza N.

    2015-01-01

    We report the complete genome sequence of Herbaspirillum hiltneri N3 (DSM 17495), a member of the genus Herbaspirillum of the Betaproteobacteria. The genome is contained in a single chromosome, and analysis revealed that N3 lacks the whole nitrogen fixation (nif) gene cluster, confirming its inability to fix nitrogen. PMID:26514770

  17. Wheat Allergy

    Science.gov (United States)

    ... but also, in some cases, by inhaling wheat flour. Wheat can be found in many foods, including ... protein Soy sauce Some condiments, such as ketchup Meat products, such as hot dogs or cold cuts ...

  18. Wheat Allergy

    Science.gov (United States)

    ... Events Blog Media Shop Alerts Donate About Food Allergies Home About Food Allergy Food Allergy Basics Facts ... Registration Create Your Own Events Educational Events Wheat Allergy Wheat allergy is most common in children, and ...

  19. Wheat Woes

    Institute of Scientific and Technical Information of China (English)

    DING SHENGJUN

    2010-01-01

    @@ Chicago wheat futures began to skyrocket in early June,jumping 62 percent and reaching their highest level since September 2008. In Russia, wheat prices increased 70 percent recently. And Europe's wheat prices also rose 8 percent within a short time.

  20. Wheat Woes

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Soaringwheat prices are unlikely to endanger globalgrain security chicago wheat futures began to skyrocket in early June, jumping 62 percent and reaching their highest level since September 2008. In Russia,wheat prices increased 70 percent recently.And Europe’s wheat prices also rose 8 percent within a short time.

  1. Analysis of main effect QTL for thousand grain weight in European winter wheat (Triticum aestivum L. by genome-wide association mapping

    Directory of Open Access Journals (Sweden)

    Christine Désirée Zanke

    2015-09-01

    Full Text Available Grain weight, an essential yield component, is under strong genetic control and at the same time markedly influenced by the environment. Genetic analysis of the thousand grain weight (TGW by genome-wide association study (GWAS was performed with a panel of 358 European winter wheat (Triticum aestivum L. varieties and 14 spring wheat varieties using phenotypic data of field tests in eight environments. Wide phenotypic variations were indicated for the TGW with BLUEs (best linear unbiased estimations values ranging from 35.9 g to 58.2 g with a mean value of 45.4 g and a heritability of H2=0.89. A total of 12 candidate genes for plant height, photoperiodism and grain weight were genotyped on all varieties. Only three candidates, the photoperiodism gene Ppd-D1, dwarfing gene Rht-B1and the TaGW-6A gene were significant explaining up to 14.4%, 2.3% and 3.4% of phenotypic variation, respectively. For a comprehensive genome-wide analysis of TGW-QTL genotyping data from 732 microsatellite markers and a set of 7769 mapped SNP markers genotyped with the 90k iSELECT array were analyzed. In total, 342 significant (-log10 (P-value > 3.0 marker trait associations (MTAs were detected for SSR markers and 1195 MTAs (-log10P-value > 3.0 for SNP markers in all single environments plus the BLUEs. After Bonferroni correction, 28 MTAs remained significant for SSR markers (-log10 (P-value > 4.82 and 58 MTAs for SNP markers (-log10 (P value > 5.89. Apart from chromosomes 4B and 6B for SSR markers and chromosomes 4D and 5D for SNP markers, MTAs were detected on all chromosomes. The highest number of significant SNP markers was found on chromosomes 3B and 1B, while for the SSRs most markers were significant on chromosomes 6D and 3D. Overall, TGW was determined by many markers with small effects. Only three SNP-markers had R2 values above 6%.

  2. Whole genome sequence of Clostridium bornimense strain M2/40 isolated from a lab-scale mesophilic two-phase biogas reactor digesting maize silage and wheat straw.

    Science.gov (United States)

    Hahnke, Sarah; Wibberg, Daniel; Tomazetto, Geizecler; Pühler, Alfred; Klocke, Michael; Schlüter, Andreas

    2014-08-20

    The bacterium Clostridium bornimense M2/40 is a mesophilic, anaerobic bacterium isolated from a two-phase biogas reactor continuously fed with maize silage and 5% wheat straw. Grown on glucose, it produced H2, CO2, formiate, lactate and propionate as the main fermentation products, of which some compounds serve as substrates for methanogenic Archaea to form methane. Here, the whole genome sequence of the bacterium consisting of two circular replicons is reported. This genome information provides the basis for further studies addressing metabolic features of the isolate and its role in anaerobic biomass degradation.

  3. Most significant genome regions involved in the control of earliness traits in bread wheat, as revealed by QTL meta-analysis.

    Science.gov (United States)

    Hanocq, E; Laperche, A; Jaminon, O; Lainé, A-L; Le Gouis, J

    2007-02-01

    Earliness is one of the most important adaptation traits in plant breeding. Our purpose was to identify the genome regions of bread wheat involved in the control of earliness and its three components: photoperiod sensitivity (PS), vernalization requirement (VR) and intrinsic earliness (IE). A QTL meta-analysis was carried out to examine the replicability of QTL across 13 independent studies and to propose meta-QTL (MQTL). Initial QTL were projected on a recent consensus map (2004). Quality criteria were proposed to assess the reliability of this projection. These criteria were based on the distances between markers in the QTL regions. Chromosomes of groups 2 and 5 had a greater incidence on earliness control as they carry the known, major genes Ppd and Vrn. Other chromosome regions played an intermediate role in earliness control: 4A [heading date (HD) Meta-QTL], 4B (HD MQTL), 2B (VR MQTL) and 5B (IE MQTL). Markers at this four MQTL should prove helpful in marker-assisted selection, to better control earliness.

  4. The pangenome of hexaploid bread wheat.

    Science.gov (United States)

    Montenegro, Juan D; Golicz, Agnieszka A; Bayer, Philipp E; Hurgobin, Bhavna; Lee, HueyTyng; Chan, Chon-Kit Kenneth; Visendi, Paul; Lai, Kaitao; Doležel, Jaroslav; Batley, Jacqueline; Edwards, David

    2017-02-23

    There is an increasing understanding that gene presence absence variation plays an important role in the heritability of agronomic traits, however there have been relatively few studies on gene presence absence variation in crop species. Hexaploid wheat is one of the most important food crops in the world and intensive breeding has reduced the genetic diversity of elite cultivars. Major efforts have produced draft genome assemblies for the cultivar Chinese Spring, but it is unknown how well this represents the genome diversity found in current modern elite cultivars. In this study we build an improved reference for Chinese Spring and explore gene diversity across 18 wheat cultivars. We predict a pangenome size of 140,500 +/- 102 genes, a core genome of 81,070 +/- 1,631 genes, and an average of 128,656 genes in each cultivar. Functional annotation of the variable gene set suggests that it is enriched for genes that may be associated with important agronomic traits. In addition to gene presence variation, more than 36 million intervarietal SNPs were identified across the pangenome. This study of the wheat pangenome provides insight into elite wheat genome diversity as a basis for genomics based improvement of this important crop. A wheat pangenome Gbrowse is available at http://appliedbioinformatics.com.au/cgi-bin/gb2/gbrowse/WheatPan/, and data is available for download from http://wheatgenome.info/wheat_genome_databases.php. This article is protected by copyright. All rights reserved.

  5. Genome assembly of Diuraphis noxia strain: RWA2 Russian wheat aphid. Bioproject: PRJNA233413. Assembly No. ASM118638v1 (Dnoxia_1.0)

    Science.gov (United States)

    The Russian wheat aphid, Diuraphis noxia Kurdjumov, is among one of the most destructive species with origins in Central Asia west of the Tian Shan Mountains in northwestern China. It is a significant pest of wheat and barley, expanded its range throughout all cereal production areas of the world, ...

  6. Eat Wheat!

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    This pamphlet contains puzzles, games, and a recipe designed to teach elementary school pupils about wheat. It includes word games based on the U.S. Department of Agriculture Food Guide Pyramid and on foods made from wheat. The Food Guide Pyramid can be cut out of the pamphlet and assembled as a three-dimensional information source and food guide.…

  7. Preferred analysis methods for Affymetrix GeneChips. II. An expanded, balanced, wholly-defined spike-in dataset

    Directory of Open Access Journals (Sweden)

    Zhu Qianqian

    2010-05-01

    Full Text Available Abstract Background Concomitant with the rise in the popularity of DNA microarrays has been a surge of proposed methods for the analysis of microarray data. Fully controlled "spike-in" datasets are an invaluable but rare tool for assessing the performance of various methods. Results We generated a new wholly defined Affymetrix spike-in dataset consisting of 18 microarrays. Over 5700 RNAs are spiked in at relative concentrations ranging from 1- to 4-fold, and the arrays from each condition are balanced with respect to both total RNA amount and degree of positive versus negative fold change. We use this new "Platinum Spike" dataset to evaluate microarray analysis routes and contrast the results to those achieved using our earlier Golden Spike dataset. Conclusions We present updated best-route methods for Affymetrix GeneChip analysis and demonstrate that the degree of "imbalance" in gene expression has a significant effect on the performance of these methods.

  8. Wheat: The Whole Story.

    Science.gov (United States)

    Oklahoma State Dept. of Education, Oklahoma City.

    This publication presents information on wheat. Wheat was originally a wild grass and not native to the United States. Wheat was not planted there until 1777 (and then only as a hobby crop). Wheat is grown on more acres than any other grain in this country. Soft wheats are grown east of the Mississippi River, and hard wheats are grown west of the…

  9. Advance of Study on D.villosum(H.villosa) Genome and Its Application in Wheat Improvement%簇毛麦基因组及其在小麦改良中的应用研究进展

    Institute of Scientific and Technical Information of China (English)

    孔凡晶; 陈孝

    2001-01-01

    D.villosum (H.villosa), which is the relative genus of Triticum, was the important resources for wheat improvement. The favorable genes from D.villosum (H.villosa) were introduced into wheat genetic background through cross and backcross using double diploid as parent. The alien addition lines, alien substitution lines, and alien translocation lines were obtained. By aid of morphologic, cytological, biochemical, and molecular markers, the genome, chromosomes, arms and fragments of chromosomes were identified in wheat genetic background. The disease resistance genes had been applied in wheat improvement. Many other genes, such as drought resistance genes, saline resistance genes and high protein content genes would be explored in the future.%簇毛麦是小麦的近缘属,是小麦改良重要的基因资源。簇毛麦有益基因向小麦遗传背景的导入,主要利用小麦-簇毛麦双二倍体为桥梁亲本,通过杂交、回交等方式获得小麦异代换系、异附加系、异易位系;并且利用形态标记、细胞学标记、生化标记及分子标记对小麦遗传背景下的染色体组、染色体、染色体臂及片段进行鉴定。本文对这些方面的研究进展进行了综述,对簇毛麦可利用基因进行了展望。

  10. ExonMiner: Web service for analysis of GeneChip Exon array data

    Directory of Open Access Journals (Sweden)

    Imoto Seiya

    2008-11-01

    Full Text Available Abstract Background Some splicing isoform-specific transcriptional regulations are related to disease. Therefore, detection of disease specific splice variations is the first step for finding disease specific transcriptional regulations. Affymetrix Human Exon 1.0 ST Array can measure exon-level expression profiles that are suitable to find differentially expressed exons in genome-wide scale. However, exon array produces massive datasets that are more than we can handle and analyze on personal computer. Results We have developed ExonMiner that is the first all-in-one web service for analysis of exon array data to detect transcripts that have significantly different splicing patterns in two cells, e.g. normal and cancer cells. ExonMiner can perform the following analyses: (1 data normalization, (2 statistical analysis based on two-way ANOVA, (3 finding transcripts with significantly different splice patterns, (4 efficient visualization based on heatmaps and barplots, and (5 meta-analysis to detect exon level biomarkers. We implemented ExonMiner on a supercomputer system in order to perform genome-wide analysis for more than 300,000 transcripts in exon array data, which has the potential to reveal the aberrant splice variations in cancer cells as exon level biomarkers. Conclusion ExonMiner is well suited for analysis of exon array data and does not require any installation of software except for internet browsers. What all users need to do is to access the ExonMiner URL http://ae.hgc.jp/exonminer. Users can analyze full dataset of exon array data within hours by high-level statistical analysis with sound theoretical basis that finds aberrant splice variants as biomarkers.

  11. Complete gene expression profiling of Saccharopolyspora erythraea using GeneChip DNA microarrays

    Directory of Open Access Journals (Sweden)

    Bordoni Roberta

    2007-11-01

    Full Text Available Abstract Background The Saccharopolyspora erythraea genome sequence, recently published, presents considerable divergence from those of streptomycetes in gene organization and function, confirming the remarkable potential of S. erythraea for producing many other secondary metabolites in addition to erythromycin. In order to investigate, at whole transcriptome level, how S. erythraea genes are modulated, a DNA microarray was specifically designed and constructed on the S. erythraea strain NRRL 2338 genome sequence, and the expression profiles of 6494 ORFs were monitored during growth in complex liquid medium. Results The transcriptional analysis identified a set of 404 genes, whose transcriptional signals vary during growth and characterize three distinct phases: a rapid growth until 32 h (Phase A; a growth slowdown until 52 h (Phase B; and another rapid growth phase from 56 h to 72 h (Phase C before the cells enter the stationary phase. A non-parametric statistical method, that identifies chromosomal regions with transcriptional imbalances, determined regional organization of transcription along the chromosome, highlighting differences between core and non-core regions, and strand specific patterns of expression. Microarray data were used to characterize the temporal behaviour of major functional classes and of all the gene clusters for secondary metabolism. The results confirmed that the ery cluster is up-regulated during Phase A and identified six additional clusters (for terpenes and non-ribosomal peptides that are clearly regulated in later phases. Conclusion The use of a S. erythraea DNA microarray improved specificity and sensitivity of gene expression analysis, allowing a global and at the same time detailed picture of how S. erythraea genes are modulated. This work underlines the importance of using DNA microarrays, coupled with an exhaustive statistical and bioinformatic analysis of the results, to understand the transcriptional

  12. ExonMiner: Web service for analysis of GeneChip Exon array data

    Science.gov (United States)

    Numata, Kazuyuki; Yoshida, Ryo; Nagasaki, Masao; Saito, Ayumu; Imoto, Seiya; Miyano, Satoru

    2008-01-01

    Background Some splicing isoform-specific transcriptional regulations are related to disease. Therefore, detection of disease specific splice variations is the first step for finding disease specific transcriptional regulations. Affymetrix Human Exon 1.0 ST Array can measure exon-level expression profiles that are suitable to find differentially expressed exons in genome-wide scale. However, exon array produces massive datasets that are more than we can handle and analyze on personal computer. Results We have developed ExonMiner that is the first all-in-one web service for analysis of exon array data to detect transcripts that have significantly different splicing patterns in two cells, e.g. normal and cancer cells. ExonMiner can perform the following analyses: (1) data normalization, (2) statistical analysis based on two-way ANOVA, (3) finding transcripts with significantly different splice patterns, (4) efficient visualization based on heatmaps and barplots, and (5) meta-analysis to detect exon level biomarkers. We implemented ExonMiner on a supercomputer system in order to perform genome-wide analysis for more than 300,000 transcripts in exon array data, which has the potential to reveal the aberrant splice variations in cancer cells as exon level biomarkers. Conclusion ExonMiner is well suited for analysis of exon array data and does not require any installation of software except for internet browsers. What all users need to do is to access the ExonMiner URL . Users can analyze full dataset of exon array data within hours by high-level statistical analysis with sound theoretical basis that finds aberrant splice variants as biomarkers. PMID:19036125

  13. Evolutionary, Comparative and Functional Analyses of the Brassinosteroid Receptor Gene, BRI1, in Wheat and Its Relation to Other Plant Genomes.

    Directory of Open Access Journals (Sweden)

    Christopher Navarro

    Full Text Available Brassinosteroids (BRs are plant hormones, fundamental for the growth and development of plants. A trans-membrane protein receptor kinase, Brassinosteroid-Insensitive 1 (BRI1, is known to interact with BRs and be directly involved in plant development. This study investigates the structural organization of BRI1 orthologs in several taxa, with a specific interest in Triticum aestivum. True orthologs of Arabidopsis thaliana BRI1 (AtBRI1 from seven-plant species showed sequence identity ranging from 54% to 95% at the protein level. All gene sequences lacked introns, leading to speculation that post-transcriptional processing in TaBRI1 is similar to AtBRI1. Based on in silico analysis, a single copy of BRI1 was present in each of the three wheat genomes on the long arm of chromosome 3. Domain structure of BRI1 orthologs among different taxa showed multiple leucine rich repeats (LRRs, an island domain (ID, a juxtamembrane/transmembrane domain (JTMD, a catalytic kinase domain (KD, C and N-Terminal domains. The KD showed the highest level of conservation while the LRRs and JTMD were most variable. Phosphorylation of residues in the juxtamembrane domain, known to be involved in the activation of the KD, is conserved in TaBRI1. While TaBRI1 has well-defined differences in the ID and LRR domains, many residues involved in ligand binding are conserved. The activation loop present in the KD showed 100% conservation in all taxa. Despite residue differences, hydrophobicity was conserved in the BR binding pocket across taxa, suggesting that function may not differ as drastically as residue identity may suggest. Predicted 3D structure of AtBRI1 and TaBRI1 showed a conserved super helical assembly, a feature essential in protein-protein interactions. An unrooted phylogram showed TaBRI1 in the monocot clade to be distinct from that of dicots. New insight in the structure and functions of BRI1 may help in targeting BR pathway for crop improvement.

  14. Pushing Wheat

    DEFF Research Database (Denmark)

    Sharp, Paul Richard

    This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between these varia......This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between...

  15. Genetic diversity of Brazilian triticales evaluated with genomic wheat microsatellites Diversidade genética de triticales brasileiros avaliada com microssatélites genômicos de trigo

    Directory of Open Access Journals (Sweden)

    Cibele Tesser da Costa

    2007-11-01

    Full Text Available The objective of this work was to determine the genetic variability available for triticale (X Triticosecale Wittmack crop improvement in Brazil. Forty-two wheat genomic microsatellites were used to estimate the molecular diversity of 54 genotypes, which constitute the base of one of the major triticale breeding programs in the country. Average heterozygosity was 0.06 and average and effective number of alleles per locus were 2.13 and 1.61, respectively, with average allelic frequency of 0.34. The set of genomic wheat microsatellites used clustered the genotypes into seven groups, even when the germplasm was originated primarily from only two triticale breeding programs, a fact reflected on the average polymorphic information content value estimated for the germplasm (0.36. The 71.42% transferability achieved for the tested microsatellites indicates the possibility of exploiting these transferable markers in further triticale genetic and breeding studies, even those mapped on the D genome of wheat, when analyzing hexaploid triticales.O objetivo deste trabalho foi determinar a variabilidade disponível para o melhoramento de triticale (X Triticosecale Wittmack no Brasil. Quarenta e dois microssatélites de trigo foram empregados para estimar a diversidade molecular de 54 genótipos, que constituem a base de um dos principais programas de melhoramento da espécie no país. A heterozigosidade média foi 0,06, e os números médio e efetivo de alelos por lócus foram de 2,13 e 1,61, respectivamente, com freqüência alélica média de 0,34. O conjunto de microssatélites de trigo possibilitou reunir os genótipos em sete grupos, mesmo que o germoplasma utilizado seja originado de apenas duas instituições de pesquisa, o que refletiu em baixo índice de polimorfismo médio (0,36. A taxa de transferência dos marcadores testados (71,42% indica a possibilidade de uso desses microssatélites de trigo, até mesmo os mapeados no genoma D da espécie, na

  16. Wheat induced urticaria

    Directory of Open Access Journals (Sweden)

    Uppal Monica

    2004-09-01

    Full Text Available Wheat is widely consumed all over India in various forms - flour, daliya, maida, suji and wheat bran. Very few cases of wheat induced urticaria have been reported. This may be due to unusual features of wheat related hypersensitivity. A 35 year old female presented to us with history of chronic urticaria and angioedema. History revealed correlation between wheat intake and urticaria episodes. Prick testing was done with wheat antigen in the standard series and derivatives of raw wheat. Normal saline and histamine were used as controls. Prick testing was positive. Oral challenge induced urticaria within half an hour. This report discusses clinical features of wheat related hypersensitivity.

  17. Selected items of wheat variation - from palaeobotany to molecular biology

    Directory of Open Access Journals (Sweden)

    Romuald Kosina

    2014-01-01

    Full Text Available The usefulness of data on ecotypes of wheat as well as of information about distribution of genes of hybrid necrosis for an interpretation of some questionable detections of fossil materials is emphasized. Variability of contemporary wheats is illustrated by means of morphology of lodicules, anatomical structure of caryopsis, morphology of embryo and features of epidermis of inflorescence bracts. These structures exhibit often a trend dependent on ploidy level. Discrimination of similar grains of fossil Triticum compactum and T. sphaerococcum is possible when traits of embryo are used. Wheat genomes are changed by numerous translocations and are spatially separated. This status may be detected by means of in situ hybridization of the genomic DNA. With such a spatial arrangement of the genomes the dominance of a caryopsis trait complex in hybrids between tetraploid wheats may be correlated. It may also create a part of new variation in wheat.

  18. Introgression of chromosome segments from multiple alien species in wheat breeding lines with wheat streak mosaic virus resistance

    Science.gov (United States)

    Pyramiding of alien-derived Wheat streak mosaic virus (WSMV) resistance and resistance enhancing genes in wheat is a costeffective and environmentally safe strategy for disease control. PCR-based markers and cytogenetic analysis with genomic in situ hybridisation were applied to identify alien chrom...

  19. The role of Aegilops species in the origin and improvement of common wheat

    Directory of Open Access Journals (Sweden)

    Roman Prażak

    2014-01-01

    Full Text Available Some Aegilops species participated in wheat evolution playing a major role in wheat domestication and therefore the genus Aegilops represents a big part of the additional gene pool determining important traits of wheat. Breeders have been using these genes for many years to produce improved cultivars. Wide crosses between its wild relatives are sources of desirable characteristics for genetic improvement of common wheat. Triticum aestivum evolution and methods for transfer of alien material into wheat, briefly reviewed in this article, include incorporation of the whole genomes, single chromosomes, small chromosomal segments, single genes and cytoplasm substitution in wheat.

  20. Variation in Susceptibility to Wheat dwarf virus among Wild and Domesticated Wheat

    Science.gov (United States)

    Nygren, Jim; Shad, Nadeem; Kvarnheden, Anders; Westerbergh, Anna

    2015-01-01

    We investigated the variation in plant response in host-pathogen interactions between wild (Aegilops spp., Triticum spp.) and domesticated wheat (Triticum spp.) and Wheat dwarf virus (WDV). The distribution of WDV and its wild host species overlaps in Western Asia in the Fertile Crescent, suggesting a coevolutionary relationship. Bread wheat originates from a natural hybridization between wild emmer wheat (carrying the A and B genomes) and the wild D genome donor Aegilops tauschii, followed by polyploidization and domestication. We studied whether the strong selection during these evolutionary processes, leading to genetic bottlenecks, may have resulted in a loss of resistance in domesticated wheat. In addition, we investigated whether putative fluctuations in intensity of selection imposed on the host-pathogen interactions have resulted in a variation in susceptibility to WDV. To test our hypotheses we evaluated eighteen wild and domesticated wheat taxa, directly or indirectly involved in wheat evolution, for traits associated with WDV disease such as leaf chlorosis, different growth traits and WDV content. The plants were exposed to viruliferous leafhoppers (Psammotettix alienus) in a greenhouse trial and evaluated at two time points. We found three different plant response patterns: i) continuous reduction in growth over time, ii) weak response at an early stage of plant development but a much stronger response at a later stage, and iii) remission of symptoms over time. Variation in susceptibility may be explained by differences in the intensity of natural selection, shaping the coevolutionary interaction between WDV and the wild relatives. However, genetic bottlenecks during wheat evolution have not had a strong impact on WDV resistance. Further, this study indicates that the variation in susceptibility may be associated with the genome type and that the ancestor Ae. tauschii may be useful as genetic resource for the improvement of WDV resistance in wheat. PMID

  1. Variation in susceptibility to Wheat dwarf virus among wild and domesticated wheat.

    Directory of Open Access Journals (Sweden)

    Jim Nygren

    Full Text Available We investigated the variation in plant response in host-pathogen interactions between wild (Aegilops spp., Triticum spp. and domesticated wheat (Triticum spp. and Wheat dwarf virus (WDV. The distribution of WDV and its wild host species overlaps in Western Asia in the Fertile Crescent, suggesting a coevolutionary relationship. Bread wheat originates from a natural hybridization between wild emmer wheat (carrying the A and B genomes and the wild D genome donor Aegilops tauschii, followed by polyploidization and domestication. We studied whether the strong selection during these evolutionary processes, leading to genetic bottlenecks, may have resulted in a loss of resistance in domesticated wheat. In addition, we investigated whether putative fluctuations in intensity of selection imposed on the host-pathogen interactions have resulted in a variation in susceptibility to WDV. To test our hypotheses we evaluated eighteen wild and domesticated wheat taxa, directly or indirectly involved in wheat evolution, for traits associated with WDV disease such as leaf chlorosis, different growth traits and WDV content. The plants were exposed to viruliferous leafhoppers (Psammotettix alienus in a greenhouse trial and evaluated at two time points. We found three different plant response patterns: i continuous reduction in growth over time, ii weak response at an early stage of plant development but a much stronger response at a later stage, and iii remission of symptoms over time. Variation in susceptibility may be explained by differences in the intensity of natural selection, shaping the coevolutionary interaction between WDV and the wild relatives. However, genetic bottlenecks during wheat evolution have not had a strong impact on WDV resistance. Further, this study indicates that the variation in susceptibility may be associated with the genome type and that the ancestor Ae. tauschii may be useful as genetic resource for the improvement of WDV resistance in

  2. Estimation of Genetic Diversity in Genetic Stocks of Hexaploid Wheat Using Seed Storage Proteins

    OpenAIRE

    Tanweer Kumar; Imtiaz Ahmed Khan; Niaz Ali; Muhammad Amir Zia; Tahir Hameed; Sohaib Roomi; Ali Bahadur; Habib Ahmad

    2014-01-01

    Bread wheat (Triticum aestivum L.) is an allohexaploid specie, consist of three genomes AABBDD having 2n = 6x = 42 chromosomes. The wheat is a staple food of human beings due to its bread making quality which is composed of seed storage proteins of wheat especially High Molecular Weight Glutenins (HMW-GS). During present research, HMW-GS were analyzed in genetic stocks of common wheat consist of Nullisomic- tetrasomic, ditelosomic and deletion lines of group 3 homoeologous chromosomes by Sodi...

  3. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-15

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.

  4. Synthetic hexaploids derived from under-exploited tetraploids as a new resource for disease resistance in wheat

    Science.gov (United States)

    Synthetic hexaploid wheat (SHW) (2n = 6x = 42, genome AABBDD), which is developed from the hybridization between tetraploid wheat (Triticum turgidum L., 2n = 4x = 28, genome AABB) and Aegilops tauschii Coss. (2n = 2x = 14, genome DD), is a useful bridging germplasm for the introgression of desirable...

  5. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Directory of Open Access Journals (Sweden)

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  6. Dynamic evolution of Rht-1 homologous regions in grass genomes

    Science.gov (United States)

    Bread wheat contains A, B, and D subgenomes with its well characterized ancestral genomes that exist at the diploid and tetraploid levels. Therefore, the wheat genome system acts as a model specie for studying genome evolutionary dynamics. Here, we performed intra- and inter-species comparative ana...

  7. Ancestral QTL Alleles from Wild Emmer Wheat Improve Drought Resistance and Productivity in Modern Wheat Cultivars.

    Science.gov (United States)

    Merchuk-Ovnat, Lianne; Barak, Vered; Fahima, Tzion; Ordon, Frank; Lidzbarsky, Gabriel A; Krugman, Tamar; Saranga, Yehoshua

    2016-01-01

    Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is considered a promising source for improving stress resistances in domesticated wheat. Here we explored the potential of selected quantitative trait loci (QTLs) from wild emmer wheat, introgressed via marker-assisted selection, to enhance drought resistance in elite durum (T. turgidum ssp. durum) and bread (T. aestivum) wheat cultivars. The resultant near-isogenic lines (BC3F3 and BC3F4) were genotyped using SNP array to confirm the introgressed genomic regions and evaluated in two consecutive years under well-watered (690-710 mm) and water-limited (290-320 mm) conditions. Three of the introgressed QTLs were successfully validated, two in the background of durum wheat cv. Uzan (on chromosomes 1BL and 2BS), and one in the background of bread wheat cvs. Bar Nir and Zahir (chromosome 7AS). In most cases, the QTL x environment interaction was validated in terms of improved grain yield and biomass-specifically under drought (7AS QTL in cv. Bar Nir background), under both treatments (2BS QTL), and a greater stability across treatments (1BL QTL). The results provide a first demonstration that introgression of wild emmer QTL alleles can enhance productivity and yield stability across environments in domesticated wheat, thereby enriching the modern gene pool with essential diversity for the improvement of drought resistance.

  8. Ancestral QTL Alleles from Wild Emmer Wheat Improve Drought Resistance and Productivity in Modern Wheat Cultivars

    Science.gov (United States)

    Merchuk-Ovnat, Lianne; Barak, Vered; Fahima, Tzion; Ordon, Frank; Lidzbarsky, Gabriel A.; Krugman, Tamar; Saranga, Yehoshua

    2016-01-01

    Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is considered a promising source for improving stress resistances in domesticated wheat. Here we explored the potential of selected quantitative trait loci (QTLs) from wild emmer wheat, introgressed via marker-assisted selection, to enhance drought resistance in elite durum (T. turgidum ssp. durum) and bread (T. aestivum) wheat cultivars. The resultant near-isogenic lines (BC3F3 and BC3F4) were genotyped using SNP array to confirm the introgressed genomic regions and evaluated in two consecutive years under well-watered (690–710 mm) and water-limited (290–320 mm) conditions. Three of the introgressed QTLs were successfully validated, two in the background of durum wheat cv. Uzan (on chromosomes 1BL and 2BS), and one in the background of bread wheat cvs. Bar Nir and Zahir (chromosome 7AS). In most cases, the QTL x environment interaction was validated in terms of improved grain yield and biomass—specifically under drought (7AS QTL in cv. Bar Nir background), under both treatments (2BS QTL), and a greater stability across treatments (1BL QTL). The results provide a first demonstration that introgression of wild emmer QTL alleles can enhance productivity and yield stability across environments in domesticated wheat, thereby enriching the modern gene pool with essential diversity for the improvement of drought resistance. PMID:27148287

  9. Ancestral QTL alleles from wild emmer wheat improve drought resistance and productivity in modern wheat cultivars

    Directory of Open Access Journals (Sweden)

    Lianne eMerchuk-Ovnat

    2016-04-01

    Full Text Available Wild emmer wheat (Triticum turgidum ssp. dicoccoides is considered a promising source for improving stress resistances in domesticated wheat. Here we explored the potential of selected quantitative trait loci (QTLs from wild emmer wheat, introgressed via marker-assisted selection, to enhance drought resistance in elite durum (T. turgidum ssp. durum and bread (T. aestivum wheat cultivars. The resultant near-isogenic lines (BC3F3 and BC3F4 were genotyped using SNP array to confirm the introgressed genomic regions and evaluated in two consecutive years under well-watered (690–710 mm and water-limited (290–320 mm conditions. Three of the introgressed QTLs were successfully validated, two in the background of durum wheat cv. Uzan (on chromosomes 1BL and 2BS, and one in the background of bread wheat cvs. Bar Nir and Zahir (chromosome 7AS. In most cases, the QTL x environment interaction was validated in terms of improved grain yield and biomass - specifically under drought (7AS QTL in cv. Bar Nir background, under both treatments (2BS QTL, and a greater stability across treatments (1BL QTL. The results provide a first demonstration that introgression of wild emmer QTL alleles can enhance productivity and yield stability across environments in domesticated wheat, thereby enriching the modern gene pool with essential diversity for the improvement of drought resistance.

  10. Comparative Transcriptomic Profiling of Vitis vinifera Under High Light Using a Custom-Made Array and the Affymetrix GeneChip

    Institute of Scientific and Technical Information of China (English)

    Luisa C. Carvalho; Belmiro J. Vilela; Phil M. Mullineaux; Sara Am(a)ncio

    2011-01-01

    Understanding abiotic stress responses is one of the most important issues in plant research nowadays.Abiotic stress,including excess light,can promote the onset of oxidative stress through the accumulation of reactive oxygen species.Oxidative stress also arises when in vitro propagated plants are exposed to high light upon transfer to ex vitro.To determine whether the underlying pathways activated at the transfer of in vitro grapevine to ex vitro conditions reflect the processes occurring upon light stress,we used Vitis vinifera Affymetrix GeneChip (VvGA) and a custom array of genes responsive to light stress (LSCA) detected by real-time reverse transcriptase PCR (qRT-PCR).When gene-expression profiles were compared,‘protein metabolism and modification',‘signaling',and ‘anti-oxidative' genes were more represented in LSCA,while,in VvGA,‘cell wall metabolism' and ‘secondary metabolism' were the categories in which gene expression varied more significantly.The above functional categories confirm previous studies involving other types of abiotic stresses,enhancing the common attributes of abiotic stress defense pathways.The LSCA analysis of our experimental system detected strong response of heat shock genes,particularly the protein rescuing mechanism involving the cooperation of two ATP-dependent chaperone systems,Hsp100 and Hsp70,which showed an unusually late response during the recovery period,of extreme relevance to remove non-functional,potentially harmful polypeptides arising from misfolding,denaturation,or aggregation brought about by stress.The success of LSCA also proves the feasibility of a custommade qRT-PCR approach,particularly for species for which no GeneChip is available and for researchers dealing with a specific and focused problem.

  11. Wheat and gluten intolerance

    NARCIS (Netherlands)

    Busink-van den Broeck, Hetty; Gilissen, L.J.W.J.; Brouns, F.

    2016-01-01

    With this White Paper, the current state of scientific knowledge on human disorders related to gluten and wheat is presented, with reference to other grains such as spelt, barley, rye, and oats. Backgrounds are described of coeliac disease (gluten intolerance), wheat allergies and any kind of wheat

  12. Iron Biofortification of Modern Wheat Cultivar

    DEFF Research Database (Denmark)

    Shirvanehdeh, Behrooz Darbani; Brinch-Pedersen, Henrik; Tauris, Birgitte

    2011-01-01

    -bombardment using Bar and ferritin cassettes. This, allows the possible out segregation of the antibiotic resistance gene and paves the way to meet biosafety and breeding criteria. We have created transgenic plants by a cisgenic approach. The genomic sequence including the coding part and the 3’ untranslated part...... to be translocated into the endosperm and stored. We have cloned the Vit1-1 and Vit1-2 genes from wheat and have made constructs for aleurone specific regulation. We have also found aleurone specific barley Ltp2 promoter in a same expression pattern in wheat. At present, transgenic plants are in the process...

  13. Genome-wide and fine-resolution association analysis of malaria in West Africa

    OpenAIRE

    Jallow, Muminatou; Teo, Yik Ying; Kerrin S Small; Kirk A Rockett; Deloukas, Panos; Taane G Clark; Kivinen, Katja; Kalifa A Bojang; Conway, David J.; Pinder, Margaret; Sirugo, Giorgio; Sisay-Joof, Fatou; Usen, Stanley; Auburn, Sarah; Suzannah J Bumpstead

    2009-01-01

    We report a genome-wide association (GWA) study of severe malaria in The Gambia. The initial GWA scan included 2,500 children genotyped on the Affymetrix 500K GeneChip, and a replication study included 3,400 children. We used this to examine the performance of GWA methods in Africa. We found considerable population stratification, and also that signals of association at known malaria resistance loci were greatly attenuated owing to weak linkage disequilibrium (LD). To investigate possible sol...

  14. Efficient induction of Wheat-agropyron cristatum 6P translocation lines and GISH detection.

    Directory of Open Access Journals (Sweden)

    Liqiang Song

    Full Text Available The narrow genetic background restricts wheat yield and quality improvement. The wild relatives of wheat are the huge gene pools for wheat improvement and can broaden its genetic basis. Production of wheat-alien translocation lines can transfer alien genes to wheat. So it is important to develop an efficient method to induce wheat-alien chromosome translocation. Agropyroncristatum (P genome carries many potential genes beneficial to disease resistance, stress tolerance and high yield. Chromosome 6P possesses the desirable genes exhibiting good agronomic traits, such as high grain number per spike, powdery mildew resistance and stress tolerance. In this study, the wheat-A. cristatum disomic addition was used as bridge material to produce wheat-A. cristatum translocation lines induced by (60Co-γirradiation. The results of genomic in situ hybridization showed that 216 plants contained alien chromosome translocation among 571 self-pollinated progenies. The frequency of translocation was 37.83%, much higher than previous reports. Moreover, various alien translocation types were identified. The analysis of M2 showed that 62.5% of intergeneric translocation lines grew normally without losing the translocated chromosomes. The paper reported a high efficient technical method for inducing alien translocation between wheat and Agropyroncristatum. Additionally, these translocation lines will be valuable for not only basic research on genetic balance, interaction and expression of different chromosome segments of wheat and alien species, but also wheat breeding programs to utilize superior agronomic traits and good compensation effect from alien chromosomes.

  15. Study on comparison of methods of extracting genome DNA from wheat%小麦基因组DNA提取方法比较研究

    Institute of Scientific and Technical Information of China (English)

    王小利

    2012-01-01

    This paper introduces 4 methods of wheat DNA extraction. The DNA concentration and quality are compared by using agarose gel electrophoresis and protein nucteic acid analyzer. Experimental results show that there is somewhat difference in DNA concentration between the 4 methods. The DNA concentration in Program I is the highest, but the consumption of reagent is the most. The DNA concentration of Program 11 is the lowest, but the process is simple. The extracted DNA concentrations are equivalent to Programs Ⅲ and IV. There is protein pollution in Program Ⅲ, but the process is simple. The purity of Program IV is higher than others, but the process is the most complex, Using the same pair of primers and the reaction system, the extracted DNA is amplified by PCR. The results show that the 4 methods all can meet the requirement of molecular marker detection.%用4种方法对小麦基因组DNA进行提取,采用琼脂糖凝胶电泳法和核酸蛋白分析仪比较DNA的浓度和质量,结果显示,4种DNA提取方法在DNA浓度上有所差别,方法一所提取的DNA浓度最高,但消耗试剂最多;方法二所提取的DNA浓度最低,有蛋白质污染,但过程简单;方法三和方法四所提取的DNA浓度相当,方法三有蛋白质污染,过程简单,方法四纯度高,过程最复杂.采用同一对引物和反应体系对所提取的DNA进行PCR扩增,结果显示4种方法所提取的基因组DNA均能满足分子标记检测的需要.

  16. Starch facilitates enzymatic wheat gluten hydrolysis

    NARCIS (Netherlands)

    Hardt, N.A.; Boom, R.M.; Goot, van der A.J.

    2015-01-01

    Wheat gluten can be hydrolyzed by either using (vital) wheat gluten or directly from wheat flour. This study investigates the influence of the presence of starch, the main component of wheat, on enzymatic wheat gluten hydrolysis. Wheat gluten present in wheat flour (WFG) and vital wheat gluten (VWG)

  17. Starch facilitates enzymatic wheat gluten hydrolysis

    NARCIS (Netherlands)

    Hardt, N.A.; Boom, R.M.; Goot, van der A.J.

    2015-01-01

    Wheat gluten can be hydrolyzed by either using (vital) wheat gluten or directly from wheat flour. This study investigates the influence of the presence of starch, the main component of wheat, on enzymatic wheat gluten hydrolysis. Wheat gluten present in wheat flour (WFG) and vital wheat gluten (VWG)

  18. Generation of amphidiploids from hybrids of wheat and related species from the genera Aegilops, Secale, Thinopyrum, and Triticum as a source of genetic variation for wheat improvement.

    Science.gov (United States)

    Nemeth, Csilla; Yang, Cai-yun; Kasprzak, Paul; Hubbart, Stella; Scholefield, Duncan; Mehra, Surbhi; Skipper, Emma; King, Ian; King, Julie

    2015-02-01

    We aim to improve diversity of domesticated wheat by transferring genetic variation for important target traits from related wild and cultivated grass species. The present study describes the development of F1 hybrids between wheat and related species from the genera Aegilops, Secale, Thinopyrum, and Triticum and production of new amphidiploids. Amphidiploid lines were produced from 20 different distant relatives. Both colchicine and caffeine were successfully used to double the chromosome numbers. The genomic constitution of the newly formed amphidiploids derived from seven distant relatives was determined using genomic in situ hybridization (GISH). Altogether, 42 different plants were analysed, 19 using multicolour GISH separating the chromosomes from the A, B, and D genomes of wheat, as well as the distant relative, and 23 using single colour GISH. Restructuring of the allopolyploid genome, both chromosome losses and aneuploidy, was detected in all the genomes contained by the amphidiploids. From the observed chromosome numbers there is an indication that in amphidiploids the B genome of wheat suffers chromosome losses less frequently than the other wheat genomes. Phenotyping to realize the full potential of the wheat-related grass germplasm is underway, linking the analyzed genotypes to agronomically important target traits.

  19. Alterations and abnormal mitosis of wheat chromosomes induced by wheat-rye monosomic addition lines.

    Directory of Open Access Journals (Sweden)

    Shulan Fu

    Full Text Available BACKGROUND: Wheat-rye addition lines are an old topic. However, the alterations and abnormal mitotic behaviours of wheat chromosomes caused by wheat-rye monosomic addition lines are seldom reported. METHODOLOGY/PRINCIPAL FINDINGS: Octoploid triticale was derived from common wheat T. aestivum L. 'Mianyang11'×rye S. cereale L. 'Kustro' and some progeny were obtained by the controlled backcrossing of triticale with 'Mianyang11' followed by self-fertilization. Genomic in situ hybridization (GISH using rye genomic DNA and fluorescence in situ hybridization (FISH using repetitive sequences pAs1 and pSc119.2 as probes were used to analyze the mitotic chromosomes of these progeny. Strong pSc119.2 FISH signals could be observed at the telomeric regions of 3DS arms in 'Mianyang11'. However, the pSc119.2 FISH signals were disappeared from the selfed progeny of 4R monosomic addition line and the changed 3D chromosomes could be transmitted to next generation stably. In one of the selfed progeny of 7R monosomic addition line, one 2D chromosome was broken and three 4A chromosomes were observed. In the selfed progeny of 6R monosomic addition line, structural variation and abnormal mitotic behaviour of 3D chromosome were detected. Additionally, 1A and 4B chromosomes were eliminated from some of the progeny of 6R monosomic addition line. CONCLUSIONS/SIGNIFICANCE: These results indicated that single rye chromosome added to wheat might cause alterations and abnormal mitotic behaviours of wheat chromosomes and it is possible that the stress caused by single alien chromosome might be one of the factors that induced karyotype alteration of wheat.

