WorldWideScience

Sample records for gene variations increase

  1. Exploiting natural variation in Saccharomyces cerevisiae to identify genes for increased ethanol resistance.

    Science.gov (United States)

    Lewis, Jeffrey A; Elkon, Isaac M; McGee, Mick A; Higbee, Alan J; Gasch, Audrey P

    2010-12-01

    Ethanol production from lignocellulosic biomass holds promise as an alternative fuel. However, industrial stresses, including ethanol stress, limit microbial fermentation and thus prevent cost competitiveness with fossil fuels. To identify novel engineering targets for increased ethanol tolerance, we took advantage of natural diversity in wild Saccharomyces cerevisiae strains. We previously showed that an S288c-derived lab strain cannot acquire higher ethanol tolerance after a mild ethanol pretreatment, which is distinct from other stresses. Here, we measured acquired ethanol tolerance in a large panel of wild strains and show that most strains can acquire higher tolerance after pretreatment. We exploited this major phenotypic difference to address the mechanism of acquired ethanol tolerance, by comparing the global gene expression response to 5% ethanol in S288c and two wild strains. Hundreds of genes showed variation in ethanol-dependent gene expression across strains. Computational analysis identified several transcription factor modules and known coregulated genes as differentially expressed, implicating genetic variation in the ethanol signaling pathway. We used this information to identify genes required for acquisition of ethanol tolerance in wild strains, including new genes and processes not previously linked to ethanol tolerance, and four genes that increase ethanol tolerance when overexpressed. Our approach shows that comparative genomics across natural isolates can quickly identify genes for industrial engineering while expanding our understanding of natural diversity.

  2. Germline variation in NCF4, an innate immunity gene, is associated with an increased risk of colorectal cancer.

    Science.gov (United States)

    Ryan, Bríd M; Zanetti, Krista A; Robles, Ana I; Schetter, Aaron J; Goodman, Julie; Hayes, Richard B; Huang, Wen-Yi; Gunter, Mark J; Yeager, Meredith; Burdette, Laurie; Berndt, Sonja I; Harris, Curtis C

    2014-03-15

    Chronic inflammation has been implicated in the etiology of colorectal adenoma and cancer; however, few key inflammatory genes mediating this relationship have been identified. In this study, we investigated the association of germline variation in innate immunity genes in relation to the risk of colorectal neoplasia. Our study was based on the analysis of samples collected from the prostate, lung, colorectal and ovarian (PLCO) Cancer Screening Trial. We investigated the association between 196 tag single nucleotide polymorphisms (SNPs) in 20 key innate immunity genes with risk of advanced colorectal adenoma and cancer in 719 adenoma cases, 481 cancer cases and 719 controls. Logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CIs). After Bonferroni correction, the AG/GG genotype of rs5995355, which is upstream of NCF4, was associated with an increased risk of colorectal cancer (OR = 2.43, 95% CI = 1.73-3.39; p immune response. While not definitive, our analyses suggest that the variant allele does not affect expression of NCF4, but rather modulates activity of the NADPH complex. Additional studies on the functional consequences of rs5995355 in NCF4 may help to clarify the mechanistic link between inflammation and colorectal cancer.

  3. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    Science.gov (United States)

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  4. Genetic variation in the fibrinogen gamma gene increases the risk for deep venous thrombosis by reducing plasma fibrinogen gamma' levels.

    Science.gov (United States)

    Uitte de Willige, Shirley; de Visser, Marieke C H; Houwing-Duistermaat, Jeanine J; Rosendaal, Frits R; Vos, Hans L; Bertina, Rogier M

    2005-12-15

    We investigated the association between haplotypes of fibrinogen alpha (FGA), beta (FGB), and gamma (FGG), total fibrinogen levels, fibrinogen gamma' (gammaA/gamma' plus gamma'/gamma') levels, and risk for deep venous thrombosis. In a population-based case-control study, the Leiden Thrombophilia Study, we typed 15 haplotype-tagging single nucleotide polymorphisms (htSNPs) in this gene cluster. None of these haplotypes was associated with total fibrinogen levels. In each gene, one haplotype increased the thrombosis risk approximately 2-fold. After adjustment for linkage disequilibrium between the genes, only FGG-H2 homozygosity remained associated with risk (odds ratio [OR], 2.4; 95% confidence interval [95% CI], 1.5-3.9). FGG-H2 was also associated with reduced fibrinogen gamma' levels and reduced ratios of fibrinogen gamma' to total fibrinogen. Multivariate analysis showed that reduced fibrinogen gamma' levels and elevated total fibrinogen levels were both associated with an increased risk for thrombosis, even after adjustment for FGG-H2. A reduced fibrinogen gamma' to total fibrinogen ratio (less than 0.69) also increased the risk (OR, 2.4; 95% CI, 1.7-3.5). We propose that FGG-H2 influences thrombosis risk through htSNP 10034C/T [rs2066865] by strengthening the consensus of a CstF site and thus favoring the formation of gammaA chain above that of gamma' chain. Fibrinogen gamma' contains a unique high-affinity, nonsubstrate binding site for thrombin, which seems critical for the expression of the antithrombin activity that develops during fibrin formation (antithrombin 1).