  20. Floral Transformation of Wheat

    Science.gov (United States)

    Agarwal, Sujata; Loar, Star; Steber, Camille; Zale, Janice

    A method is described for the floral transformation of wheat using a protocol similar to the floral dip of Arabidopsis. This method does not employ tissue culture of dissected embryos, but instead pre-anthesis spikes with clipped florets at the early, mid to late uninucleate microspore stage are dipped in Agrobacterium infiltration media harboring a vector carrying anthocyanin reporters and the NPTII selectable marker. T1 seeds are examined for color changes induced in the embryo by the anthocyanin reporters. Putatively transformed seeds are germinated and the seedlings are screened for the presence of the NPTII gene based on resistance to paromomycin spray and assayed with NPTII ELISAs. Genomic DNA of putative transformants is digested and analyzed on Southern blots for copy number to determine whether the T-DNA has integrated into the nucleus and to show the number of insertions. The non-optimized transformation efficiencies range from 0.3 to 0.6% (number of transformants/number of florets dipped) but the efficiencies are higher in terms of the number of transformants produced/number of seeds set ranging from 0.9 to 10%. Research is underway to maximize seed set and optimize the protocol by testing different Agrobacterium strains, visual reporters, vectors, and surfactants.

  1. Microsatellite-based molecular diversity of bread wheat germplasm and association mapping of wheat resistance to the Russian wheat aphid.

    Science.gov (United States)

    Peng, J H; Bai, Y; Haley, S D; Lapitan, N L V

    2009-01-01

    Genetic diversity of a set of 71 wheat accessions, including 53 biotype 2 Russian wheat aphid (RWA2)-resistant landraces and 18 RWA2 susceptible accessions, was assessed by examining molecular variation at multiple microsatellite (SSR) loci. Fifty-one wheat SSR primer pairs were used, 81 SSR loci were determined, and 545 SSR alleles were detected. These SSR loci covered all the three genomes, 21 chromosomes, and at least 41 of the 42 chromosome arms. Diversity values averaged over SSR loci were high with mean number of SSR alleles/locus = 6.7, mean Shannon's index (H) = 1.291, and mean Nei's gene diversity (He) = 0.609. The three wheat genomes ranked as A > D > B and the homoeologous groups ranked as 7 > 3 > 1 > 2 > 6 > 5 > 4 based on the number of alleles per locus. Xgwm136 on chromosome arm 1AS is the most polymorphic SSR locus with the largest number of observed and effective alleles and the highest H and He. Among all 2485 pairs of wheat accessions, genetic distance (GD) ranged from 0.054 to 1.933 and averaged 0.9832. A dendrogram based on GD matrix showed that all the wheat accessions could be grouped into distinct clusters. Most of the susceptible cultivars (13/18) were clustered into groups that contains all or mostly susceptible accessions. Most of the U.S. cultivars belong to a group that is distinguishable from all the different RWA2 resistant groups. Diversity analysis was also conducted separately for subgroups containing 53 RWA2-resistant accessions and 18 RWA2-susceptible accessions. Association mapping revealed 28 SSR loci significantly associated with leaf chlorosis, and 8 with leaf rolling. New chromosome regions associated with RWA2 resistance were detected, and indicated existence of new RWA resistance genes located on chromosomes of all other homoeologous groups in addition to the groups 1 and 7 in bread wheat. This information is helpful for development of mapping populations for RWA2 resistance genes from different phylogenetic groups, and for

  2. Alien DNA introgression and wheat DNA rearrangements in a stable wheat line derived from the early generation of distant hybridization

    Institute of Scientific and Technical Information of China (English)

    ZHANG Lianquan; LIU Dengcai; YAN Zehong; ZHENG Youliang

    2005-01-01

    Polyploidy has been found to be common in plants. Bread or common wheat (Triticum aestivum L., 2n = 42) is a good example of allopolyploid made up of three diploid genomes A, B and D. In recent years, by the study of mimicking the origination of common wheat, it was found that changes of DNA sequence and gene expression occurred at the early stages of artificial allohexaploid between tetraploid wheat and Aegilops tauschii, which was probably favorable to genetic diploidization of new synthetic hexaploid wheat. Common wheat 99L2 is a new line stable in genetic, which was derived from the early self-pollinated generation of wide hybrids between common wheat and rye. In this study, it was found that at least two rye DNA segments had been introgressed into 99L2. This result suggested that a mechanism of alien DNA introgression may exist, which was different from the traditional mechanism of chromosome pairing and DNA recombination between wheat and alien species. Meanwhile, during the introgression process of alien rye DNA segments, the changes in DNA sequences of wheat itself occurred.

  3. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Science.gov (United States)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  4. Fusarium head blight resistance loci in a stratified population of wheat landraces and varieties

    Science.gov (United States)

    To determine if Chinese and Japanese wheat landraces and varieties have unique sources of Fusarium head blight (FHB) resistance, an association mapping panel of 195 wheat accessions including both commercial varieties and landraces was genotyped with 364 genome-wide simple sequence repeat (SSR) and ...

  5. Fast neutron radiation induced Glu-B1 deficient lines of an elite bread wheat variety

    Science.gov (United States)

    Five isogenic wheat lines deficient in high-molecular weight subunit (HMW-GS) proteins encoded by the B-genome were identified from a fast-neutron radiation-mutagenized population of Summit, an elite variety of bread wheat (Triticum aestivum L.). The mutant lines differ from the wild-type progenit...

  6. Genetic diversity among synthetic hexaploid wheat accessions with resistance to several fungal diseases

    Science.gov (United States)

    Synthetic hexaploid wheat (SHW) is known to be an excellent vehicle for transferring large genetic variations especially the many useful traits present in the D genome of Aegilops tauschii Coss (2n=2x=14, DD) for improvement of cultivated wheat (Triticum aestivum L., 2n=6x=42, AABBDD). The objectiv...

  7. 21 CFR 137.195 - Crushed wheat.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Crushed wheat. 137.195 Section 137.195 Food and... Related Products § 137.195 Crushed wheat. Crushed wheat, coarse ground wheat, is the food prepared by so crushing cleaned wheat other than durum wheat and red durum wheat that, when tested by the method...

  8. MEASUREMENT OF WHEAT DENSITY

    Institute of Scientific and Technical Information of China (English)

    冯跟胜; 党金春; 等

    1995-01-01

    A method used for on line determining the change of wheat density with a automatic watering machine in a lqarge flour mill has been studied.The results show that the higher distinguishing ability is obtained when using 241Am as a γ-ray source for measuring the wheat density than using 137Cs.

  9. Genetic analysis of wheat domestication and evolution under domestication.

    Science.gov (United States)

    Peleg, Zvi; Fahima, Tzion; Korol, Abraham B; Abbo, Shahal; Saranga, Yehoshua

    2011-10-01

    Wheat is undoubtedly one of the world's major food sources since the dawn of Near Eastern agriculture and up to the present day. Morphological, physiological, and genetic modifications involved in domestication and subsequent evolution under domestication were investigated in a tetraploid recombinant inbred line population, derived from a cross between durum wheat and its immediate progenitor wild emmer wheat. Experimental data were used to test previous assumptions regarding a protracted domestication process. The brittle rachis (Br) spike, thought to be a primary characteristic of domestication, was mapped to chromosome 2A as a single gene, suggesting, in light of previously reported Br loci (homoeologous group 3), a complex genetic model involved in spike brittleness. Twenty-seven quantitative trait loci (QTLs) conferring threshability and yield components (kernel size and number of kernels per spike) were mapped. The large number of QTLs detected in this and other studies suggests that following domestication, wheat evolutionary processes involved many genomic changes. The Br gene did not show either genetic (co-localization with QTLs) or phenotypic association with threshability or yield components, suggesting independence of the respective loci. It is argued here that changes in spike threshability and agronomic traits (e.g. yield and its components) are the outcome of plant evolution under domestication, rather than the result of a protracted domestication process. Revealing the genomic basis of wheat domestication and evolution under domestication, and clarifying their inter-relationships, will improve our understanding of wheat biology and contribute to further crop improvement.

  10. Hybrid breeding in wheat: technologies to improve hybrid wheat seed production.

    Science.gov (United States)

    Whitford, Ryan; Fleury, Delphine; Reif, Jochen C; Garcia, Melissa; Okada, Takashi; Korzun, Viktor; Langridge, Peter

    2013-12-01

    Global food security demands the development and delivery of new technologies to increase and secure cereal production on finite arable land without increasing water and fertilizer use. There are several options for boosting wheat yields, but most offer only small yield increases. Wheat is an inbred plant, and hybrids hold the potential to deliver a major lift in yield and will open a wide range of new breeding opportunities. A series of technological advances are needed as a base for hybrid wheat programmes. These start with major changes in floral development and architecture to separate the sexes and force outcrossing. Male sterility provides the best method to block self-fertilization, and modifying the flower structure will enhance pollen access. The recent explosion in genomic resources and technologies provides new opportunities to overcome these limitations. This review outlines the problems with existing hybrid wheat breeding systems and explores molecular-based technologies that could improve the hybrid production system to reduce hybrid seed production costs, a prerequisite for a commercial hybrid wheat system.

  11. Assessment of the relationship between pre-chip and post-chip quality measures for Affymetrix GeneChip expression data

    Directory of Open Access Journals (Sweden)

    Augood Sarah J

    2006-04-01

    Full Text Available Abstract Background Gene expression microarray experiments are expensive to conduct and guidelines for acceptable quality control at intermediate steps before and after the samples are hybridised to chips are vague. We conducted an experiment hybridising RNA from human brain to 117 U133A Affymetrix GeneChips and used these data to explore the relationship between 4 pre-chip variables and 22 post-chip outcomes and quality control measures. Results We found that the pre-chip variables were significantly correlated with each other but that this correlation was strongest between measures of RNA quality and cRNA yield. Post-mortem interval was negatively correlated with these variables. Four principal components, reflecting array outliers, array adjustment, hybridisation noise and RNA integrity, explain about 75% of the total post-chip measure variability. Two significant canonical correlations existed between the pre-chip and post-chip variables, derived from MAS 5.0, dChip and the Bioconductor packages affy and affyPLM. The strongest (CANCOR 0.838, p Conclusion We have found that the post-chip variables having the strongest association with quantities measurable before hybridisation are those reflecting RNA integrity. Other aspects of quality, such as noise measures (reflecting the execution of the assay or measures reflecting data quality (outlier status and array adjustment variables are not well predicted by the variables we were able to determine ahead of time. There could be other variables measurable pre-hybridisation which may be better associated with expression data quality measures. Uncovering such connections could create savings on costly microarray experiments by eliminating poor samples before hybridisation.

  12. Integrating multiple genome annotation databases improves the interpretation of microarray gene expression data

    Directory of Open Access Journals (Sweden)

    Kennedy Breandan

    2010-01-01

    Full Text Available Abstract Background The Affymetrix GeneChip is a widely used gene expression profiling platform. Since the chips were originally designed, the genome databases and gene definitions have been considerably updated. Thus, more accurate interpretation of microarray data requires parallel updating of the specificity of GeneChip probes. We propose a new probe remapping protocol, using the zebrafish GeneChips as an example, by removing nonspecific probes, and grouping the probes into transcript level probe sets using an integrated zebrafish genome annotation. This genome annotation is based on combining transcript information from multiple databases. This new remapping protocol, especially the new genome annotation, is shown here to be an important factor in improving the interpretation of gene expression microarray data. Results Transcript data from the RefSeq, GenBank and Ensembl databases were downloaded from the UCSC genome browser, and integrated to generate a combined zebrafish genome annotation. Affymetrix probes were filtered and remapped according to the new annotation. The influence of transcript collection and gene definition methods was tested using two microarray data sets. Compared to remapping using a single database, this new remapping protocol results in up to 20% more probes being retained in the remapping, leading to approximately 1,000 more genes being detected. The differentially expressed gene lists are consequently increased by up to 30%. We are also able to detect up to three times more alternative splicing events. A small number of the bioinformatics predictions were confirmed using real-time PCR validation. Conclusions By combining gene definitions from multiple databases, it is possible to greatly increase the numbers of genes and splice variants that can be detected in microarray gene expression experiments.

  13. Genetic rearrangements of six wheat-agropyron cristatum 6P addition lines revealed by molecular markers.

    Directory of Open Access Journals (Sweden)

    Haiming Han

    Full Text Available Agropyron cristatum (L. Gaertn. (2n = 4x = 28, PPPP not only is cultivated as pasture fodder but also could provide many desirable genes for wheat improvement. It is critical to obtain common wheat-A. cristatum alien disomic addition lines to locate the desired genes on the P genome chromosomes. Comparative analysis of the homoeologous relationships between the P genome chromosome and wheat genome chromosomes is a key step in transferring different desirable genes into common wheat and producing the desired alien translocation line while compensating for the loss of wheat chromatin. In this study, six common wheat-A. cristatum disomic addition lines were produced and analyzed by phenotypic examination, genomic in situ hybridization (GISH, SSR markers from the ABD genomes and STS markers from the P genome. Comparative maps, six in total, were generated and demonstrated that all six addition lines belonged to homoeologous group 6. However, chromosome 6P had undergone obvious rearrangements in different addition lines compared with the wheat chromosome, indicating that to obtain a genetic compensating alien translocation line, one should recombine alien chromosomal regions with homoeologous wheat chromosomes. Indeed, these addition lines were classified into four types based on the comparative mapping: 6PI, 6PII, 6PIII, and 6PIV. The different types of chromosome 6P possessed different desirable genes. For example, the 6PI type, containing three addition lines, carried genes conferring high numbers of kernels per spike and resistance to powdery mildew, important traits for wheat improvement. These results may prove valuable for promoting the development of conventional chromosome engineering techniques toward molecular chromosome engineering.

  14. High Transferability of Homoeolog-Specific Markers between Bread Wheat and Newly Synthesized Hexaploid Wheat Lines

    Science.gov (United States)

    Zeng, Deying; Luo, Jiangtao; Li, Zenglin; Chen, Gang; Zhang, Lianquan; Ning, Shunzong; Yuan, Zhongwei; Zheng, Youliang; Hao, Ming; Liu, Dengcai

    2016-01-01

    Bread wheat (Triticum aestivum, 2n = 6x = 42, AABBDD) has a complex allohexaploid genome, which makes it difficult to differentiate between the homoeologous sequences and assign them to the chromosome A, B, or D subgenomes. The chromosome-based draft genome sequence of the ‘Chinese Spring’ common wheat cultivar enables the large-scale development of polymerase chain reaction (PCR)-based markers specific for homoeologs. Based on high-confidence ‘Chinese Spring’ genes with known functions, we developed 183 putative homoeolog-specific markers for chromosomes 4B and 7B. These markers were used in PCR assays for the 4B and 7B nullisomes and their euploid synthetic hexaploid wheat (SHW) line that was newly generated from a hybridization between Triticum turgidum (AABB) and the wild diploid species Aegilops tauschii (DD). Up to 64% of the markers for chromosomes 4B or 7B in the SHW background were confirmed to be homoeolog-specific. Thus, these markers were highly transferable between the ‘Chinese Spring’ bread wheat and SHW lines. Homoeolog-specific markers designed using genes with known functions may be useful for genetic investigations involving homoeologous chromosome tracking and homoeolog expression and interaction analyses. PMID:27611704

  15. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    Indian Academy of Sciences (India)

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  16. Combining ability and heterosis effect in hexaploid wheat group

    Directory of Open Access Journals (Sweden)

    Titan Primož

    2012-01-01

    Full Text Available The main goal of hybrid wheat breeding is the identification of parents with high specific combining ability for grain yield and other agronomic traits. This kind of data facilitate the development of hybrid combinations with high level of heterosis in first filial generation (F1 generation. The use of species from the hexaploid wheat group (e.g. Triticum spelta L. Triticum compactum HOST... is representing an opportunity for the increase of heterosis level in the germplasm of common wheat (Triticum aestivum L.. The study of combining ability and heterosis effect in hexaploid wheat group was carried out using crosses between thirteen inbred lines of common wheat (6 lines x 7 testers and inter-species crosses (T. aestivum L. × T. spelta L., T. aestivum L. × T. compactum HOST, T. aestivum L. × T. sphaerococcum PERCIV., T. aestivum L. × T. macha DEKAPR. et MENABDE, T. aestivum L. × T. petropavlovskyi UDACZ. et MIGUSCH, T. aestivum L. × T. vavilovii (THUM. JAKUBZ.. The 42 common wheat F1 hybrids were tested during two seasons (2010/11 and 2011/12 on the Selection center Ptuj. The experiment was carried out in a randomized block design with four replications. The 43 interspecies F1 hybrids were tested on the same location in the season 2011/12 and the experiment was designed as an randomized block with three replications. The results were analyzed using statistical package AGROBASE generation II and STATGRAPHICS Centurion XVI. The analysis of variance was significant for both, GCA and SCA variances (P < 0,01. Generally, SCA variances were lower than GCA variances. We could state, that the improvement of heterosis level in the common wheat germplasm through the use of relatives with the same genome (genome BAD is possible. As an example we can point out the interspecies F1 hybrid between common wheat variety Garcia and an accession of the Triticum sphaerococcum PERCIV. species (accession number 01C0201227.

  17. Current status and trends of wheat genetic transformation studies in China

    Institute of Scientific and Technical Information of China (English)

    HE Yi; WANG Qiong; ZENG Jian; SUN Tao; YANG Guang-xiao; HE Guang-yuan

    2015-01-01

    More than 20 years have passed since the ifrst report on successful genetic transformation of wheat. With the establishment and improvement of transformation platform, great progresses have been made on wheat genetic transformation both on its fundamental and applied studies in China, especial y driven by the National Major Project for Transgenic Organism Breed-ing, China, initiated in 2008. In this review, wheat genetic transformation platform improvement and transgenic research progresses including new techniques applied and functional studies of wheat quality, yield and stress tolerant related genes and biosafety assessment are summarized. The existing problems and the trends in wheat transformation with traditional methods combined with genomic studies and genome editing technology are also discussed.

  18. Beta-amylase gene variability in introgressive wheat lines.

    Science.gov (United States)

    Antonyuk, Maksym; Navalikhina, Anastasiia; Ternovska, Tamara

    2017-05-01

    Variability of the beta-amylase gene in bread wheat, artificial amphidiploids, and derived introgression wheat lines was analyzed. Variation in homeologous beta-amylase sequences caused by the presence of MITE (Miniature Inverted-Repeat Transposable Element) and its footprint has been identified in bread wheat. The previously unknown location of MITE in Triticum urartu and T. aestivum L. beta-amylase gene has been found. These species have a MITE sequence in the third intron of beta-amylase, as opposed to Aegilops comosa and a number of other Triticeae species, which have it in the fourth intron. These two MITEs from Ae. comosa and T. aestivum were shown to have low identity scores. Miosa, an artificial amphidiploid, which has the M genome from Ae. comosa was shown to lose the MITE sequences. This loss might be caused by genomic shock due to allopolyploidization.

  19. A wheat homologue of PHYTOCLOCK 1 is a candidate gene conferring the early heading phenotype to einkorn wheat.

    Science.gov (United States)

    Mizuno, Nobuyuki; Nitta, Miyuki; Sato, Kazuhiro; Nasuda, Shuhei

    2012-01-01

    An X-ray mutant showing an early flowering phenotype has been identified in einkorn wheat (Triticum monococcum L.), for which a major QTL for heading time was previously mapped in the telomeric region on the long arm of chromosome 3A. Recent advances in Triticeae genomics revealed that the gene order in this region is highly conserved between wheat and barley. Thus, we adopted a hypothetical gene order in barley, the so-called GenomeZipper, to develop DNA markers for fine mapping the target gene in wheat. We identified three genes tightly linked to the early heading phenotype. PCR analysis revealed that early-flowering is associated with the deletion of two genes in the mutant. Of the two deleted genes, one is an ortholog of the LUX ARRHYTHMO (LUX)/PHYTOCLOCK 1 (PCL1) gene found in Arabidopsis, which regulates the circadian clock and flowering time. We found distorted expression patterns of two clock genes (TOC1 and LHY) in the einkorn pcl1 deletion mutant as was reported for the Arabidopsis lux mutant. Transcript accumulation levels of photoperiod-response related genes, a photoperiod sensitivity gene (Ppd-1) and two wheat CONSTANS-like genes (WCO1 and TaHd1), were significantly higher in the einkorn wheat mutant. In addition, transcripts of the wheat florigen gene (WFT) accumulated temporally under short-day conditions in the einkorn wheat mutant. These results suggest that deletion of WPCL1 leads to abnormally higher expression of Ppd-1, resulting in the accumulation of WFT transcripts that triggers flowering even under short-day conditions. Our observations from gene mapping, gene deletions, and expression levels of flowering related genes strongly suggest that WPCL1 is the most likely candidate gene for controlling the early flowering phenotype in the einkorn wheat mutant.

  20. Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat.

    KAUST Repository

    Leach, Lindsey J

    2014-04-11

    BACKGROUND: Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution \\'nullisomic-tetrasomic\\' lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. RESULTS: We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. CONCLUSIONS: We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution.

  1. Homoeologous gene silencing in tissue cultured wheat callus

    Directory of Open Access Journals (Sweden)

    Chapman Natalie H

    2008-10-01

    Full Text Available Abstract Background In contrast to diploids, most polyploid plant species, which include the hexaploid bread wheat, possess an additional layer of epigenetic complexity. Several studies have demonstrated that polyploids are affected by homoeologous gene silencing, a process in which sub-genomic genomic copies are selectively transcriptionally inactivated. This form of silencing can be tissue specific and may be linked to developmental or stress responses. Results Evidence was sought as to whether the frequency of homoeologous silencing in in vitro cultured wheat callus differ from that in differentiated organs, given that disorganized cells are associated with a globally lower level of DNA methylation. Using a reverse transcription PCR (RT-PCR single strand conformation polymorphism (SSCP platform to detect the pattern of expression of 20 homoeologous sets of single-copy genes known to be affected by this form of silencing in the root and/or leaf, we observed no silencing in any of the wheat callus tissue tested. Conclusion Our results suggest that much of the homoeologous silencing observed in differentiated tissues is probably under epigenetic control, rather than being linked to genomic instability arising from allopolyploidization. This study reinforces the notion of plasticity in the wheat epi-genome.

  2. 21 CFR 137.190 - Cracked wheat.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cracked wheat. 137.190 Section 137.190 Food and... Related Products § 137.190 Cracked wheat. Cracked wheat is the food prepared by so cracking or cutting into angular fragments cleaned wheat other than durum wheat and red durum wheat that, when tested by...

  3. Wheat for Kids! [and] Teacher's Guide.

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    "Wheat for Kids" contains information at the elementary school level about: the structure of the wheat kernel; varieties of wheat and their uses; growing wheat; making wheat dough; the U.S. Department of Agriculture Food Guide Pyramid and nutrition; Idaho's part of the international wheat market; recipes; and word games based on the…

  4. Wheat for Kids! [and] Teacher's Guide.

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    "Wheat for Kids" contains information at the elementary school level about: the structure of the wheat kernel; varieties of wheat and their uses; growing wheat; making wheat dough; the U.S. Department of Agriculture Food Guide Pyramid and nutrition; Idaho's part of the international wheat market; recipes; and word games based on the…

  5. A new class of wheat gliadin genes and proteins.

    Directory of Open Access Journals (Sweden)

    Olin D Anderson

    Full Text Available The utility of mining DNA sequence data to understand the structure and expression of cereal prolamin genes is demonstrated by the identification of a new class of wheat prolamins. This previously unrecognized wheat prolamin class, given the name δ-gliadins, is the most direct ortholog of barley γ3-hordeins. Phylogenetic analysis shows that the orthologous δ-gliadins and γ3-hordeins form a distinct prolamin branch that existed separate from the γ-gliadins and γ-hordeins in an ancestral Triticeae prior to the branching of wheat and barley. The expressed δ-gliadins are encoded by a single gene in each of the hexaploid wheat genomes. This single δ-gliadin/γ3-hordein ortholog may be a general feature of the Triticeae tribe since examination of ESTs from three barley cultivars also confirms a single γ3-hordein gene. Analysis of ESTs and cDNAs shows that the genes are expressed in at least five hexaploid wheat cultivars in addition to diploids Triticum monococcum and Aegilops tauschii. The latter two sequences also allow assignment of the δ-gliadin genes to the A and D genomes, respectively, with the third sequence type assumed to be from the B genome. Two wheat cultivars for which there are sufficient ESTs show different patterns of expression, i.e., with cv Chinese Spring expressing the genes from the A and B genomes, while cv Recital has ESTs from the A and D genomes. Genomic sequences of Chinese Spring show that the D genome gene is inactivated by tandem premature stop codons. A fourth δ-gliadin sequence occurs in the D genome of both Chinese Spring and Ae. tauschii, but no ESTs match this sequence and limited genomic sequences indicates a pseudogene containing frame shifts and premature stop codons. Sequencing of BACs covering a 3 Mb region from Ae. tauschii locates the δ-gliadin gene to the complex Gli-1 plus Glu-3 region on chromosome 1.

  6. A LTR copia retrotransposon and Mutator transposons interrupt Pgip genes in cultivated and wild wheats.

    Science.gov (United States)

    Di Giovanni, Michela; Cenci, Alberto; Janni, Michela; D'Ovidio, Renato

    2008-04-01

    Polygalacturonase-inhibiting proteins (PGIPs) are leucine-rich repeat (LRR) proteins involved in plant defence. Wheat pgip genes have been isolated from the B (Tapgip1) and D (Tapgip2) genomes, and now we report the identification of pgip genes from the A genomes of wild and cultivated wheats. By Southern blots and sequence analysis of BAC clones we demonstrated that wheat contains a single copy pgip gene per genome and the one from the A genome, pgip3, is inactivated by the insertion of a long terminal repeat copia retrotranspon within the fourth LRR. We demonstrated also that this retrotransposon insertion is present in Triticum urartu and all the polyploidy wheats assayed, but is absent in T. monococcum (Tmpgip3), suggesting that this insertion took place after the divergence between T. monococcum and T. urartu, but before the formation of the polyploid wheats. We identified also two independent insertion events of new Class II transposable elements, Vacuna, belonging to the Mutator superfamily, that interrupted the Tdipgip1 gene of T. turgidum ssp. dicoccoides. The occurrence of these transposons within the coding region of Tdipgip1 facilitated the mapping of the Pgip locus in the pericentric region of the short arm of chromosome group 7. We speculate that the inactivation of pgip genes are tolerated because of redundancy of PGIP activities in the wheat genome.

  7. Wheat Production and Economics

    Directory of Open Access Journals (Sweden)

    Elgilany Ahmed

    2011-01-01

    Full Text Available Problem statement: The crop in the irrigated scheme has faced by manifold problems contributed to low level of productivity and high cost of production of wheat. The crop is commonly produced under pump irrigation from the River Nile. In River Nile State (RNS, wheat is grown under the irrigated sector, the State is considered as a suitable environment for producing this crop. The study was conducted at Elzeidab irrigated scheme of RNS which is regarded as the oldest and biggest scheme belonging to the Ministry of Agriculture of RNS. Approach: Primary data was collected by using structured questionnaire for (70 randomly selected respondents. More than one technique used to assess economic aspects of the crop. Cobb-Douglas production function, descriptive statistics and partial budgeting have been employed to analyze the primary data. The study detected that the major socioeconomic characteristics of Elzeidab farmers were educated, the scheme tenants have had a cumulative experience in agriculture and average farm size is found to be small and the majority 50% of surveyed tenants in Elzeidab scheme were rented. The farming system of Elzeidab scheme is dominated by wheat production which counts to 25% of the farm land. The yield gab with the potential yield obtained by Agricultural Research Corporation (ARC in the State amounts 66%. The microfinance market in Elzeidab scheme is not well developed. Water charges in the scheme were high. About 53% of the annual running expenses were allocated for fuel that made irrigation costs to be the highest single component of production costs of the crop, while irrigation water cost was considered as the most agricultural constraint, this item was found to be as 19% of the total cost of production as the highest percentage overall the variable cost items. Results: The regression analysis revealed that the most factors affecting wheat productivity under the study were: the average of tenants age, family labor

  8. Wheat Quality Council, Hard Spring Wheat Technical Committee, 2015 Crop

    Science.gov (United States)

    Nine experimental lines of hard spring wheat were grown at up to five locations in 2015 and evaluated for kernel, milling, and bread baking quality against the check variety Glenn. Wheat samples were submitted through the Wheat Quality Council and processed and milled at the USDA-ARS Hard Red Sprin...

  9. New Uses for Wheat and Modified Wheat Products

    Science.gov (United States)

    Hard wheat from the Great Plains historically has been used as a source of flour for the production of leavened bakery products. However, potentially applications of wheat in both new markets and new products has necessitated the need to develop wheats with novel processing attributes. The most lo...

  10. Expression of a potato antimicrobial peptide SN1 increases resistance to take-all pathogen Gaeumannomyces graminis var. tritici in transgenic wheat.

    Science.gov (United States)

    Rong, Wei; Qi, Lin; Wang, Jingfen; Du, Lipu; Xu, Huijun; Wang, Aiyun; Zhang, Zengyan

    2013-08-01

    Take-all, caused by soil-borne fungus Gaeumannomyces graminis var. tritici (Ggt), is a devastating root disease of wheat (Triticum aestivum) worldwide. Breeding resistant wheat cultivars is the most promising and reliable approach to protect wheat from take-all. Currently, no resistant wheat germplasm is available to breed cultivars using traditional methods. In this study, gene transformation was carried out using Snakin-1 (SN1) gene isolated from potato (Solanum tuberosum) because the peptide shows broad-spectrum antimicrobial activity in vitro. Purified SN1 peptide also inhibits in vitro the growth of Ggt mycelia. By bombardment-mediated method, the gene SN1 was transformed into Chinese wheat cultivar Yangmai 18 to generate SN1 transgenic wheat lines, which were used to assess the effectiveness of the SN1 peptide in protecting wheat from Ggt. Genomic PCR and Southern blot analyses indicated that the alien gene SN1 was integrated into the genomes of five transgenic wheat lines and heritable from T₀ to T₄ progeny. Reverse transcription-PCR and Western blot analyses showed that the introduced SN1 gene was transcribed and highly expressed in the five transgenic wheat lines. Following challenging with Ggt, disease test results showed that compared to segregants lacking the transgene and untransformed wheat plants, these five transgenic wheat lines expressing SN1 displayed significantly enhanced resistance to take-all. These results suggest that SN1 may be a potentially transgenic tool for improving the take-all resistance of wheat.

  11. PESTICIDES EFFICIENCY IN WHEAT PRODUCTION

    OpenAIRE

    2009-01-01

    It is suggested that the Karate Zeon insecticide is highly effective in wheat protection against pests. The profitability of soft spring wheat production with the above preparation used is about 176%. The economic effect of Karate Zeon is the same as that of Krezatsin, Mival and TMTD Plus preparations that are used for wheat seeds treatment against plant diseases

  12. Functional characterisation of wheat Pgip genes reveals their involvement in the local response to wounding.

    Science.gov (United States)

    Janni, M; Bozzini, T; Moscetti, I; Volpi, C; D'Ovidio, R

    2013-11-01

    Polygalacturonase-inhibiting proteins (PGIPs) are cell wall leucine-rich repeat (LRR) proteins involved in plant defence. The hexaploid wheat (Triticum aestivum, genome AABBDD) genome contains one Pgip gene per genome. Tapgip1 (B genome) and Tapgip2 (D genome) are expressed in all tissues, whereas Tapgip3 (A genome) is inactive because of a long terminal repeat, Copia retrotransposon insertion within the coding region. To verify whether Tapgip1 and Tapgip2 encode active PGIPs and are involved in the wheat defence response, we expressed them transiently and analysed their expression under stress conditions. Neither TaPGIP1 nor TaPGIP2 showed inhibition activity in vitro against fungal polygalacturonases. Moreover, a wheat genotype (T. turgidum ssp. dicoccoides) lacking active homologues of Tapgip1 or Tapgip2 possesses PGIP activity. At transcript level, Tapgip1 and Tapgip2 were both up-regulated after fungal infection and strongly induced following wounding. This latter result has been confirmed in transgenic wheat plants expressing the β-glucuronidase (GUS) gene under control of the 5'-flanking region of Tdpgip1, a homologue of Tapgip1 with an identical sequence. Strong and transient GUS staining was mainly restricted to the damaged tissues and was not observed in adjacent tissues. Taken together, these results suggest that Tapgips and their homologues are involved in the wheat defence response by acting at the site of the lesion caused by pathogen infection.

  13. Transgenic expression of lactoferrin imparts enhanced resistance to head blight of wheat caused by Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Han Jigang

    2012-03-01

    Full Text Available Abstract Background The development of plant gene transfer systems has allowed for the introgression of alien genes into plant genomes for novel disease control strategies, thus providing a mechanism for broadening the genetic resources available to plant breeders. Using the tools of plant genetic engineering, a broad-spectrum antimicrobial gene was tested for resistance against head blight caused by Fusarium graminearum Schwabe, a devastating disease of wheat (Triticum aestivum L. and barley (Hordeum vulgare L. that reduces both grain yield and quality. Results A construct containing a bovine lactoferrin cDNA was used to transform wheat using an Agrobacterium-mediated DNA transfer system to express this antimicrobial protein in transgenic wheat. Transformants were analyzed by Northern and Western blots to determine lactoferrin gene expression levels and were inoculated with the head blight disease fungus F. graminearum. Transgenic wheat showed a significant reduction of disease incidence caused by F. graminearum compared to control wheat plants. The level of resistance in the highly susceptible wheat cultivar Bobwhite was significantly higher in transgenic plants compared to control Bobwhite and two untransformed commercial wheat cultivars, susceptible Wheaton and tolerant ND 2710. Quantification of the expressed lactoferrin protein by ELISA in transgenic wheat indicated a positive correlation between the lactoferrin gene expression levels and the levels of disease resistance. Conclusions Introgression of the lactoferrin gene into elite commercial wheat, barley and other susceptible cereals may enhance resistance to F. graminearum.

  14. Thermoformed wheat gluten biopolymers.

    Science.gov (United States)

    Pallos, Ferenc M; Robertson, George H; Pavlath, Attila E; Orts, William J

    2006-01-25

    The quantity of available wheat gluten exceeds the current food use markets. Thermoforming is an alternative technical means for transforming wheat gluten. Thermoforming was applied here to wheat gluten under chemically reductive conditions to form pliable, translucent sheets. A wide variety of conditions, i.e., temperature, reducing agents, plasticizers and additives were tested to obtain a range of elastic properties in the thermoformed sheets. These properties were compared to those of commercially available polymers, such as polypropylene. Elasticity of the gluten formulations were indexed by Young's modulus and were in the range measured for commercial products when tested in the 30-70% relative humidity range. Removal of the gliadin subfraction of gluten yielded polymers with higher Young's modulus since this component acts as a polymer-chain terminator. At relative humidity less than 30% all whole gluten-based sheets were brittle, while above 70% they were highly elastic.

  15. Polymorphism of microsatellite loci in bread wheat (Triticum aestivum L. and related species

    Directory of Open Access Journals (Sweden)

    Kondić-Špika Ankica Đ.

    2016-01-01

    Full Text Available This study analysed polymorphism of 15 microsatellite loci in the col­lection comprising of 40 genotypes of bread wheat (Triticum aestivum L., 32 genotypes belonging to other species within Triticum genus and 3 genotypes from Aegilops genus. The results showed significant differences in the variability of the tested loci in bread wheat and related species. In the collection of bread wheat genotypes, 119 alleles were detected with the average number of 7.9 alleles per locus. In wild and cultivated related species 157 alleles were identified, with the average of 10.5 alleles per locus. All analysed parameters of micro­satellite loci variability (PIC value, gene diversity, heterozygosity, etc. indicated higher level of polymorphism in wild relatives than in the cultivated bread wheat. Analyses of individual genomes indicated that in the bread wheat genetic diversity of the B and D genomes was significantly reduced in relation to the A genome, while the differences in polymorphism between genomes in the wild relatives were significantly lower. The results showed that wild related species can be used as sources for new variability in wheat breeding. [Project of the Serbian Ministry of Education, Science and Technological Development

  16. Wheat allergy: diagnosis and management

    Directory of Open Access Journals (Sweden)

    Cianferoni A

    2016-01-01

    Full Text Available Antonella Cianferoni Department of Pediatrics, Division of Allergy and Immunology, The Children’s Hospital of Philadelphia, PA, USA Abstract: Triticum aestivum (bread wheat is the most widely grown crop worldwide. In genetically predisposed individuals, wheat can cause specific immune responses. A food allergy to wheat is characterized by T helper type 2 activation which can result in immunoglobulin E (IgE and non-IgE mediated reactions. IgE mediated reactions are immediate, are characterized by the presence of wheat-specific IgE antibodies, and can be life-threatening. Non-IgE mediated reactions are characterized by chronic eosinophilic and lymphocytic infiltration of the gastrointestinal tract. IgE mediated responses to wheat can be related to wheat ingestion (food allergy or wheat inhalation (respiratory allergy. A food allergy to wheat is more common in children and can be associated with a severe reaction such as anaphylaxis and wheat-dependent, exercise-induced anaphylaxis. An inhalation induced IgE mediated wheat allergy can cause baker’s asthma or rhinitis, which are common occupational diseases in workers who have significant repetitive exposure to wheat flour, such as bakers. Non-IgE mediated food allergy reactions to wheat are mainly eosinophilic esophagitis (EoE or eosinophilic gastritis (EG, which are both characterized by chronic eosinophilic inflammation. EG is a systemic disease, and is associated with severe inflammation that requires oral steroids to resolve. EoE is a less severe disease, which can lead to complications in feeding intolerance and fibrosis. In both EoE and EG, wheat allergy diagnosis is based on both an elimination diet preceded by a tissue biopsy obtained by esophagogastroduodenoscopy in order to show the effectiveness of the diet. Diagnosis of IgE mediated wheat allergy is based on the medical history, the detection of specific IgE to wheat, and oral food challenges. Currently, the main treatment of a

  17. A high resolution radiation hybrid map of wheat chromosome 4A

    Science.gov (United States)

    Bread wheat has a large and complex allohexaploid genome with low recombination level at chromosome centromeric and peri-centromeric regions. This significantly hampers ordering of markers, contigs of physical maps and sequence scaffolds and impedes obtaining of high-quality reference genome sequenc...

  18. Chromosome engineering for alien gene introgression in wheat: Progress and prospective

    Science.gov (United States)

    Chromosome engineering is a useful strategy for introgression of desirable genes from wild relatives into cultivated wheat. However, it has been a challenge to transfer a small amount of alien chromatin containing the gene of interest from one genome to another non-homologous genome through classic...

  19. Application of Genechips Technology in Male Reproductive Medicine%高通量基因芯片技术在男性生殖医学研究中的应用

    Institute of Scientific and Technical Information of China (English)

    陈冠培; 赵永平; 金玲丽

    2013-01-01

    无精子症、少精子症、弱精子症、畸形精子症是男性生殖医学的重要课题,致病因素极其复杂.由基因异常引起精子发生异常导致男性不育的占30%以上.利用基因芯片技术迅速、高通量、大规模等优点,可以深入研究精子发生、精子功能异常以及生殖毒理学机制,为男性不育的预防、诊断与治疗提供更加明确的理论依据.%Azoospermia, oligozoospermia, asthenozoospermia and teratozoospermia are the important subjects of the male reproductive medicine. Although the causes are complicated, the abnormal spermatogenesis caused by genetic abnormalities accounted for more than 30% in male infertility. Because of their particular advantages in fast and quick gene analysis, genechips have be fully used in spermatogenesis, sperm dysfuction and reproductive toxicology. In this way, genechips bring solid support for the prevention, diagnosis and treatment of the male infertility.

  20. Durum wheat modeling

    DEFF Research Database (Denmark)

    Toscano, P.; Ranieri, R.; Matese, A.

    2012-01-01

    durum wheat during phenological development, at regional scale. We present an innovative system capable of predicting spatial yield variation and temporal yield fluctuation in long-term analysis, that are the main purposes of regional crop simulation study. The Delphi system was applied to simulate...... growth and yield of durum wheat in the major Italian supply basins (Basilicata, Capitanata, Marche, Tuscany). The model was validated and evaluated for three years (1995–1997) at 11 experimental fields and then used in operational mode for eleven years (1999–2009), showing an excellent/good accuracy...

  1. Genetic Relationships Among Five Basic Genomes St, E, A, B and D in Triticeae Revealed by Genomic Southern and in situ Hybridization

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The St and E are two important basic genomes in the perennial tribe Triticeae (Poaceae). They exist in many perennial species and are very closely related to the A, B and D genomes of bread wheat (Triticum aestivum L.). Genomic Southern hybridization and genomic in situ hybridization (GISH) were used to analyze the genomic relationships between the two genomes (St and E) and the three basic genomes (A, B and D) of T. aestivum. The semi-quantitative analysis of the Southern hybridization suggested that both St and E genomes are most closely related to the D genome, then the A genome, and relatively distant to the B genome. GISH analysis using St and E genomic DNA as probes further confirmed the conclusion.St and E are the two basic genomes of Thinopyrum ponticum (StStEeEbEx) and Th. intermedium (StEeEb), two perennial species successfully used in wheat improvement. Therefore, this paper provides a possible answer as to why most of the spontaneous wheat- Thinopyrum translocations and substitutions usually happen in the D genome, some in the A genome and rarely in the B genome. This would develop further use of alien species for wheat improvement, especially those containing St or E in their genome components.

  2. Wheat syntenome unveils new evidences of contrasted evolutionary plasticity between paleo- and neoduplicated subgenomes.