  5. Increased brain size in mammals is associated with size variations in gene families with cell signalling, chemotaxis and immune-related functions.

    Science.gov (United States)

    Castillo-Morales, Atahualpa; Monzón-Sandoval, Jimena; Urrutia, Araxi O; Gutiérrez, Humberto

    2014-01-22

    Genomic determinants underlying increased encephalization across mammalian lineages are unknown. Whole genome comparisons have revealed large and frequent changes in the size of gene families, and it has been proposed that these variations could play a major role in shaping morphological and physiological differences among species. Using a genome-wide comparative approach, we examined changes in gene family size (GFS) and degree of encephalization in 39 fully sequenced mammalian species and found a significant over-representation of GFS variations in line with increased encephalization in mammals. We found that this relationship is not accounted for by known correlates of brain size such as maximum lifespan or body size and is not explained by phylogenetic relatedness. Genes involved in chemotaxis, immune regulation and cell signalling-related functions are significantly over-represented among those gene families most highly correlated with encephalization. Genes within these families are prominently expressed in the human brain, particularly the cortex, and organized in co-expression modules that display distinct temporal patterns of expression in the developing cortex. Our results suggest that changes in GFS associated with encephalization represent an evolutionary response to the specific functional requirements underlying increased brain size in mammals.

  6. Endocannabinoid receptor 1 gene variations increase risk for obesity and modulate body mass index in European populations

    DEFF Research Database (Denmark)

    Benzinou, Michael; Chèvre, Jean-Claude; Ward, Kirsten J

    2008-01-01

    The therapeutic effects of cannabinoid receptor blockade on obesity-associated phenotypes underline the importance of the endocannabinoid pathway on the energy balance. Using a staged-approach, we examined the contribution of the endocannabinoid receptor 1 gene (CNR1) on obesity and body mass index...

  7. No association between variation in the NR4A1 gene locus and metabolic traits in white subjects at increased risk for type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Fritsche Andreas

    2010-06-01

    Full Text Available Abstract Background The nuclear receptor NR4A1 is implicated in metabolic regulation in insulin-sensitive tissues, such as liver, adipose tissue, and skeletal muscle. Functional loss of NR4A1 results in insulin resistance and enhanced intramuscular and hepatic lipid content. Therefore, we investigated in a cohort of white European subjects at increased risk for type 2 diabetes whether genetic variation within the NR4A1 gene locus contributes to prediabetic phenotypes, such as insulin resistance, ectopic fat distribution, or β-cell dysfunction. Methods We genotyped 1495 subjects (989 women, 506 men for five single nucleotide polymorphisms (SNPs tagging 100% of common variants (MAF = 0.05 within the NR4A1 gene locus with an r2 = 0.8. All subjects underwent an oral glucose tolerance test (OGTT, a subset additionally had a hyperinsulinemic-euglycemic clamp (n = 506. Ectopic hepatic (n = 296 and intramyocellular (n = 264 lipids were determined by magnetic resonance spectroscopy. Peak aerobic capacity, a surrogate parameter for oxidative capacity of skeletal muscle, was measured by an incremental exercise test on a motorized treadmill (n = 270. Results After appropriate adjustment and Bonferroni correction for multiple comparisons, none of the five SNPs was reliably associated with insulin sensitivity, ectopic fat distribution, peak aerobic capacity, or indices of insulin secretion (all p ≥ 0.05. Conclusions Our data suggest that common genetic variation within the NR4A1 gene locus may not play a major role in the development of prediabetic phenotypes in our white European population.

  8. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important contributors...

  9. Genetic Variation in the REL Gene Increases Risk of Behcet's Disease in a Chinese Han Population but That of PRKCQ Does Not.

    Directory of Open Access Journals (Sweden)