    Science.gov (United States)

    Pont, Caroline; Murat, Florent; Guizard, Sébastien; Flores, Raphael; Foucrier, Séverine; Bidet, Yannick; Quraishi, Umar Masood; Alaux, Michael; Doležel, Jaroslav; Fahima, Tzion; Budak, Hikmet; Keller, Beat; Salvi, Silvio; Maccaferri, Marco; Steinbach, Delphine; Feuillet, Catherine; Quesneville, Hadi; Salse, Jérôme

    2013-12-01

    Bread wheat derives from a grass ancestor structured in seven protochromosomes followed by a paleotetraploidization to reach a 12 chromosomes intermediate and a neohexaploidization (involving subgenomes A, B and D) event that finally shaped the 21 modern chromosomes. Insights into wheat syntenome in sequencing conserved orthologous set (COS) genes unravelled differences in genomic structure (such as gene conservation and diversity) and genetical landscape (such as recombination pattern) between ancestral as well as recent duplicated blocks. Contrasted evolutionary plasticity is observed where the B subgenome appears more sensitive (i.e. plastic) in contrast to A as dominant (i.e. stable) in response to the neotetraploidization and D subgenome as supra-dominant (i.e. pivotal) in response to the neohexaploidization event. Finally, the wheat syntenome, delivered through a public web interface PlantSyntenyViewer at http://urgi.versailles.inra.fr/synteny-wheat, can be considered as a guide for accelerated dissection of major agronomical traits in wheat.

  3. 21 CFR 184.1322 - Wheat gluten.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Wheat gluten. 184.1322 Section 184.1322 Food and... Substances Affirmed as GRAS § 184.1322 Wheat gluten. (a) Wheat gluten (CAS Reg. No. 8002-80-0) is the principal protein component of wheat and consists mainly of gliadin and glutenin. Wheat gluten is...

  4. Registration of 'Tiger' wheat

    Science.gov (United States)

    ‘Tiger’ hard white winter wheat (Triticum aestivum L.) was developed at Research Center-Hays, Kansas State University and released by Kansas Agricultural Experiment Station in 2010. Tiger was selected from a three-way cross KS98H245/’Trego’//KS98HW518 made in 1999 at Hays, KS. The objective of this ...

  5. Assessing batch effects of genotype calling algorithm BRLMM for the Affymetrix GeneChip Human Mapping 500 K array set using 270 HapMap samples

    OpenAIRE

    Kaput Jim; Han Tao; Chen James J; Xu Joshua; Fang Hong; Perkins Roger; Shi Leming; Ge Weigong; Su Zhenqiang; Hong Huixiao; Fuscoe James C; Tong Weida

    2008-01-01

    Abstract Background Genome-wide association studies (GWAS) aim to identify genetic variants (usually single nucleotide polymorphisms [SNPs]) across the entire human genome that are associated with phenotypic traits such as disease status and drug response. Highly accurate and reproducible genotype calling are paramount since errors introduced by calling algorithms can lead to inflation of false associations between genotype and phenotype. Most genotype calling algorithms currently used for GW...

  6. Wheat allergy: diagnosis and management.

    Science.gov (United States)

    Cianferoni, Antonella

    2016-01-01

    Triticum aestivum (bread wheat) is the most widely grown crop worldwide. In genetically predisposed individuals, wheat can cause specific immune responses. A food allergy to wheat is characterized by T helper type 2 activation which can result in immunoglobulin E (IgE) and non-IgE mediated reactions. IgE mediated reactions are immediate, are characterized by the presence of wheat-specific IgE antibodies, and can be life-threatening. Non-IgE mediated reactions are characterized by chronic eosinophilic and lymphocytic infiltration of the gastrointestinal tract. IgE mediated responses to wheat can be related to wheat ingestion (food allergy) or wheat inhalation (respiratory allergy). A food allergy to wheat is more common in children and can be associated with a severe reaction such as anaphylaxis and wheat-dependent, exercise-induced anaphylaxis. An inhalation induced IgE mediated wheat allergy can cause baker's asthma or rhinitis, which are common occupational diseases in workers who have significant repetitive exposure to wheat flour, such as bakers. Non-IgE mediated food allergy reactions to wheat are mainly eosinophilic esophagitis (EoE) or eosinophilic gastritis (EG), which are both characterized by chronic eosinophilic inflammation. EG is a systemic disease, and is associated with severe inflammation that requires oral steroids to resolve. EoE is a less severe disease, which can lead to complications in feeding intolerance and fibrosis. In both EoE and EG, wheat allergy diagnosis is based on both an elimination diet preceded by a tissue biopsy obtained by esophagogastroduodenoscopy in order to show the effectiveness of the diet. Diagnosis of IgE mediated wheat allergy is based on the medical history, the detection of specific IgE to wheat, and oral food challenges. Currently, the main treatment of a wheat allergy is based on avoidance of wheat altogether. However, in the near future immunotherapy may represent a valid way to treat IgE mediated reactions to

  7. Interorganellar DNA transfer in wheat: dynamics and phylogenetic origin

    Science.gov (United States)

    TSUNEWAKI, Koichiro

    2011-01-01

    A homology search of wheat chloroplast (ct) and mitochondrial (mt) genomes identified 54 ctDNA segments that have homology with 66 mtDNA segments. The mtDNA segments were classified according to their origin: orthologs (prokaryotic origin), xenologs (interorganellar DNA transfer origin) and paralogs (intraorganellar DNA amplification origin). The 66 mtDNA sequences with homology to ctDNA segments included 14 paralogs, 18 orthologs and 34 xenologs. Analysis of the xenologs indicated that the DNA transfer occurred unidirectionally from the ct genome to the mt genome. The evolutionary timing of each interorganellar DNA transfer that generated a xenolog was estimated. This analysis showed that 2 xenologs originated early in green plant evolution, 4 in angiosperm evolution, 3 in monocotyledon evolution, 9 during cereal diversification and 8 in the evolution of wheat. Six other xenologs showed recurrent transfer from the ct to mt genomes in more than one taxon. The two remaining xenologs were uninformative on the evolutionary timing of their transfer. The wheat mt nad9 gene was found to be chimeric, consisting of the cereal nad9 gene and its 291 bp 5′-flanking region that included a 58 bp xenolog of the ct-ndhC origin. PMID:21986316

  8. Breeding wheat for drought tolerance:Progress and technologies

    Institute of Scientific and Technical Information of China (English)

    Learnmore Mwadzingeni; Hussein Shimelis; Ernest Dube; Mark D Laing; Toi J Tsilo

    2016-01-01

    Recurrent drought associated with climate change is among the principal constraints to global productivity of wheat (Triticum aestivum (L.) andT. turgidum (L.)). Numerous efforts to mitigate drought through breeding resilient varieties are underway across the world. Progress is, however, hampered because drought tolerance is a complex trait that is controled by many genes and its ful expression is affected by the environment. Furthermore, wheat has a structuraly intricate and large genome. Consequently, breeding for drought tolerance requires the integration of various knowledge systems and methodologies from multiple disciplines in plant sciences. This review summarizes the progress made in dry land wheat improvement, advances in knowledge, complementary methodologies, and perspectives towards breeding for drought tolerance in the crop to create a coherent overview. Phenotypic, biochemical and genomics-assisted selection methodologies are discussed as leading research components used to exploit genetic variation. Advances in phenomic and genomic technologies are highlighted as options to circumvent existing bottlenecks in phenotypic and genomic selection, and gene transfer. The prospects of further integration of these technologies with other omics technologies are also provided.

  9. Reticulate Evolution of the Rye Genome

    OpenAIRE

    2013-01-01

    Rye (Secale cereale) is closely related to wheat (Triticum aestivum) and barley (Hordeum vulgare). Due to its large genome (similar to 8 Gb) and its regional importance, genome analysis of rye has lagged behind other cereals. Here, we established a virtual linear gene order model (genome zipper) comprising 22,426 or 72% of the detected set of 31,008 rye genes. This was achieved by high-throughput transcript mapping, chromosome survey sequencing, and integration of conserved synteny informatio...

  10. GENETIC DIVERSITY OF WHEAT CULTIVARS ESTIMATED BY SSR MARKERS

    Directory of Open Access Journals (Sweden)

    K. Dvojković

    2008-09-01

    Full Text Available Presence and utilization of the genetic variability in the breeding programmes is prerequisite for their successfulness. Important factor for crop improvement is knowledge about the genetic diversity which providing a basis for the precise selection of parental combinations. Since beginning of 20th century, generation of wheat breeders and scientists in Croatia developed numerous advanced and successful wheat cultivars. Previous researches aimed to genetic diversity evaluation in Croatia were conducted by means of morphological traits, pedigree data (coefficients of parentage, proteins (glutenins and gliadins and RAPD DNA markers. DNA markers detect directly variation of DNA sequence for particular loci and they are not under influence of environment, epistatic and pleiotropic effects. Microsatellite markers (Simple Sequence Repeats; SSRs, as highly polymorphic, informative and codominant DNA marker system, have been extensively used for genetic diversity studies on wheat world wide. A set of 98 wheat cultivars released in Croatia during the period 1905-2007, and 24 foreign cultivar (included because of their ancestral significance or as standards, were screened by 45 microsatellite markers, covering all three wheat genomes. The objectives of this study were to evaluate the microsatellites-based genetic diversity with emphasize on cultivars created at the Agricultural Institute Osijek, as well as to investigate SSR application for selection of genetically the most distant parental pairs. Preliminary data obtained by means of SSR markers showed a satisfactory level of genetic diversity and usefulness of microsatellites for parental selection.

  11. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  12. Breeding Value of Primary Synthetic Wheat Genotypes for Grain Yield

    Science.gov (United States)

    Jafarzadeh, Jafar; Bonnett, David; Jannink, Jean-Luc; Akdemir, Deniz; Dreisigacker, Susanne; Sorrells, Mark E.

    2016-01-01

    To introduce new genetic diversity into the bread wheat gene pool from its progenitor, Aegilops tauschii (Coss.) Schmalh, 33 primary synthetic hexaploid wheat genotypes (SYN) were crossed to 20 spring bread wheat (BW) cultivars at the International Wheat and Maize Improvement Center. Modified single seed descent was used to develop 97 populations with 50 individuals per population using first back-cross, biparental, and three-way crosses. Individuals from each cross were selected for short stature, early heading, flowering and maturity, minimal lodging, and free threshing. Yield trials were conducted under irrigated, drought, and heat-stress conditions from 2011 to 2014 in Ciudad Obregon, Mexico. Genomic estimated breeding values (GEBVs) of parents and synthetic derived lines (SDLs) were estimated using a genomic best linear unbiased prediction (GBLUP) model with markers in each trial. In each environment, there were SDLs that had higher GEBVs than their recurrent BW parent for yield. The GEBVs of BW parents for yield ranged from -0.32 in heat to 1.40 in irrigated trials. The range of the SYN parent GEBVs for yield was from -2.69 in the irrigated to 0.26 in the heat trials and were mostly negative across environments. The contribution of the SYN parents to improved grain yield of the SDLs was highest under heat stress, with an average GEBV for the top 10% of the SDLs of 0.55 while the weighted average GEBV of their corresponding recurrent BW parents was 0.26. Using the pedigree-based model, the accuracy of genomic prediction for yield was 0.42, 0.43, and 0.49 in the drought, heat and irrigated trials, respectively, while for the marker-based model these values were 0.43, 0.44, and 0.55. The SYN parents introduced novel diversity into the wheat gene pool. Higher GEBVs of progenies were due to introgression and retention of some positive alleles from SYN parents. PMID:27656893

  13. Detection of Genetic Diversity in Synthetic Hexaploid Wheats Using Microsatellite Markers

    Institute of Scientific and Technical Information of China (English)

    CHEN Guo-yue; LI Li-hui

    2007-01-01

    Ninety-five synthetic hexaploid wheats(2n=6x=42,AABBDD)were analyzed using 45 microsatellite markers to investigate the potential genetic diversity in wheat breeding programs.A total of 326 alleles were detected by these microsatellite primer pairs,with an average of 6.65 alleles per locus.The polymorphic information content(PIC),Simpson index(SI),and genetic similarity(GS)coefficient showed that the D genome is of the highest genetic diversity among the A,B,and D genomes in the synthetic hexaploid wheats.The results also indicated that the synthetic hexaploid wheat is an efficient way to enrich wheat genetic backgrounds,especially to use the genetic variations of the D genome from Aegilops squarrosa for wheat improvement.The UPGMA dendogram,based on a similarity matrix by a simple matching coefficient algorithm,delineated the above accessions into 5 major clusters and was in accordance with the available pedigree information.The results demonstrated the utility of microsatellite markers in detecting DNA polymorphism and estimating genetic diversity.

  14. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat.

    Science.gov (United States)

    Koo, Dal-Hoe; Tiwari, Vijay K; Hřibová, Eva; Doležel, Jaroslav; Friebe, Bernd; Gill, Bikram S

    2016-01-01

    Fluorescence in situ hybridization (FISH) provides an efficient system for cytogenetic analysis of wild relatives of wheat for individual chromosome identification, elucidation of homoeologous relationships, and for monitoring alien gene transfers into wheat. This study is aimed at developing cytogenetic markers for chromosome identification of wheat and Aegilops geniculata (2n = 4x = 28, UgUgMgMg) using satellite DNAs obtained from flow-sorted chromosome 5Mg. FISH was performed to localize the satellite DNAs on chromosomes of wheat and selected Aegilops species. The FISH signals for satellite DNAs on chromosome 5Mg were generally associated with constitutive heterochromatin regions corresponding to C-band-positive chromatin including telomeric, pericentromeric, centromeric, and interstitial regions of all the 14 chromosome pairs of Ae. geniculata. Most satellite DNAs also generated FISH signals on wheat chromosomes and provided diagnostic chromosome arm-specific cytogenetic markers that significantly improved chromosome identification in wheat. The newly identified satellite DNA CL36 produced localized Mg genome chromosome-specific FISH signals in Ae. geniculata and in the M genome of the putative diploid donor species Ae. comosa subsp. subventricosa but not in Ae. comosa subsp. comosa, suggesting that the Mg genome of Ae. geniculata was probably derived from subsp. subventricosa.

  15. Hairpin RNA derived from viral NIa gene confers immunity to wheat streak mosaic virus infection in transgenic wheat plants.

    Science.gov (United States)

    Fahim, Muhammad; Ayala-Navarrete, Ligia; Millar, Anthony A; Larkin, Philip J

    2010-09-01

    Wheat streak mosaic virus (WSMV), vectored by Wheat curl mite, has been of great economic importance in the Great Plains of the United States and Canada. Recently, the virus has been identified in Australia, where it has spread quickly to all major wheat growing areas. The difficulties in finding adequate natural resistance in wheat prompted us to develop transgenic resistance based on RNA interference (RNAi). An RNAi construct was designed to target the nuclear inclusion protein 'a' (NIa) gene of WSMV. Wheat was stably cotransformed with two plasmids: pStargate-NIa expressing hairpin RNA (hpRNA) including WSMV sequence and pCMneoSTLS2 with the nptII selectable marker. When T(1) progeny were assayed against WSMV, ten of sixteen families showed complete resistance in transgenic segregants. The resistance was classified as immunity by four criteria: no disease symptoms were produced; ELISA readings were as in uninoculated plants; viral sequences could not be detected by RT-PCR from leaf extracts; and leaf extracts failed to give infections in susceptible plants when used in test-inoculation experiments. Southern blot hybridization analysis indicated hpRNA transgene integrated into the wheat genome. Moreover, accumulation of small RNAs derived from the hpRNA transgene sequence positively correlated with immunity. We also showed that the selectable marker gene nptII segregated independently of the hpRNA transgene in some transgenics, and therefore demonstrated that it is possible using these techniques, to produce marker-free WSMV immune transgenic plants. This is the first report of immunity in wheat to WSMV using a spliceable intron hpRNA strategy.

  16. Divergent Development of Hexaploid Triticale by a Wheat - Rye -Psathyrostachys huashanica Trigeneric Hybrid Method.

    Science.gov (United States)

    Kang, Houyang; Wang, Hao; Huang, Juan; Wang, Yujie; Li, Daiyan; Diao, Chengdou; Zhu, Wei; Tang, Yao; Wang, Yi; Fan, Xing; Zeng, Jian; Xu, Lili; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong

    2016-01-01

    Hexaploid triticale is an important forage crop and a promising energy plant. Some forms were previously reported for developing the hexaploid triticale, such as crossing tetraploid wheat or hexaploid wheat with rye, crossing hexaploid triticale and/or hexaploid wheat with octoploid triticale, and spontaneously appearing in the selfed progenies of octoploid triticale. In the present study, we developed an effective method for production of diverse types of hexaploid triticale via wheat-rye-Psathyrostachys huashanica trigeneric hybrid. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) karyotyping revealed that D genome chromosomes were completely eliminated and the whole A, B, and R genome chromosomes were retained in three lines. More interestingly, the composite genome of the line K14-489-2 consisted of complete A and B genomes and chromosomes 1D, 2R, 3R, 4R, 5R, 6R, and 7R, that of line K14-491-2 was 12 A-genome (1A-6A), 14 B-genome (1B-7B), 12 R-genome (1R-3R, 5R-7R), and chromosomes 1D and 3D, and that of the line K14-547-1 had 26A/B and 14R chromosomes, plus one pair of centric 6BL/2DS translocations. This finding implies that some of D genome chromosomes can be spontaneously and stably incorporated into the hexaploid triticale. Additionally, a variety of high-molecular-weight glutenin subunits (HMW-GS) compositions were detected in the six hexaploid triticale lines, respectively. Besides, compared with its recurrent triticale parent Zhongsi828, these lines showed high level of resistance to stripe rust (Puccinia striiformis f. sp. tritici, Pst) pathogens prevalent in China, including V26/Gui 22. These new hexaploid triticales not only enhanced diversification of triticale but also could be utilized as valuable germplasm for wheat improvement.

  17. Divergent Development of Hexaploid Triticale by a Wheat - Rye -Psathyrostachys huashanica Trigeneric Hybrid Method.

    Directory of Open Access Journals (Sweden)

    Houyang Kang

    Full Text Available Hexaploid triticale is an important forage crop and a promising energy plant. Some forms were previously reported for developing the hexaploid triticale, such as crossing tetraploid wheat or hexaploid wheat with rye, crossing hexaploid triticale and/or hexaploid wheat with octoploid triticale, and spontaneously appearing in the selfed progenies of octoploid triticale. In the present study, we developed an effective method for production of diverse types of hexaploid triticale via wheat-rye-Psathyrostachys huashanica trigeneric hybrid. Genomic in situ hybridization (GISH and fluorescence in situ hybridization (FISH karyotyping revealed that D genome chromosomes were completely eliminated and the whole A, B, and R genome chromosomes were retained in three lines. More interestingly, the composite genome of the line K14-489-2 consisted of complete A and B genomes and chromosomes 1D, 2R, 3R, 4R, 5R, 6R, and 7R, that of line K14-491-2 was 12 A-genome (1A-6A, 14 B-genome (1B-7B, 12 R-genome (1R-3R, 5R-7R, and chromosomes 1D and 3D, and that of the line K14-547-1 had 26A/B and 14R chromosomes, plus one pair of centric 6BL/2DS translocations. This finding implies that some of D genome chromosomes can be spontaneously and stably incorporated into the hexaploid triticale. Additionally, a variety of high-molecular-weight glutenin subunits (HMW-GS compositions were detected in the six hexaploid triticale lines, respectively. Besides, compared with its recurrent triticale parent Zhongsi828, these lines showed high level of resistance to stripe rust (Puccinia striiformis f. sp. tritici, Pst pathogens prevalent in China, including V26/Gui 22. These new hexaploid triticales not only enhanced diversification of triticale but also could be utilized as valuable germplasm for wheat improvement.

  18. Heat tolerance in wheat

    DEFF Research Database (Denmark)

    Sharma, Dew Kumari

    climate, wheat is sensitive to heat stress. We need to understand how our crops will perform in these changing climatic conditions and how we can develop varieties, which are more tolerant. The PhD study focussed on understanding heat tolerance in wheat with a combined approach of plant physiology...... II (PSII), which is a fundamental process in photosynthesis. The first study was conducted to identify cultivars differing in Fv/Fm as a measure of heat tolerance during reproductive phase. The proportion of the total variation in cultivar Fv/Fm that was due to the genotypic difference was termed...... among cultivars due to heat stress as the GD of most of them remained similar in control and stress. The second study investigated if it was possible to use detached leaves to screen for heat tolerance instead of intact plants. The previously selected 41 cultivars, known to differ in v/Fm, were used...

  19. Repetitive DNA Sequences in Wheat and Its Relatives

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xue-yong; LI Da-yong

    2001-01-01

    Repetitive DNA sequences form a large portion of eukaryote genomes. Using wheat ( Triticum )as a model, the classification, features and functions of repetitive DNA sequences in the Tritieeae grass tribe is reviewed as well as the role of these sequences in genome differentiation, control and regulation of homologous chromosome synapsis and pairing. Transposable elements, as an important portion of dispersed repetitives,may play an essential role in gene mutation of the host. Dynamic models for change of copy number and sequences of the repetitive family are also presented after the models of Charlesworth et al. Application of repetitive DNA sequences in the study of evolution, chromosome fingerprinting and marker assisted gene transfer and breeding are described by taking wheat as an example.

  20. Global transgenerational gene expression dynamics in two newly synthesized allohexaploid wheat (Triticum aestivum lines

    Directory of Open Access Journals (Sweden)

    Qi Bao

    2012-01-01

    Full Text Available Abstract Background Alteration in gene expression resulting from allopolyploidization is a prominent feature in plants, but its spectrum and extent are not fully known. Common wheat (Triticum aestivum was formed via allohexaploidization about 10,000 years ago, and became the most important crop plant. To gain further insights into the genome-wide transcriptional dynamics associated with the onset of common wheat formation, we conducted microarray-based genome-wide gene expression analysis on two newly synthesized allohexaploid wheat lines with chromosomal stability and a genome constitution analogous to that of the present-day common wheat. Results Multi-color GISH (genomic in situ hybridization was used to identify individual plants from two nascent allohexaploid wheat lines between Triticum turgidum (2n = 4x = 28; genome BBAA and Aegilops tauschii (2n = 2x = 14; genome DD, which had a stable chromosomal constitution analogous to that of common wheat (2n = 6x = 42; genome BBAADD. Genome-wide analysis of gene expression was performed for these allohexaploid lines along with their parental plants from T. turgidum and Ae. tauschii, using the Affymetrix Gene Chip Wheat Genome-Array. Comparison with the parental plants coupled with inclusion of empirical mid-parent values (MPVs revealed that whereas the great majority of genes showed the expected parental additivity, two major patterns of alteration in gene expression in the allohexaploid lines were identified: parental dominance expression and non-additive expression. Genes involved in each of the two altered expression patterns could be classified into three distinct groups, stochastic, heritable and persistent, based on their transgenerational heritability and inter-line conservation. Strikingly, whereas both altered patterns of gene expression showed a propensity of inheritance, identity of the involved genes was highly stochastic, consistent with the involvement of diverse Gene Ontology (GO

  1. Gene enrichment in plant genomic shotgun libraries.

    Science.gov (United States)

    Rabinowicz, Pablo D; McCombie, W Richard; Martienssen, Robert A

    2003-04-01

    The Arabidopsis genome (about 130 Mbp) has been completely sequenced; whereas a draft sequence of the rice genome (about 430 Mbp) is now available and the sequencing of this genome will be completed in the near future. The much larger genomes of several important crop species, such as wheat (about 16,000 Mbp) or maize (about 2500 Mbp), may not be fully sequenced with current technology. Instead, sequencing-analysis strategies are being developed to obtain sequencing and mapping information selectively for the genic fraction (gene space) of complex plant genomes.

  2. Resistance of alloplasmic wheats to brown leaf rust

    Directory of Open Access Journals (Sweden)

    Alexander Lvovivh SECHNYAK

    2010-11-01

    Full Text Available The reaction of alloplasmic and euplasmic lines of wheat on brown leaf rust was studied in the condition of field infectious nursery in 2002, 2004, 2006 and 2007. The influence of cytoplasmic genome on resistance of the investigated lines varied for years and probably was mainly specific to race. However the positive effect of alloplasm from Aegilops squarrosa var. typica on resistance to pathogene was stable and universal.

  3. DOP-PCR-based chromosome painting of rye (Secale cereale) and wheat-rye hybrid 1R and 1RS chromosomes

    Science.gov (United States)

    The chromosome painting is an efficient tool for chromosome research. In oeder to determine whether the chromosome painting techniques can be used to identify rye genome in wheat genetic background, 1R and 1RS chromosomes were microdissected from rye (Secale cereale L. var. King ll) and wheat-rye a...

  4. Changes in allelic frequency over time in European bread wheat (Triticum aestivum L.) varieties revealed using DArT and SSR markers

    DEFF Research Database (Denmark)

    Orabi, Jihad; Jahoor, Ahmed; Backes, Gunter Martin

    2014-01-01

    A collection of 189 bread wheat landraces and cultivars, primarily of European origin, released between 1886 and 2009, was analyzed using two DNA marker systems. A set of 76 SSR markers and ~7,000 DArT markers distributed across the wheat genome were employed in these analyses. All of the SSR mar...

  5. GmPGIP3 enhanced resistance to both take-all and common root rot diseases in transgenic wheat.

    Science.gov (United States)

    Wang, Aiyun; Wei, Xuening; Rong, Wei; Dang, Liang; Du, Li-Pu; Qi, Lin; Xu, Hui-Jun; Shao, Yanjun; Zhang, Zengyan

    2015-05-01

    Take-all (caused by the fungal pathogen Gaeumannomyces graminis var. tritici, Ggt) and common root rot (caused by Bipolaris sorokiniana) are devastating root diseases of wheat (Triticum aestivum L.). Development of resistant wheat cultivars has been a challenge since no resistant wheat accession is available. GmPGIP3, one member of polygalacturonase-inhibiting protein (PGIP) family in soybean (Glycine max), exhibited inhibition activity against fungal endopolygalacturonases (PGs) in vitro. In this study, the GmPGIP3 transgenic wheat plants were generated and used to assess the effectiveness of GmPGIP3 in protecting wheat from the infection of Ggt and B. sorokiniana. Four independent transgenic lines were identified by genomic PCR, Southern blot, and reverse transcription PCR (RT-PCR). The introduced GmPGIP3 was integrated into the genomes of these transgenic lines and could be expressed. The expressing GmPGIP3 protein in these transgenic wheat lines could inhibit the PGs produced by Ggt and B. sorokiniana. The disease response assessments postinoculation showed that the GmPGIP3-expressing transgenic wheat lines displayed significantly enhanced resistance to both take-all and common root rot diseases caused by the infection of Ggt and B. sorokiniana. These data suggested that GmPGIP3 is an attractive gene resource in improving resistance to both take-all and common root rot diseases in wheat.

  6. Comparative transcriptomics in the Triticeae

    Directory of Open Access Journals (Sweden)

    Waugh Robbie

    2009-06-01

    Full Text Available Abstract Background Barley and particularly wheat are two grass species of immense agricultural importance. In spite of polyploidization events within the latter, studies have shown that genotypically and phenotypically these species are very closely related and, indeed, fertile hybrids can be created by interbreeding. The advent of two genome-scale Affymetrix GeneChips now allows studies of the comparison of their transcriptomes. Results We have used the Wheat GeneChip to create a "gene expression atlas" for the wheat transcriptome (cv. Chinese Spring. For this, we chose mRNA from a range of tissues and developmental stages closely mirroring a comparable study carried out for barley (cv. Morex using the Barley1 GeneChip. This, together with large-scale clustering of the probesets from the two GeneChips into "homologous groups", has allowed us to perform a genomic-scale comparative study of expression patterns in these two species. We explore the influence of the polyploidy of wheat on the results obtained with the Wheat GeneChip and quantify the correlation between conservation in gene sequence and gene expression in wheat and barley. In addition, we show how the conservation of expression patterns can be used to elucidate, probeset by probeset, the reliability of the Wheat GeneChip. Conclusion While there are many differences in expression on the level of individual genes and tissues, we demonstrate that the wheat and barley transcriptomes appear highly correlated. This finding is significant not only because given small evolutionary distance between the two species it is widely expected, but also because it demonstrates that it is possible to use the two GeneChips for comparative studies. This is the case even though their probeset composition reflects rather different design principles as well as, of course, the present incomplete knowledge of the gene content of the two species. We also show that, in general, the Wheat GeneChip is not able

  7. 77 FR 21685 - United States Standards for Wheat

    Science.gov (United States)

    2012-04-11

    ... believe that the blending of wheat would facilitate the marketing of wheat, as a buyer may purchase Mixed... marketing of wheat. DATES: Comments must be received on or before June 11, 2012. ADDRESSES: You may submit... (SWH) wheat, Unclassed wheat, and Mixed wheat. Wheat is consumed primarily as a human food but is also...

  8. Characterization of Capsicum annuum genetic diversity and population structure based on parallel polymorphism discovery with a 30K unigene Pepper GeneChip.

    Science.gov (United States)

    Hill, Theresa A; Ashrafi, Hamid; Reyes-Chin-Wo, Sebastian; Yao, JiQiang; Stoffel, Kevin; Truco, Maria-Jose; Kozik, Alexander; Michelmore, Richard W; Van Deynze, Allen

    2013-01-01

    The widely cultivated pepper, Capsicum spp., important as a vegetable and spice crop world-wide, is one of the most diverse crops. To enhance breeding programs, a detailed characterization of Capsicum diversity including morphological, geographical and molecular data is required. Currently, molecular data characterizing Capsicum genetic diversity is limited. The development and application of high-throughput genome-wide markers in Capsicum will facilitate more detailed molecular characterization of germplasm collections, genetic relationships, and the generation of ultra-high density maps. We have developed the Pepper GeneChip® array from Affymetrix for polymorphism detection and expression analysis in Capsicum. Probes on the array were designed from 30,815 unigenes assembled from expressed sequence tags (ESTs). Our array design provides a maximum redundancy of 13 probes per base pair position allowing integration of multiple hybridization values per position to detect single position polymorphism (SPP). Hybridization of genomic DNA from 40 diverse C. annuum lines, used in breeding and research programs, and a representative from three additional cultivated species (C. frutescens, C. chinense and C. pubescens) detected 33,401 SPP markers within 13,323 unigenes. Among the C. annuum lines, 6,426 SPPs covering 3,818 unigenes were identified. An estimated three-fold reduction in diversity was detected in non-pungent compared with pungent lines, however, we were able to detect 251 highly informative markers across these C. annuum lines. In addition, an 8.7 cM region without polymorphism was detected around Pun1 in non-pungent C. annuum. An analysis of genetic relatedness and diversity using the software Structure revealed clustering of the germplasm which was confirmed with statistical support by principle components analysis (PCA) and phylogenetic analysis. This research demonstrates the effectiveness of parallel high-throughput discovery and application of genome

  9. Characterization of Capsicum annuum genetic diversity and population structure based on parallel polymorphism discovery with a 30K unigene Pepper GeneChip.

    Directory of Open Access Journals (Sweden)

    Theresa A Hill

    Full Text Available The widely cultivated pepper, Capsicum spp., important as a vegetable and spice crop world-wide, is one of the most diverse crops. To enhance breeding programs, a detailed characterization of Capsicum diversity including morphological, geographical and molecular data is required. Currently, molecular data characterizing Capsicum genetic diversity is limited. The development and application of high-throughput genome-wide markers in Capsicum will facilitate more detailed molecular characterization of germplasm collections, genetic relationships, and the generation of ultra-high density maps. We have developed the Pepper GeneChip® array from Affymetrix for polymorphism detection and expression analysis in Capsicum. Probes on the array were designed from 30,815 unigenes assembled from expressed sequence tags (ESTs. Our array design provides a maximum redundancy of 13 probes per base pair position allowing integration of multiple hybridization values per position to detect single position polymorphism (SPP. Hybridization of genomic DNA from 40 diverse C. annuum lines, used in breeding and research programs, and a representative from three additional cultivated species (C. frutescens, C. chinense and C. pubescens detected 33,401 SPP markers within 13,323 unigenes. Among the C. annuum lines, 6,426 SPPs covering 3,818 unigenes were identified. An estimated three-fold reduction in diversity was detected in non-pungent compared with pungent lines, however, we were able to detect 251 highly informative markers across these C. annuum lines. In addition, an 8.7 cM region without polymorphism was detected around Pun1 in non-pungent C. annuum. An analysis of genetic relatedness and diversity using the software Structure revealed clustering of the germplasm which was confirmed with statistical support by principle components analysis (PCA and phylogenetic analysis. This research demonstrates the effectiveness of parallel high-throughput discovery and

  10. Intrinsic karyotype stability and gene copy number variations may have laid the foundation for tetraploid wheat formation.

    Science.gov (United States)

    Zhang, Huakun; Bian, Yao; Gou, Xiaowan; Dong, Yuzhu; Rustgi, Sachin; Zhang, Bangjiao; Xu, Chunming; Li, Ning; Qi, Bao; Han, Fangpu; von Wettstein, Diter; Liu, Bao

    2013-11-26

    Polyploidy or whole-genome duplication is recurrent in plant evolution, yet only a small fraction of whole-genome duplications has led to successful speciation. A major challenge in the establishment of nascent polyploids is sustained karyotype instability, which compromises fitness. The three putative diploid progenitors of bread wheat, with AA, SS (S ∼ B), and DD genomes occurred sympatrically, and their cross-fertilization in different combinations may have resulted in fertile allotetraploids with various genomic constitutions. However, only SSAA or closely related genome combinations have led to the speciation of tetraploid wheats like Triticum turgidum and Triticum timopheevii. We analyzed early generations of four newly synthesized allotetraploid wheats with genome compositions S(sh)S(sh)A(m)A(m), S(l)S(l)AA, S(b)S(b)DD, and AADD by combined fluorescence and genomic in situ hybridization-based karyotyping. Results of karyotype analyses showed that although S(sh)S(sh)A(m)A(m) and S(l)S(l)AA are characterized by immediate and persistent karyotype stability, massive aneuploidy and extensive chromosome restructuring are associated with S(b)S(b)DD and AADD in which parental subgenomes showed markedly different propensities for chromosome gain/loss and rearrangements. Although compensating aneuploidy and reciprocal translocation between homeologs prevailed, reproductive fitness was substantially compromised due to chromosome instability. Strikingly, localized genomic changes in repetitive DNA and copy-number variations in gene homologs occurred in both chromosome stable lines, S(sh)S(sh)A(m)A(m) and S(l)S(l)AA. Our data demonstrated that immediate and persistent karyotype stability is intrinsic to newly formed allotetraploid wheat with genome combinations analogous to natural tetraploid wheats. This property, coupled with rapid gene copy-number variations, may have laid the foundation of tetraploid wheat establishment.

  11. Subgenome chromosome walking in wheat: A 450-kb physical contig in Triticum monococcum L. spans the Lr10 resistance locus in hexaploid wheat (Triticum aestivum L.)

    Science.gov (United States)

    Stein, Nils; Feuillet, Catherine; Wicker, Thomas; Schlagenhauf, Edith; Keller, Beat

    2000-01-01

    For many agronomically important plant genes, only their position on a genetic map is known. In the absence of an efficient transposon tagging system, such genes have to be isolated by map-based cloning. In bread wheat Triticum aestivum, the genome is hexaploid, has a size of 1.6 × 1010 bp, and contains more than 80% of repetitive sequences. So far, this genome complexity has not allowed chromosome walking and positional cloning. Here, we demonstrate that chromosome walking using bacterial artificial chromosome (BAC) clones is possible in the diploid wheat Triticum monococcum (Am genome). BAC end sequences were mostly repetitive and could not be used for the first walking step. New probes corresponding to rare low-copy sequences were efficiently identified by low-pass DNA sequencing of the BACs. Two walking steps resulted in a physical contig of 450 kb on chromosome 1AmS. Genetic mapping of the probes derived from the BAC contig demonstrated perfect colinearity between the physical map of T. monococcum and the genetic map of bread wheat on chromosome 1AS. The contig genetically spans the Lr10 leaf rust disease resistance locus in bread wheat, with 0.13 centimorgans corresponding to 300 kb between the closest flanking markers. Comparison of the genetic to physical distances has shown large variations within 350 kb of the contig. The physical contig can now be used for the isolation of the orthologous regions in bread wheat. Thus, subgenome chromosome walking in wheat can produce large physical contigs and saturate genomic regions to support positional cloning. PMID:11078510

  12. PGSB/MIPS Plant Genome Information Resources and Concepts for the Analysis of Complex Grass Genomes.

    Science.gov (United States)

    Spannagl, Manuel; Bader, Kai; Pfeifer, Matthias; Nussbaumer, Thomas; Mayer, Klaus F X

    2016-01-01

    PGSB (Plant Genome and Systems Biology; formerly MIPS-Munich Institute for Protein Sequences) has been involved in developing, implementing and maintaining plant genome databases for more than a decade. Genome databases and analysis resources have focused on individual genomes and aim to provide flexible and maintainable datasets for model plant genomes as a backbone against which experimental data, e.g., from high-throughput functional genomics, can be organized and analyzed. In addition, genomes from both model and crop plants form a scaffold for comparative genomics, assisted by specialized tools such as the CrowsNest viewer to explore conserved gene order (synteny) between related species on macro- and micro-levels.The genomes of many economically important Triticeae plants such as wheat, barley, and rye present a great challenge for sequence assembly and bioinformatic analysis due to their enormous complexity and large genome size. Novel concepts and strategies have been developed to deal with these difficulties and have been applied to the genomes of wheat, barley, rye, and other cereals. This includes the GenomeZipper concept, reference-guided exome assembly, and "chromosome genomics" based on flow cytometry sorted chromosomes.

  13. Proteomic profiling of 16 cereal grains and the application of targeted proteomics to detect wheat contamination.

    Science.gov (United States)

    Colgrave, Michelle L; Goswami, Hareshwar; Byrne, Keren; Blundell, Malcolm; Howitt, Crispin A; Tanner, Gregory J

    2015-06-01

    Global proteomic analysis utilizing SDS-PAGE, Western blotting and LC-MS/MS of total protein and gluten-enriched extracts derived from 16 economically important cereals was undertaken, providing a foundation for the development of MS-based quantitative methodologies that would enable the detection of wheat contamination in foods. The number of proteins identified in each grain correlated with the number of entries in publicly available databases, highlighting the importance of continued advances in genome sequencing to facilitate accurate protein identification. Subsequently, candidate wheat-specific peptide markers were evaluated by multiple-reaction monitoring MS. The selected markers were unique to wheat, yet present in a wide range of wheat varieties that represent up to 80% of the bread wheat genome. The final analytical method was rapid (15 min) and robust (CV 0.98) spanning over 3 orders of magnitude, and was highly selective and sensitive with detection down to 15 mg/kg in intentionally contaminated soy flour. Furthermore, application of this technology revealed wheat contamination in commercially sourced flours, including rye, millet, oats, sorghum, buckwheat and three varieties of soy.

  14. Genetic mapping using the Diversity Arrays Technology (DArT) : application and validation using the whole-genome sequences of Arabidopsis thaliana and the fungal wheat pathogen Mycosphaerella graminicola

    NARCIS (Netherlands)

    Wittenberg, A.H.J.

    2007-01-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds- to thousands of restriction site based polymorphisms between genotypes and does not require DNA sequence informat

  15. Genetic mapping using the Diversity Arrays Technology (DArT) : application and validation using the whole-genome sequences of Arabidopsis thaliana and the fungal wheat pathogen Mycosphaerella graminicola

    NARCIS (Netherlands)

    Wittenberg, A.H.J.

    2007-01-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds- to thousands of restriction site based polymorphisms between genotypes and does not require DNA sequence informat

  16. Genetic mapping using the Diversity Arrays Technology (DArT) : application and validation using the whole-genome sequences of Arabidopsis thaliana and the fungal wheat pathogen Mycosphaerella graminicola

    NARCIS (Netherlands)

    Wittenberg, A.H.J.

    2007-01-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds- to thousands of restriction site based polymorphisms between genotypes and does not require DNA sequence

  17. Path Through the Wheat

    Directory of Open Access Journals (Sweden)

    David Middleton

    2005-01-01

    Full Text Available The hillside’s tidal waves of yellow-green Break downward into full-grown stalks of wheat In which a peasant, shouldering his hoe Passes along a snaking narrow path -- A teeming place through which his hard thighs press And where his head just barely stays above The swaying grain, drunken in abundance, Farm buildings almost floating on the swells Beyond which sea gulls gliding white in air Fly down on out of sight to salty fields, Taking the channel fish off Normandy, A surfeit fit for Eden i...

  18. Mutation Scanning in Wheat by Exon Capture and Next-Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Robert King

    Full Text Available Targeted Induced Local Lesions in Genomes (TILLING is a reverse genetics approach to identify novel sequence variation in genomes, with the aims of investigating gene function and/or developing useful alleles for breeding. Despite recent advances in wheat genomics, most current TILLING methods are low to medium in throughput, being based on PCR amplification of the target genes. We performed a pilot-scale evaluation of TILLING in wheat by next-generation sequencing through exon capture. An oligonucleotide-based enrichment array covering ~2 Mbp of wheat coding sequence was used to carry out exon capture and sequencing on three mutagenised lines of wheat containing previously-identified mutations in the TaGA20ox1 homoeologous genes. After testing different mapping algorithms and settings, candidate SNPs were identified by mapping to the IWGSC wheat Chromosome Survey Sequences. Where sequence data for all three homoeologues were found in the reference, mutant calls were unambiguous; however, where the reference lacked one or two of the homoeologues, captured reads from these genes were mis-mapped to other homoeologues, resulting either in dilution of the variant allele frequency or assignment of mutations to the wrong homoeologue. Competitive PCR assays were used to validate the putative SNPs and estimate cut-off levels for SNP filtering. At least 464 high-confidence SNPs were detected across the three mutagenized lines, including the three known alleles in TaGA20ox1, indicating a mutation rate of ~35 SNPs per Mb, similar to that estimated by PCR-based TILLING. This demonstrates the feasibility of using exon capture for genome re-sequencing as a method of mutation detection in polyploid wheat, but accurate mutation calling will require an improved genomic reference with more comprehensive coverage of homoeologues.

  19. Evolution of New Disease Specificity at a Simple Resistance Locus in a Crop–Weed Complex: Reconstitution of the Lr21 Gene in Wheat

    OpenAIRE

    Huang, Li; Brooks, Steven; Li, Wanlong; Fellers, John; Nelson, James C.; Gill, Bikram

    2009-01-01

    The wheat leaf-rust resistance gene Lr21 was first identified in an Iranian accession of goatgrass, Aegilops tauschii Coss., the D-genome donor of hexaploid bread wheat, and was introgressed into modern wheat cultivars by breeding. To elucidate the origin of the gene, we analyzed sequences of Lr21 and lr21 alleles from 24 wheat cultivars and 25 accessions of Ae. tauschii collected along the Caspian Sea in Iran and Azerbaijan. Three basic nonfunctional lr21 haplotypes, H1, H2, and H3, were ide...

  20. Comparative Proteomic Analysis of Flag Leaves Reveals New Insight into Wheat Heat Adaptation

    Directory of Open Access Journals (Sweden)

    Yunze Lu

    2017-06-01

    Full Text Available Hexaploid wheat (Triticum aestivum L. is an important food crop but it is vulnerable to heat. The heat-responsive proteome of wheat remains to be fully elucidated because of previous technical and genomic limitations, and this has hindered our understanding of the mechanisms of wheat heat adaptation and advances in improving thermotolerance. Here, flag leaves of wheat during grain filling stage were subjected to high daytime temperature stress, and 258 heat-responsive proteins (HRPs were identified with iTRAQ analysis. Enrichment analysis revealed that chlorophyll synthesis, carbon fixation, protein turnover, and redox regulation were the most remarkable heat-responsive processes. The HRPs involved in chlorophyll synthesis and carbon fixation were significantly decreased, together with severe membrane damage, demonstrating the specific effects of heat on photosynthesis of wheat leaves. In addition, the decrease in chlorophyll content may result from the decrease in HRPs involved in chlorophyll precursor synthesis. Further analysis showed that the accumulated effect of heat stress played a critical role in photosynthesis reduction, suggested that improvement in heat tolerance of photosynthesis, and extending heat tolerant period would be major research targets. The significantly accumulation of GSTs and Trxs in response to heat suggested their important roles in redox regulation, and they could be the promising candidates for improving wheat thermotolerance. In summary, our results provide new insight into wheat heat adaption and provide new perspectives on thermotolerance improvement.

  1. Isolation and characterization of a Psathyrostachys huashanica Keng 6Ns chromosome addition in common wheat.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The development of alien addition lines is important for transferring useful genes from exotic species into common wheat. A hybrid of common wheat cv. 7182 (2n = 6x = 42, AABBDD and Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs via embryo culture produced the novel intergeneric disomic addition line 59-11. The seed morphology of 59-11 resembled the parent 7182 and it exhibited extreme agronomic characteristics, i.e., twin stable spikelets, fertile florets, and multi-kernel clusters. Furthermore, 59-11 produced plump kernels with a high seed-setting percentage during the advanced maturation stage. The line was screened based on genomic in situ hybridization, EST-SSR, EST-STS, and gliadin to identify P. huashanica chromatin in the wheat background. The chromosome number and configuration of 59-11 was 2n = 44 = 22 II and we confirmed the 6Ns disomic chromosome additions based on A-PAGE analysis and molecular markers. The results suggested that the production of twin spikelets and multiple kernels per spike in the wheat-P. huashanica addition line was related to homologous group 6 in the wheat chromosome. This is the first report of the introduction of improved spike traits into common wheat from the alien species P. huashanica and it opens up the possibility of increasing the wheat yield based on this enlarged gene pool.

  2. Mutations in Durum Wheat SBEII Genes affect Grain Yield Components, Quality, and Fermentation Responses in Rats.

    Science.gov (United States)

    Hazard, Brittany; Zhang, Xiaoqin; Naemeh, Mahmoudreza; Hamilton, M Kristina; Rust, Bret; Raybould, Helen E; Newman, John W; Martin, Roy; Dubcovsky, Jorge

    2015-01-01

    Increased amylose in wheat (Triticum ssp.) starch is associated with increased resistant starch, a fermentable dietary fiber. Fermentation of resistant starch in the large intestine produces short-chain fatty acids that are associated with human health benefits. Since wheat foods are an important component of the human diet, increases in amylose and resistant starch in wheat grains have the potential to deliver health benefits to a large number of people. In three replicated field trials we found that mutations in starch branching enzyme II genes (SBEIIa and SBEIIb) in both A and B genomes (SBEIIa/b-AB) of durum wheat [T. turgidum L. subsp. durum (Desf.) Husn.] resulted in large increases of amylose and resistant starch content. The presence of these four mutations was also associated with an average 5% reduction in kernel weight (P = 0.0007) and 15% reduction in grain yield (P = 0.06) compared to the wild type. Complete milling and pasta quality analysis showed that the mutant lines have an acceptable quality with positive effects on pasta firmness and negative effects on semolina extraction and pasta color. Positive fermentation responses were detected in rats (Rattus spp.) fed with diets incorporating mutant wheat flour. This study quantifies benefits and limitations associated with the deployment of the SBEIIa/b-AB mutations in durum wheat and provides the information required to develop realistic strategies to deploy durum wheat varieties with increased levels of amylose and resistant starch.

  3. Development, identification and utilization of introgression lines using Chinese endemic and synthetic wheat as donors

    Institute of Scientific and Technical Information of China (English)

    Liqing Gu; Bo Wei; Renchun Fan; Xu Jia; Xianping Wang; Xiangqi Zhang

    2015-01-01

    Chromosome segmental introgression lines (ILs) are an effective way to utilize germplasm resources in crops. To improve agronomic traits of wheat cultivar (Triticum aestivum) Shi 4185, four sets of ILs were developed. The donors were Chinese endemic subspecies accessions Yunnan wheat (T. aestivum ssp. yunnanense) YN3, Tibetan semi-wild wheat (T. aestivum ssp. tibetanum) XZ-ZM19450, and Xinjiang wheat (T. aestivum ssp. petropavlovskyi) XJ5, and synthetic wheat HC-XM1620 derived from a cross between T. durum acc. D67.2/P66.270 with Aegilops tauschii acc. 218. Totals of 356, 366, 445 and 457 simple sequence repeat (SSR) markers were polymorphic between Shi 4185 and YN3, XZ-ZM19450, XJ5 and HC-XM1620, respectively. In total, 991 ILs were identified, including 300 derived from YN3, covering 95%of the genome of Shi 4185, 218 from XZ-ZM19450 (79%), 279 from XJ5 (97%), and 194 from HC-ZX1620 (84%). The sizes and locations of each introgression were determined from a consensus SSR linkage map. Using the ILs, 11 putative quantitative trait loci (QTLs) were identified for plant height (PH), spike length (SL) and grain number per spike (GNS). Comparative analyses of 24 elite ILs with the parents revealed that the four donor parents could be important resources to improve wheat SL and GNS. Our work offers a case for utilizing endemic landraces for QTL mapping and improvement of wheat cultivars using introgression lines.

  4. Wheat Production and Wheat Rust Management in Canada

    Institute of Scientific and Technical Information of China (English)

    Xue Allen G; Chi Dawn T; Zhang Shu-zhen; Li Zuo-fu

    2012-01-01

    Wheat is Canada's the largest crop with most of the production in the western Canadian Prairie Provinces of Manitoba, Saskatchewan and Alberta. There were approximately 10 million (M) hectares (hm2) seeded to wheat in Canada, including 7 M hm2 of hexaploid spring wheat (Triticum aestivum L.), 2 M hm2 of durum wheat (T. turgidum L. ssp. durum (Desf.) Husn.), and 1 M hm2 of winter wheat (T. aestivum). Within hexaploid wheat there has been diversification into a number of market classes based on different end-use quality criteria. The predominant spring bread wheat class has been the Canada Western Red Spring (CWRS) class. Historically, the disease of major concern in wheat was stem rust, caused by Puccinia graminis f. sp. tritici. The first significant stem rust resistant cultivar in Canada was Thatcher, grown extensively from 1939 until the early 1970s. Thatcher, however, was very susceptible to leaf rust, caused by Puccinia triticina. Over years, improved resistance to both stem and leaf rust was achieved with the release of cultivars with additional genes for resistance, primarily Sr2, Sr6, Sr7a, Sr9b, Lr13, Lr14a, Lr16, and Lr34. The genetic resistance has adequately controlled stem rust but leaf rust continues to cause significant loss, partially due to changes in the P. triticina population which reduced the effectiveness of resistance genes such as Lr13 and Lr16. Stripe rust on wheat, caused by Puccinia striiformis f. sp. tritici, was historically a problem under irrigation in southern Alberta, but since 2000, it has been found annually in the central Canadian prairies and southern Ontario. The genetic basis of resistance to stripe rust in most Canadian wheat cultivars has not been determined, although Yr18 provides partial resistance in many cultivars. In the future, other rust diseases, such as wheat stripe rust, or highly virulent new pathotypes of current rust pathogens, such as P. graminis f. sp. tritici race Ug-99, may pose

  5. Sequence analysis of a soil-borne wheat mosaic virus isolate from Italy shows that it is the same virus as European wheat mosaic virus and Soil-borne rye mosaic virus

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The complete sequence of the two RNAs of a furovirus isolate fromdurum wheat in Italy was determined. Sequence comparisons and phylogenetic analysis were done to compare the Italian virus with Soil-borne wheat mosaic virus (SBWMV) from the USA and with furovirus sequences recently published as European wheat mosaic virus (EWMV), from wheat in France, and Soil-borne rye mosaic virus (SBRMV), from rye and wheat in Germany. Over the entire genome, the Italian isolate RNA1 and RNA2 had respectively 97.5% and 98.6% nucleotide identity with EWMV, 95.5% and 85.8% with SBRMV-G and 70.6% and 64.5% with SBWMV. The Italian isolate was therefore clearly distinct from SBWMV. The European isolates all appear to belong to the same virus and the name Soil-borne cereal mosaic virus may resolve earlier ambiguities.

  6. The epitopes in wheat proteins for defining toxic units relevant to human health.

    Science.gov (United States)

    Juhász, Angéla; Gell, Gyöngyvér; Békés, Frank; Balázs, Ervin

    2012-11-01

    Wheat-related disorders are well-studied health problems. Knowledge of the composition and amounts of epitopes present in a single wheat sample represents a significant gap, and the detailed wheat proteome datasets now available can provide the necessary information to carry out an estimation of allergen prediction for a single cultivar. The combined use of genome sequence and allergen databases, prediction methodology, and cereal chemistry results in better understanding of the level of toxicity present in the end-products produced from wheat flour. The workflow presented in this review provides information about the number and distribution of epitopes at single protein, or protein fraction, levels. In addition, epitopes present in the highest frequency and harmful proteins expressed in the highest amount can be identified. The "epitope toxicity" value obtained in this way is a significant research output from the analysis of large datasets that can be applied to the food industry.

  7. SNP Discovery for mapping alien introgressions in wheat

    Science.gov (United States)

    2014-01-01

    Background Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). Results The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. Conclusion This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and

  8. Drought Tolerance in Wheat

    Directory of Open Access Journals (Sweden)

    Arash Nezhadahmadi

    2013-01-01

    Full Text Available Drought is one of the most important phenomena which limit crops’ production and yield. Crops demonstrate various morphological, physiological, biochemical, and molecular responses to tackle drought stress. Plants’ vegetative and reproductive stages are intensively influenced by drought stress. Drought tolerance is a complicated trait which is controlled by polygenes and their expressions are influenced by various environmental elements. This means that breeding for this trait is so difficult and new molecular methods such as molecular markers, quantitative trait loci (QTL mapping strategies, and expression patterns of genes should be applied to produce drought tolerant genotypes. In wheat, there are several genes which are responsible for drought stress tolerance and produce different types of enzymes and proteins for instance, late embryogenesis abundant (lea, responsive to abscisic acid (Rab, rubisco, helicase, proline, glutathione-S-transferase (GST, and carbohydrates during drought stress. This review paper has concentrated on the study of water limitation and its effects on morphological, physiological, biochemical, and molecular responses of wheat with the possible losses caused by drought stress.

  9. Nucleolus organizer regions (Nor loci) of Chinese wheats

    Institute of Scientific and Technical Information of China (English)

    Cedric E.May; 辛志勇

    1996-01-01

    Nucleolus organizer regions (Nor loci) of a range of Chinese wheat landraces and cultivars (Triticum aestivum L. em Thell.) were analysed using genomic DNA extracted from leaves. Only two allelic variants of the Nor-B1 locus were found on chromosome 1B (Nor-B1a and Nor-B1g), while Nor-B1g was probably introduced from North America in the early 1960s. The even more recent introduction of the rye allele Nor-R1 in the early 1980s was also revealed. Eight allelic variants of the Nor-B2 locus on chromosome 6B (Nor-B2a, b, d, f, h, o, p and s) were identified. A Chinese origin for the a, d, f, o, p and s alkies is evident although the d allele was successfully introduced into Australian wheats in the early 1900s. Nor-B2h and Nor-B2b are again very recent introductions into Chinese wheat breeding programs, the former from CIMMYT wheats and the latter in association with the introduction of the 1RS/1BL translocation from Europe. On the basis of the presence of different combinations of Nor-B1 and Nor-B2 alleles

  10. COMPUTER APPROACHES TO WHEAT HIGH-THROUGHPUT PHENOTYPING

    Directory of Open Access Journals (Sweden)

    Afonnikov D.

    2012-08-01

    Full Text Available The growing need for rapid and accurate approaches for large-scale assessment of phenotypic characters in plants becomes more and more obvious in the studies looking into relationships between genotype and phenotype. This need is due to the advent of high throughput methods for analysis of genomes. Nowadays, any genetic experiment involves data on thousands and dozens of thousands of plants. Traditional ways of assessing most phenotypic characteristics (those with reliance on the eye, the touch, the ruler are little effective on samples of such sizes. Modern approaches seek to take advantage of automated phenotyping, which warrants a much more rapid data acquisition, higher accuracy of the assessment of phenotypic features, measurement of new parameters of these features and exclusion of human subjectivity from the process. Additionally, automation allows measurement data to be rapidly loaded into computer databases, which reduces data processing time.In this work, we present the WheatPGE information system designed to solve the problem of integration of genotypic and phenotypic data and parameters of the environment, as well as to analyze the relationships between the genotype and phenotype in wheat. The system is used to consolidate miscellaneous data on a plant for storing and processing various morphological traits and genotypes of wheat plants as well as data on various environmental factors. The system is available at www.wheatdb.org. Its potential in genetic experiments has been demonstrated in high-throughput phenotyping of wheat leaf pubescence.

  11. Radiation hybrid maps of D-genome of Aegilops tauschii and their application in sequence assembly of large and complex plant genomes

    Science.gov (United States)

    The large and complex genome of bread wheat (Triticum aestivum L., ~17 Gb) requires high-resolution genome maps saturated with ordered markers to assist in anchoring and orienting BAC contigs/ sequence scaffolds for whole genome sequence assembly. Radiation hybrid (RH) mapping has proven to be an e...

  12. AGROBACTERIUM-MEDIATED TRANSFORMATION OF WHEAT

    Directory of Open Access Journals (Sweden)

    K. Mészáros

    2008-09-01

    Full Text Available Transformation of cereals is one of the emerging areas for plant genomic and biotechnology research. Wheat was among the last major crops to be transformed by particle bombardment about 10 years ago. However, Agrobacterium-mediated transformation has several advantages over bombardment, including a reduction in copy number, fewer rearrangements and preferential integration into transcriptionally active chromosome regions. As a first step, we started to adapt an immature embryo-based transformation method for the model variety ‘Cadenza’. The regeneration of this variety was low and especially the cost of generating donor plants was high. Therefore, we decided (i to test regeneration capacity of winter and spring wheats using four different explants, (ii to determine the optimal genotype-regeneration system combinations, and (iii to work out the details of mature embryo transformation with Agrobacterium. The experiment was carried out with 16 cultivated winter wheat and 2 model spring wheat varieties. Four different explants: anther, immature embryo, mature embryo and dry seed were tested for callus induction and plant regeneration. The regeneration capacity was the lowest in the case of anther culture and ranged from 20% (‘Mv Béres’ to 0.1% (‘Mv Magvas’ with four varieties exerting significantly higher regeneration than ‘Cadenza’. Plant regeneration from immature embryos ranged between 59% (‘Mv Regiment’ and 0.1% (‘Mv Toborzó’. Again, four varieties produced significantly more plants than the control ‘Cadenza’. We tested two systems for the plant regeneration from mature embryos. First, mature embryos were isolated from seeds, which resulted in an average of 17% plant regeneration (from 63% in ‘Fatima’ to zero in ‘Mv Palotás’. ‘Cadenza’ was one of the worse regenerating genotype (7%. The highest plant regeneration (average 54% was in the case of seed explants. There were no significant differences

  13. Gliadin and glutenin polymorphism in durum wheat landraces and breeding varieties of Azerbaijan

    Directory of Open Access Journals (Sweden)

    Sadigov-Baykishi Hamlet

    2015-01-01

    Full Text Available Durum wheat genotypes including 7 landraces and 17 breeding varieties were studied. Polyacrylamide gel electrophoresis under acidic conditions of pH 3.1 was used to study gliadin and glutenin polymorphisms. In total, 32 gliadin and 8 high molecular weight glutenin alleles were identified. The contribution of B genome (58.5% to the allelic variation of durum wheat varieties was higher than of A genome. The cluster analysis delineated genotypes into four main clusters. According to cluster analysis, legitimacy identifying the distribution of botanical varieties through the tree was observed. The study confirms the suitability of biochemical markers for cultivar identification and genetic relation study in durum wheat genotypes.

  14. Rye Genomic Specific SCAR Marker Detected Leaf Rust Resistance Related Gene in Rye Transferred to Wheat%黑麦基因组特异 SCAR 标记检测抗叶锈相关黑麦染色质向小麦的转移

    Institute of Scientific and Technical Information of China (English)

    刘春燕; 郭楠; 闫红飞; 刘大群

    2013-01-01

      A SCAR marker of rye genome was used to amplified the TcLr 45 and the background material Thatcher.One unique band in TcLr45,and two different bands in Thatcher were implified .In addition,49 wheat leaf rust resistance near isogenic gene lines (NILs) were detected by the marker,the marker is specific for TcLr45 a-mong these genes.F2 segregate groups screening results showed a long distance genetic linkage between Lr45 and the marker.The band was cloned and sequenced ,the full length 650 bp,which was different from the sequence am -plified in rye (643 bp),compared the two sequences by BLAST2 soft,the homology is 97%.16 of 100 wheat varie-ties were amplified the same bands as TcLr45.%  利用黑麦基因组特异 SCAR 标记对小麦抗叶锈病近等基因系材料 TcLr45和其背景材料 Thatcher 进行 PCR扩增,在 TcLr45中获得了单一条带,而在 Thatcher 中则扩增出2条与其大小不同的条带。进一步利用49个小麦抗叶锈近等基因系进行扩增,经5%聚丙烯酰胺凝胶电泳分析,该片段为 TcLr45特有片段。经 TcLr45×Thatcher F2分离群体验证,该标记与 Lr45基因连锁距离较远。对该片段进行克隆测序,片段长度为650 bp,与该引物在黑麦中的扩增序列有差异(643 bp),进一步经 BLAST2对这2个序列分析,相似性为97%,表明该片段为由黑麦向小麦转移的外源片段。100个小麦品种检测中有16个品种扩增出与 TcLr45相同的条带。

  15. Evaluation of the safety of ancient strains of wheat in coeliac disease reveals heterogeneous small intestinal T cell responses suggestive of coeliac toxicity.

    Science.gov (United States)

    Šuligoj, Tanja; Gregorini, Armando; Colomba, Mariastella; Ellis, H Julia; Ciclitira, Paul J

    2013-12-01

    Coeliac disease is a chronic small intestinal immune-mediated enteropathy triggered by dietary gluten in genetically predisposed individuals. Since it is unknown if all wheat varieties are equally toxic to coeliac patients seven Triticum accessions showing different origin (ancient/modern) and ploidy (di-, tetra- hexaploid) were studied. Selected strains of wheat were ancient Triticum monococcum precoce (AA genome) and Triticum speltoides (BB genome), accessions of Triticum turgidum durum (AABB genome) including two ancient (Graziella Ra and Kamut) and two modern (Senatore Cappelli and Svevo) durum strains of wheat and Triticum aestivum compactum (AABBDD genome). Small intestinal gluten-specific T-cell lines generated from 13 coeliac patients were tested with wheat accessions by proliferation assays. All strains of wheat independent of ploidy or ancient/modern origin triggered heterogeneous responses covering wide ranges of stimulation indices. Ancient strains of wheat, although previously suggested to be low or devoid of coeliac toxicity, should be tested for immunogenicity using gluten-specific T-cell lines from multiple coeliac patients rather than gluten-specific clones to assess their potential toxicity. Our findings provide further evidence for the need for a strict gluten-free diet in coeliac patients, including avoidance of ancient strains of wheat. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  16. Characterization of wheat-Secale africanum chromosome 5R(a) derivatives carrying Secale specific genes for grain hardness.

    Science.gov (United States)

    Li, Guangrong; Gao, Dan; La, Shixiao; Wang, Hongjin; Li, Jianbo; He, Weilin; Yang, Ennian; Yang, Zujun

    2016-05-01

    New wheat- Secale africanum chromosome 5R (a) substitution and translocation lines were developed and identified by fluorescence in situ hybridization and molecular markers, and chromosome 5R (a) specific genes responsible for grain hardness were isolated. The wild species, Secale africanum Stapf. (genome R(a)R(a)), serves as a valuable germplasm resource for increasing the diversity of cultivated rye (S. cereale L., genome RR) and providing novel genes for wheat improvement. In the current study, fluorescence in situ hybridization (FISH) and molecular markers were applied to characterize new wheat-S. africanum chromosome 5R(a) derivatives. Labeled rye genomic DNA (GISH) and the Oligo-probes pSc119.2 and pTa535 (FISH) were used to study a wheat-S. africanum amphiploid and a disomic 5R(a) (5D) substitution, and to identify a T5DL.5R(a)S translocation line and 5R(a)S and 5R(a)L isotelosome lines. Twenty-one molecular markers were mapped to chromosome 5R(a) arms which will facilitate future rapid identification of 5R(a) introgressions in wheat backgrounds. Comparative analysis of the molecular markers mapped on 5R(a) with homoeologous regions in wheat confirmed a deletion on the chromosome T5DL.5R(a)S, which suggests that the wheat-S. africanum Robertsonian translocation involving homologous group 5 may not be fully compensating. Complete coding sequences at the paralogous puroindoline-a (Pina) and grain softness protein gene (Gsp-1) loci from S. africanum were cloned and localized onto the short arm of chromosome 5R(a). The S. africanum chromosome 5R(a) substitution and translocation lines showed a reduction in the hardness index, which may be associated with the S. africanum- specific Pina and Gsp-1 gene sequences. The present study reports the production of novel wheat-S. africanum chromosome 5R(a) stripe rust resistant derivatives and new rye-specific molecular markers, which may find application in future use of wild Secale genome resources for grain quality

  17. Shortcomings in wheat yield predictions

    Science.gov (United States)

    Semenov, Mikhail A.; Mitchell, Rowan A. C.; Whitmore, Andrew P.; Hawkesford, Malcolm J.; Parry, Martin A. J.; Shewry, Peter R.

    2012-06-01

    Predictions of a 40-140% increase in wheat yield by 2050, reported in the UK Climate Change Risk Assessment, are based on a simplistic approach that ignores key factors affecting yields and hence are seriously misleading.

  18. Functional genomics strategies with transposons in rice

    NARCIS (Netherlands)

    Greco, R.

    2003-01-01

    Rice is a major staple food crop and a recognizedmonocotylenedousmodel plant from which gene function discovery is projected to contribute to improvements in a variety of cereals like wheat and maize. The recent release of rough drafts of the rice genome sequence for public

  19. Microencapsulation of wheat germ oil

    OpenAIRE

    Yazicioglu, Basak; Sahin, Serpil; Sumnu, Gulum

    2014-01-01

    Wheat germ oil (WGO) is beneficial for health since it is a rich source of omega-3, omega-6 and tocopherol. However, as it contains polyunsaturated fatty acids, it is prone to oxidation. The aim of this study was to encapsulate wheat germ oil and determine the effects of core to coating ratio, coating materials ratio and ultrasonication time on particle size distribution of emulsions and encapsulation efficiency (EE) and surface morphology of capsules. Maltodextrin (MD) and whey protein conce...

  20. A radiation hybrid map of chromosome ID reveals synteny conservation at a wheat speciation locus.

    Science.gov (United States)

    The species cytoplasm specific (scs) genes affect nuclear-cytoplasmic interactions in interspecific hybrids. A radiation hybrid (RH) mapping population of 188 individuals was employed to refine the location of the scsae locus of Tritcum aestivum chromosome 1D. ‘Wheat Zapper’, a comparative genomic...

  1. Functional analysis of the kinome of the wheat scab fungus Fusarium graminearum

    Science.gov (United States)

    As in many other eukaryotes, protein kinases play major regulatory roles in filamentous fungi. Although the genomes of numerous plant pathogenic fungi have been sequenced, systematic characterization of their kinomes has not been reported. The wheat scab fungus Fusarium graminearum has 116 putative ...

  2. Quantifying Phenotypic Plasticity Using Genetic Information for Simulating Plant Height in Winter Wheat

    Science.gov (United States)

    A challenge for crop simulation modeling is to incorporate existing and rapidly emerging genomic information into models to develop new and improved algorithms. The objective of this effort was to simulate plant height in winter wheat (Triticum aestivum L.) across a range of environments in Nebraska...

  3. WHEAT GRASS HEALTH BENEFITS

    Directory of Open Access Journals (Sweden)

    Akula Annapurna

    2013-10-01

    Full Text Available Nutraceutical is a food or food product that provides health and medical benefits, including the preventionand treatment of disease. Nutraceuticals are the products typically claim to prevent chronic diseases, improve health,delay the aging process, and increase life expectancy.Let us know something about one such nutraceutical.Wheatgrass is a commonly found herb in India contains enzymes like protease, cytrochrome, amylase, lipase,transhydrogenase and SOD (super oxide dismutase. Besides these enzymes, it also contains all the essential aminoacids especially alanine, asparatic acid, glutamic acid, arginine and serine, which are helpful in providing good amountof protein in body which builds and repair tissues. Wheatgrass contains chlorophyll and flavonoids in good amount.It also contains vitamins like vitamin A, vitamin C, and vitamin E and minerals like iron, calcium and magnesium.Chlorophyll has been shown to build red blood cells quickly,cures anemia, normalise blood pressure by dilating theblood vessels. Chlorophyll has been shown to produce an unfavourable environment for bacterial growth in the bodyand therefore effective in increasing the body's resistance to illness. Probably the most important benefit ofwheatgrass is, it is a cancer fighting agent. Many people strongly believe that the benefits of wheatgrass on cancerare real and that consuming wheat grass can help in the treatment and even in the prevention of cancer. Wheatgrassproduces an immunization effect against many dietary carcinogens..Additional benefits of wheatgrass are bettercomplexion and a healthy glow. The slowing of graying hair is also a benefit believed to come from wheatgrass. Wecan grow wheat grass in small cups, pots and trays very conveniently in our homes, so that we will have fresh juiceand powder with minimum cost.

  4. Dough Rheology and Wet Milling of Hard Waxy Wheat Flours

    Science.gov (United States)

    To realize the full potential of waxy wheat (Triticum aestivum L.), wet milling of waxy wheat flour to produce gluten and waxy wheat starch was investigated. Flours of six advanced lines of waxy hard wheats, one normal hard wheat (‘Karl 92’), and one partial waxy wheat (‘Trego’) were fractionated by...

  5. 19 CFR 19.32 - Wheat manipulation; reconditioning.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Wheat manipulation; reconditioning. 19.32 Section... Bonded for the Storage of Wheat § 19.32 Wheat manipulation; reconditioning. (a) The mixing, blending, or commingling of imported wheat and domestic wheat, or of imported wheat of different classes and grades, as...

  6. Characterization of Wheat Random Amplified Polymorphic DNA Markers Associated with the H11 Hessian Fly Resistance Gene

    Institute of Scientific and Technical Information of China (English)

    Dhia Bouktila; Maha Mezghani; Mohamed Marrakchi; Hanem Makni

    2006-01-01

    In Tunisia, the Hessian fly Mayetiola destructor Say is a major pest of durum wheat (Triticum durum Desf.)and bread wheat (T. aestivum L.). Genetic resistance is the most efficient and economical method of control of this pest. To date, 31 resistance genes, designated H1-H31, have been identified in wheat. These genes condition resistance to the insect genes responsible for virulence. Using wheat cultivars differing for the presence of an individual Hessian fly resistance gene and random amplified polymorphic DNA (RAPD) analysis,we have identified a polymorphic 386-bp DNA marker (Xgmib1-1A.1) associated with the H11 Hessian fly resistance gene. Blast analysis showed a high identity with a short region in the wild wheat (T. monococcum)genome, adjacent to the leaf rust resistance Lr10 gene. A genetic linkage was reported between this gene (Lr10) and Hessian fly response in wheat. These data were used for screening Hessian fly resistance in Tunisian wheat germplasm. Xgmib1-1A.1-like fragments were detected in four Tunisian durum and bread wheat varieties. Using these varieties in Hessian fly breeding programs in Tunisia would be of benefit in reducing the damage caused by this fly.

  7. [Aluminum induces chromosome aberrations in wheat root meristem cells].

    Science.gov (United States)

    Bulanova, N V; Synzynys, B I; Koz'min, G V

    2001-12-01

    The yield and pattern of chromosome structure aberrations in wheat seedlings treated with aluminum nitrate and aluminum sulfate at various concentrations have been determined by the anaphase method. Aluminum has a genotoxic effect causing genome, chromatid, and chromosome aberrations in apical root meristem cells. The relationship between the total yield of structural mutations and the aluminum concentration follows a bell-shaped curve. The mutagenic activity of aluminum nitrate peaks at 10(-3) mg/ml, which is twice as high as the permissible concentration limit (PCL) of aluminum in potable water. The maximum of the mutagenic activity of aluminum sulfate is observed at 5 x 10(-4) mg/ml, i.e., one PCL. Tap water boiled for 2 h in an aluminum vessel has virtually no genotoxic effect on wheat cells.

  8. Discovery of secondary metabolites from Bacillus spp. biocontrol strains using genome mining and mass spectroscopy

    Science.gov (United States)

    Genome sequencing, data mining and mass spectrometry were used to identify secondary metabolites produced by several Bacillus spp. biocontrol strains. These biocontrol strains have shown promise in managing Fusarium head blight in wheat. Draft genomes were produced and screened in silico using genom...

  9. Genome-wide characterization of microsatellites in Triticeae species: abundance, distribution and evolution

    Science.gov (United States)

    Deng, Pingchuan; Wang, Meng; Feng, Kewei; Cui, Licao; Tong, Wei; Song, Weining; Nie, Xiaojun

    2016-01-01

    Microsatellites are an important constituent of plant genome and distributed across entire genome. In this study, genome-wide analysis of microsatellites in 8 Triticeae species and 9 model plants revealed that microsatellite characteristics were similar among the Triticeae species. Furthermore, genome-wide microsatellite markers were designed in wheat and then used to analyze the evolutionary relationship of wheat and other Triticeae species. Results displayed that Aegilops tauschii was found to be the closest species to Triticum aestivum, followed by Triticum urartu, Triticum turgidum and Aegilops speltoides, while Triticum monococcum, Aegilops sharonensis and Hordeum vulgare showed a relatively lower PCR amplification effectivity. Additionally, a significantly higher PCR amplification effectivity was found in chromosomes at the same subgenome than its homoeologous when these markers were subjected to search against different chromosomes in wheat. After a rigorous screening process, a total of 20,666 markers showed high amplification and polymorphic potential in wheat and its relatives, which were integrated with the public available wheat markers and then anchored to the genome of wheat (CS). This study not only provided the useful resource for SSR markers development in Triticeae species, but also shed light on the evolution of polyploid wheat from the perspective of microsatellites. PMID:27561724

  10. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment.

  11. 75 FR 41963 - Wheat and Oilseed Programs; Durum Wheat Quality Program

    Science.gov (United States)

    2010-07-20

    ... Corporation 7 CFR Part 1413 RIN 0560-AH72 Wheat and Oilseed Programs; Durum Wheat Quality Program AGENCY: Farm... specific requirements for the Durum Wheat Quality Program (DWQP) authorized by the Food, Conservation, and... through 2012 to partially compensate producers for the cost of fungicides applied to durum wheat to...

  12. Wheat in the Mediterranean revisited - tetraploid wheat landraces assessed with elite bread wheat Single Nucleotide Polymorphism markers

    OpenAIRE

    Oliveira, Hugo R; Hagenblad, Jenny; Leino, Matti W.; Leigh, Fiona J; Lister, Diane L.; Peña-Chocarro, Leonor; Jones, Martin K.

    2014-01-01

    Abstract Background Single Nucleotide Polymorphism (SNP) panels recently developed for the assessment of genetic diversity in wheat are primarily based on elite varieties, mostly those of bread wheat. The usefulness of such SNP panels for studying wheat evolution and domestication has not yet been fully explored and ascertainment bias issues can potentially affect their applicability when studying landraces and tetraploid ancestors of bread wheat. We here evaluate whether population structure...

  13. Introgression of chromosome segments from multiple alien species in wheat breeding lines with wheat streak mosaic virus resistance.

    Science.gov (United States)

    Ali, N; Heslop-Harrison, Js Pat; Ahmad, H; Graybosch, R A; Hein, G L; Schwarzacher, T

    2016-08-01

    Pyramiding of alien-derived Wheat streak mosaic virus (WSMV) resistance and resistance enhancing genes in wheat is a cost-effective and environmentally safe strategy for disease control. PCR-based markers and cytogenetic analysis with genomic in situ hybridisation were applied to identify alien chromatin in four genetically diverse populations of wheat (Triticum aestivum) lines incorporating chromosome segments from Thinopyrum intermedium and Secale cereale (rye). Out of 20 experimental lines, 10 carried Th. intermedium chromatin as T4DL*4Ai#2S translocations, while, unexpectedly, 7 lines were positive for alien chromatin (Th. intermedium or rye) on chromosome 1B. The newly described rye 1RS chromatin, transmitted from early in the pedigree, was associated with enhanced WSMV resistance. Under field conditions, the 1RS chromatin alone showed some resistance, while together with the Th. intermedium 4Ai#2S offered superior resistance to that demonstrated by the known resistant cultivar Mace. Most alien wheat lines carry whole chromosome arms, and it is notable that these lines showed intra-arm recombination within the 1BS arm. The translocation breakpoints between 1BS and alien chromatin fell in three categories: (i) at or near to the centromere, (ii) intercalary between markers UL-Thin5 and Xgwm1130 and (iii) towards the telomere between Xgwm0911 and Xbarc194. Labelled genomic Th. intermedium DNA hybridised to the rye 1RS chromatin under high stringency conditions, indicating the presence of shared tandem repeats among the cereals. The novel small alien fragments may explain the difficulty in developing well-adapted lines carrying Wsm1 despite improved tolerance to the virus. The results will facilitate directed chromosome engineering producing agronomically desirable WSMV-resistant germplasm.

  14. Strategies for transferring resistance into wheat: from wide crosses to GM cassettes

    Directory of Open Access Journals (Sweden)

    Brande B. H. Wulff

    2014-12-01

    Full Text Available The domestication of wheat in the Fertile Crescent 10,000 years ago led to a genetic bottleneck. Modern agriculture has further narrowed the genetic base by introducing extreme levels of uniformity on a vast spatial and temporal scale. This reduction in genetic complexity renders the crop vulnerable to new and emerging pests and pathogens. The wild relatives of wheat represent an important source of genetic variation for disease resistance. For nearly a century farmers, breeders, and cytogeneticists have sought to access this variation for crop improvement. Several barriers restricting interspecies hybridization and introgression have been overcome, providing the opportunity to tap an extensive reservoir of genetic diversity. Resistance has been introgressed into wheat from at least 52 species from 13 genera, demonstrating the remarkable plasticity of the wheat genome and the importance of such natural variation in wheat breeding. Two main problems hinder the effective deployment of introgressed resistance genes for crop improvement: (1 the simultaneous introduction of genetically linked deleterious traits and (2 the rapid breakdown of resistance when deployed individually. In this review we discuss how recent advances in molecular genomics are providing new opportunities to overcome these problems.

  15. Molecular basis of adaptation to high soil boron in wheat landraces and elite cultivars.

    Science.gov (United States)

    Pallotta, Margaret; Schnurbusch, Thorsten; Hayes, Julie; Hay, Alison; Baumann, Ute; Paull, Jeff; Langridge, Peter; Sutton, Tim

    2014-10-02

    Environmental constraints severely restrict crop yields in most production environments, and expanding the use of variation will underpin future progress in breeding. In semi-arid environments boron toxicity constrains productivity, and genetic improvement is the only effective strategy for addressing the problem. Wheat breeders have sought and used available genetic diversity from landraces to maintain yield in these environments; however, the identity of the genes at the major tolerance loci was unknown. Here we describe the identification of near-identical, root-specific boron transporter genes underlying the two major-effect quantitative trait loci for boron tolerance in wheat, Bo1 and Bo4 (ref. 2). We show that tolerance to a high concentration of boron is associated with multiple genomic changes including tetraploid introgression, dispersed gene duplication, and variation in gene structure and transcript level. An allelic series was identified from a panel of bread and durum wheat cultivars and landraces originating from diverse agronomic zones. Our results demonstrate that, during selection, breeders have matched functionally different boron tolerance alleles to specific environments. The characterization of boron tolerance in wheat illustrates the power of the new wheat genomic resources to define key adaptive processes that have underpinned crop improvement.

  16. Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat.

    Science.gov (United States)

    Aggarwal, R; Gupta, S; Banerjee, S; Singh, V B

    2011-11-01

    Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

  17. Genetic Architecture of Anther Extrusion in Spring and Winter Wheat

    Directory of Open Access Journals (Sweden)

    Quddoos H. Muqaddasi

    2017-05-01

    Full Text Available Hybrid wheat breeding is gaining prominence worldwide because it ensures higher and more static yield than conventionally bred varieties. The cleistogamous floral architecture of wheat (Triticum aestivum L. impedes anthers inside the floret, making it largely an inbreeder. For hybrid seed production, high anther extrusion is needed to promote cross pollination and to ensure a high level of pollen availability for the seed plant. This study, therefore, aimed at the genetic dissection of anther extrusion (AE in panels of spring (SP, and winter wheat (WP accessions by genome wide association studies (GWAS. We performed GWAS to identify the SNP markers potentially linked with AE in each panel separately. Phenotypic data were collected for 3 years for each panel. The average levels of Pearson's correlation (r among all years and their best linear unbiased estimates (BLUEs within both panels were high (r(SP = 0.75, P < 0.0001;r(WP = 0.72, P < 0.0001. Genotypic data (with minimum of 0.05 minor allele frequency applied included 12,066 and 12,191 SNP markers for SP and WP, respectively. Both genotypes and environment influenced the magnitude of AE. In total, 23 significant (|log10(P| > 3.0 marker trait associations (MTAs were detected (SP = 11; WP = 12. Anther extrusion behaved as a complex trait with significant markers having either favorable or unfavorable additive effects and imparting minor to moderate levels of phenotypic variance (R2(SP = 9.75−14.24%; R2 (WP = 9.44−16.98%. All mapped significant markers as well as the markers within their significant linkage disequilibrium (r2 ≥ 0.30 regions were blasted against wheat genome assembly (IWGSC1+popseq to find the corresponding genes and their high confidence descriptions were retrieved. These genes and their orthologs in Hordeum vulgare, Brachypodium distachyon, Oryza sativa, and Sorghum bicolor revealed syntenic genomic regions potentially involved in flowering-related traits. Moreover, the

  18. Allelic variations and differential expressions detected at quantitative trait loci for salt stress tolerance in wheat.

    Science.gov (United States)

    Oyiga, Benedict C; Sharma, Ram C; Baum, Michael; Ogbonnaya, Francis C; Léon, Jens; Ballvora, Agim

    2017-01-03

    The increasing salinization of agricultural lands is a threat to global wheat production. Understanding of the mechanistic basis of salt tolerance (ST) is essential for developing breeding and selection strategies that would allow for increased wheat production under saline conditions to meet the increasing global demand. We used a set that consists of 150 internationally derived winter and facultative wheat cultivars genotyped with a 90K SNP chip and phenotyped for ST across three growth stages and for ionic (leaf K(+) and Na(+)  contents) traits to dissect the genetic architecture regulating ST in wheat. Genome-wide association mapping revealed 187 Single Nucleotide Polymorphism (SNPs) (R(2)  = 3.00-30.67%), representing 37 quantitative trait loci (QTL), significantly associated with the ST traits. Of these, four QTL on 1BS, 2AL, 2BS and 3AL were associated with ST across the three growth stages and with the ionic traits. Novel QTL were also detected on 1BS and 1DL. Candidate genes linked to these polymorphisms were uncovered, and expression analyses were performed and validated on them under saline and non-saline conditions using transcriptomics and qRT-PCR data. Expressed sequence comparisons in contrasting ST wheat genotypes identified several non-synonymous/missense mutation sites that are contributory to the ST trait variations, indicating the biological relevance of these polymorphisms that can be exploited in breeding for ST in wheat. © 2017 The Authors. Plant, Cell & Environment published by John Wiley & Sons Ltd.

  19. Duplication and partitioning in evolution and function of homoeologous Q loci governing domestication characters in polyploid wheat

    Science.gov (United States)

    Zhang, Zengcui; Belcram, Harry; Gornicki, Piotr; Charles, Mathieu; Just, Jérémy; Huneau, Cécile; Magdelenat, Ghislaine; Couloux, Arnaud; Samain, Sylvie; Gill, Bikram S.; Rasmussen, Jack B.; Barbe, Valérie; Faris, Justin D.; Chalhoub, Boulos

    2011-01-01

    The Q gene encodes an AP2-like transcription factor that played an important role in domestication of polyploid wheat. The chromosome 5A Q alleles (5AQ and 5Aq) have been well studied, but much less is known about the q alleles on wheat homoeologous chromosomes 5B (5Bq) and 5D (5Dq). We investigated the organization, evolution, and function of the Q/q homoeoalleles in hexaploid wheat (Triticum aestivum L.). Q/q gene sequences are highly conserved within and among the A, B, and D genomes of hexaploid wheat, the A and B genomes of tetraploid wheat, and the A, S, and D genomes of the diploid progenitors, but the intergenic regions of the Q/q locus are highly divergent among homoeologous genomes. Duplication of the q gene 5.8 Mya was likely followed by selective loss of one of the copies from the A genome progenitor and the other copy from the B, D, and S genomes. A recent V329-to-I mutation in the A lineage is correlated with the Q phenotype. The 5Bq homoeoalleles became a pseudogene after allotetraploidization. Expression analysis indicated that the homoeoalleles are coregulated in a complex manner. Combined phenotypic and expression analysis indicated that, whereas 5AQ plays a major role in conferring domestication-related traits, 5Dq contributes directly and 5Bq indirectly to suppression of the speltoid phenotype. The evolution of the Q/q loci in polyploid wheat resulted in the hyperfunctionalization of 5AQ, pseudogenization of 5Bq, and subfunctionalization of 5Dq, all contributing to the domestication traits. PMID:22042872

  20. Identification and Phylogenetic Analysis of a CC-NBS-LRR Encoding Gene Assigned on Chromosome 7B of Wheat

    Directory of Open Access Journals (Sweden)

    Xiangqi Zhang

    2013-07-01

    Full Text Available Hexaploid wheat displays limited genetic variation. As a direct A and B genome donor of hexaploid wheat, tetraploid wheat represents an important gene pool for cultivated bread wheat. Many disease resistant genes express conserved domains of the nucleotide-binding site and leucine-rich repeats (NBS-LRR. In this study, we isolated a CC-NBS-LRR gene locating on chromosome 7B from durum wheat variety Italy 363, and designated it TdRGA-7Ba. Its open reading frame was 4014 bp, encoding a 1337 amino acid protein with a complete NBS domain and 18 LRR repeats, sharing 44.7% identity with the PM3B protein. TdRGA-7Ba expression was continuously seen at low levels and was highest in leaves. TdRGA-7Ba has another allele TdRGA-7Bb with a 4 bp deletion at position +1892 in other cultivars of tetraploid wheat. In Ae. speltoides, as a B genome progenitor, both TdRGA-7Ba and TdRGA-7Bb were detected. In all six species of hexaploid wheats (AABBDD, only TdRGA-7Bb existed. Phylogenic analysis showed that all TdRGA-7Bb type genes were grouped in one sub-branch. We speculate that TdRGA-7Bb was derived from a TdRGA-7Ba mutation, and it happened in Ae. speltoides. Both types of TdRGA-7B participated in tetraploid wheat formation. However, only the TdRGA-7Bb was retained in hexaploid wheat.

  1. Development of an ultra-dense genetic map of the sunflower genome based on single-feature polymorphisms.

    Directory of Open Access Journals (Sweden)

    John E Bowers

    Full Text Available The development of ultra-dense genetic maps has the potential to facilitate detailed comparative genomic analyses and whole genome sequence assemblies. Here we describe the use of a custom Affymetrix GeneChip containing nearly 2.4 million features (25 bp sequences targeting 86,023 unigenes from sunflower (Helianthus annuus L. and related species to test for single-feature polymorphisms (SFPs in a recombinant inbred line (RIL mapping population derived from a cross between confectionery and oilseed sunflower lines (RHA280×RHA801. We then employed an existing genetic map derived from this same population to rigorously filter out low quality data and place 67,486 features corresponding to 22,481 unigenes on the sunflower genetic map. The resulting map contains a substantial fraction of all sunflower genes and will thus facilitate a number of downstream applications, including genome assembly and the identification of candidate genes underlying QTL or traits of interest.

  2. Molecular Cytogenetic Characterization of Wheat-Thinopyrum elongatum Addition, Substitution and Translocation Lines with a Novel Source of Resistance to Wheat Fusarium Head Blight

    Institute of Scientific and Technical Information of China (English)

    Shulan Fu; Zhenling Lv; Bao Qi; Xiang Guo; Jun Li; Bao Liu; Fangpu Han

    2012-01-01

    Thinopyrum elongatum (2n =2x =14,EE),a wild relative of wheat,has been suggested as a potentially novel source of resistance to several major wheat diseases including Fusarium Head Blight (FHB).In this study,a series of wheat (cv.Chinese Spring,CS) substitution and ditelosomic lines,including Th.elongatum additions,were assessed for Type Ⅱ resistance to FHB.Results indicated that the lines containing chromosome 7E of Th.elongatum gave a high level of resistance to FHB,wherein the infection did not spread beyond the inoculated floret.Furthermore,it was determined that the novel resistance gene(s) of 7E was located on the short-arm (7ES) based on sharp difference in FHB resistance between the two 7E ditelosomic lines for each arm.On the other hand,Th.elongatum chromosomes 5E and 6E likely contain gene(s) for susceptibility to FHB because the disease spreads rapidly within the inoculated spikes of these lines.Genomic in situ hybridization (GISH) analysis revealed that the alien chromosomes in the addition and substitution lines were intact,and the lines did not contain discernible genomic aberrations.GISH and multicolor-GISH analyses were further performed on three translocation lines that also showed high levels of resistance to FHB.Lines TA3499 and TA3695 were shown to contain one pair of wheat-Th.elongatum translocated chromosomes involving fragments of 7D plus a segment of the 7E,while line TA3493 was found to contain one pair of wheat-Th.elongatum translocated chromosomes involving the D- and A-genome chromosomes of wheat.Thus,this study has established that the short-arm of chromosome 7E of Th.elongatum harbors gene(s) highly resistant to the spreading of FHB,and chromatin of 7E introgressed into wheat chromosomes largely retained the resistance,implicating the feasibility of using these lines as novel material for breeding FHB-resistant wheat cultivars.

  3. Soft durum wheat - a paradigm shift

    Science.gov (United States)

    Two traits define most aspects of wheat quality and utilization: kernel texture (hardness) and gluten. The former is far simpler genetically and is controlled by two genes, Puroindoline a and Puroindoline b. Durum wheat lacks puroindolines and has very hard kernels. As such, durum wheat when milled ...

  4. Growing Wheat. People on the Farm.

    Science.gov (United States)

    Department of Agriculture, Washington, DC. Office of Governmental and Public Affairs.

    This booklet, one in a series about life on modern farms, describes the daily life of the Don Riffel family, wheat farmers in Kansas. Beginning with early morning, the booklet traces the family's activities through a typical harvesting day in July, while explaining how a wheat farm is run. The booklet also briefly describes the wheat growing…

  5. The value of wheat landraces (Editorial)

    Science.gov (United States)

    Whether man was domesticated by wheat, or wheat was domesticated by man is but two faces of the same coin; both incidents marked a turning point in human history and led to the emergence of human civilization in the Fertile Crescent of the Old World. The complex history of wheat domestication from i...

  6. Hard Spring Wheat Technical Committee 2016 Crop

    Science.gov (United States)

    Seven experimental lines of hard spring wheat were grown at up to five locations in 2016 and evaluated for kernel, milling, and bread baking quality against the check variety Glenn. Wheat samples were submitted through the Wheat Quality Council and processed and milled at the USDA-ARS Hard Red Spri...

  7. Biotechnology Assisted Wheat Breeding for Organic Agriculture

    DEFF Research Database (Denmark)

    Steffan, Philipp Matthias

    Common bunt of wheat is a major seed borne disease of wheat worldwide. It is of particular importance to organic farming, where systemic fungicides cannot be applied. The knowledge about location and mechanisms of common bunt resistance in wheat is limited, and only three race specific genes have...

  8. Biotechnology Assisted Wheat Breeding for Organic Agriculture

    DEFF Research Database (Denmark)

    Steffan, Philipp Matthias

    Common bunt of wheat is a major seed borne disease of wheat worldwide. It is of particular importance to organic farming, where systemic fungicides cannot be applied. The knowledge about location and mechanisms of common bunt resistance in wheat is limited, and only three race specific genes have...

  9. Functional analysis of a cinnamyl alcohol dehydrogenase involved in lignin biosynthesis in wheat.

    Science.gov (United States)

    Ma, Qing-Hu

    2010-06-01

    Cinnamyl alcohol dehydrogenase (CAD) catalyses the final step in the biosynthesis of monolignols. In the present study, a cDNA encoding a CAD was isolated from wheat, designated as TaCAD1. A genome-wide data mining in the wheat EST database revealed another 10 CAD-like homologues, namely TaCAD2 to TaCAD11. A phylogenetic analysis showed that TaCAD1 belonged to the bona fide CAD group involved in lignin synthesis. Two other putative CADs from the wheat genome (TaCAD2 and TaCAD4) also belonged to this group and were very close to TaCAD1, but lacked C-terminal domain, suggesting that they are pseudogenes. DNA gel blot analysis for the wheat genome showed two to three copies of CAD related to TaCAD1, but RNA gel blot analysis revealed only single band for TaCAD1, which was highly expressed in stem, with quite low expression in leaf and undetectable expression in root. The predicted three-dimension structure of TaCAD1 resembled that of AtCAD5, but two amino acid substitutions were identified in the substrate binding region. Recombinant TaCAD1 protein used coniferyl aldehyde as the most favoured substrate, also showed high efficiencies toward sinapyl and p-coumaryl aldehydes. TaCAD1 was an enzyme being pH-dependent and temperature-sensitive, and showing a typical random catalysing mechanism. At the milky stage of wheat, TaCAD1 mRNA abundance, protein level and enzyme activity in stem tissues were higher in a lodging-resistant cultivar (H4546) than in lodging-sensitive cultivar (C6001). These properties were correlated to the lignin contents and lodging indices of the two cultivars. These data suggest that TaCAD1 is the predominant CAD in wheat stem for lignin biosynthesis and is critical for lodging resistance.

  10. Screening for Kaposi sarcoma-associated genes by using Genechip technology%基因芯片表达谱筛选Kaposi肉瘤相关基因

    Institute of Scientific and Technical Information of China (English)

    王慧; 吕国栋; 王晓东; 惠艳; 刘辉; 林仁勇; 王星

    2011-01-01

    Objective To screen for Kaposi sarcoma (KS)-related genes. Methods Tissue samples were obtained from the lesion and normal skin of a patient with KS in Xinjiang Uygur Autonomous Region,and total RNA was extracted from these samples and reverse transcribed into cDNA. Real-time fluorescent quantitative reverse transcription PCR (RT-qPCR) was performed to determine the expression of K8.1, K2 and ORF50 in these samples. The cDNA was labeled with fluorescein and hybridized to a human 35K genome array containing 25 100 genes. Subsequently, the signal images were scanned by a laser scanner and acquired images were analyzed by software. Results RT-qPCR revealed the mRNA expression of K8.1, K2 and ORF50 in the KS tissues but not in the normal skin tissues, indicating that there was no crossed contamination in these specimens. Among the 25 100 genes, 1313 genes were identified to be differentially expressed between KS and normal skin tissues, including 756 up-regulated genes and 557 down-regulated genes. These differentially expressed genes, such as myeloid cell leukemia-1 gene (MCI-1), annexins (ANX) and serine proteinase inhibitor Kazal type 5 (SPINK5), were associated with apoptosis, angiogenesis, cell signaling, protein processing, cell cycle regulation, and so on. Conclusion The differentially expressed genes such as MCI-1 and SPINK5 may be associated with the development of KS.%目的 筛选Kaposi肉瘤相关基因.方法 新疆本地1例经典型Kaposi肉瘤患者,提取病灶组织及正常皮肤组织的总RNA,逆转录成cDNA,采用实时荧光定量PCR(RT-qPCR)的方法检测Kaposi肉瘤相关疱疹病毒(Kaposi sarcoma-associated herpersivims,KSHV)基因K8.1、K2、ORF50在组织中的表达来确定所取标本有无交叉污染.随后进行荧光标记制备探针,与含有25100条人类基因的35KcDNA基因表达谱芯片进行杂交,用扫描仪扫描芯片荧光信号图像,并用软件对扫描图像进行数字化处理和分析.结果 RT-qPCR检测

  11. In search of tetraploid wheat accessions reduced in celiac disease-related gluten epitopes.

    Science.gov (United States)

    van den Broeck, Hetty; Hongbing, Chen; Lacaze, Xavier; Dusautoir, Jean-Claude; Gilissen, Ludovicus; Smulders, Marinus; van der Meer, Ingrid

    2010-11-01

    Tetraploid wheat (durum wheat) is mainly used for the preparation of pasta. As a result of breeding, thousands of tetraploid wheat varieties exist, but also tetraploid landraces are still maintained and used for local food preparations. Gluten proteins present in wheat can induce celiac disease, a T-cell mediated auto-immune disorder, in genetically predisposed individuals after ingestion. Compared to hexaploid wheat, tetraploid wheat might be reduced in T-cell stimulatory epitopes that cause celiac disease because of the absence of the D-genome. We tested gluten protein extracts from 103 tetraploid wheat accessions (obtained from the Dutch CGN genebank and from the French INRA collection) including landraces, old, modern, and domesticated accessions of various tetraploid species and subspecies from many geographic origins. Those accessions were typed for their level of T-cell stimulatory epitopes by immunoblotting with monoclonal antibodies against the α-gliadin epitopes Glia-α9 and Glia-α20. In the first selection, we found 8 CGN and 6 INRA accessions with reduced epitope staining. Fourteen of the 57 CGN accessions turned out to be mixed with hexaploid wheat, and 5 out of the 8 selected CGN accessions were mixtures of two or more different gluten protein chemotypes. Based on single seed analysis, lines from two CGN accessions and one INRA accession were obtained with significantly reduced levels of Glia-α9 and Glia-α20 epitopes. These lines will be further tested for industrial quality and may contribute to the development of safer foods for celiac patients.

  12. De Novo Assembly and Transcriptome Analysis of Wheat with Male Sterility Induced by the Chemical Hybridizing Agent SQ-1.

    Directory of Open Access Journals (Sweden)

    Qidi Zhu

    Full Text Available Wheat (Triticum aestivum L., one of the world's most important food crops, is a strictly autogamous (self-pollinating species with exclusively perfect flowers. Male sterility induced by chemical hybridizing agents has increasingly attracted attention as a tool for hybrid seed production in wheat; however, the molecular mechanisms of male sterility induced by the agent SQ-1 remain poorly understood due to limited whole transcriptome data. Therefore, a comparative analysis of wheat anther transcriptomes for male fertile wheat and SQ-1-induced male sterile wheat was carried out using next-generation sequencing technology. In all, 42,634,123 sequence reads were generated and were assembled into 82,356 high-quality unigenes with an average length of 724 bp. Of these, 1,088 unigenes were significantly differentially expressed in the fertile and sterile wheat anthers, including 643 up-regulated unigenes and 445 down-regulated unigenes. The differentially expressed unigenes with functional annotations were mapped onto 60 pathways using the Kyoto Encyclopedia of Genes and Genomes database. They were mainly involved in coding for the components of ribosomes, photosynthesis, respiration, purine and pyrimidine metabolism, amino acid metabolism, glutathione metabolism, RNA transport and signal transduction, reactive oxygen species metabolism, mRNA surveillance pathways, protein processing in the endoplasmic reticulum, protein export, and ubiquitin-mediated proteolysis. This study is the first to provide a systematic overview comparing wheat anther transcriptomes of male fertile wheat with those of SQ-1-induced male sterile wheat and is a valuable source of data for future research in SQ-1-induced wheat male sterility.

  13. RNA-Seq Analysis Provides the First Insights into the Phylogenetic Relationship and Interspecific Variation between Agropyron cristatum and Wheat

    Directory of Open Access Journals (Sweden)

    Shenghui Zhou

    2017-09-01

    Full Text Available Agropyron cristatum, which is a wild grass of the tribe Triticeae, grows widely in harsh environments and provides many desirable genetic resources for wheat improvement. However, unclear interspecific phylogeny and genome-wide variation has limited the utilization of A. cristatum in the production of superior wheat varieties. In this study, by sequencing the transcriptome of the representative tetraploid A. cristatum Z559 and the common wheat variety Fukuhokomugi (Fukuho, which are often used as parents in a wide cross, their phylogenetic relationship and interspecific variation were dissected. First, 214,854 transcript sequences were assembled, and 3,457 orthologous genes related to traits of interest were identified in A. cristatum. Second, a total of 72 putative orthologous gene clusters were used to construct phylogenetic relationships among A. cristatum, Triticeae and other genomes. A clear division between A. cristatum and the other Triticeae species was revealed. Third, the sequence similarity of most genes related to traits of interest is greater than 95% between A. cristatum and wheat. Therefore, using the 5% mismatch parameter for A. cristatum, we mapped the transcriptome sequencing data to wheat reference sequences to discover the variations between A. cristatum and wheat and 862,340 high-quality variants were identified. Additionally, compared with the wheat A and B genomes, the P and D genomes displayed an obviously larger variant density and a longer evolutionary distance, suggesting that A. cristatum is more distantly related to the wheat D genome. Finally, by using Kompetitive Allele Specific PCR array (KASPar technology, 37 of 53 (69.8% SNPs were shown to be genuine in Z559, Fukuho, and additional lines with seven different P chromosomes, and function of the genes in which these SNPs are located were also determined. This study provides not only the first insights into the phylogenetic relationships between the P genome and

  14. [Analysis of allelic content of genes responsible for baking properties in allocytoplasmic wheat hybrids].

    Science.gov (United States)

    Klimushina, M V; Divashuk, M G; Mukhammed, T A K; Semenov, O G; Karlov, G I

    2013-05-01

    A collection comprised of allocytoplasmic hybrids of mild wheat (ACPH) was screened for the allelic state of genes responsible for baking properties (high-molecular glutenins, puroindolines, and Waxy). The possibility of the introgression of the Waxy gene of T. timopheevii into the mild wheat genome was demonstrated in several ACPH samples using the set of molecular markers. Allelic gene variants responsible for the baking properties were revealed for 22 ACPH samples, which make it possible to detect the most challenging samples for both molecular-genetic research and applied science.

  15. [Transformation of common wheat (Triticum aestivum L.) with herbicide-resistant EPSPs gene].

    Science.gov (United States)

    Chen, L H; Wang, X W; Zhang, W J; Zhang, X D; Hu, D F; Liu, G T

    1999-01-01

    The herbicide-resistant EPSPs (5-enolpyruvylshikimate-3-phosphate synthase) gene was transformed into about 1,000 young spikes and 800 young embryos of wheat variety, Jinghua 1, with gene gun. Thirty-eight and four regenerated plants were obtained respectively screened with glyphosate. All regenerated plants were analysed by PCR and/or Southern blotting. The results indicated that EPSPs gene was integrated stably into the genome of Jinghua 1, and some of the transformants showed fertile. So herbicide-resistant EPSPs gene could be used as selective marker in the transformation of monocotyledon cereal crops, such as wheat.

  16. [Comparative molecular cytogenetic characterization of partial wheat-wheatgrass hybrids].

    Science.gov (United States)

    Krupin, P Yu; Divashuk, M G; Belov, V I; Glukhova, L I; Aleksandrov, O S; Karlov, G I

    2011-04-01

    The chromosomal composition of the Zernokormovaya 169, Istra 1, Ostankinskaya, and Otrastayushchaya 38 cultivars of octoploid partial wheat-wheatgrass hybrids was studied using genomic in situ hybridization (GISH). Differentiation of wheatgrass chromosomes by the distribution of the GISH signal along the chromosome was revealed. The wheatgrass chromosomes of the hybrid cultivars studied in the work differed in the type of differentiation, centromeric index, and absolute size. The cytogenetic distinctions of these chromosomes revealed by us can be used in making crosses and in studying the transmission through gametes of additional wheatgrass chromosomes.

  17. Adverse Effects of Wheat Gluten.

    Science.gov (United States)

    Koning, Frits

    2015-01-01

    Man began to consume cereals approximately 10,000 years ago when hunter-gatherers settled in the fertile golden crescent in the Middle East. Gluten has been an integral part of the Western type of diet ever since, and wheat consumption is also common in the Middle East, parts of India and China as well as Australia and Africa. In fact, the food supply in the world heavily depends on the availability of cereal-based food products, with wheat being one of the largest crops in the world. Part of this is due to the unique properties of wheat gluten, which has a high nutritional value and is crucial for the preparation of high-quality dough. In the last 10 years, however, wheat and gluten have received much negative attention. Many believe that it is inherently bad for our health and try to avoid consumption of gluten-containing cereals; a gluten-low lifestyle so to speak. This is fueled by a series of popular publications like Wheat Belly; Lose the Wheat, Lose the Weight, and Find Your Path Back to Health. However, in reality, there is only one condition where gluten is definitively the culprit: celiac disease (CD), affecting approximately 1% of the population in the Western world. Here, I describe the complexity of the cereals from which gluten is derived, the special properties of gluten which make it so widely used in the food industry, the basis for its toxicity in CD patients and the potential for the development of safe gluten and alternatives to the gluten-free diet.

  18. Genotyping-by-Sequencing derived High-Density Linkage Map and its Application to QTL Mapping of Flag Leaf Traits in Bread Wheat

    Science.gov (United States)

    Hard red winter wheat parents ‘Harry’ (drought tolerant) and ‘Wesley’ (drought susceptible) was used to develop a recombinant inbred population to identify genomic regions associated with drought and adaptation. To precisely map genomic regions high-density linkage maps are a prerequisite. In this s...

  19. Rapid and targeted introgression of genes into popular wheat cultivars using marker-assisted background selection.

    Directory of Open Access Journals (Sweden)

    Harpinder S Randhawa

    Full Text Available A marker-assisted background selection (MABS-based gene introgression approach in wheat (Triticum aestivum L. was optimized, where 97% or more of a recurrent parent genome (RPG can be recovered in just two backcross (BC generations. A four-step MABS method was developed based on 'Plabsim' computer simulations and wheat genome structure information. During empirical optimization of this method, double recombinants around the target gene were selected in a step-wise fashion during the two BC cycles followed by selection for recurrent parent genotype on non-carrier chromosomes. The average spacing between carrier chromosome markers was <4 cM. For non-carrier chromosome markers that flanked each of the 48 wheat gene-rich regions, this distance was approximately 12 cM. Employed to introgress seedling stripe rust (Puccinia striiformis f. sp. tritici resistance gene Yr15 into the spring wheat cultivar 'Zak', marker analysis of 2,187 backcross-derived progeny resulted in the recovery of a BC(2F(2ratio3 plant with 97% of the recurrent parent genome. In contrast, only 82% of the recurrent parent genome was recovered in phenotypically selected BC(4F(7 plants developed without MABS. Field evaluation results from 17 locations indicated that the MABS-derived line was either equal or superior to the recurrent parent for the tested agronomic characteristics. Based on these results, MABS is recommended as a strategy for rapidly introgressing a targeted gene into a wheat genotype in just two backcross generations while recovering 97% or more of the recurrent parent genotype.

  20. Collinearity Analysis and High-Density Genetic Mapping of the Wheat Powdery Mildew Resistance Gene Pm40 in PI 672538.

    Science.gov (United States)

    Zhong, Shengfu; Ma, Lixia; Fatima, Syeda Akash; Yang, Jiezhi; Chen, Wanquan; Liu, Taiguo; Hu, Yuting; Li, Qing; Guo, Jingwei; Zhang, Min; Lei, Li; Li, Xin; Tang, Shengwen; Luo, Peigao

    2016-01-01

    The wheat powdery mildew resistance gene Pm40, which is located on chromosomal arm 7BS, is effective against nearly all prevalent races of Blumeria graminis f. sp tritici (Bgt) in China and is carried by the common wheat germplasm PI 672538. A set of the F1, F2 and F2:3 populations from the cross of the resistant PI 672538 with the susceptible line L1034 were used to conduct genetic analysis of powdery mildew resistance and construct a high-density linkage map of the Pm40 gene. We constructed a high-density linkage genetic map with a total length of 6.18 cM and average spacing between markers of 0.48 cM.Pm40 is flanked by Xwmc335 and BF291338 at genetic distances of 0.58 cM and 0.26 cM, respectively, in deletion bin C-7BS-1-0.27. Comparative genomic analysis based on EST-STS markers established a high level of collinearity of the Pm40 genomic region with a 1.09-Mbp genomic region on Brachypodium chromosome 3, a 1.16-Mbp genomic region on rice chromosome 8, and a 1.62-Mbp genomic region on sorghum chromosome 7. We further anchored the Pm40 target intervals to the wheat genome sequence. A putative linear index of 85 wheat contigs containing 97 genes on 7BS was constructed. In total, 9 genes could be considered as candidates for the resistances to powdery mildew in the target genomic regions, which encoded proteins that were involved in the plant defense and response to pathogen attack. These results will facilitate the development of new markers for map-based cloning and marker-assisted selection of Pm40 in wheat breeding programs.

  1. Collinearity Analysis and High-Density Genetic Mapping of the Wheat Powdery Mildew Resistance Gene Pm40 in PI 672538

    Science.gov (United States)

    Fatima, Syeda Akash; Yang, Jiezhi; Chen, Wanquan; Liu, Taiguo; Hu, Yuting; Li, Qing; Guo, Jingwei; Zhang, Min; Lei, Li; Li, Xin; Tang, Shengwen; Luo, Peigao

    2016-01-01

    The wheat powdery mildew resistance gene Pm40, which is located on chromosomal arm 7BS, is effective against nearly all prevalent races of Blumeria graminis f. sp tritici (Bgt) in China and is carried by the common wheat germplasm PI 672538. A set of the F1, F2 and F2:3 populations from the cross of the resistant PI 672538 with the susceptible line L1034 were used to conduct genetic analysis of powdery mildew resistance and construct a high-density linkage map of the Pm40 gene. We constructed a high-density linkage genetic map with a total length of 6.18 cM and average spacing between markers of 0.48 cM.Pm40 is flanked by Xwmc335 and BF291338 at genetic distances of 0.58 cM and 0.26 cM, respectively, in deletion bin C-7BS-1-0.27. Comparative genomic analysis based on EST-STS markers established a high level of collinearity of the Pm40 genomic region with a 1.09-Mbp genomic region on Brachypodium chromosome 3, a 1.16-Mbp genomic region on rice chromosome 8, and a 1.62-Mbp genomic region on sorghum chromosome 7. We further anchored the Pm40 target intervals to the wheat genome sequence. A putative linear index of 85 wheat contigs containing 97 genes on 7BS was constructed. In total, 9 genes could be considered as candidates for the resistances to powdery mildew in the target genomic regions, which encoded proteins that were involved in the plant defense and response to pathogen attack. These results will facilitate the development of new markers for map-based cloning and marker-assisted selection of Pm40 in wheat breeding programs. PMID:27755575

  2. Sequencing chromosome 5D of Aegilops tauschii and comparison with its allopolyploid descendant bread wheat (Triticum aestivum).

    Science.gov (United States)

    Akpinar, Bala A; Lucas, Stuart J; Vrána, Jan; Doležel, Jaroslav; Budak, Hikmet

    2015-08-01

    Flow cytometric sorting of individual chromosomes and chromosome-based sequencing reduces the complexity of large, repetitive Triticeae genomes. We flow-sorted chromosome 5D of Aegilops tauschii, the D genome donor of bread wheat and sequenced it by Roche 454 GS FLX platform to approximately 2.2x coverage. Repetitive sequences represent 81.09% of the survey sequences of this chromosome, and Class I retroelements are the prominent type, with a particular abundance of LTR/Gypsy superfamily. Nonrepetitive sequences were assembled to cover 17.76% of the total chromosome regions. Up to 6188 nonrepetitive gene loci were predicted to be encoded by the 5D chromosome. The numbers and chromosomal distribution patterns of tRNA genes suggest abundance in tRNA(L) (ys) and tRNA(M) (et) species, while the nonrepetitive assembly reveals tRNA(A) (la) species as the most abundant type. A comparative analysis of the genomic sequences of bread wheat and Aegilops chromosome 5D indicates conservation of gene content. Orthologous unique genes, matching Aegilops 5D sequences, numbered 3730 in barley, 5063 in Brachypodium, 4872 in sorghum and 4209 in rice. In this study, we provide a chromosome-specific view into the structure and organization of the 5D chromosome of Ae. tauschii, the D genome ancestor of bread wheat. This study contributes to our understanding of the chromosome-level evolution of the wheat genome and presents a valuable resource in wheat genomics due to the recent hybridization of Ae. tauschii genome with its tetraploid ancestor.

  3. Investigation of Seed Storage Proteins in some Wild Wheat Progenitors Using SDS-PAGE and ACID-PAGE

    Directory of Open Access Journals (Sweden)

    Omid SOFALIAN

    2009-06-01

    Full Text Available Wheat storage proteins accounted for up to 60% of the total grain proteins. They form gluten proteins, which make a visco-elastic network enables dough to be processed into bread, pasta and other products. In order to study genetic variation of wild wheat relatives, electrophoretic patterns of seed storage proteins, the high-molecular-weight glutenins and gliadins from about 12 wild species and some check improved cultivars were fractionated by SDS-PAGE and Acid-PAGE. The results showed some close relationship between T. urartu, T. dicoccum and bread wheat in the case of glutenin and gliadin. Therefore It was speculated that progenitor of A genome of cultivated wheat could be T. urartu strongly. A high level of polymorphism was detected in the glutenin and gliadin subunits of the wild wheat relatives, showing some similarities with cultivated bread wheat, useful breeding perspectives. The electrophoresis proved to be a suitable method to discriminate wheat variety and species. Also results of this study confirmed that the genetic variation amongst seed storage proteins of wild relatives were considerable. The wild progenitors are important genetic resources and therefore observed genetic variability could be use in any selection strategies.

  4. Association analysis of grain traits with SSR markers between Aegilops tauschii and hexaploid wheat (Triticum aestivumL.)

    Institute of Scientific and Technical Information of China (English)

    ZHAO Jing-lan; WANG Hong-wei; ZHANG Xiao-cun; DU Xu-ye; LI An-fei; KONG Ling-rang

    2015-01-01

    Seven important grain traits, including grain length (GL), grain width (GW), grain perimeter (GP), grain area (GA), grain length/width ratio (GLW), roundness (GR), and thousand-grain weight (TGW), were analyzed using a set of 139 simple sequence repeat (SSR) markers in 130 hexaploid wheat varieties and 193Aegilops tauschiaccessions worldwide. In total, 1612 aleles inAe. tauschiand 1360 aleles in hexaploid wheat (Triticum aestivumL.) were detected throughout the D genome. 197 marker-trait associations inAe. tauschi were identiifed with 58 different SSR loci in 3 environments, and the average phenotypic variation value (R2) ranged from 0.68 to 15.12%. In contrast, 208 marker-trait associations were identiifed in wheat with 66 different SSR markers in 4 environments and the average phenotypicR2ranged from 0.90 to 19.92%. Further analysis indicated that there are 6 common SSR loci present in bothAe. tauschi and hexaploid wheat, which are signiifcantly associated with the 5 investigated grain traits (i.e., GA, GP, GR, GL, and TGW) and in total, 16 aleles derived from the 6 aforementioned SSR loci were shared byAe. tauschi and hexaploid wheat. These preliminary data suggest the existence of common aleles may explain the evolutionary process and the selection betweenAe. tauschi and hexaploid wheat. Furthermore, the genetic differentiation of grain shape and thousand-grain weight were observed in the evolutionary developmental process fromAe. tauschi to hexaploid wheat.

  5. Reticulate evolution of the rye genome.

    Science.gov (United States)

    Martis, Mihaela M; Zhou, Ruonan; Haseneyer, Grit; Schmutzer, Thomas; Vrána, Jan; Kubaláková, Marie; König, Susanne; Kugler, Karl G; Scholz, Uwe; Hackauf, Bernd; Korzun, Viktor; Schön, Chris-Carolin; Dolezel, Jaroslav; Bauer, Eva; Mayer, Klaus F X; Stein, Nils

    2013-10-01

    Rye (Secale cereale) is closely related to wheat (Triticum aestivum) and barley (Hordeum vulgare). Due to its large genome (~8 Gb) and its regional importance, genome analysis of rye has lagged behind other cereals. Here, we established a virtual linear gene order model (genome zipper) comprising 22,426 or 72% of the detected set of 31,008 rye genes. This was achieved by high-throughput transcript mapping, chromosome survey sequencing, and integration of conserved synteny information of three sequenced model grass genomes (Brachypodium distachyon, rice [Oryza sativa], and sorghum [Sorghum bicolor]). This enabled a genome-wide high-density comparative analysis of rye/barley/model grass genome synteny. Seventeen conserved syntenic linkage blocks making up the rye and barley genomes were defined in comparison to model grass genomes. Six major translocations shaped the modern rye genome in comparison to a putative Triticeae ancestral genome. Strikingly dissimilar conserved syntenic gene content, gene sequence diversity signatures, and phylogenetic networks were found for individual rye syntenic blocks. This indicates that introgressive hybridizations (diploid or polyploidy hybrid speciation) and/or a series of whole-genome or chromosome duplications played a role in rye speciation and genome evolution.

  6. A wheat CCAAT box-binding transcription factor increases the grain yield of wheat with less fertilizer input.

    Science.gov (United States)

    Qu, Baoyuan; He, Xue; Wang, Jing; Zhao, Yanyan; Teng, Wan; Shao, An; Zhao, Xueqiang; Ma, Wenying; Wang, Junyi; Li, Bin; Li, Zhensheng; Tong, Yiping

    2015-02-01

    Increasing fertilizer consumption has led to low fertilizer use efficiency and environmental problems. Identifying nutrient-efficient genes will facilitate the breeding of crops with improved fertilizer use efficiency. This research performed a genome-wide sequence analysis of the A (NFYA), B (NFYB), and C (NFYC) subunits of Nuclear Factor Y (NF-Y) in wheat (Triticum aestivum) and further investigated their responses to nitrogen and phosphorus availability in wheat seedlings. Sequence mining together with gene cloning identified 18 NFYAs, 34 NFYBs, and 28 NFYCs. The expression of most NFYAs positively responded to low nitrogen and phosphorus availability. In contrast, microRNA169 negatively responded to low nitrogen and phosphorus availability and degraded NFYAs. Overexpressing TaNFYA-B1, a low-nitrogen- and low-phosphorus-inducible NFYA transcript factor on chromosome 6B, significantly increased both nitrogen and phosphorus uptake and grain yield under differing nitrogen and phosphorus supply levels in a field experiment. The increased nitrogen and phosphorus uptake may have resulted from the fact that that overexpressing TaNFYA-B1 stimulated root development and up-regulated the expression of both nitrate and phosphate transporters in roots. Our results suggest that TaNFYA-B1 plays essential roles in root development and in nitrogen and phosphorus usage in wheat. Furthermore, our results provide new knowledge and valuable gene resources that should be useful in efforts to breed crops targeting high yield with less fertilizer input.

  7. 7 CFR 810.2201 - Definition of wheat.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Definition of wheat. 810.2201 Section 810.2201... GRAIN United States Standards for Wheat Terms Defined § 810.2201 Definition of wheat. Grain that, before the removal of dockage, consists of 50 percent or more common wheat (Triticum aestivum L.), club wheat...

  8. Multimodel ensembles of wheat growth

    DEFF Research Database (Denmark)

    Martre, Pierre; Wallach, Daniel; Asseng, Senthold

    2015-01-01

    , but such studies are difficult to organize and have only recently begun. We report on the largest ensemble study to date, of 27 wheat models tested in four contrasting locations for their accuracy in simulating multiple crop growth and yield variables. The relative error averaged over models was 24...

  9. IPR 118 - Bread wheat cultivar

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Riede

    2007-01-01

    Full Text Available Wheat cultivar IPR 118 developed by IAPAR has a good yield potential and is widely adapted. It is earlymaturing and moderately tolerant to shattering and soil aluminum, moderately resistant to leaf rust and presents high glutenstrength for bread-making. The overall yield exceeded controls by 13%.

  10. WHEAT FLOUR (DUBBIE) IN RATS

    African Journals Online (AJOL)

    food product to be widely distributed was a blend of wheat, defatted soy flour, .... drops of blood from the retroocular capillary bed (under light diethyl ether ..... Bioavaiiability to rats of the iron contents in selected cereals and pulses. Nutr. Rep.

  11. Directional transduction of male sterile gene rfv1 of NIAN type in wheat

    Institute of Scientific and Technical Information of China (English)

    Na NIU; Gaisheng ZHANG; Yue CAO; Yu ZHANG; Fang WEI

    2008-01-01

    A new method for producing a NIAN type wheat maintenance line with the male sterile gene rfv1was described. That is the variety Xinong Fpl, a 1BL/1RS translocation line, as the acceptor and Triticum macha var. subletschchumicum, a non-1BL/1RS transloca-tion line, as the donor, a directional substitution back-cross was made and confirmed by chromosome of root tip preparations and SDS-PAGE analysis. The male ster-ile gene rfv1 of Triticum macha var. subletschchumicum was transferred to the genome of Xinong Fpl. A new NIAN type wheat maintenance line with the male sterile gene rfv1was bred. The method described was success-ful in breeding a new male sterile type for hybrid wheat production.

  12. Transformation of Coat Protein Encoding Gene from Soil-Borne Mosaic Virus into Wheat

    Institute of Scientific and Technical Information of China (English)

    PANG Jun-lan; XU Hui-jun; DU Li-pu; YE Xing-guo; LI Lian-cheng; XIN Zhi-yong; MA You-zhi; DIAO Ai-po; Adams M J

    2003-01-01

    CWMV-CP1 target gene and bar selection gene were co-transferred into commercial wheat vari-ety of Yangmai158 by particle bombardment. In total, 145 resistant plants to 3 - 5 mg L-1 Bialaphos were ob-tained, 21 plants were identified to be positive in T0 generation by PCR-Southern test, and the transformationfrequency had 0. 99%. T1 plants were further tested by PCR and Southern hybridization. Results demonstra-ted that the alien resistance gene had been integrated into the wheat genome. The segregation ratio of CP1+ toCP1- in T1 generation was 1.0 to 1.3, and didn't agree with Mendelian rule. RT-PCR result from T2 plantsshowed that the alien gene CWMV-CP1 had stable expression in wheat genetic background.

  13. Addition of Aegilops U and M Chromosomes Affects Protein and Dietary Fiber Content of Wholemeal Wheat Flour

    Directory of Open Access Journals (Sweden)

    Marianna Rakszegi

    2017-09-01

    Full Text Available Cereal grain fiber is an important health-promoting component in the human diet. One option to improve dietary fiber content and composition in wheat is to introduce genes from its wild relatives Aegilops biuncialis and Aegilops geniculata. This study showed that the addition of chromosomes 2Ug, 4Ug, 5Ug, 7Ug, 2Mg, 5Mg, and 7Mg of Ae. geniculata and 3Ub, 2Mb, 3Mb, and 7Mb of Ae. biuncialis into bread wheat increased the seed protein content. Chromosomes 1Ug and 1Mg increased the proportion of polymeric glutenin proteins, while the addition of chromosomes 1Ub and 6Ub led to its decrease. Both Aegilops species had higher proportions of β-glucan compared to arabinoxylan (AX than wheat lines, and elevated β-glucan content was also observed in wheat chromosome addition lines 5U, 7U, and 7M. The AX content in wheat was increased by the addition of chromosomes 5Ug, 7Ug, and 1Ub while water-soluble AX was increased by the addition of chromosomes 5U, 5M, and 7M, and to a lesser extent by chromosomes 3, 4, 6Ug, and 2Mb. Chromosomes 5Ug and 7Mb also affected the structure of wheat AX, as shown by the pattern of oligosaccharides released by digestion with endoxylanase. These results will help to map genomic regions responsible for edible fiber content in Aegilops and will contribute to the efficient transfer of wild alleles in introgression breeding programs to obtain wheat varieties with improved health benefits.Key Message: Addition of Aegilops U- and M-genome chromosomes 5 and 7 improves seed protein and fiber content and composition in wheat.

  14. HULLED WHEAT FARMING IN DEVELI

    Directory of Open Access Journals (Sweden)

    Sancar Bulut

    2016-07-01

    Full Text Available Emmer (Triticum dicoccum and einkorn (T. monococcum cultivation has a long history in Anatolia. The crops, cultivated in Anatolia over thousands years, can still be found in some parts of the country, especially Develi in the Kayseri province. The total cultivation area of these crops was around 36 000 ha in 2015. The species is mainly cultivated in sloping and marginal lands by poor farmers, where no other crops can be economically grown. Cultivation area is rapidly declining, and if such trend continues, hulled wheats will be shortly completely wiped out from Turkey. Present-day distribution of emmer and spelt within Turkey is concentrated in countryside areas of Develi where traditional farming systems still survive. This group of wheats is called in Turkish the general name of ‘kaplìca’ which means ‘covered’ or ‘hulled’. More specifically, the tetraploid species (emmer is called ‘gacer’ in the Develi. Being a low-yielding type of wheat, emmer was replaced by other improved varieties of Triticum. This decrease was mainly due to the widespread use of improved cultivars of wheat and the adoption of new agricultural techniques, but also to social and economic factors. In fact, wheat yielded 2840 t/ha, whereas hulled wheats yielded 1200 t/ha. The cultivation of these two crops shows disadvantages that relate to the harvesting techniques used and the need to dehisce the spikelets to obtain the grain for human consumption. The increasing interest in low-input systems due to the actual ecological and economical situation has led to a growing interest in specific genetic variability. Organic agriculture and health food products have been gaining increasing popularity that has led to a renewed interest in hulled wheat species such as emmer and spelt. The objective of this study was to estimate agronomical and grain quality characteristics of some Turkey (Develi emmer landraces. This effort was motivated by the fact that autochthonous

  15. 氮磷钾胁迫下不同D基因组人工合成小麦生长和养分积累差异%Difference in growth and nutrient accumulation of synthetic wheat with different D genome under nitrogen, phosphorus and potassium stresses

    Institute of Scientific and Technical Information of China (English)

    杨玉敏; 张庆玉; 杨武云; 万洪深; 张冀; 李俊; 雷建容; 王琴; 阳路芳; 田丽

    2015-01-01

    Objectives] Synthetic wheat has many desirable qualities derived from D genome of Aegilops tauschii. The synthetic wheat cultivar, S79 and S80, have the same A and B genomes but different D genome. The two cultivars were used to evaluate the growth, nutrient use efficiency and tolerance to nitrogen(N), phosphorus(P) and potassium( K) stresses,which will provide information for the localization of tolerance genes and improvement of heredity in wheat breeding in the future. [Methods] A pot experiment was carried out with the two synthetic wheat cultivar, S79 and S80. N 0. 20 g/kg、P2O5 0. 15 g/kg and K2O 0. 15 g/kg were set as sufficient supplies, no N, P and K as stress. Four treatments were designed: NPK(CK), N0PK, NP0K and NPK0. The plant height and tillering number were investigated once a month during the whole growing stage. The whole plant samples were collected at harvest and divided into root, stem and leaves, shells( ears) and grains. The yield components were investigated. [Results] The significant differences in growth, nutrient accumulation and nutrient use efficiency were found between S79 and S80 under N, P or K stress. S80 exhibited lower sensitivity to N and P stress than S79, and demonstrated better performance on growing vigor, effective tiller, stem, leaf, glumes and grain yield per plant. Plant height, root length and the ratio root versus shoot from S80 increased significantly, but these indexes in S79 reduced significantly. Wherea, S79 had lower sensitivity to low K, and showed better agronomic performance than S80 under K stress. Root weight, stem and leaf weight, spike weight and grain weight per plant of S79 were higher than those of S80 under K stress. Although S79 accumulated more N, P and K than S80 under N and K stress, but N, P and K use efficiency and harvest index of S80 were higher than those of S79. Accumulation of N, P and K in the stem, leaf and spike of S80 was higher than those in S79 under P stress. While, N, P and K use

  16. [Sequence polymorphism and mapping of wheat Ca2+-binding protein TaCRT-A gene].

    Science.gov (United States)

    Wang, Ji-Ping; Mao, Xin-Guo; Li, Run-Zhi; Jing, Rui-Lian

    2012-09-01

    Taking thirty-seven hexaploid wheat (AABBDD) accessions with different drought resistance at seedling stage, three wheat species with A genome (AA), and three tetraploid wheat species (AABB) as test materials, and by direct sequencing the single nucleotide polymorphism (SNP) in TaCRT-A, this paper analyzed the relationships of the SNP with the drought resistance of wheat ( Triticum aestivum) at its seedling stage, and mapped the TaCRT-A on the chromosome of wheat. The full-length sequence of the TaCRT-A genomic DNA was 3887 bp. A total of 202 nucleotide variant loci were observed in the full length sequence of 167141 bp, among which, 165 SNP and 37 InDel with the frequencies of 1 SNP/1013 bp and 1 InDel/4517 bp were detected, respectively. The nucleotide diversity (pi) in coding region of TaCRT-A was lower than that in non-coding region, suggesting that the selection pressure in coding region was stronger than that in non-coding region. The 43 accessions could be classified as 14 haplotypes (H1-H14) by haploid analysis, among which, H1, H2, and H13 all contained one accession which was the donor species of A genome in common wheat, H16 and H7 had one high drought-resistant accession, H8 comprised tetraploid wheat, drought-resistant accessions, and drought-sensitive accessions, whereas H11 included the wheat accessions with drought-resistance and medium-drought resistance. Though the expression of TaCRT was induced by water stress, no significant relationship was identified between TaCRT-A polymorphism and drought resistance. Using a population of recombinant inbred lines derived from a cross of Opata 85 x W7984, the TaCRT-A was mapped between SSR markers Xmwg30 and Xmwg570 on chromosome 3A, and the genetic distances were 10.5 cM and 49.6 cM from the flanking markers, respectively.

  17. Structure and expression analysis of genes encoding ADP-glucose pyrophosphorylase large subunit in wheat and its relatives.

    Science.gov (United States)

    Zhang, Xiao-Wei; Li, Si-Yu; Zhang, Ling-Ling; Yang, Qiang; Jiang, Qian-Tao; Ma, Jian; Qi, Peng-Fei; Li, Wei; Chen, Guo-Yue; Lan, Xiu-Jin; Deng, Mei; Lu, Zhen-Xiang; Liu, Chunji; Wei, Yu-Ming; Zheng, You-Liang

    2016-07-01

    ADP-glucose pyrophosphorylase (AGP), which consists of two large subunits (AGP-L) and two small subunits (AGP-S), controls the rate-limiting step in the starch biosynthetic pathway. In this study, a full-length open reading frame (ORF) of AGP-L gene (named as Agp2) in wheat and a series of Agp2 gene sequences in wheat relatives were isolated. The coding region of Agp2 contained 15 exons and 14 introns including a full-length ORF of 1566 nucleotides, and the deduced protein contained 522 amino acids (57.8 kDa). Generally, the phylogenetic tree of Agp2 indicated that sequences from A- and D-genome donor species were most similar to each other and sequences from B-genome donor species contained more variation. Starch accumulation and Agp2 expression in wheat grains reached their peak at 21 and 15 days post anthesis (DPA), respectively.

  18. Rapid changes of microsatellite flanking sequence in the allopolyploidization of new synthesized hexaploid wheat

    Institute of Scientific and Technical Information of China (English)

    ZHANG Lianquan; LIU Dengcai; YAN Zehong; LAN Xiujin; ZHENG Youliang; ZHOU Yonghong

    2004-01-01

    It was suggested that the rapid changes of DNA sequence and gene expression occurred at the early stages of allopolyploid formation. In this study, we revealed the microsatellite (SSR) differences between newly formed allopolyploids and their donor parents by using 21 primer sets specific for D genome of wheat. It was indicated that rapid changes had occurred in the "shock" process of the allopolyploid formation between tetraploid wheat and Aegilops tauschii. The changes of SSR flanking sequence resulted in appearance of novel bands or disappearance of parental bands. The disappearance of the parental bands showed much higher frequencies in comparison with that of appearance of novel bands. Disappearance of the parental bands was not random. The frequency of disappearance in tetraploid wheat was much higher than in Ae. tauschii, i. e. the disappearance frequency in AABB genome was much higher than in D genome. Changes of SSR flanking sequence occurred at the early stage of F1 hybrid or just after chromosome doubling. From the above results, it can be inferred that SSR flanking sequence region was very active and was amenable to change in the process of polyploidization. This suggested that SSR flanking sequence probably had special biological function at the early stage of ployploidization. The rapid and directional changes at the early stage of polyploidization might contribute to the rapid evolution of the newly formed allopolyploid and allow the divergent genomes to act in harmony.

  19. Analysis of DNA methylation variation in wheat genetic background after alien chromatin introduction based on methylation-sensitive amplification polymorphism

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    During the process of alien germplasm introduced into wheat genome by chromosome engineering,extensive genetic variations of genome structure and gene expression in recipient could be induced.In this study,we performed GISH(genome in situ hybridization)and AFLP(amplified fragment length polymorphism) on wheat-rye chromosome transIocation lines and their parents to detect the identity in genomic structure of different translocation lines.The results showed that the genome primary structure variations were not obviously detected in different translocation lines except the same 1RS chromosome translocation.Methylation sensitive amplification polymorphism(MSAP)analyses on genomic DNA showed that the ratios of fully-methylated sites were significantly increased in translocation lines(CN12,20.15%;CN17,20.91%;CN18,22.42%),but the ratios of hemimethylated sites were significantly lowered(CN12,21.41%;CN17,23.43%;CN18,22.42%),whereas 16.37%were fully-methylated and 25.44%were hemimethylated in case of their wheat parent.Twenty-nine classes of methylation patterns were identified in a comparative assay of cytosine methylation patterns between wheat-rye translocation lines and their wheat parent,including 13 hypermethylation patterns(33.74%),9 demethylation patterns(22.76%)and 7 uncertain patterns(4.07%).In further sequence analysis,the alterations of methylation pattern affected both repetitive DNA sequences,such as retrotransposons and tandem repetitive sequences,and low-copy DNA.

  20. A Pooled Genome-Wide Association Study of Asperger Syndrome.

    Directory of Open Access Journals (Sweden)

    Varun Warrier

    Full Text Available Asperger Syndrome (AS is a neurodevelopmental condition characterized by impairments in social interaction and communication, alongside the presence of unusually repetitive, restricted interests and stereotyped behaviour. Individuals with AS have no delay in cognitive and language development. It is a subset of Autism Spectrum Conditions (ASC, which are highly heritable and has a population prevalence of approximately 1%. Few studies have investigated the genetic basis of AS. To address this gap in the literature, we performed a genome-wide pooled DNA association study to identify candidate loci in 612 individuals (294 cases and 318 controls of Caucasian ancestry, using the Affymetrix GeneChip Human Mapping version 6.0 array. We identified 11 SNPs that had a p-value below 1x10-5. These SNPs were independently genotyped in the same sample. Three of the SNPs (rs1268055, rs7785891 and rs2782448 were nominally significant, though none remained significant after Bonferroni correction. Two of our top three SNPs (rs7785891 and rs2782448 lie in loci previously implicated in ASC. However, investigation of the three SNPs in the ASC genome-wide association dataset from the Psychiatric Genomics Consortium indicated that these three SNPs were not significantly associated with ASC. The effect sizes of the variants were modest, indicating that our study was not sufficiently powered to identify causal variants with precision.

  1. A Pooled Genome-Wide Association Study of Asperger Syndrome.

    Science.gov (United States)

    Warrier, Varun; Chakrabarti, Bhismadev; Murphy, Laura; Chan, Allen; Craig, Ian; Mallya, Uma; Lakatošová, Silvia; Rehnstrom, Karola; Peltonen, Leena; Wheelwright, Sally; Allison, Carrie; Fisher, Simon E; Baron-Cohen, Simon

    2015-01-01

    Asperger Syndrome (AS) is a neurodevelopmental condition characterized by impairments in social interaction and communication, alongside the presence of unusually repetitive, restricted interests and stereotyped behaviour. Individuals with AS have no delay in cognitive and language development. It is a subset of Autism Spectrum Conditions (ASC), which are highly heritable and has a population prevalence of approximately 1%. Few studies have investigated the genetic basis of AS. To address this gap in the literature, we performed a genome-wide pooled DNA association study to identify candidate loci in 612 individuals (294 cases and 318 controls) of Caucasian ancestry, using the Affymetrix GeneChip Human Mapping version 6.0 array. We identified 11 SNPs that had a p-value below 1x10-5. These SNPs were independently genotyped in the same sample. Three of the SNPs (rs1268055, rs7785891 and rs2782448) were nominally significant, though none remained significant after Bonferroni correction. Two of our top three SNPs (rs7785891 and rs2782448) lie in loci previously implicated in ASC. However, investigation of the three SNPs in the ASC genome-wide association dataset from the Psychiatric Genomics Consortium indicated that these three SNPs were not significantly associated with ASC. The effect sizes of the variants were modest, indicating that our study was not sufficiently powered to identify causal variants with precision.

  2. A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat

    Directory of Open Access Journals (Sweden)

    Tsai Helen

    2009-08-01

    Full Text Available Abstract Background Wheat (Triticum ssp. is an important food source for humans in many regions around the world. However, the ability to understand and modify gene function for crop improvement is hindered by the lack of available genomic resources. TILLING is a powerful reverse genetics approach that combines chemical mutagenesis with a high-throughput screen for mutations. Wheat is specially well-suited for TILLING due to the high mutation densities tolerated by polyploids, which allow for very efficient screens. Despite this, few TILLING populations are currently available. In addition, current TILLING screening protocols require high-throughput genotyping platforms, limiting their use. Results We developed mutant populations of pasta and common wheat and organized them for TILLING. To simplify and decrease costs, we developed a non-denaturing polyacrylamide gel set-up that uses ethidium bromide to detect fragments generated by crude celery juice extract digestion of heteroduplexes. This detection method had similar sensitivity as traditional LI-COR screens, suggesting that it represents a valid alternative. We developed genome-specific primers to circumvent the presence of multiple homoeologous copies of our target genes. Each mutant library was characterized by TILLING multiple genes, revealing high mutation densities in both the hexaploid (~1/38 kb and tetraploid (~1/51 kb populations for 50% GC targets. These mutation frequencies predict that screening 1,536 lines for an effective target region of 1.3 kb with 50% GC content will result in ~52 hexaploid and ~39 tetraploid mutant alleles. This implies a high probability of obtaining knock-out alleles (P = 0.91 for hexaploid, P = 0.84 for tetraploid, in addition to multiple missense mutations. In total, we identified over 275 novel alleles in eleven targeted gene/genome combinations in hexaploid and tetraploid wheat and have validated the presence of a subset of them in our seed stock

  3. The PDI genes of wheat and their syntenic relationship to the esp2 locus of rice.

    Science.gov (United States)

    Johnson, Joshua C; Appels, Rudi; Bhave, Mrinal

    2006-04-01

    The storage protein polymers in the endosperm, stabilised by disulphide bonds, determine a number of processing qualities of wheat dough. The enzyme protein disulphide isomerase (PDI), involved in the formation of disulphide bonds, is strongly suggested to play a role in the formation of wheat storage protein bodies. Reports of the rice mutant esp2 exhibiting aberrant storage protein deposition in conjunction with a lack of PDI expression provided strong indications of a direct role for PDI in storage protein deposition. The potential significance of wheat PDI prompted the present studies into exploring any orthology between wheat PDI genes and rice PDI and esp2 loci. By designing allele-specific (AS)-polymerase chain reaction (PCR) markers, two of the three wheat PDI genes could be genetically mapped to group 4 chromosomes and showed close association with GERMIN genes. Physical mapping led to localisation of wheat PDI genes to chromosomal "bins" on the proximal section of chromosome 4AL and distal sections of 4BS and 4DS. Identification of the putative PDI gene of rice and its comparison to the esp2 locus revealed that they were present at similar positions on the short arm of chromosome 11. Analysis of a large section of the PDI-containing section of rice chromosome 11S revealed a number of putative orthologues from The Institute for Genomic Research Triticum aestivum Gene Index database, of which five had been mapped, each localising to group 4 chromosomes, many in good agreement with our mapping results. The results strongly suggest a close linkage between the esp2 marker and the PDI gene of rice and an orthology between the PDI loci of rice and wheat and predict quantitative-trait loci involved in storage protein deposition at the PDI loci.

  4. Characterization of WAP2 gene in Aegilops tauschii and comparison with homoeologous loci in wheat

    Institute of Scientific and Technical Information of China (English)

    Shun-Zong NING; Qi-Jiao CHEN; Zhong-Wei YUAN; Lian-Quan ZHANG; Ze-Hong YAN; You-Liang ZHENG; Deng-Cai LIU

    2009-01-01

    The Q/q gene, also known as WAP2, is an important gene for wheat domestication and is a member of the AP2 (APETALA2) class of transcription factors. In the present study, we first isolated the W~t AP2 allele (where the superscript "t" refers to the speciese source, in this case "tauschii") on chromosome 5D from Aegilops tauschii Coss., the D-genome donor species of common wheat. We found that W~t AP2 and the AP2 gene from Arabidopsis share a central core of the AP2 polypeptide, a highly basic 10-amino acid domain, and an AASSGF box, although there are many differences in the 37-amino acid serine-rich acidic domain and the remaining regions. In addition, W~t AP2 was highly homologous to the homoeologous loci on 5A and 5B of wheat at both the nucleotide and amino acid level. However, there were some variations that are probably related to gene function. In the first AP2 domain, the amino acids VYL on the 5D and 5A loci were replaced with LLR on 5B. In the 37-amino acid serine-rich acidic domain, W~t AP2 on 5D had an extra amino acid insertion. There was also a variation at the 329 amino acid position, which is thought to be related to the appearance of free-threshing wheat. At this position, the amino acid is isoleucine on 5A for the Q allele and valine for the q allele, whereas the amino acid is leucine on 5D and 5B. Furthermore, a Stowaway miniature terminal inverted repeat element (MITE) insertion was present in the ninth intron of WAP2 on 5B of all common wheats and partial tetraploid Triticum turgidum wheats. These results provide new clues for studies into the evolutionary biology of WAP2 and the origin of common wheat.

  5. Effect of Sucrose Esters on the Physicochemical Properties of Wheat ...

    African Journals Online (AJOL)

    Effect of Sucrose Esters on the Physicochemical Properties of Wheat Starch. ... Methods: Sucrose ester was mixed with wheat starch extracted from normal soft wheat cultivars and heated. Change in starch properties arising ... Article Metrics.

  6. Genome-wide analysis of single nucleotide polymorphisms in patients with atrophic age-related macular degeneration in oldest old Han Chinese.

    Science.gov (United States)

    Zhou, T Q; Guan, H J; Hu, J Y

    2015-12-21

    The aim of this study was to identify disease-associated loci in oldest old Han Chinese with atrophic age-related macular degeneration (AMD). This genome-wide association study (GWAS) only included oldest old (≥95 years old) subjects in Rugao County, China. Thirty atrophic AMD patients and 47 age-matched non-AMD controls were enrolled. The study subjects underwent a complete ophthalmic examination. Genomic DNA was extracted from peripheral blood samples. Single nucleotide polymorphisms (SNPs) were scanned by Genome-Wide Human Mapping SNP 6.0 Arrays and GeneChip Scanner 3000 7G. The results were read and analyzed by the Affymetrix Genotyping Console software. We filtered out the SNPs with a no-call rate ≥10%, MAF P old Han Chinese population. This finding may lead to new strategies for screening of atrophic AMD for Han Chinese.

  7. Water and Nutrient Use Efficiency in Diploid, Tetraploid and Hexaploid Wheats

    Institute of Scientific and Technical Information of China (English)

    Ming-Li Huang; Xi-Ping Deng; Yu-Zong Zhao; Sheng-Lu Zhou; Shinobu Inanaga; Satoshi Yamada; Kiyoshi Tanaka

    2007-01-01

    efficiency is mainly controlled by genotypes. Compared to theother two diploid wheats, Ae. squarrosa (DD) had significant higher WUE and nutrient utilization efficiency, Indicating that the D genome may carry genes controlling high efficient utilization of water and nutrient. Significant relationships were found between WUE and N, P and K utilization efficiency.

  8. Silencing of TaBTF3 gene impairs tolerance to freezing and drought stresses in wheat.

    Science.gov (United States)

    Kang, Guozhang; Ma, Hongzhen; Liu, Guoqin; Han, Qiaoxia; Li, Chengwei; Guo, Tiancai

    2013-11-01

    Basic transcription factor 3 (BTF3), the β-subunit of the nascent polypeptide-associated complex, is responsible for the transcriptional initiation of RNA polymerase II and is also involved in cell apoptosis, translation initiation regulation, growth, development, and other functions. Here, we report the impact of BTF3 on abiotic tolerance in higher plants. The transcription levels of the TaBTF3 gene, first isolated from wheat seedlings in our lab, were differentially regulated by diverse abiotic stresses and hormone treatments, including PEG-induced stress (20 % polyethylene glycol 6000), cold (4 °C), salt (100 mM NaCl), abscisic acid (100 μM), methyl jasmonate (50 μM), and salicylic acid (50 μM). Southern blot analysis indicated that, in the wheat genome, TaBTF3 is a multi-copy gene. Compared to BSMV-GFP-infected wheat plants (control), under freezing (-8 °C for 48 h) or drought stress (withholding water for 15 days) conditions, TaBTF3-silenced wheat plants showed lower survival rates, free proline content, and relative water content and higher relative electrical conductivity and water loss rate. These results suggest that silencing of the TaBTF3 gene may impair tolerance to freezing and drought stresses in wheat and that it may be involved in the response to abiotic stresses in higher plants.

  9. Introgression of a leaf rust resistance gene from Aegilops caudata to bread wheat

    Indian Academy of Sciences (India)

    Amandeep Kaur Riar; Satinder Kaur; H. S. Dhaliwal; Kuldeep Singh; Parveen Chhuneja

    2012-08-01

    Rusts are the most important biotic constraints limiting wheat productivity worldwide. Deployment of cultivars with broad spectrum rust resistance is the only environmentally viable option to combat these diseases. Identification and introgression of novel sources of resistance is a continuous process to combat the ever evolving pathogens. The germplasm of nonprogenitor Aegilops species with substantial amount of variability has been exploited to a limited extent. In the present investigation introgression, inheritance and molecular mapping of a leaf rust resistance gene of Ae. caudata (CC) acc. pau3556 in cultivated wheat were undertaken. An F2 population derived from the cross of Triticum aestivum cv.WL711 – Ae. caudata introgression line T291-2 with wheat cultivar PBW343 segregated for a single dominant leaf rust resistance gene at the seedling and adult plant stages. Progeny testing in F3 confirmed the introgression of a single gene for leaf rust resistance. Bulked segregant analysis using polymorphic D-genome-specific SSR markers and the cosegregation of the 5DS anchored markers (Xcfd18, Xcfd78, Xfd81 and Xcfd189) with the rust resistance in the F2 population mapped the leaf rust resistance gene (LrAC) on the short arm of wheat chromosome 5D. Genetic complementation and the linked molecular markers revealed that LrAC is a novel homoeoallele of an orthologue Lr57 already introgressed from the 5M chromosome of Ae. geniculata on 5DS of wheat.

  10. GM wheat development in China: current status and challenges to commercialization.

    Science.gov (United States)

    Xia, Lanqin; Ma, Youzhi; He, Yi; Jones, Huw D

    2012-03-01

    Genetic modification facilitates research into fundamental questions of plant functional genomics and provides a route for developing novel commercial varieties. In 2008, significant financial resources were supplied by the Chinese government for research and development (R&D) into genetic modification of the major crop species. This project was aimed at providing an opportunity for crop improvement while accentuating the development of a safe, precise, and effective wheat genetic transformation system suitable for commercialization. The focus here is on one of the key crops included in this project, wheat, to provide an insight into the main transformation methods currently in use, the target traits of major importance, and the successful applications of wheat genetic improvement in China. Furthermore, the biosafety and regulatory issues of major concern and the strategies to produce 'clean' transgenic wheat plants will also be discussed. This commentary is intended to be a helpful insight into the production and commercialization of transgenic wheat in China and to put these activities into a global context.

  11. Stable chloroplast transformation of immature scutella and inflorescences in wheat (Triticum aestivum L.)

    Institute of Scientific and Technical Information of China (English)

    Cuiju Cui; Guangxiao Yang; Guangyuan He; Fei Song; Yi Tan; Xuan Zhou; Wen Zhao; Fengyun Ma; Yunyi Liu; Javeed Hussain; Yuesheng Wang

    2011-01-01

    Chloroplast transformation in wheat was achieved by bombardment of scutella from immature embryos and immature inflorescences. respectively. A wheat chloroplast sitespecific expression vector, pBAGNRK, was constructed by placing an expression cassette containing neomycin phosphotransferase Ⅱ (nptⅡ) and green fluorescent protein (gfp) as selection and reporter genes, respectively, in the intergenic spacer between atpB and rbcL of wheat chloroplast genome. Integration of gfp gene in the plastome was identified by polymerase chain reaction (PCR) analysis and Southern blotting using gfp gene as a probe. Expression of GFP protein was examined by western blot. Three positive transformants were obtained and the Southern blot of partial fragment of atpB and rbcL (targeting site) probes verified that one of them was homoplasmic. Stable expression of GFP fluorescence was confirmed by confocal microscopy in the leaf tissues from T progeny seedlings. PCR analysis of gfp gene also confirmed the inheritance of transgene in the T progeny. These results strengthen the feasibility of wheat chloroplast transformation and also give a novel method for the introduction of important agronomic traits in wheat through chloroplast transformation.

  12. Applicability of Aegilops tauschii drought tolerance traits to breeding of hexaploid wheat.

    Science.gov (United States)

    Sohail, Quahir; Inoue, Tomoe; Tanaka, Hiroyuki; Eltayeb, Amin Elsadig; Matsuoka, Yoshihiro; Tsujimoto, Hisashi

    2011-12-01

    Few genes are available to develop drought-tolerant bread wheat (Triticum aestivum L.) cultivars. One way to enhance bread wheat's genetic diversity would be to take advantage of the diversity of wild species by creating synthetic hexaploid wheat (SW) with the genomic constitution of bread wheat. In this study, we compared the expression of traits encoded at different ploidy levels and evaluated the applicability of Aegilops tauschii drought-related traits using 33 Ae. tauschii accessions along with their corresponding SW lines under well-watered and drought conditions. We found wide variation in Ae. tauschii, and even wider variation in the SW lines. Some SW lines were more drought-tolerant than the standard cultivar Cham 6. Aegilops tauschii from some regions gave better performing SW lines. The traits of Ae. tauschii were not significantly correlated with their corresponding SW lines, indicating that the traits expressed in wild diploid relatives of wheat may not predict the traits that will be expressed in SW lines derived from them. We suggest that, regardless of the adaptability and performance of the Ae. tauschii under drought, production of SW could probably result in genotypes with enhanced trait expression due to gene interactions, and that the traits of the synthetic should be evaluated in hexaploid level.

  13. A chromosome bin map of 2148 expressed sequence tag loci of wheat homoeologous group 7.

    Science.gov (United States)

    Hossain, K G; Kalavacharla, V; Lazo, G R; Hegstad, J; Wentz, M J; Kianian, P M A; Simons, K; Gehlhar, S; Rust, J L; Syamala, R R; Obeori, K; Bhamidimarri, S; Karunadharma, P; Chao, S; Anderson, O D; Qi, L L; Echalier, B; Gill, B S; Linkiewicz, A M; Ratnasiri, A; Dubcovsky, J; Akhunov, E D; Dvorák, J; Miftahudin; Ross, K; Gustafson, J P; Radhawa, H S; Dilbirligi, M; Gill, K S; Peng, J H; Lapitan, N L V; Greene, R A; Bermudez-Kandianis, C E; Sorrells, M E; Feril, O; Pathan, M S; Nguyen, H T; Gonzalez-Hernandez, J L; Conley, E J; Anderson, J A; Choi, D W; Fenton, D; Close, T J; McGuire, P E; Qualset, C O; Kianian, S F

    2004-10-01

    The objectives of this study were to develop a high-density chromosome bin map of homoeologous group 7 in hexaploid wheat (Triticum aestivum L.), to identify gene distribution in these chromosomes, and to perform comparative studies of wheat with rice and barley. We mapped 2148 loci from 919 EST clones onto group 7 chromosomes of wheat. In the majority of cases the numbers of loci were significantly lower in the centromeric regions and tended to increase in the distal regions. The level of duplicated loci in this group was 24% with most of these loci being localized toward the distal regions. One hundred nineteen EST probes that hybridized to three fragments and mapped to the three group 7 chromosomes were designated landmark probes and were used to construct a consensus homoeologous group 7 map. An additional 49 probes that mapped to 7AS, 7DS, and the ancestral translocated segment involving 7BS also were designated landmarks. Landmark probe orders and comparative maps of wheat, rice, and barley were produced on the basis of corresponding rice BAC/PAC and genetic markers that mapped on chromosomes 6 and 8 of rice. Identification of landmark ESTs and development of consensus maps may provide a framework of conserved coding regions predating the evolution of wheat genomes.

  14. Molecular characterization of vernalization loci VRN1 in wild and cultivated wheats

    Directory of Open Access Journals (Sweden)

    Golovnina Kseniya A

    2010-08-01

    Full Text Available Abstract Background Variability of the VRN1 promoter region of the unique collection of spring polyploid and wild diploid wheat species together with diploid goatgrasses (donor of B and D genomes of polyploid wheats were investigated. Accessions of wild diploid (T. boeoticum, T. urartu and tetraploid (T. araraticum, T. timopheevii species were studied for the first time. Results Sequence analysis indicated great variability in the region from -62 to -221 nucleotide positions of the VRN1 promoter region. Different indels were found within this region in spring wheats. It was shown that VRN1 promoter region of B and G genome can also contain damages such as the insertion of the transposable element. Some transcription factor recognition sites including hybrid C/G-box for TaFDL2 protein known as the VRN1 gene upregulator were predicted inside the variable region. It was shown that deletions leading to promoter damage occurred in diploid and polyploid species independently. DNA transposon insertions first occurred in polyploid species. At the same time, the duplication of the promoter region was observed in A genomes of polyploid species. Conclusions We can conclude that supposed molecular mechanism of the VRN1 gene activating in cultivated diploid wheat species T. monococcum is common also for wild T. boeoticum and was inherited by T. monococcum. The spring polyploids are not related in their origin to spring diploids. The spring T. urartu and goatgrass accessions have another mechanism of flowering activation that is not connected with indels in VRN1 promoter region. All obtained data may be useful for detailed insight into origin of spring wheat forms in evolution and domestication process.

  15. Tetraploid and hexaploid wheat varieties reveal large differences in expression of alpha-gliadins from homoelogous Gli-loci

    NARCIS (Netherlands)

    Salentijn, E.M.J.; Goryunova, S.V.; Bas, N.; Meer, van der I.M.; Broeck, van den H.C.; Bastien, T.A.; Gilissen, L.J.W.J.; Smulders, M.J.M.

    2009-01-01

    Background - A-gliadins form a multigene protein family encoded by multiple ¿-gliadin (Gli-2) genes at three genomic loci, Gli-A2, Gli-B2 and Gli-D2, respectively located on the homoeologous wheat chromosomes 6AS, 6BS, and 6DS. These proteins contain a number of important celiac disease (CD)-immunog

  16. Allelic Variation and Genetic Diversity at HMW Glutenin Subunits Loci in Yunnan,Tibetan and Xinjiang Wheat

    Institute of Scientific and Technical Information of China (English)

    WANG Hai-yan; WANG Xiu-e; CHEN Pei-du; LIU Da-jun

    2004-01-01

    Allelic variation and genetic diversity at HMW glutenin subunits loci, Glu-A1, Glu-B1and Glu-D1 were investigated in 64 accessions of three unique wheats of western China using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Two HMW glutenin patterns (i.e., "null, 7+8, 2+12" and "null, 7, 2+12") in 34 Yunnan wheat accessions, 3 HMW glutenin patterns (i.e., "null, 7+8, 2+12"; "null, 6+8, 2+12" and "null, 7+8, 2") in 24 Tibetan accessions and 1 HMW glutenin pattern ("null, 7, 2+12") in 6 Xinjiang wheat accessions were found. The Tibetan accession TB18 was found to be with a rare subunit 2 encoded by Glu-D1. A total of 4 (i.e., Glu-A1c, Glu-B1a, Glu-B1b and Glu-D1a), 5 (i.e., Glu-A1c, Glu-B1d, Glu-B1b, Glu-D1a and Glu-D1) and 3 alleles (i.e.,Glu-A1c, Glu-B1a and Glu-D1a) at Glu-1 locus were identified among Yunnan, Tibetan and Xinjiang unique wheat accessions, respectively. For Yunnan wheat, Tibetan wheat and Xinjiang wheat, the Nei′s mean genetic variation indexes were 0.1574, 0.1366 and 0,respectively, which might indicate the higher genetic diversity at HMW glutenin subunits loci of Yunnan and Tibetan wheat accessions as compared to that of Xinjiang wheat accessions. Among the three genomes of hexaploid wheats of western China, the highest Nei′s genetic variation index was appeared in B genome with the mean value of 0.2674,while the indexes for genomes A and D were 0 and 0.0270, respectively. It might be reasonable to indicate that Glu-B1 showed the highest, Glu-D1 the intermediate and GluA1 always the lowest genetic diversity.

  17. IMPROVING WHEAT TRITICUM AESTIVUM L. BY INTERSPECIFIC AND INTERGENERIC HYBRIDIZATION WITH POACEAE FAMILY SPECIES

    Directory of Open Access Journals (Sweden)

    Czaplicki A.Z.

    2012-08-01

    Full Text Available The related species of the family Poaceae (Triticeae are the source of unprecedented new genes that allow the extension of genetic variation of common wheat Triticum aestivum L. These species have similar homoeologous chromosomes and rDNA sequences very similar to T. aestivum L. [1-3]. This allows the introgression of alien genes and their incorporation into the genomes A, B and D of wheat, where they can function permanently in the wheat genetic systems. Many of them have already been transferred to the varieties of T. aestivum L. [4].The experimental material consisted of 28 lines of winter wheat obtained using the interspecific and intergeneric hybridization of T. aestivum L. with alien species T. durum Desf., T. timopheevii Zhuk., Lolium perenne L. and Aegilops speltoides Taush. Among them, 15 lines were developed from the cross-combination with tetraploid species (AABB T. durum Desf., 4 lines from the combination with other tetraploid species of different genome composition (AAGG T. timopheevii Zhuk., 4 lines from cross with L. perenne L. and 5 lines were the double hybrids (three-generic derived with two related species, T. durum Desf. (AABB and Ae. speltoides Taush (BB.The anther culture method was used for obtaining DH lines from these interspecific and intergeneric hybrids. In in vitro culture 124 green plants were regenerated. The method of cluster analysis grouped hybrids in terms of comprehensive general similarity of the studied traits.

  18. Molecular Characterization and SNP Markers of the β-purothionin Gene in Einkorn Wheats

    Institute of Scientific and Technical Information of China (English)

    LI Jing-qiong; ZHENG You-liang; WEI Yu-ming

    2009-01-01

    Forty-three gene sequences encoding purothionin were characterized from the three species or subspecies of einkorn wheats.These sequences contained 887 bp,among which 92 SNPs including 29 indel loci were detected,giving an average SNP frequency of one SNP per 9.64 bases.According to these sequences,5 SNP markers were successfully designed,which were used to mine the variations of purothionin genes of 102 einkorn wheat accessions.Based on the 5 detected SNP loci,102 einkorn wheat accessions could be divided into 21 haplotypes,among which 11 hapiotypes contained a single sample.Phylogenetic analysis indicated that the purothionin genes from einkorn wheats were more closely related to those from D genome than B genome.Seven out of the 43 gene sequences were assumed to be pseudogenes by the definition of containing in-frame stop codons and small insertions/deletions leading to frameshifi.In the remaining 36 amino acid sequences,the 8 Cys and Tyr-13 loci in the mature thionin domain which played important roles in the biological activities were all conserved,whereas there were some varieties occurred in some other important amino acid residues such as Lys and Arg.

  19. Degradation of the benzoxazolinone class of phytoalexins is important for virulence of Fusarium pseudograminearum towards wheat.

    Science.gov (United States)

    Kettle, Andrew J; Batley, Jacqueline; Benfield, Aurelie H; Manners, John M; Kazan, Kemal; Gardiner, Donald M

    2015-12-01

    Wheat, maize, rye and certain other agriculturally important species in the Poaceae family produce the benzoxazolinone class of phytoalexins on pest and pathogen attack. Benzoxazolinones can inhibit the growth of pathogens. However, certain fungi can actively detoxify these compounds. Despite this, a clear link between the ability to detoxify benzoxazolinones and pathogen virulence has not been shown. Here, through comparative genome analysis of several Fusarium species, we have identified a conserved genomic region around the FDB2 gene encoding an N-malonyltransferase enzyme known to be involved in benzoxazolinone degradation in the maize pathogen Fusarium verticillioides. Expression analyses demonstrated that a cluster of nine genes was responsive to exogenous benzoxazolinone in the important wheat pathogen Fusarium pseudograminearum. The analysis of independent F. pseudograminearum FDB2 knockouts and complementation of the knockout with FDB2 homologues from F. graminearum and F. verticillioides confirmed that the N-malonyltransferase enzyme encoded by this gene is central to the detoxification of benzoxazolinones, and that Fdb2 contributes quantitatively to virulence towards wheat in head blight inoculation assays. This contrasts with previous observations in F. verticillioides, where no effect of FDB2 mutations on pathogen virulence towards maize was observed. Overall, our results demonstrate that the detoxification of benzoxazolinones is a strategy adopted by wheat-infecting F. pseudograminearum to overcome host-derived chemical defences. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  20. Wheat yield dynamics: a structural econometric analysis.

    Science.gov (United States)

    Sahin, Afsin; Akdi, Yilmaz; Arslan, Fahrettin

    2007-10-15

    In this study we initially have tried to explore the wheat situation in Turkey, which has a small-open economy and in the member countries of European Union (EU). We have observed that increasing the wheat yield is fundamental to obtain comparative advantage among countries by depressing domestic prices. Also the changing structure of supporting schemes in Turkey makes it necessary to increase its wheat yield level. For this purpose, we have used available data to determine the dynamics of wheat yield by Ordinary Least Square Regression methods. In order to find out whether there is a linear relationship among these series we have checked each series whether they are integrated at the same order or not. Consequently, we have pointed out that fertilizer usage and precipitation level are substantial inputs for producing high wheat yield. Furthermore, in respect for our model, fertilizer usage affects wheat yield more than precipitation level.

  1. Concept, Characteristics and Future of Cold-type Wheat

    Institute of Scientific and Technical Information of China (English)

    Zhang Songwu

    2007-01-01

    Cold types of wheat are the kinds of wheat whose canopy temperature keeps slightly lower and has a series of advantageous traits, which are favorable for wheat to have high and stable yield and stable high quality. The paper expatiates on the advances and important problems in the research of cold types of wheat and predicts the future of cold types of wheat and the influences of the research about cold types of wheat on other crops and plants.

  2. Evaluation and reselection of wheat resistance to Russian wheat aphid biotype 2

    Science.gov (United States)

    Russian wheat aphid (RWA, Diuraphis noxia, Mordvilko) biotype 2 (RWA2) is virulent to most known RWA resistance genes and severely threatens wheat production in the hard winter wheat area of the US western Great Plains. We determined RWA2 reactions of 386 cultivars from China, 227 advanced breeding...

  3. Aroma of wheat porridge and bread-crumb is influenced by the wheat variety

    DEFF Research Database (Denmark)

    Starr, Gerrard; Hansen, Åse Solvej; Petersen, Mikael Agerlin

    2015-01-01

    Sensory evaluations were conducted on wheat-flour porridge and baked-bread samples, made from wheat varieties with known odour and flavour variations. The purpose was to determine if these odour and flavour variations were expressed in baked-bread. In all, 24 wheat varieties were used for porridge...

  4. Effects of protein in wheat flour on retrogradation of wheat starch.

    Science.gov (United States)

    Xijun, Lian; Junjie, Guo; Danli, Wang; Lin, Li; Jiaran, Zhu

    2014-08-01

    Albumins, globulins, gliadins, and glutenins were isolated from wheat flour and the effects of those proteins on retrogradation of wheat starch were investigated. The results showed that only glutenins retarded retrogradation of wheat starch and other 3 proteins promoted it. The results of IR spectra proved that no S-S linkage formed during retrogradation of wheat starch blended with wheat proteins. Combination of wheat starch and globulins or gliadins through glucosidic bonds hindered the hydrolysis of wheat starch by α-amylase. The melting peak temperatures of retrograded wheat starch attached to different proteins were 128.46, 126.14, 132.03, 121.65, and 134.84 °C for the control with no protein, albumins, glutenins, globulins, gliadins groups, respectively, and there was no second melting temperature for albumins group. Interaction of wheat proteins and starch in retrograded wheat starch greatly decreased the endothermic enthalpy (△H) of retrograded wheat starch. Retrograded wheat starch bound to gliadins might be a new kind of resistant starch based on glycosidic bond between starch and protein.

  5. BIOPULPING OF WHEAT STRAW WITH PHANEROCHAETE CHRYSOSPORIUM

    Institute of Scientific and Technical Information of China (English)

    HongYu; MenghuaQin; XuemeiLu; YinboQu; PeijiGao

    2004-01-01

    Wheat straw was cut into a certain size range and treated with a strain of the white rot fungus Phaneroehatete Chrysosporium for 5 days before subjected to a chemi-mechanical treatment. Chemical analyses revealed the effects of the white rot fungus on the wheat straw components. SEM was applied to observe the changes in fiber micromorphological structures. CODcr of the effluent from the sulfonation treatment of wheat straw was also discussed. Handsheets made from the treated anduntreated wheat straw exhibited different optical and physical properties after chemi-mechanical pulping.

  6. BIOPULPING OF WHEAT STRAW WITH PHANEROCHAETE CHRYSOSPORIUM

    Institute of Scientific and Technical Information of China (English)

    Hong Yu; Menghua Qin; Xuemei Lu; Yinbo Qu; Peiji Gao

    2004-01-01

    Wheat straw was cut into a certain size range and treated with a strain of the white rot fungus Phanerochatete Chrysosporium for 5 days before subjected to a chemi-mechanical treatment. Chemical analyses revealed the effects of the white rot fungus on the wheat straw components. SEM was applied to observe the changes in fiber micromorphological structures. CODcr of the effluent from the sulfonation treatment of wheat straw was also discussed. Handsheets made from the treated and untreated wheat straw exhibited different optical and physical properties after chemi-mechanical pulping.

  7. Interference of allelopathic wheat with different weeds.

    Science.gov (United States)

    Zhang, Song-Zhu; Li, Yong-Hua; Kong, Chui-Hua; Xu, Xiao-Hua

    2016-01-01

    Interference of allelopathic wheat with weeds involves a broad spectrum of species either independently or synergistically with competitive factors. This study examined the interference of allelopathic wheat with 38 weeds in relation to the production of allelochemical 2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one (DIMBOA) in wheat with and without root-root interactions. There were substantial differences in weed biomass and DIMBOA concentration in wheat-weed coexisting systems. Among 38 weeds, nine weeds were inhibited significantly by allelopathic wheat but the other 29 weeds were not. DIMBOA levels in wheat varied greatly with weed species. There was no significant relationship between DIMBOA levels and weed suppression effects. Root segregation led to great changes in weed inhibition and DIMBOA level. Compared with root contact, the inhibition of eight weeds was lowered significantly, while significantly increased inhibition occurred in 11 weeds with an increased DIMBOA concentration under root segregation. Furthermore, the production of DIMBOA in wheat was induced by the root exudates from weeds. Interference of allelopathic wheat with weeds not only is determined by the specificity of the weeds but also depends on root-root interactions. In particular, allelopathic wheat may detect certain weeds through the root exudates and respond by increasing the allelochemical, resulting in weed identity recognition. © 2015 Society of Chemical Industry.

  8. Changes of anti-oxidative enzymes and membrane peroxidation for soil water deficits among 10 wheat genotypes at seedling stage.

    Science.gov (United States)

    Shao, Hong Bo; Liang, Zong Suo; Shao, Ming An; Wang, Bo Chu

    2005-05-10

    Drought is one of the major factors limiting crop production globally, with increasing global climate change making the situation more serious. Wheat is the staple food for more than 35% of world population, so wheat anti-drought physiology study is of importance to wheat production and biological breeding for the sake of coping with abiotic and biotic conditions. Much research is involved in this hot topic, but the pace of progress is not so large because of drought resistance being a multiple-gene-control quantitative character and wheat genome being larger (16,000 Mb). On the other hand, stress adaptive mechanisms are quite different, with stress degree, time course, materials, and experimental plots, thus increasing the complexity of the issue in question. Additionally, a little study is related to the whole life circle of wheat, which cannot provide a comprehensive understanding of its anti-drought machinery. We selected 10 kinds of wheat genotypes as materials, which have potential to be applied in practice, and measured relative change of anti-oxidative enzymes and membrane peroxidation through wheat whole growth-developmental circle (i.e. seedling, tillering and maturing). Here, we firstly reported the results of seedling stage as follows: (1) 10 wheat genotypes can be grouped into three kinds (A-C, respectively) according to their changing trend of the measured indices; (2) A performed better resistance drought under the condition of treatment level 1 (appropriate level), whose activities of anti-oxidative enzymes (POD, SOD, CAT) were higher and MDA lower and chlorophyll a+b higher; (3) B exhibited stronger anti-drought under treatment level 2 (light stress level), whose activities of anti-oxidative enzymes were higher, MDA lower and chlorophyll higher; (4) C expressed anti-drought to some extent under treatment level 3 (serious stress), whose activities of anti-oxidative enzymes were stronger, MDA lower and chlorophyll higher; (5) these results

  9. Dynamics of small RNA profiles of virus and host origin in wheat cultivars synergistically infected by Wheat streak mosaic virus and Triticum mosaic virus: virus infection caused a drastic shift in the endogenous small RNA profile.

    Science.gov (United States)

    Tatineni, Satyanarayana; Riethoven, Jean-Jack M; Graybosch, Robert A; French, Roy; Mitra, Amitava

    2014-01-01

    Co-infection of wheat (Triticum aestivum L.) by Wheat streak mosaic virus (WSMV, a Tritimovirus) and Triticum mosaic virus (TriMV, a Poacevirus) of the family Potyviridae causes synergistic interaction. In this study, the effects of the synergistic interaction between WSMV and TriMV on endogenous and virus-derived small interfering RNAs (vsiRNAs) were examined in susceptible ('Arapahoe') and temperature-sensitive resistant ('Mace') wheat cultivars at 18°C and 27°C. Single and double infections in wheat caused a shift in the profile of endogenous small RNAs from 24 nt being the most predominant in healthy plants to 21 nt in infected wheat. Massive amounts of 21 and 22 nt vsiRNAs accumulated in singly and doubly infected Arapahoe at both temperatures and in Mace at 27°C but not 18°C. The plus- and minus-sense vsiRNAs were distributed throughout the genomic RNAs in Arapahoe at both temperature regimens and in Mace at 27°C, although some regions served as hot-spots, spawning an excessive number of vsiRNAs. The vsiRNA peaks were conserved among cultivars, suggesting that the Dicer-like enzymes in susceptible and resistant cultivars similarly accessed the genomic RNAs of WSMV or TriMV. Accumulation of large amounts of vsiRNAs in doubly infected plants suggests that the silencing suppressor proteins encoded by TriMV and WSMV do not prevent the formation of vsiRNAs; thus, the synergistic effect observed is independent from RNA-silencing mediated vsiRNA biogenesis. The high-resolution map of endogenous and vsiRNAs from WSMV- and/or TriMV-infected wheat cultivars may form a foundation for understanding the virus-host interactions, the effect of synergistic interactions on host defense, and virus resistance mechanisms in wheat.

  10. Effects of crop rotation on weed density, biomass and yield of wheat (Titicum aestivum L.

    Directory of Open Access Journals (Sweden)

    A. Zareafeizabadi

    2016-05-01

    Full Text Available In order to study the weed populations in wheat, under different crop rotations an experiment was carried out at Agricultural Research Station of Jolgeh Rokh, Iran. During growing season this project was done in five years, based on Randomized Complete Bloch Design with three replications, on Crop rotations included: wheat monoculture for the whole period (WWWWW, wheat- wheat- wheat- canola- wheat (WWWCW, wheat- sugar beet- wheat-sugar beet- wheat (WSWSW, wheat- potato- wheat- potato- wheat (WPWPW, wheat- potato- wheat- canola- wheat (WPWCW, wheat- sugar beet- wheat- potato- wheat (WSWPW, wheat- maize- wheat- potato- wheat (WMWPW, wheat- maize- wheat- sugar beet- wheat (WMWSW. Data analysis was done in fifth year. Weed sampling was done at four growth stages of wheat, including tillering, shooting, heading and soft dough stage of grains. Density, dry and fresh weight of each weed species per unit area, besides wheat grain yield were determined. All analysis of variances for traits related to weed were statistically significant (p≤0.01. The highest weed biomass was obtained in heading stage of wheat, and the greatest weed dry matter in all four growth stages was achieved in WWWWW rotation and the least one in WMWSW rotation. The highest weed density in different growth stages was achieved in rotations 7, 3, and 6. Wheat grain yield in all crop rotation treatments had a significant increase compared to monoculture. It seems that, yield reduction of wheat monoculture is related to weed density, its population and higher weed biomass in this treatment.

  11. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-09-01

    Full Text Available To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV (most likely pathogens using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV. The full genome of WLYaV corresponds to 5,772 nucleotides (nt, with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV, but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90% in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  12. Identification and Validation of a Major Quantitative Trait Locus for Slow-rusting Resistance to Stripe Rust in Wheat

    Institute of Scientific and Technical Information of China (English)

    Xiaohua Cao; Jianghong Zhou; Xiaoping Gong; Guangyao Zhao; Jizeng Jia; Xiaoquan Qi

    2012-01-01

    Stripe (yellow) rust,caused by Puccinia striiformis Westend.f.sp.tritici Eriks (Pst),is one of the most important wheat (Triticum aestivum L.) diseases and causes significant yield losses.A recombinant inbred (RI) population derived from a cross between Yanzhan 1 and Xichang 76-9 cultivars was evaluated for resistance to wheat stripe rust strain CYR32 at both the seedling and adult plant stages.Four resistance quantitative trait loci (QTLs) were detected in this population,in which the major one,designated as Yrq1,was mapped on chromosome 2DS.The strategy of using the Brachypodium distachyon genome,wheat expressed sequence tags and a draft DNA sequences (scaffolds) of the D-genome (Aegilops tauschii Coss.) for the development of simple sequence repeat (SSR) markers was successfully used to identify 147 SSRs in hexaploid wheat.Of the 19 polymorphic SSRs in the RI population,17 SSRs were mapped in the homeologous group 2 chromosomes near Yrq1 region and eight SSRs were genetically mapped in the 2.7 cM region of Yrq1,providing abundant DNA markers for fine-mapping of Yrq1 and marker-assisted selection in wheat breeding program.The effectiveness of Yrq1 was validated in an independent population,indicating that this resistance QTL can be successfully transferred into a susceptible cultivar for improvement of stripe rust resistance.

  13. Molecular cytogenetic identification of a wheat-rye 1R addition line with multiple spikelets and resistance to powdery mildew.

    Science.gov (United States)

    Yang, Wujuan; Wang, Changyou; Chen, Chunhuan; Wang, Yajuan; Zhang, Hong; Liu, Xinlun; Ji, Wanquan

    2016-04-01

    Alien addition lines are important for transferring useful genes from alien species into common wheat. Rye is an important and valuable gene resource for improving wheat disease resistance, yield, and environment adaptation. A new wheat-rye addition line, N9436B, was developed from the progeny of the cross of common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) cultivar Shaanmai 611 and rye (Secale cereal L., 2n = 2x = 14, RR) accession Austrian rye. We characterized this new line by cytology, genomic in situ hybridization (GISH), fluorescence in situ hybridization (FISH), molecular markers, and disease resistance screening. N9436B was stable in morphology and cytology, with a chromosome composition of 2n = 42 + 2t = 22II. GISH investigations showed that this line contained two rye chromosomes. GISH, FISH, and molecular maker identification suggested that the introduced R chromosome and the missing wheat chromosome arms were 1R chromosome and 2DL chromosome arm, respectively. N9436B exhibited 30-37 spikelets per spike and a high level of resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) isolate E09 at the seedling stage. N9436B was cytologically stable, had the trait of multiple spikelets, and was resistant to powdery mildew; this line should thus be useful in wheat improvement.

  14. The use of the ph1b mutant to induce recombination between the chromosomes of wheat and barley

    Science.gov (United States)

    Rey, María-Dolores; Calderón, María C.; Prieto, Pilar

    2015-01-01

    Intensive breeding has led to a narrowing in the genetic base of our major crops. In wheat, access to the extensive gene pool residing in its many and varied relatives (some cultivated, others wild) is hampered by the block on recombination imposed by the Ph1 (Pairing homoeologous 1) gene. Here, the ph1b mutant has been exploited to induced allosyndesis between wheat chromosomes and those of both Hordeum vulgare (cultivated barley) and H. chilense (a wild barley). A number of single chromosome Hordeum sp. substitution and addition lines in wheat were crossed and backcrossed to the ph1b mutant to produce plants in which pairing between the wheat and the non-wheat chromosomes was not suppressed by the presence of Ph1. Genomic in situ hybridization was applied to almost 500 BC1F2 progeny as a screen for allosyndetic recombinants. Chromosome rearrangements were detected affecting H. chilense chromosomes 4Hch, 5Hch, 6Hch, and 7Hch and H. vulgare chromosomes 4Hv, 6Hv, and 7Hv. Two of these were clearly the product of a recombination event involving chromosome 4Hch and a wheat chromosome. PMID:25852713

  15. Evaluation of Aegilops tauschii for Heading Date and Its Gene Location in a Re-synthesized Hexaploid Wheat

    Institute of Scientific and Technical Information of China (English)

    XIANG Zhi-guo; ZHANG Lian-quan; NING Shun-zong; ZHENG You-Liang; LIU Deng-cai

    2009-01-01

    The successful worldwide cultivation of hexaploid wheat in a diverse range of environments is because of, in part, breeding and selection for appropriate heading date. To adjust and fine-tune the heading time of hexaploid wheat to particular geographical regions and specific environment within these, there is an urgent need to evaluate and use alternative alleles for heading time. Aegilops tauschii, the donor species of D-genome of hexaploid wheat, has a wide geographic distribution. The present study revealed a wide variation for heading time among 56 Ae. tauschii accessions. All the accessions with short heading dates belonged to the ssp. tauschii, whereas most of ssp. strangulata accessions showed very long heading date. The heading date was also related to distribution of this species. The monotelosomic and monosomic analysis of a synthetic hexaploid wheat showed that chromosome 2D derived from ssp. tauschii accession AS60 had a major effect on promoting heading time with a reduction of more than 5 days. It is postulated that this Ae. tauschii genotype possess the allele Ppd-Dt1 responsible for the insensitivity to photoperiod. This allele is probably different from Ppd-D1 existing in hexaploid wheat. The new allele Ppd-Dt1 derived from Ae. tauschii might be used as a source for hexaploid wheat breeding on photoperiod response.

  16. Haplotype variation of Glu-D1 locus and the origin of Glu-D1d allele conferring superior end-use qualities in common wheat.

    Directory of Open Access Journals (Sweden)

    Zhenying Dong

    Full Text Available In higher plants, seed storage proteins (SSPs are frequently expressed from complex gene families, and allelic variation of SSP genes often affects the quality traits of crops. In common wheat, the Glu-D1 locus, encoding 1Dx and 1Dy SSPs, has multiple alleles. The Glu-D1d allele frequently confers superior end-use qualities to commercial wheat varieties. Here, we studied the haplotype structure of Glu-D1 genomic region and the origin of Glu-D1d. Using seven diagnostic DNA markers, 12 Glu-D1 haplotypes were detected among common wheat, European spelt wheat (T. spelta, a primitive hexaploid relative of common wheat, and Aegilops tauschii (the D genome donor of hexaploid wheat. By comparatively analyzing Glu-D1 haplotypes and their associated 1Dx and 1Dy genes, we deduce that the haplotype carrying Glu-D1d was likely differentiated in the ancestral hexaploid wheat around 10,000 years ago, and was subsequently transmitted to domesticated common wheat and T. spelta. A group of relatively ancient Glu-D1 haplotypes was discovered in Ae. tauschii, which may serve for the evolution of other haplotypes. Moreover, a number of new Glu-D1d variants were found in T. spelta. The main steps in Glu-D1d differentiation are proposed. The implications of our work for enhancing the utility of Glu-D1d in wheat quality improvement and studying the SSP alleles in other crop species are discussed.

  17. Deoxynivalenol in wheat and wheat products from a harvest affected by fusarium head blight

    Directory of Open Access Journals (Sweden)

    Lidiane Viera MACHADO

    Full Text Available Abstract Fusarium head blight is an important disease occurring in wheat, caused mainly by the fungus Fusarium graminearum. In addition to direct damage to crops, reduced quality and yield losses, the infected grains can accumulate mycotoxins (toxic metabolites originating from prior fungal growth, especially deoxynivalenol (DON. Wheat crops harvested in 2014/2015 in southern Brazil were affected by high levels of Fusarium head blight. In this context, the aim of this study was evaluate the mycotoxicological quality of Brazilian wheat grains and wheat products (wheat flour and wheat bran for DON. DON contamination was evaluated in 1,504 wheat and wheat product samples produced in Brazil during 2014. It was determined by high performance liquid chromatograph fitted to a mass spectrometer (LC-MS / MS. The results showed that 1,000 (66.5% out of the total samples tested were positive for DON. The mean level of sample contamination was 1047 µg.kg-1, but only 242 samples (16.1% had contamination levels above the maximum permissible levels (MPL - the maximum content allowed by current Brazilian regulation. As of 2017, MPL will be stricter. Thus, research should be conducted on DON contamination of wheat and wheat products, since wheat is a raw material widely used in the food industry, and DON can cause serious harm to public health.

  18. Dynamic changes of anti-oxidative enzymes of 10 wheat genotypes at soil water deficits.

    Science.gov (United States)

    Shao, Hong Bo; Liang, Zong Suo; Shao, Ming An; Sun, Qun

    2005-05-25

    Drought is a world-spread problem seriously influencing crop production and quality, the loss of which is the total for other natural disasters, with increasing global climate change making the situation more serious. Wheat is the staple food for more than 35% of world population, so wheat anti-drought physiology study is of importance to wheat production and biological breeding for the sake of coping with abiotic and biotic conditions. Much research is involved in this hot topic, but the pace of progress is not so large because of drought resistance being a multiple-gene-control quantitative character and wheat genome being larger (16,000 Mb). On the other hand, stress adaptive mechanisms are quite different, with stress degree, different growth and developmental stages, time course, materials and experimental plots, thus increasing the complexity of the issue in question. Additionally, a little study is related to the whole life circle of wheat, which cannot provide a comprehensive understanding of its anti-drought machinery. We selected 10 kinds of wheat genotypes as materials, which have potential to be applied in practice, and measured change of relative physiological indices through wheat whole growing developmental circle (i.e. seedling, tillage and maturing). Here, we reported the dynamic anti-oxidative results of whole stage (i.e. seedling, tillage and maturing) in terms of activities of POD, SOD, CAT of 10 wheat genotypes as follows: (1) 10 wheat genotypes can be grouped into three kinds (A, B and C, respectively) according to their changing trend of the measured indices; (2) A group performed better resistance drought under the condition of treatment level 1, whose activities of anti-oxidative enzymes (POD, SOD, CAT) were higher; (3) B group exhibited stronger anti-drought under treatment level 2, whose activities of anti-oxidative enzymes were higher; (4) C group expressed anti-drought to some extent under treatment level 3, whose activities of anti

  19. Hypersensitive response-like reaction is associated with hybrid necrosis in interspecific crosses between tetraploid wheat and Aegilops tauschii coss.

    Directory of Open Access Journals (Sweden)

    Nobuyuki Mizuno

    Full Text Available BACKGROUND: Hybrid speciation is classified into homoploid and polyploid based on ploidy level. Common wheat is an allohexaploid species that originated from a naturally occurring interploidy cross between tetraploid wheat and diploid wild wheat Aegilops tauschii Coss. Aegilops tauschii provides wide naturally occurring genetic variation. Sometimes its triploid hybrids with tetraploid wheat show the following four types of hybrid growth abnormalities: types II and III hybrid necrosis, hybrid chlorosis, and severe growth abortion. The growth abnormalities in the triploid hybrids could act as postzygotic hybridization barriers to prevent formation of hexaploid wheat. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report on the geographical and phylogenetic distribution of Ae. tauschii accessions inducing the hybrid growth abnormalities and showed that they are widely distributed across growth habitats in Ae. tauschii. Molecular and cytological characterization of the type III necrosis phenotype was performed. The hybrid abnormality causing accessions were widely distributed across growth habitats in Ae. tauschii. Transcriptome analysis showed that a number of defense-related genes such as pathogenesis-related genes were highly up-regulated in the type III necrosis lines. Transmission electron microscope observation revealed that cell death occurred accompanied by generation of reactive oxygen species in leaves undergoing type III necrosis. The reduction of photosynthetic activity occurred prior to the appearance of necrotic symptoms on the leaves exhibiting hybrid necrosis. CONCLUSIONS/SIGNIFICANCE: Taking these results together strongly suggests that an autoimmune response might be triggered by intergenomic incompatibility between the tetraploid wheat and Ae. tauschii genomes in type III necrosis, and that genetically programmed cell death could be regarded as a hypersensitive response-like cell death similar to that observed in Arabidopsis

  20. Quantitation of coeliac toxicity in wheat using genomics and proteomics

    NARCIS (Netherlands)

    Gilissen, L.J.W.J.; Salentijn, E.M.J.; Broeck, van den H.C.; Cordewener, J.H.G.; America, T.H.P.; Schaart, J.G.; Meer, van der I.M.; Smulders, M.J.M.

    2013-01-01

    Several tests are currently marketed for measuring the amount of gluten in food products and to determine whether products are gluten-free. Of these tests, the Codex Alimentarius approved the R-Biopharm R5 ELISA as the gluten detection standard. This test is based on recognition by a monoclonal anti

  1. Evaluation of Genetic Diversity of Sichuan Common Wheat Landraces in China by SSR Markers

    Institute of Scientific and Technical Information of China (English)

    LI Wei; BIAN Chun-mei; WEI Yu-ming; LIU An-jun; CHEN Guo-yue; PU Zhi-en; LIU Ya-xi; ZHENG You-liang

    2013-01-01

    Genetic diversity of 62 Sichuan wheat landraces accessions of China was investigated by agronomic traits and SSR markers. The landrace population showed the characters of higher tiller capability and more kernels/spike, especially tiller no./plant of six accessions was over 40 and kernels/spike of three accessions was more than 70. A total of 547 alleles in 124 polymorphic loci were detected with an average of 4.76 alleles per locus by 114 SSR markers. Parameters analysis indicated that the genetic diversity ranked as genome A>genome B>genome D, and the homoeologous groups ranked as 5>4>3>1>2>7>6 based on genetic richness (Ri). Furthermore, chromosomes 2A, 1B and 3D had more diversity than that of chromosomes 4A, 7A and 6B. The variation of SSR loci on chromosomes 1B, 2A, 2D, 3B, and 4B implied that, in the past, different selective pressures might have acted on different chromosome regions of these landraces. Our results suggested that Sichuan common wheat landraces is a useful genetic resource for genetic research and wheat improvement.

  2. Subgenomic Diversity Patterns Caused by Directional Selection in Bread Wheat Gene Pools

    Directory of Open Access Journals (Sweden)

    Kai Voss-Fels

    2015-07-01

    Full Text Available Genetic diversity represents the fundamental key to breeding success, providing the basis for breeders to select varieties with constantly improving yield performance. On the other hand, strong selection during domestication and breeding have eliminated considerable genetic diversity in the breeding pools of major crops, causing erosion of genetic potential for adaptation to emerging challenges like climate change. High-throughput genomic technologies can address this dilemma by providing detailed knowledge to characterize and replenish genetic diversity in breeding programs. In hexaploid bread wheat ( L., the staple food for 35% of the world’s population, bottlenecks during allopolyploidisation followed by strong artificial selection have considerably narrowed diversity to the extent that yields in many regions appear to be unexpectedly stagnating. In this study, we used a 90,000 single nucleotide polymorphism (SNP wheat genotyping array to assay high-frequency, polymorphic SNP markers in 460 accessions representing different phenological diversity groups from Asian, Australian, European, and North American bread wheat breeding materials. Detailed analysis of subgroup diversity at the chromosome and subgenome scale revealed highly distinct patterns of conserved linkage disequilibrium between different gene pools. The data enable identification of genome regions in most need of rejuvenation with novel diversity and provide a high-resolution molecular basis for genomic-assisted introgression of new variation into chromosome segments surrounding directionally selected metaloci conferring important adaptation and quality traits.

  3. The in silico identification and characterization of a bread wheat/Triticum militinae introgression line.

    Science.gov (United States)

    Abrouk, Michael; Balcárková, Barbora; Šimková, Hana; Komínkova, Eva; Martis, Mihaela M; Jakobson, Irena; Timofejeva, Ljudmilla; Rey, Elodie; Vrána, Jan; Kilian, Andrzej; Järve, Kadri; Doležel, Jaroslav; Valárik, Miroslav

    2017-02-01

    The capacity of the bread wheat (Triticum aestivum) genome to tolerate introgression from related genomes can be exploited for wheat improvement. A resistance to powdery mildew expressed by a derivative of the cross-bread wheat cv. Tähti × T. militinae (Tm) is known to be due to the incorporation of a Tm segment into the long arm of chromosome 4A. Here, a newly developed in silico method termed rearrangement identification and characterization (RICh) has been applied to characterize the introgression. A virtual gene order, assembled using the GenomeZipper approach, was obtained for the native copy of chromosome 4A; it incorporated 570 4A DArTseq markers to produce a zipper comprising 2132 loci. A comparison between the native and introgressed forms of the 4AL chromosome arm showed that the introgressed region is located at the distal part of the arm. The Tm segment, derived from chromosome 7G, harbours 131 homoeologs of the 357 genes present on the corresponding region of Chinese Spring 4AL. The estimated number of Tm genes transferred along with the disease resistance gene was 169. Characterizing the introgression's position, gene content and internal gene order should not only facilitate gene isolation, but may also be informative with respect to chromatin structure and behaviour studies. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Genetic mapping of flavor loci in wheat

    Science.gov (United States)

    Flavor is an essential aspect of consumer acceptance, especially with whole-wheat foods. However, little if any selection is performed during breeding of new wheat cultivars for flavor, and little is known regarding the genetics of flavor. Our research is aimed at identifying genes that impart eithe...

  5. Registration of 'Sunshine' Hard White Winter Wheat

    Science.gov (United States)

    ’Sunshine’ (Reg. No. CV-XXXX, PI 674741) hard white winter wheat (Triticum aestivum L.) was developed by the Colorado Agricultural Experiment Station and released in August 2014 through a marketing agreement with the Colorado Wheat Research Foundation. In addition to researchers at Colorado State Un...

  6. Agronomic Performance of Low Phytic Acid Wheat

    Science.gov (United States)

    Low phytic acid (LPA) genotypes of wheat are one approach to improving the nutritional quality of wheat by reducing the concentration of phytic acid in the aleurone layer, thus reducing the chelation of nutritionally important minerals and improving the bioavailability of phosphorus. Field studies ...

  7. Deciphering the complexities of the wheat flour proteome using quantitative two-dimensional electrophoresis, three proteases and tandem mass spectrometry

    Directory of Open Access Journals (Sweden)

    Hurkman William J

    2011-02-01

    Full Text Available Abstract Background Wheat flour is one of the world's major food ingredients, in part because of the unique end-use qualities conferred by the abundant glutamine- and proline-rich gluten proteins. Many wheat flour proteins also present dietary problems for consumers with celiac disease or wheat allergies. Despite the importance of these proteins it has been particularly challenging to use MS/MS to distinguish the many proteins in a flour sample and relate them to gene sequences. Results Grain from the extensively characterized spring wheat cultivar Triticum aestivum 'Butte 86' was milled to white flour from which proteins were extracted, then separated and quantified by 2-DE. Protein spots were identified by separate digestions with three proteases, followed by tandem mass spectrometry analysis of the peptides. The spectra were used to interrogate an improved protein sequence database and results were integrated using the Scaffold program. Inclusion of cultivar specific sequences in the database greatly improved the results, and 233 spots were identified, accounting for 93.1% of normalized spot volume. Identified proteins were assigned to 157 wheat sequences, many for proteins unique to wheat and nearly 40% from Butte 86. Alpha-gliadins accounted for 20.4% of flour protein, low molecular weight glutenin subunits 18.0%, high molecular weight glutenin subunits 17.1%, gamma-gliadins 12.2%, omega-gliadins 10.5%, amylase/protease inhibitors 4.1%, triticins 1.6%, serpins 1.6%, purinins 0.9%, farinins 0.8%, beta-amylase 0.5%, globulins 0.4%, other enzymes and factors 1.9%, and all other 3%. Conclusions This is the first successful effort to identify the majority of abundant flour proteins for a single wheat cultivar, relate them to individual gene sequences and estimate their relative levels. Many genes for wheat flour proteins are not expressed, so this study represents further progress in describing the expressed wheat genome. Use of cultivar

  8. Transgenic wheat expressing Thinopyrum intermedium MYB transcription factor TiMYB2R-1 shows enhanced resistance to the take-all disease.

    Science.gov (United States)

    Liu, Xin; Yang, Lihua; Zhou, Xianyao; Zhou, Miaoping; Lu, Yan; Ma, Lingjian; Ma, Hongxiang; Zhang, Zengyan

    2013-05-01

    The disease take-all, caused by the fungus Gaeumannomyces graminis, is one of the most destructive root diseases of wheat worldwide. Breeding resistant cultivars is an effective way to protect wheat from take-all. However, little progress has been made in improving the disease resistance level in commercial wheat cultivars. MYB transcription factors play important roles in plant responses to environmental stresses. In this study, an R2R3-MYB gene in Thinopyrum intermedium, TiMYB2R-1, was cloned and characterized. The gene sequence includes two exons and an intron. The expression of TiMYB2R-1 was significantly induced following G. graminis infection. An in vitro DNA binding assay proved that TiMYB2R-1 protein could bind to the MYB-binding site cis-element ACI. Subcellular localization assays revealed that TiMYB2R-1 was localized in the nucleus. TiMYB2R-1 transgenic wheat plants were generated, characterized molecularly, and evaluated for take-all resistance. PCR and Southern blot analyses confirmed that TiMYB2R-1 was integrated into the genomes of three independent transgenic wheat lines by distinct patterns and the transgene was heritable. Reverse transcription-PCR and western blot analyses revealed that TiMYB2R-1 was highly expressed in the transgenic wheat lines. Based on disease response assessments for three successive generations, the significantly enhanced resistance to take-all was observed in the three TiMYB2R-1-overexpressing transgenic wheat lines. Furthermore, the transcript levels of at least six wheat defence-related genes were significantly elevated in the TiMYB2R-1 transgenic wheat lines. These results suggest that engineering and overexpression of TiMYB2R-1 may be used for improving take-all resistance of wheat and other cereal crops.

  9. Interplay of ribosomal DNA loci in nucleolar dominance: dominant NORs are up-regulated by chromatin dynamics in the wheat-rye system.

    Directory of Open Access Journals (Sweden)

    Manuela Silva

    Full Text Available BACKGROUND: Chromatin organizational and topological plasticity, and its functions in gene expression regulation, have been strongly revealed by the analysis of nucleolar dominance in hybrids and polyploids where one parental set of ribosomal RNA (rDNA genes that are clustered in nucleolar organizing regions (NORs, is rendered silent by epigenetic pathways and heterochromatization. However, information on the behaviour of dominant NORs is very sparse and needed for an integrative knowledge of differential gene transcription levels and chromatin specific domain interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using molecular and cytological approaches in a wheat-rye addition line (wheat genome plus the rye nucleolar chromosome pair 1R, we investigated transcriptional activity and chromatin topology of the wheat dominant NORs in a nucleolar dominance situation. Herein we report dominant NORs up-regulation in the addition line through quantitative real-time PCR and silver-staining technique. Accompanying this modification in wheat rDNA trascription level, we also disclose that perinucleolar knobs of ribosomal chromatin are almost transcriptionally silent due to the residual detection of BrUTP incorporation in these domains, contrary to the marked labelling of intranucleolar condensed rDNA. Further, by comparative confocal analysis of nuclei probed to wheat and rye NORs, we found that in the wheat-rye addition line there is a significant decrease in the number of wheat-origin perinucleolar rDNA knobs, corresponding to a diminution of the rDNA heterochromatic fraction of the dominant (wheat NORs. CONCLUSIONS/SIGNIFICANCE: We demonstrate that inter-specific interactions leading to wheat-origin NOR dominance results not only on the silencing of rye origin NOR loci, but dominant NORs are also modified in their transcriptional activity and interphase organization. The results show a cross-talk between wheat and rye NORs, mediated by ribosomal chromatin

  10. Independent mis-splicing mutations in TaPHS1 causing loss of preharvest sprouting (PHS) resistance during wheat domestication.

    Science.gov (United States)

    Liu, Shubing; Sehgal, Sunish K; Lin, Meng; Li, Jiarui; Trick, Harold N; Gill, Bikram S; Bai, Guihua

    2015-11-01

    Preharvest sprouting (PHS) is one of the major constraints of wheat production in areas where prolonged rainfall occurs during harvest. TaPHS1 is a gene that regulates PHS resistance on chromosome 3A of wheat, and two causal mutations in the positions +646 and +666 of the TaPHS1 coding region result in wheat PHS susceptibility. Three competitive allele-specific PCR (KASP) markers were developed based on the two mutations in the coding region and one in the promoter region and validated in 82 wheat cultivars with known genotypes. These markers can be used to transfer TaPHS1 in breeding through marker-assisted selection. Screening of 327 accessions of wheat A genome progenitors using the three KASP markers identified different haplotypes in both diploid and tetraploid wheats. Only one Triticum monococcum accession, however, carries both causal mutations in the TaPHS1 coding region and shows PHS susceptibility. Five of 249 common wheat landraces collected from the Fertile Crescent and surrounding areas carried the mutation (C) in the promoter (-222), and one landrace carries both the causal mutations in the TaPHS1 coding region, indicating that the mis-splicing (+646) mutation occurred during common wheat domestication. PHS assay of wheat progenitor accessions demonstrated that the wild-types were highly PHS-resistant, whereas the domesticated type showed increased PHS susceptibility. The mis-splicing TaPHS1 mutation for PHS susceptibility was involved in wheat domestication and might arise independently between T. monococcum and Triticum aestivum. No claim to original US government works New Phytologist © 2015 New Phytologist Trust.

  11. WHEAT PATHOGEN RESISTANCE AND CHITINASE PROFILE

    Directory of Open Access Journals (Sweden)

    Zuzana Gregorová

    2015-02-01

    Full Text Available The powdery mildew and leaf rust caused by Blumeria graminis and Puccinia recondita (respectively are common diseases of wheat throughout the world. These fungal diseases greatly affect crop productivity. Incorporation of effective and durable disease resistance is an important breeding objective for wheat improvement. We have evaluated resistance of four bread wheat (Triticum aestivum and four spelt wheat (Triticum spelta cultivars. Chitinases occurrence as well as their activity was determined in leaf tissues. There was no correlation between resistance rating and activity of chitinase. The pattern of chitinases reveals four isoforms with different size in eight wheat cultivars. A detailed understanding of the molecular events that take place during a plant–pathogen interaction is an essential goal for disease control in the future.

  12. Genome sequence analysis of the model grass Brachypodium distachyon: insights into grass genome evolution

    Energy Technology Data Exchange (ETDEWEB)

    Schulman, Al

    2009-08-09

    Three subfamilies of grasses, the Erhardtoideae (rice), the Panicoideae (maize, sorghum, sugar cane and millet), and the Pooideae (wheat, barley and cool season forage grasses) provide the basis of human nutrition and are poised to become major sources of renewable energy. Here we describe the complete genome sequence of the wild grass Brachypodium distachyon (Brachypodium), the first member of the Pooideae subfamily to be completely sequenced. Comparison of the Brachypodium, rice and sorghum genomes reveals a precise sequence- based history of genome evolution across a broad diversity of the grass family and identifies nested insertions of whole chromosomes into centromeric regions as a predominant mechanism driving chromosome evolution in the grasses. The relatively compact genome of Brachypodium is maintained by a balance of retroelement replication and loss. The complete genome sequence of Brachypodium, coupled to its exceptional promise as a model system for grass research, will support the development of new energy and food crops

  13. Development of high-density genetic maps for barley and wheat using a novel two-enzyme genotyping-by-sequencing approach.

    Directory of Open Access Journals (Sweden)

    Jesse A Poland

    Full Text Available Advancements in next-generation sequencing technology have enabled whole genome re-sequencing in many species providing unprecedented discovery and characterization of molecular polymorphisms. There are limitations, however, to next-generation sequencing approaches for species with large complex genomes such as barley and wheat. Genotyping-by-sequencing (GBS has been developed as a tool for association studies and genomics-assisted breeding in a range of species including those with complex genomes. GBS uses restriction enzymes for targeted complexity reduction followed by multiplex sequencing to produce high-quality polymorphism data at a relatively low per sample cost. Here we present a GBS approach for species that currently lack a reference genome sequence. We developed a novel two-enzyme GBS protocol and genotyped bi-parental barley and wheat populations to develop a genetically anchored reference map of identified SNPs and tags. We were able to map over 34,000 SNPs and 240,000 tags onto the Oregon Wolfe Barley reference map, and 20,000 SNPs and 367,000 tags on the Synthetic W9784 × Opata85 (SynOpDH wheat reference map. To further evaluate GBS in wheat, we also constructed a de novo genetic map using only SNP markers from the GBS data. The GBS approach presented here provides a powerful method of developing high-density markers in species without a sequenced genome while providing valuable tools for anchoring and ordering physical maps and whole-genome shotgun sequence. Development of the sequenced reference genome(s will in turn increase the utility of GBS data enabling physical mapping of genes and haplotype imputation of missing data. Finally, as a result of low per-sample costs, GBS will have broad application in genomics-assisted plant breeding programs.

  14. End-use quality of soft kernel durum wheat

    Science.gov (United States)

    Kernel texture is a major determinant of end-use quality of wheat. Durum wheat has very hard kernels. We developed soft kernel durum wheat via Ph1b-mediated homoeologous recombination. The Hardness locus was transferred from Chinese Spring to Svevo durum wheat via back-crossing. ‘Soft Svevo’ had SKC...

  15. 21 CFR 137.205 - Bromated whole wheat flour.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Bromated whole wheat flour. 137.205 Section 137... Cereal Flours and Related Products § 137.205 Bromated whole wheat flour. Bromated whole wheat flour... of ingredients, prescribed for whole wheat flour by § 137.200, except that potassium bromate is added...

  16. 21 CFR 139.140 - Wheat and soy macaroni products.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Wheat and soy macaroni products. 139.140 Section... Macaroni and Noodle Products § 139.140 Wheat and soy macaroni products. (a) Wheat and soy macaroni products... percent of the combined weight of the wheat and soy ingredients used (the soy flour used is made from...

  17. 7 CFR 782.17 - Wheat purchased for resale.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Wheat purchased for resale. 782.17 Section 782.17... § 782.17 Wheat purchased for resale. (a) This section applies to an importer or subsequent buyer who imports or purchases Canadian-produced wheat for the purpose of reselling the wheat. (b) The importer...

  18. 21 CFR 139.180 - Wheat and soy noodle products.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Wheat and soy noodle products. 139.180 Section 139... and Noodle Products § 139.180 Wheat and soy noodle products. (a) Wheat and soy noodle products are the... wheat and soy ingredients used (the soy flour used is made from heat-processed, dehulled soybeans,...

  19. Stem Rust Resistance in a Geographically Diverse Collection of Spring Wheat Lines Collected from Across Africa

    Science.gov (United States)

    Prins, Renée; Dreisigacker, Susanne; Pretorius, Zakkie; van Schalkwyk, Hester; Wessels, Elsabet; Smit, Corneli; Bender, Cornel; Singh, Davinder; Boyd, Lesley A.

    2016-01-01

    Following the emergence of the Ug99 lineage of Puccinia graminis f. sp. tritici (Pgt) a collective international effort has been undertaken to identify new sources of wheat stem rust resistance effective against these races. Analyses were undertaken in a collection of wheat genotypes gathered from across Africa to identify stem rust resistance effective against the Pgt races found in Eastern and Southern Africa. The African wheat collection consisted of historic genotypes collected in Kenya, South Africa, Ethiopia, Sudan, Zambia, Morocco, and Tunisia, and current South African breeding lines. Both Bayesian cluster and principal coordinate analyses placed the wheat lines from Sudan in a distinct group, but indicated a degree of genetic relatedness among the other wheat lines despite originating from countries across Africa. Seedling screens with Pgt race PTKST, pedigree information and marker haplotype analysis confirmed the presence of Sr2, Sr36, Sr24, Sr31, and Lr34/Yr18/Sr57 in a number of the lines. A genome-wide association study (GWAS) undertaken with Diversiry Arrays Technology (DArT) and stem rust (Sr) gene associated markers and Stem Area Infected (SAI) and Reaction Type (RT) field phenotypes, collected from trials carried out across two seasons in Kenya in 2009 and in South Africa in 2011, identified 29 marker-trait associations (MTA). Three MTA were in common between SAI and RT, with the biggest effect MTA being found on chromosome 6AS. Two wheat lines, W1406 and W6979 that exhibited high levels of adult plant stem rust resistance were selected to generate bi-parental mapping populations. Only the MTA on chromosomes 6AS and 3BS, and the locus Lr34/Yr18/Sr57 were confirmed following QTL mapping. Additional stem rust resistance QTL, not detected by the GWAS, were found on chromosomes 2BS, 2DL, 3DL, and 4D. PMID:27462322

  20. Enhancing lignan biosynthesis by over-expressing pinoresinol lariciresinol reductase in transgenic wheat.

    Science.gov (United States)

    Ayella, Allan K; Trick, Harold N; Wang, Weiqun

    2007-12-01

    Lignans are phenylpropane dimers that are biosynthesized via the phenylpropanoid pathway, in which pinoresinol lariciresinol reductase (PLR) catalyzes the last steps of lignan production. Our previous studies demonstrated that the contents of lignans in various wheat cultivars were significantly associated with anti-tumor activities in APC(Min) mice. To enhance lignan biosynthesis, this study was conducted to transform wheat cultivars ('Bobwhite', 'Madison', and 'Fielder', respectively) with the Forsythia intermedia PLR gene under the regulatory control of maize ubiquitin promoter. Of 24 putative transgenic wheat lines, we successfully obtained 3 transformants with the inserted ubiquitin-PLR gene as screened by PCR. Southern blot analysis further demonstrated that different copies of the PLR gene up to 5 were carried out in their genomes. Furthermore, a real-time PCR indicated approximately 17% increase of PLR gene expression over the control in 2 of the 3 positive transformants at T(0) generation. The levels of secoisolariciresinol diglucoside, a prominent lignan in wheat as determined by HPLC-MS, were found to be 2.2-times higher in one of the three positive transgenic sub-lines at T(2 )than that in the wild-type (117.9 +/- 4.5 vs. 52.9 +/- 19.8 mug/g, p <0.005). To the best of our knowledge, this is the first study that elevated lignan levels in a transgenic wheat line has been successfully achieved through genetic engineering of over-expressed PLR gene. Although future studies are needed for a stably expression and more efficient transformants, the new wheat line with significantly higher SDG contents obtained from this study may have potential application in providing additive health benefits for cancer prevention.

  1. Expression of the intact C4 type pepc gene cloned from maize in transgenic winter wheat

    Institute of Scientific and Technical Information of China (English)

    CHEN Xuqing; ZHANG Xiaodong; LIANG Rongqi; ZHANG Liquan; YANG Fengping; CAO Mingqing

    2004-01-01

    Maize intact C4-pepc gene was amplified through LA-PCR and successfully sub-cloned into modified vector pGreen0029 to form a stable expression construct named as Pbac214 (12 kb), which contains CaMV 35S promoter driven bar gene as selection marker. Comparing the cloned DNA sequences (6.7 kb) with published maize C4-pepc gene (GenBank accession E17154) sequences, the identity of DNA sequence alignment is 98.96%. There are only 49 differences between these two intact DNA sequences, of which 13 occur in the region of promoter, 18 in introns, and 18 in exons. The homology of Mrna sequence alignment is 99.38%, and the putative amino acids sequence identity is 99.38%. There are only 15 differences between these two Mrna, and these differences bring 4 sites mutant on the putative amino acids of PEPC protein. Through biolistic bombardment of PDS1000/He system, expression vector Pbac214 has been transformed into winter wheat. Southern blotting results show that the intact C4-pepc gene has been integrated into genome of winter wheat. SDS-PAGE analysis of leaf soluble protein in transgenic wheat showed that the intact C4-pepc gene was well transcribed, spliced and translated as in maize. The enzyme activity of leaf PEPC in transgenic wheat has been detected. The activities of leaf PEPC increased over 3-5 times in some transgenic plants. The data of photosynthesis rate and transpiration rate of transgenic wheat flag leaves showed that the C4-pepc gene can increase the photosynthesis rate and transpiration rate of transgenic wheat.

  2. Effects of Processing on Wheat Tortilla Quality: Benefits of Hard White Wheat

    Institute of Scientific and Technical Information of China (English)

    Michael Tilley; Valquiria Pierucci; Katherine A Tilley; Okkyung Kim Chung

    2006-01-01

    The suitability of Kansas hard white winter (HWW) wheat milled at a high extraction rate for tortilla production was investigated. All of the Kansas varieties of white wheat, milled to 80% extraction, performed as well as, if not better than, a standard commercial tortilla flour milled to 72% extraction when various quality factors were compared. Tortillas were made from eight wheat cultivars milled at 80% extraction: four HWW wheat cultivars included Betty, Heyne, Oro Blanco and NuWest; three hard red winter (HRW) wheat samples were Jagger and Ike grown at Hutchinson, Kansas (Ike-Hutch) and at Hays, Kansas (Ike-Hays); and one hard white spring (HWS) wheat cultivar, Idaho 377-S. Tortillas made from these flours were compared to tortillas made from one commercial tortilla-flour milled to 72% extraction from a blend of HRW wheat. Mixograph parameters, starch pasting properties,dough-handling characteristics and tortilla- making attributes of the new Kansas HWW wheat cultivars, Betty and Heyne, were superior. In summary, Kansas HWW wheat flours, milled to 80% extraction, produced tortillas which were equal to, or superior to,those made from 80%-extraction HRW wheat flours and 72%-extraction commercial tortilla flour.

  3. Cancer genomics

    DEFF Research Database (Denmark)

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  4. Using multispectral imagery to compare the spatial pattern of injury to wheat caused by Russian wheat aphid and greenbug

    Science.gov (United States)

    The Russian wheat aphid, Diuraphis noxia (Mordvilko), and greenbug, Schizaphis graminum (Rondani), are important aphid pests of wheat. Outbreaks of both pests in commercial wheat fields occur almost every year in the Great Plains of the United States. Infestations of both pests in wheat fields are...

  5. End-use quality of CIMMYT-derived soft kernel durum wheat germplasm. I. Grain, milling and soft wheat quality.

    Science.gov (United States)

    Wheat kernel texture is used in part to define U.S. wheat market class due to its importance in end-use quality and utilization. Durum wheat (Triticum turgidum subsp. durum) has lower demand and fewer culinary end-uses compared to bread wheat because of its extremely hard kernel texture, which precl...

  6. AB-QTL analysis in winter wheat: II. Genetic analysis of seedling and field resistance against leaf rust in a wheat advanced backcross population.

    Science.gov (United States)

    Naz, Ali Ahmad; Kunert, Antje; Lind, Volker; Pillen, Klaus; Léon, Jens

    2008-05-01

    The present study aimed to localize exotic quantitative trait locus (QTL) alleles for the improvement of leaf rust (P. triticina) resistance in an advanced backcross (AB) population, B22, which is derived from a cross between the winter wheat cultivar Batis (Triticum aestivum) and the synthetic wheat accession Syn022L. The latter was developed from hybridization of T. turgidum ssp. dicoccoides and T. tauschii. Altogether, 250 BC2F3 lines of B22 were assessed for seedling resistance against the leaf rust isolate 77WxR under controlled conditions. In addition, field resistance against leaf rust was evaluated by assessing symptom severity under natural infestation across multiple environments. Simultaneously, population B22 was genotyped with a total of 97 SSR markers, distributed over the wheat A, B and D genomes. The phenotype and genotype data were subjected to QTL analysis by applying a 3-factorial mixed model analysis of variance including the marker genotype as a fixed effect and the environments, the lines and the marker by environment interactions as random effects. The QTL analysis revealed six putative QTLs for seedling resistance and seven for field resistance. For seedling resistance, the effects of exotic QTL alleles improved resistance at all detected loci. The maximum decrease of disease symptoms (-46.3%) was associated with marker locus Xbarc149 on chromosome 1D. For field resistance, two loci had stable main effects across environments and five loci exhibited marker by environment interaction effects. The strongest effects were detected at marker locus Xbarc149 on chromosome 1D, at which the exotic allele decreased seedling symptoms by 46.3% and field symptoms by 43.6%, respectively. Some of the detected QTLs co-localized with known resistance genes, while others appear to be as novel resistance loci. Our findings indicate, that the exotic wheat accession Syn022L may be useful for the improvement of leaf rust resistance in cultivated wheat.

  7. GRAIN QUALITY AND NORTH AMERICAN HARD WHEAT EXPORTS

    OpenAIRE

    Wilson, William W.; Dahl, Bruce L.

    1998-01-01

    Past debate on competition and quality in international wheat markets has focused on class and country of origin as the salient source of differentiation. This study analyzes changes in demand for both wheat classes and grades. Comparisons are made between Canadian and U.S. hard wheats, principal competitors in the hard wheat market. Both countries are dominant producers of Hard Red Spring Wheat (HRS in the United States and Canadian Western Red Spring [CWRS] in Canada); the United States is ...

  8. An efficient and reproducible protocol for the production of salt tolerant transgenic wheat plants expressing the Arabidopsis AtNHX1 gene.

    Science.gov (United States)

    Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A

    2014-01-01

    We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.

  9. AGRONOMIC AND QUALITY QTL MAPPING IN SPRING WHEAT

    Directory of Open Access Journals (Sweden)

    Mohamed Mergoum

    2013-04-01

    Full Text Available Wheat (Triticum aestivum L. flour represents one of the primary sources of calories and proteins for the human diet. The increase in the wheat yield without losing its baking and milling quality is an important breeding objective. The use of QTL analysis is an expedient methodology to help breeders to face this multifaceted challenge. Here, a population of 129 recombinant inbred lines (RILs developed from a cross between ‘Steele-ND’ cultivar and ‘ND 735’ advanced line was used to evaluate several yield and quality traits and map the genomic regions controlling these traits. The phenotypic data were collected from field experiments conducted at four North Dakota (ND, USA environments. Transgressive segregation was observed for all traits, with RILs outperforming the most adapted parent and commercial cultivars. Using a linkage map of 392 markers, composite interval mapping identified a total of 13 environment-specific QTLs, all explaining large phenotypic variations (R2=16-44%. The genotypic values of these “reserve” alleles were directly used as criteria of selection in breeding programs.

  10. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  11. Morphological, yield, cytological and molecular characterization of a bread wheat × tritordeum F1 hybrid

    Indian Academy of Sciences (India)

    J. Lima-Brito; A. Carvalho; A. Martin; J. S. Heslop-Harrison; H. Guedes-Pinto

    2006-08-01

    The morphological, yield, cytological and molecular characteristics of bread wheat × tritordeum F1 hybrids ($2n = 6x = 42$; AABBDHch) and their parents were analysed. Morphologically, these hybrids resembled the wheat parent. They were slightly bigger than both parents, had more spikelets per spike, and tillered more profusely. The hybrids are self-fertile but a reduction of average values of yield parameters was observed. For the cytological approach we used a double-target fluorescence in situ hybridization performed with total genomic DNA from Hordeum chilense L. and the ribosomal sequence pTa71. This technique allowed us to confirm the hybrid nature and to analyse chromosome pairing in this material. Our results showed that the expected complete homologous pairing (14 bivalents plus 14 univalents) was only observed in 9.59% of the pollen mother cells (PMCs) analysed. Some PMCs presented autosyndetic pairing of Hch and A, B or D chromosomes. The average number of univalents was higher in the wheat genome (6.8) than in the Hch genome (5.4). The maximum number of univalents per PMC was 20. We only observed wheat multivalents (one per PMC) but the frequency of trivalents (0.08) was higher than that of quadrivalents (0.058). We amplified 50 RAPD bands polymorphic between the F1 hybrid and one of its parents, and 31 ISSR polymorphic bands. Both sets of markers proved to be reliable for DNA fingerprinting. The complementary use of morphological and yield analysis, molecular cytogenetic techniques and molecular markers allowed a more accurate evaluation and characterization of the hybrids analysed here.

  12. Genetic Architecture of Resistance to Stripe Rust in a Global Winter Wheat Germplasm Collection

    Directory of Open Access Journals (Sweden)

    Peter Bulli

    2016-08-01

    Full Text Available Virulence shifts in populations of Puccinia striiformis f. sp. tritici (Pst, the causal pathogen of wheat stripe rust, are a major challenge to resistance breeding. The majority of known resistance genes are already ineffective against current races of Pst, necessitating the identification and introgression of new sources of resistance. Germplasm core collections that reflect the range of genetic and phenotypic diversity of crop species are ideal platforms for examining the genetic architecture of complex traits such as resistance to stripe rust. We report the results of genetic characterization and genome-wide association analysis (GWAS for resistance to stripe rust in a core subset of 1175 accessions in the National Small Grains Collection (NSGC winter wheat germplasm collection, based on genotyping with the wheat 9K single nucleotide polymorphism (SNP iSelect assay and phenotyping of seedling and adult plants under natural disease epidemics in four environments. High correlations among the field data translated into high heritability values within and across locations. Population structure was evident when accessions were grouped by stripe rust reaction. GWAS identified 127 resistance loci that were effective across at least two environments, including 20 with significant genome-wide adjusted P-values. Based on relative map positions of previously reported genes and QTL, five of the QTL with significant genome-wide adjusted P-values in this study represent potentially new loci. This study provides an overview of the diversity of Pst resistance in the NSGC winter wheat germplasm core collection, which can be exploited for diversification of stripe rust resistance in breeding programs.

  13. Micromilling enhances iron bioaccessibility from wholegrain wheat.

    Science.gov (United States)

    Latunde-Dada, G O; Li, X; Parodi, A; Edwards, C H; Ellis, P R; Sharp, P A

    2014-11-19

    Cereals constitute important sources of iron in human diet; however, much of the iron in wheat is lost during processing for the production of white flour. This study employed novel food processing techniques to increase the bioaccessibility of naturally occurring iron in wheat. Iron was localized in wheat by Perl's Prussian blue staining. Soluble iron from digested wheat flour was measured by a ferrozine spectrophotometric assay. Iron bioaccessibility was determined using an in vitro simulated peptic-pancreatic digestion, followed by measurement of ferritin (a surrogate marker for iron absorption) in Caco-2 cells. Light microscopy revealed that iron in wheat was encapsulated in cells of the aleurone layer and remained intact after in vivo digestion and passage through the gastrointestinal tract. The solubility of iron in wholegrain wheat and in purified wheat aleurone increased significantly after enzymatic digestion with Driselase, and following mechanical disruption using micromilling. Furthermore, following in vitro simulated peptic-pancreatic digestion, iron bioaccessibility, measured as ferritin formation in Caco-2 cells, from micromilled aleurone flour was significantly higher (52%) than from whole aleurone flour. Taken together our data show that disruption of aleurone cell walls could increase iron bioaccessibility. Micromilled aleurone could provide an alternative strategy for iron fortification of cereal products.

  14. Aluminium toxicity in winter wheat

    Directory of Open Access Journals (Sweden)

    Szabó A.

    2015-01-01

    Full Text Available Aluminium is the most frequent metal of the earth crust; it occurs mainly as biologically inactive, insoluble deposit. Environmental problems, industrial contaminations and acid rains increase the soil acidity, leading to the mobilization of Al. Half of the world’s potential arable lands are acidic; therefore, Al-toxicity decreases crop productivity. Wheat is a staple food for 35% of the world population. The effects of Al-stress (0.1 mM were studied on winter wheat; seedlings were grown hydroponically, at acidic pH. After two weeks, the root weight was decreased; a significant difference was found in the P- and Ca-content. The shoot weight and element content changed slightly; Al-content in the root was one magnitude higher than in the shoot, while Al-translocation was limited. The root plasma membrane H+-ATPase has central role in the uptake processes; Al-stress increased the Mg2+-ATPase activity of the microsomal fraction.

  15. Microencapsulation of wheat germ oil.

    Science.gov (United States)

    Yazicioglu, Basak; Sahin, Serpil; Sumnu, Gulum

    2015-06-01

    Wheat germ oil (WGO) is beneficial for health since it is a rich source of omega-3, omega-6 and tocopherol. However, as it contains polyunsaturated fatty acids, it is prone to oxidation. The aim of this study was to encapsulate wheat germ oil and determine the effects of core to coating ratio, coating materials ratio and ultrasonication time on particle size distribution of emulsions and encapsulation efficiency (EE) and surface morphology of capsules. Maltodextrin (MD) and whey protein concentrate (WPC) at different ratios (3:1, 2:2, 1:3) were used as coating materials. Total solid content of samples was 40 % (w/w). Five core to coating ratios (1:8, 1:4, 1:2, 3:4, 1:1) were tried. Ultrasound was used at 320 W and 20 kHz for 2, 5, 10 min to obtain emulsions. Then, emulsions were freeze dried to obtain microcapsules. It was observed that, increasing WPC ratio in the coating resulted in higher encapsulation efficiency and smaller particle size. Microcapsules prepared with MD:WPC ratio of 1:3 were found to have higher EE (74.35-89.62 %). Increase in oil load led to decrease in EE. Thus 1:8 core to coating ratio gave better results. Increasing ultrasonication time also had a positive effect on encapsulation efficiency.

  16. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew.

    Science.gov (United States)

    Wang, Yanpeng; Cheng, Xi; Shan, Qiwei; Zhang, Yi; Liu, Jinxing; Gao, Caixia; Qiu, Jin-Long

    2014-09-01

    Sequence-specific nucleases have been applied to engineer targeted modifications in polyploid genomes, but simultaneous modification of multiple homoeoalleles has not been reported. Here we use transcription activator-like effector nuclease (TALEN) and clustered, regularly interspaced, short palindromic repeats (CRISPR)-Cas9 (refs. 4,5) technologies in hexaploid bread wheat to introduce targeted mutations in the three homoeoalleles that encode MILDEW-RESISTANCE LOCUS (MLO) proteins. Genetic redundancy has prevented evaluation of whether mutation of all three MLO alleles in bread wheat might confer resistance to powdery mildew, a trait not found in natural populations. We show that TALEN-induced mutation of all three TaMLO homoeologs in the same plant confers heritable broad-spectrum resistance to powdery mildew. We further use CRISPR-Cas9 technology to generate transgenic wheat plants that carry mutations in the TaMLO-A1 allele. We also demonstrate the feasibility of engineering targeted DNA insertion in bread wheat through nonhomologous end joining of the double-strand breaks caused by TALENs. Our findings provide a methodological framework to improve polyploid crops.

  17. Involvement of Fungal Pectin Methylesterase Activity in the Interaction Between Fusarium graminearum and Wheat.

    Science.gov (United States)

    Sella, Luca; Castiglioni, Carla; Paccanaro, Maria Chiara; Janni, Michela; Schäfer, Wilhelm; D'Ovidio, Renato; Favaron, Francesco

    2016-04-01

    The genome of Fusarium graminearum, the causal agent of Fusarium head blight of wheat, contains two putative pectin methylesterase (PME)-encoding genes. However, when grown in liquid culture containing pectin, F. graminearum produces only a single PME, which was purified and identified. Its encoding gene, expressed during wheat spike infection, was disrupted by targeted homologous recombination. Two Δpme mutant strains lacked PME activity but were still able to grow on highly methyl-esterified pectin even though their polygalacturonase (PG) activity showed a reduced capacity to depolymerize this substrate. The enzymatic assays performed with purified F. graminearum PG and PME demonstrated an increase in PG activity in the presence of PME on highly methyl-esterified pectin. The virulence of the mutant strains was tested on Triticum aestivum and Triticum durum spikes, and a significant reduction in the percentage of symptomatic spikelets was observed between 7 and 12 days postinfection compared with wild type, demonstrating that the F. graminearum PME contributes to fungal virulence on wheat by promoting spike colonization in the initial and middle stages of infection. In contrast, transgenic wheat plants with increased levels of pectin methyl esterification did not show any increase in resistance to the Δpme mutant, indicating that the infectivity of the fungus relies only to a certain degree on pectin degradation.

  18. Identification of retrotransposon families and analysis of their transcriptional activation in wheat

    Institute of Scientific and Technical Information of China (English)

    TANG Yimiao; MA Youzhi; LI Liancheng; XIN Zhiyong

    2005-01-01

    Variations in the reverse transcriptase (RT) domain were analyzed to clarify retrotransposon family structure and their evolution in wheat genome. RT-PCR was conducted by using primers based on the conserved RT peptide motifs of plant retrotransposons to amplify the RT domain of retrotransposons in the seedlings of wheat line Pm97034 treated with powdery mildew fungus. High level of heterogeneity was detected in 51 (RT1-51) clones randomly selected and the identity of nucleotide sequence among them ranged from 75.4% to 97.9%. These sequences, in combination with previously identified seven representatives from wheat retrotransposon families (families 1―7), were used to construct a composite phylogenetic tree. Three new families, designated family 8 to family 10, were identified. Famliy 8 formed before divergence of the Pooideae subfamily and was regarged as an ancient retrotransposon family. Some members of family 4 and family 7 had transcriptional activativity, and were present with multiple copies in wheat and its related species.

  19. Comprehensive survey of SNPs in the Affymetrix exon array using the 1000 Genomes dataset.

    Directory of Open Access Journals (Sweden)

    Eric R Gamazon

    Full Text Available Microarray gene expression data has been used in genome-wide association studies to allow researchers to study gene regulation as well as other complex phenotypes including disease risks and drug response. To reach scientifically sound conclusions from these studies, however, it is necessary to get reliable summarization of gene expression intensities. Among various factors that could affect expression profiling using a microarray platform, single nucleotide polymorphisms (SNPs in target mRNA may lead to reduced signal intensity measurements and result in spurious results. The recently released 1000 Genomes Project dataset provides an opportunity to evaluate the distribution of both known and novel SNPs in the International HapMap Project lymphoblastoid cell lines (LCLs. We mapped the 1000 Genomes Project genotypic data to the Affymetrix GeneChip Human Exon 1.0ST array (exon array, which had been used in our previous studies and for which gene expression data had been made publicly available. We also evaluated the potential impact of these SNPs on the differentially spliced probesets we had identified previously. Though the 1000 Genomes Project data allowed a comprehensive survey of the SNPs in this particular array, the same approach can certainly be applied to other microarray platforms. Furthermore, we present a detailed catalogue of SNP-containing probesets (exon-level and transcript clusters (gene-level, which can be considered in evaluating findings using the exon array as well as benefit the design of follow-up experiments and data re-analysis.

  20. Study on Homogeneous Particleboard of Wheat Straw

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    In the paper homogeneous particleboard of wheat straw is researched. The result shows the technology of homogeneous particleboard from cost and quality. The moisture content of straw particle is 2.0%~2.5 %. The temperature of hot-pressing is 150℃. The time of hot-pressing is 48 sec/mm ( panel thickness). The ratio between MDI and UF is 0.40. The glue content for surface layer of wheat straw particle is 10% (MDI 2.86%, UF 7.14%). The glue content for core layer of wheat straw particle is 8% (MDI 2.29%, U...

  1. Pelletizing properties of torrefied wheat straw

    DEFF Research Database (Denmark)

    Stelte, Wolfgang; Nielsen, Niels Peter; Hansen, Hans Ove;

    2013-01-01

    of wheat straw have been analyzed. Laboratory equipment has been used to investigate the pelletizing properties of wheat straw torrefied at temperatures between 150 and 300 °C. IR spectroscopy and chemical analyses have shown that high torrefaction temperatures change the chemical properties of the wheat...... straw significantly, and the pelletizing analyses have shown that these changes correlate to changes in the pelletizing properties. Torrefaction increase the friction in the press channel and pellet strength and density decrease with an increase in torrefaction temperature....

  2. On the Parable of Weeds and Wheat

    Institute of Scientific and Technical Information of China (English)

    HUANG Wei

    2013-01-01

    This paper probes on one of the famous parables of Jesus-the Wheat and Weeds, and demonstrates some implied meaning and morals connoted in it. Through an interesting contrast between the calm restraint of the householder and high anxi-ety of his slaves, this parable suggests that people should stay calm and learn from God to be tolerate and lenient religiously to“let wheat and weeds grow together until the harvest”. Meanwhile, God drops a subtle hint to seed wheat positively in stead of sug-gesting people to remove weeds negatively.

  3. Durum wheat quality prediction in Mediterranean environments

    DEFF Research Database (Denmark)

    Toscano, P.; Gioli, B.; Genesio, L.

    2014-01-01

    Durum wheat is one of the most important agricultural crops in the Mediterranean area. In addition to yield, grain quality is very important in wheat markets because of the demand for high-quality end products such as pasta, couscous and bulgur wheat. Grain quality is directly affected by several...... agronomic and environmental factors. Our objective is to determine the general principles underlying how, in Mediterranean environments, grain protein content (GPC) is affected by these factors and provide a system model with high predictive ability. We initially evaluated the capability of the Delphi...

  4. Patterns of suspected wheat-related allergy

    DEFF Research Database (Denmark)

    Junker Christensen, Morten; Eller, Esben; Mortz, Charlotte G

    2014-01-01

    ). All children had atopic dermatitis, and most (13/15) outgrew their wheat allergy. Most children (13/15) had other food allergies. Challenge positive patients showed significantly higher levels of sIgE to wheat and significantly more were SPT positive than challenge negative. Group 2: Eleven out of 13...... adults with occupational asthma or rhinitis were challenge positive. None outgrew their allergy. Seven had positive sIgE and 10 had positive SPT to wheat. Group 3: Ten of 48 (adolescent/adults) were positive when challenged during exercise. Challenge positive patients showed significantly higher levels...

  5. Proteome characterization of developing grains in bread wheat cultivars (Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Guo Guangfang

    2012-08-01

    Full Text Available Abstract Background The analyses of protein synthesis, accumulation and regulation during grain development in wheat are more complex because of its larger genome size compared to model plants such as Arabidopsis and rice. In this study, grains from two wheat cultivars Jimai 20 and Zhoumai 16 with different gluten quality properties were harvested at five development stages, and were used to displayed variable expression patterns of grain proteins. Results Proteome characterization during grain development in Chinese bread wheat cultivars Jimai 20 and Zhoumai 16 with different quality properties was investigated by 2-DE and tandem MALDI-TOF/TOF-MS. Identification of 117 differentially accumulated protein spots representing 82 unique proteins and five main expression patterns enabled a chronological description of wheat grain formation. Significant proteome expression differences between the two cultivars were found; these included 14 protein spots that accumulated in both cultivars but with different patterns and 27 cultivar-different spots. Among the cultivar-different protein spots, 14 accumulated in higher abundance in Jimai 20 than in Zhoumai 16, and included NAD-dependent isocitrate dehydrogenase, triticin precursor, LMW-s glutenin subunit and replication factor C-like protein. These proteins are likely to be associated with superior gluten quality. In addition, some proteins such as class II chitinase and peroxidase 1 with isoforms in developing grains were shown to be phosphorylated by Pro-Q Diamond staining and phosphorprotein site prediction. Phosphorylation could have important roles in wheat grain development. qRT-PCR analysis demonstrated that transcriptional and translational expression patterns of many genes were significantly different. Conclusions Wheat grain proteins displayed variable expression patterns at different developmental stages and a considerable number of protein spots showed differential accumulation between two

  6. Chronic headaches and sleepiness caused by facial soap (containing hydrolyzed wheat proteins)-induced wheat allergy.

    Science.gov (United States)

    Iseki, Chifumi; Kawanami, Toru; Tsunoda, Takahiko; Chinuki, Yuko; Kato, Takeo

    2014-01-01

    A 38-year-old woman was suffering from irregular headaches and sleepiness. She had used soap containing Glupearl 19S (hydrolyzed wheat proteins) every day for approximately one year and had experienced an episode of rash eruption on her face seven months ago. Wheat-specific IgE antibodies were detected in her serum. A Western blot analysis revealed a high titer of IgE antibodies against Glupearl 19S and wheat proteins. The patient was sensitive to these compounds in a skin prick test. After avoiding eating wheat, her headaches and sleepiness disappeared. A hidden food allergy is a possible cause of these symptoms.

  7. Wheat Bran Phenolic Acids: Bioavailability and Stability in Whole Wheat-Based Foods

    Directory of Open Access Journals (Sweden)

    Barbara Laddomada

    2015-08-01

    Full Text Available Wheat bran is generally considered a byproduct of the flour milling industry, but it is a great source of fibers, minerals, and antioxidants that are important for human health. Phenolic acids are a specific class of wheat bran components that may act as antioxidants to prevent heart disease and to lower the incidence of colon cancer. Moreover, phenolic acids have anti-inflammatory properties that are potentially significant for the promotion of gastrointestinal health. Evidence on the beneficial effects of phenolic acids as well as of other wheat bran components is encouraging the use of wheat bran as an ingredient of functional foods. After an overview of the chemistry, function, and bioavailability of wheat phenolic acids, the discussion will focus on how technologies can allow the formulation of new, functional whole wheat products with enhanced health-promoting value and safety without renouncing the good-tasting standards that are required by consumers. Finally, this review summarizes the latest studies about the stability of phenolic acids in wheat foods fortified by the addition of wheat bran, pearled fractions, or wheat bran extracts.

  8. Wheat Bran Phenolic Acids: Bioavailability and Stability in Whole Wheat-Based Foods.

    Science.gov (United States)

    Laddomada, Barbara; Caretto, Sofia; Mita, Giovanni

    2015-08-28

    Wheat bran is generally considered a byproduct of the flour milling industry, but it is a great source of fibers, minerals, and antioxidants that are important for human health. Phenolic acids are a specific class of wheat bran components that may act as antioxidants to prevent heart disease and to lower the incidence of colon cancer. Moreover, phenolic acids have anti-inflammatory properties that are potentially significant for the promotion of gastrointestinal health. Evidence on the beneficial effects of phenolic acids as well as of other wheat bran components is encouraging the use of wheat bran as an ingredient of functional foods. After an overview of the chemistry, function, and bioavailability of wheat phenolic acids, the discussion will focus on how technologies can allow the formulation of new, functional whole wheat products with enhanced health-promoting value and safety without renouncing the good-tasting standards that are required by consumers. Finally, this review summarizes the latest studies about the stability of phenolic acids in wheat foods fortified by the addition of wheat bran, pearled fractions, or wheat bran extracts.

  9. Durum wheat and allelopathy: toward wheat breeding for natural weed management.

    Science.gov (United States)

    Fragasso, Mariagiovanna; Iannucci, Anna; Papa, Roberto

    2013-09-24

    Wheat-derived foodstuffs represent about one-fifth of the calories consumed by humans worldwide. Bread wheat (Triticum aestivum L.) is one of the most important crops throughout the world, and it has been extensively studied for its allelopathic potential. In contrast, for allelopathy in durum wheat (Triticum turgidum ssp. durum), our knowledge is partial and fragmentary. Through highlighting recent advances in using allelopathy as a crop-breeding tool, we provide an overview of allelopathy in Triticum spp., to stimulate further coordinated breeding-oriented studies, to favor allelopathy exploitation for the sustainable cultivation of wheat, and in particular, to achieve improved biological weed control.

  10. Evolutionary analysis of the CACTA DNA-transposon Caspar across wheat species using sequence comparison and in situ hybridization.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Salina, Elena A; Adonina, Irina G; Chalhoub, Boulos

    2010-07-01

    Mobile elements constitute a considerable part of the eukaryotic genome. This work is focused on the distribution and evolution of DNA-transposons in the genomes of diploid and allopolyploid Triticeae species and their role in the formation of functionally important chromosomal subtelomeric regions. The Caspar family is among the most abundant of CACTA DNA-transposons in Triticeae. To study the evolution of Caspar-like elements in Triticeae genomes, we analyzed their sequences and distribution in chromosomes by in situ hybridization. In total, 46 Caspar-like elements from the wheat and barley Caspar, Clifford, and Donald families were analyzed after being extracted from databases using the transposase consensus sequence. Sequence alignment and subsequent phylogenetic analyses revealed that the transposase DNA sequences formed three major distinct groups: (1) Clifford, (2) Caspar_Triticinae, and (3) Caspar_Hordeinae. Additionally, in situ hybridization demonstrated that Caspar_Triticinae transposons are predominantly compartmentalized in the subtelomeric chromosomal regions of wheat and its progenitors. Analysis of data suggested that compartmentalization in the subtelomeric chromosomal region was a characteristic feature of all the main groups of Caspar-like elements. Furthermore, a dot plot analysis of the terminal repeats demonstrated that the divergence of these repeats strictly correlated with the divergence of Caspar coding sequences. A clear distinction in the Caspar DNA sequences among the species Triticum/Aegilops (Caspar_Triticinae), Hordeum (Caspar_Hordeinae), and different distributions in individual hexaploid wheat genomes (A/B and D) suggest an independent proliferation of these elements in wheat (or its progenitors) and barley genomes. Thus, Caspar-like transposons can significantly contribute to the formation and differentiation of subtelomeric regions in Triticeae species.

  11. Low temperature-induced necrosis shows phenotypic plasticity in wheat triploid hybrids.

    Science.gov (United States)

    Takumi, Shigeo; Mizuno, Nobuyuki

    2011-10-01

    Hybrid necrosis sometimes appears in triploid hybrids between tetraploid wheat and Aegilops tauschii Coss. Two types of hybrid necrosis (type II and type III) were observed when cultivar Langdon was used as female parent for hybrid production. Type II necrosis symptoms occurred only under low temperature conditions, whereas bushy and dwarf phenotypes were observed under normal temperature conditions. The developmental plasticity might be related to a temperature-responsive alteration of meristematic activity at the crown tissue of triploid hybrids. Epistatic interaction between the AB and D genomes induced not only upregulation of a number of defense-related genes, but also extensive changes in plant architecture in the type II necrosis hybrids. Such phenotypic plasticity was also observed in other cross combinations between cultivated tetraploid wheat and type II necrosis-induced Ae. tauschii accessions. Wild tetraploid wheat, Triticum turgidum subspecies dicoccoides, did not induce type II necrosis in the triploid hybrids, indicating the possibility of identifying the chromosomal location of a causal gene for type II necrosis in the AB genome.

  12. Segregation ratios of colored grains in F1 hybrid wheat

    Directory of Open Access Journals (Sweden)

    Zifeng Guo

    2012-01-01

    Full Text Available Nutritious and functional foods from wheat have received great attention in recent years. Colored-grain wheat contains a large number of nutrients such as anthocyanins and hence the breeding is interesting. In this work, colored-grained wheat lines of mixed pollination of einkorn wheat (Triticum boeoticum, AA and French rye (French Secale cereale, RR were used as male parents and wheat line Y1642 (derived from common wheat and Agropyron elongatum, AABBDD was used as the female parent. These colored wheat were used for diallel cross to study the segregation ratios of F1 colored grains. Results show that the color inheritance of purple-grained wheat follows a maternal inheritance pattern and that the blue-grained wheat expresses xenia in most cases. In some circumstances, the grains with different color shades appear in the same spike.

  13. Research and application of hybrid wheat in China

    Institute of Scientific and Technical Information of China (English)

    Zhao Changping

    2013-01-01

    Hybrid wheat is recognized as a preferred approach to improve wheat yield,and it will be a competi-tion focus in high-tech seed industry in the future. We have made a breakthrough for the first time in creation of two-line hybrid wheat system,which reaches the world leading level in wheat research and has laid an important foundation for the future direction of the world wheat research. Similar to hybrid rice,the innovation of two-line hybrid wheat system is another achievement in science and technology. The application of hybrid wheat in China will greatly increase the food production,and make a great significance to food production and food security. This paper introduces the development process and major breakthrough of hybrid wheat in China,and the main bottle-neck and countermeasures in the application of hybrid wheat.

  14. Genetic and epigenetic variations induced by wheat-rye 2R and 5R monosomic addition lines.

    Directory of Open Access Journals (Sweden)

    Shulan Fu

    Full Text Available BACKGROUND: Monosomic alien addition lines (MAALs can easily induce structural variation of chromosomes and have been used in crop breeding; however, it is unclear whether MAALs will induce drastic genetic and epigenetic alterations. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, wheat-rye 2R and 5R MAALs together with their selfed progeny and parental common wheat were investigated through amplified fragment length polymorphism (AFLP and methylation-sensitive amplification polymorphism (MSAP analyses. The MAALs in different generations displayed different genetic variations. Some progeny that only contained 42 wheat chromosomes showed great genetic/epigenetic alterations. Cryptic rye chromatin has introgressed into the wheat genome. However, one of the progeny that contained cryptic rye chromatin did not display outstanding genetic/epigenetic variation. 78 and 49 sequences were cloned from changed AFLP and MSAP bands, respectively. Blastn search indicated that almost half of them showed no significant similarity to known sequences. Retrotransposons were mainly involved in genetic and epigenetic variations. Genetic variations basically affected Gypsy-like retrotransposons, whereas epigenetic alterations affected Copia-like and Gypsy-like retrotransposons equally. Genetic and epigenetic variations seldom affected low-copy coding DNA sequences. CONCLUSIONS/SIGNIFICANCE: The results in the present study provided direct evidence to illustrate that monosomic wheat-rye addition lines could induce different and drastic genetic/epigenetic variations and these variations might not be caused by introgression of rye chromatins into wheat. Therefore, MAALs may be directly used as an effective means to broaden the genetic diversity of common wheat.

  15. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    Science.gov (United States)

    Chao, Shiaoman; Singh, Ravi P.; Sorrells, Mark E.

    2017-01-01

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS) for identifying loci associated with the Ug99 stem rust resistance (SR) in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT). Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP) chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR) assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat. PMID:28241006

  16. Common bunt resistant wheat composite cross populations

    DEFF Research Database (Denmark)

    Steffan, Philipp Matthias; Borgen, A.; Backes, Gunter Martin

    stability. However, a number of challenges must be met before diverse wheat populations can be introduced into commercial wheat production: one of these is the development of breeding technologies based on mass selection which enable breeders and farmers to improve specific traits in populations...... and maintain diversity at the same time. BIOBREED is a project which commenced in Denmark in 2011 to meet these challenges for wheat population breeding. The project focuses on the development of tools and methods for mass selection of traits relevant for organic and low input production, where it is expected...... that the highest benefits of utilizing diverse populations can be achieved. BIOBREED focuses on three main aspects of wheat population breeding for organic and low input production systems: i) common bunt (caused by Tilletia caries) resistance, ii) selection for improved protein content and iii) the influence...

  17. Evaluation of wheat by polyacrylamide gel electrophoresis

    African Journals Online (AJOL)

    PRECIOUS

    2010-01-11

    Jan 11, 2010 ... SDS-PAGE gels cluster analysis was performed to check the ... It is concluded that SDS-PAGE analysis of wheat endosperm protein is useful for evaluation of ..... Comparison of phenotypic and molecular marker-based.

  18. QUALITY PARAMETRES OF EMMER WHEAT LANDRACES

    Directory of Open Access Journals (Sweden)

    Petr KONVALINA

    2009-03-01

    Full Text Available Emmer wheat, Triticum dicoccum SCHUEBL, is an old variety of cereals which has been traditionally grown in aride areas. Nowdays, it is mainly grown in Italy, Spain, Turkey, Austria and in the Czech republic. This article deals with a study of quality parametres and selected economic parametres of 6 varieties coming from the genetic resources of emmer wheat. High crude protein content in grain was proved during the trials. Nevertheless, such a characteristic is not suitable for the classical bakery processing (production of leavened products. Low figure of the harvest index is supposed to be the most problematic economic character. However, emmer wheat is a suitable variety for organic farming system. Growing of emmer wheat contributes to an extension of the agrobiodiversity in the countryside and to the suistainable development of a region.

  19. Benchmark data set for wheat growth models

    DEFF Research Database (Denmark)

    Asseng, S; Ewert, F.; Martre, P;

    2015-01-01

    The data set includes a current representative management treatment from detailed, quality-tested sentinel field experiments with wheat from four contrasting environments including Australia, The Netherlands, India and Argentina. Measurements include local daily climate data (solar radiation, max...

  20. Production of ethanol from wheat straw

    Directory of Open Access Journals (Sweden)

    Smuga-Kogut Małgorzata

    2015-09-01

    Full Text Available This study proposes a method for the production of ethanol from wheat straw lignocellulose where the raw material is chemically processed before hydrolysis and fermentation. The usefulness of wheat straw delignification was evaluated with the use of a 4:1 mixture of 95% ethanol and 65% HNO3 (V. Chemically processed lignocellulose was subjected to enzymatic hydrolysis to produce reducing sugars, which were converted to ethanol in the process of alcoholic fermentation. Chemical processing damages the molecular structure of wheat straw, thus improving ethanol yield. The removal of lignin from straw improves fermentation by eliminating lignin’s negative influence on the growth and viability of yeast cells. Straw pretreatment facilitates enzymatic hydrolysis by increasing the content of reducing sugars and ethanol per g in comparison with untreated wheat straw.

  1. Prevalence of Wheat Allergy in Japanese Adults

    Directory of Open Access Journals (Sweden)

    Eishin Morita

    2012-01-01

    Conclusions: The prevalence of wheat allergy in Japanese adults was found to be 0.21% by using a combination of questionnaire-based examination, skin prick test and serum omega-5 gliadin-specific IgE test.

  2. AGRONOMIC CHARACTERISTICS OF EMMER WHEAT VARIETIES

    National Research Council Canada - National Science Library

    Magdaléna Lacko - Bartosová; Veronika Curná

    2015-01-01

    ...) of four emmer wheat varieties - Agnone, Farvento, Molise sel Colli, Guardiaregia cultivated under the conditions of organic farming system in the south region of the Slovak republic during 2010...

  3. Rising Temperatures Reduce Global Wheat Production

    Science.gov (United States)

    Asseng, S.; Ewert, F.; Martre, P.; Rötter, R. P.; Lobell, D. B.; Cammarano, D.; Kimball, B. A.; Ottman, M. J.; Wall, G. W.; White, J. W.; Reynolds, M. P.; Alderman, P. D.; Prasad, P. V. V.; Aggarwal, P. K.; Anothai, J.; Basso, B.; Biernath, C.; Challinor, A. J.; De Sanctis, G.; Doltra, J.; Fereres, E.; Garcia-Vila, M.; Gayler, S.; Hoogenboom, G.; Hunt, L. A.; Izaurralde, R. C.; Jabloun, M.; C. D. Jones,; Kersebaum, K. C.; Koehler, A-K.; Müller, C.; Naresh Kumar, S.; Nendel, C.; O’Leary, G.; Olesen, J. E.; Palosuo, T.; Priesack, E.; Eyshi Rezaei, E.; Ruane, A. C.; Semenov, M. A.; Shcherbak, I.; Stöckle, C.; Stratonovitch, P.; Streck, T.; Supit, I.; Tao, F.; Thorburn, P. J.; Waha, K.; Wang, E.; Wallach, D.; Wolf, J.; Zhao, Z.; Zhu, Y.

    2015-01-01

    Crop models are essential tools for assessing the threat of climate change to local and global food production. Present models used to predict wheat grain yield are highly uncertain when simulating how crops respond to temperature. Here we systematically tested 30 different wheat crop models of the Agricultural Model Intercomparison and Improvement Project against field experiments in which growing season mean temperatures ranged from 15 degrees C to 32? degrees C, including experiments with artificial heating. Many models simulated yields well, but were less accurate at higher temperatures. The model ensemble median was consistently more accurate in simulating the crop temperature response than any single model, regardless of the input information used. Extrapolating the model ensemble temperature response indicates that warming is already slowing yield gains at a majority of wheat-growing locations. Global wheat production is estimated to fall by 6% for each degree C of further temperature increase and become more variable over space and time.

  4. Quantitation of the immunodominant 33-mer peptide from α-gliadin in wheat flours by liquid chromatography tandem mass spectrometry

    Science.gov (United States)

    Schalk, Kathrin; Lang, Christina; Wieser, Herbert; Koehler, Peter; Scherf, Katharina Anne

    2017-01-01

    Coeliac disease (CD) is triggered by the ingestion of gluten proteins from wheat, rye, and barley. The 33-mer peptide from α2-gliadin has frequently been described as the most important CD-immunogenic sequence within gluten. However, from more than 890 published amino acid sequences of α-gliadins, only 19 sequences contain the 33-mer. In order to make a precise assessment of the importance of the 33-mer, it is necessary to elucidate which wheat species and cultivars contain the peptide and at which concentrations. This paper presents the development of a stable isotope dilution assay followed by liquid chromatography tandem mass spectrometry to quantitate the 33-mer in flours of 23 hexaploid modern and 15 old common (bread) wheat as well as two spelt cultivars. All flours contained the 33-mer peptide at levels ranging from 91–603 μg/g flour. In contrast, the 33-mer was absent (wheat, emmer, einkorn), most likely because of the absence of the D-genome, which encodes α2-gliadins. Due to the presence of the 33-mer in all common wheat and spelt flours analysed here, the special focus in the literature on this most immunodominant peptide seems to be justified. PMID:28327674

  5. Mapping of wheat mitochondrial mRNA termini and comparison with breakpoints in DNA homology among plants.

    Science.gov (United States)

    Choi, Boyoung; Acero, Maria M; Bonen, Linda

    2012-11-01

    Mitochondrial DNA rearrangements occur very frequently in flowering plants and when close to genes there must be concomitant acquisition of new regulatory cis-elements. To explore whether there might be limits to such DNA shuffling, we have mapped the termini of mitochondrial mRNAs in wheat, a monocot, and compared them to the known positions for counterpart genes in the eudicot Arabidopsis. Nine genes share homologous 3' UTRs over their full-length and for six of them, the termini map very close to the site of wheat/Arabidopsis DNA rearrangements. Only one such case was seen for comparisons of 5' UTRs, and the 5' ends of mRNAs are typically more heterogeneous than 3' termini. Approximately half of the thirty-one wheat mitochondrial transcriptional units are preceded by CRTA promoter-like motifs, and of the potential stem-loop or tRNA-like structures identified as candidate RNA processing/stability signals near the 5' or 3' ends, several are shared with Arabidopsis. Comparison of the mitochondrial gene flanking sequences from normal fertile wheat (Triticum aestivum) with those of Aegilops kotschyi which is the source of mitochondria present in K-type cytoplasmic male sterile wheat, revealed six cases where mRNAs are precluded from sharing full-length homologous UTRs because of genomic reorganization events, and the presence of short repeats located at the sites of discontinuity points to a reciprocal recombination-mediated mode of rearrangement.

  6. Complex phylogeny and gene expression patterns of members of the NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family (NPF) in wheat.

    Science.gov (United States)

    Buchner, Peter; Hawkesford, Malcolm J

    2014-10-01

    NPF (formerly referred to as low-affinity NRT1) and 'high-affinity' NRT2 nitrate transporter genes are involved in nitrate uptake by the root, and transport and distribution of nitrate within the plant. The NPF gene family consists of 53 members in Arabidopsis thaliana, however only 11 of these have been functionally characterized. Although homologous genes have been identified in genomes of different plant species including some cereals, there is little information available for wheat (Triticum aestivum). Sixteen genes were identified in wheat homologous to characterized Arabidopsis low-affinity nitrate transporter NPF genes, suggesting a complex wheat NPF gene family. The regulation of wheat NFP genes by plant N-status indicated involvement of these transporters in substrate transport in relation to N-metabolism. The complex expression pattern in relation to tissue specificity, nitrate availability and senescence may be associated with the complex growth patterns of wheat depending on sink/source demands, as well as remobilization during grain filling.

  7. Lead- induced genotoxicity in wheat

    Directory of Open Access Journals (Sweden)

    Elena Truta

    2010-02-01

    Full Text Available The changes induced in cytogenetic parameters from root meristems of Triticum aestivum cv. Maruca seedlings have been studied after treatment with lead acetate and lead nitrate solutions, at four concentrations (10, 25, 50, 100 μM containing 2.07, 5.18, 10.36, respectively 20.72 μg ml-1 Pb2+. Lead induced mitosis disturbances in root meristematic cells of wheat seedlings, expressed mainly in decrease of mitotic index and changes in preponderance of division phases. This heavy metal has genotoxic effects, expressed in the occurrence of many chromosomal aberrations in all Pb2+ treated variants. Pb2+ nitrate shows a more pronounced genotoxic potential than lead acetate trihydrate.

  8. Adjuvants for spraying of fungicides in wheat

    OpenAIRE

    2014-01-01

    The foliar diseases and spike can markedly reduce the yield of wheat. Despite prevailing chemical control in the management of disease, studies with adjuvants to improve the performance of fungicides are still incipient. The aim of this study was to evaluate the effect of adding adjuvants to chemical fungicides to control leaf diseases and spike, as well as on the yield of wheat crop. The experimental design was a randomized block design with 05 treatments: control (no fungicide application i...