    Feilan Chen

    Full Text Available Genome-wide association studies (GWAS and candidate gene studies have identified the REL and PRKCQ genes as risk loci for various autoimmune diseases. The purpose of the present study was to investigate the association of the REL and PRKCQ genes with Behcet's disease (BD in a Chinese Han population. A case-control study was conducted on three single nucleotide polymorphisms (SNPs, rs13031237, rs702873, and rs842647 of the REL gene and three SNPs (rs4750316, rs11258747, and rs947474 of the PRKCQ gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP in a total of 623 BD patients and 1,074 healthy controls. Multiple variables were assessed, including age, sex distribution, and extra-ocular findings. In the present study, the frequencies of rs842647 GG genotypes and rs842647 G alleles were significantly higher in patients than in controls and those of the rs842647 AG genotypes were lower in patients than in controls [GG genotype: Bonferroni corrected P-value for gender adjustment (Pc(a = 0.0074, odds ratio (OR = 1.63; G allele: Pc(a = 0.0072, OR = 1.57; AG genotype: Pc(a = 0.024, OR = 0.63, respectively]. No statistically significant differences in the frequencies of rs702873, rs13031237, rs4750316, rs11258747, and rs947474 between BD patients and controls were observed. Stratification analysis indicated that the REL rs842647 polymorphism was associated with BD patients with skin lesions. No significant association of the other five SNPs between BD patients with other extra-ocular findings, including genital ulcer, arthritis, and positive pathergy test results was found. The REL rs842647 polymorphism may be a susceptibility factor for BD pathogenesis and skin lesions, which indicate that c-Rel may be involved in the pathogenesis and skin lesions of BD through the NF-κB pathway.

  10. MEFV gene variations in patients with systemic lupus erythematosus.

    Science.gov (United States)

    Erer, Burak; Cosan, Fulya; Oku, Basar; Ustek, Duran; Inanc, Murat; Aral, Orhan; Gul, Ahmet

    2014-01-01

    The aim of this study was to investigate the frequency of familial Mediterranean fever (FMF)-associated MEFV gene variations in patients with systemic lupus erythematosus (SLE). The study group comprised 190 SLE patients and 101 healthy controls of Turkish origin with no clinical features of FMF. All individuals were genotyped for the four most common MEFV gene variations (M694V, M680I, V726A and E148Q) by PCR-restriction fragment length polymorphism analysis. The frequency of carrying any of the four MEFV gene variations under study was 15 % in patients with SLE and 10 % in the healthy controls (p = 0.23). After the exclusion of the less penetrant E148Q variation, re-analysis for the three penetrant mutations revealed a significant association between exon 10 variations and pericarditis [p = 0.038, odds ratio (OR) 3.5, 95 % confidence interval (CI) 1.0-12.1], and pleural effusion (p = 0.043, OR 5.2, 95 % CI 0.8-30.9). No significant association was detected between the MEFV gene variations and a higher acute phase response. The MEFV gene variations analyzed in our study do not seem to increase the overall susceptibility to SLE and do not have any strong association with its clinical manifestations. The possibility of a modest effect of penetrant exon 10 MEFV variants on the development of serosal effusions needs to be explored in a larger series of patients.

  11. Variation in the Major Surface Glycoprotein Genes in Pneumocystis jirovecii

    Science.gov (United States)

    Kutty, Geetha; Maldarelli, Frank; Achaz, Guillaume; Kovacs, Joseph A.

    2008-01-01

    The genome of Pneumocystis, which causes life-threatening pneumonia in immunosuppressed patients, contains a multi-copy gene family that encodes the major surface glycoprotein (Msg). Pneumocystis can vary the expressed Msg, presumably as a mechanism to avoid host immune responses. Analysis of 24 msg gene sequences obtained from a single human Pneumocystis isolate demonstrated that the sequences segregate into two branches. Based on a number of analyses, recombination among msg genes appears to be an important mechanism for generating msg diversity. Intra-branch recombination occurred more frequently than inter-branch recombination. Restriction fragment length polymorphism analysis demonstrated substantial variation in the repertoire of the msg gene family among isolates of human Pneumocystis, which was not observed in laboratory isolates of rat or mouse Pneumocystis; this may be the result of examining outbred vs. captive populations. Increased diversity in the Msg repertoire, generated in part by recombination, increases the potential for antigenic variation in this abundant surface protein. PMID:18627244

  12. Exploiting natural variation to identify insect-resistance genes.

    Science.gov (United States)

    Broekgaarden, Colette; Snoeren, Tjeerd A L; Dicke, Marcel; Vosman, Ben

    2011-10-01

    Herbivorous insects are widespread and often serious constraints to crop production. The use of insect-resistant crops is a very effective way to control insect pests in agriculture, and the development of such crops can be greatly enhanced by knowledge on plant resistance mechanisms and the genes involved. Plants have evolved diverse ways to cope with insect attack that has resulted in natural variation for resistance towards herbivorous insects. Studying the molecular genetics and transcriptional background of this variation has facilitated the identification of resistance genes and processes that lead to resistance against insects. With the development of new technologies, molecular studies are not restricted to model plants anymore. This review addresses the need to exploit natural variation in resistance towards insects to increase our knowledge on resistance mechanisms and the genes involved. We will discuss how this knowledge can be exploited in breeding programmes to provide sustainable crop protection against insect pests. Additionally, we discuss the current status of genetic research on insect-resistance genes. We conclude that insect-resistance mechanisms are still unclear at the molecular level and that exploiting natural variation with novel technologies will contribute greatly to the development of insect-resistant crop varieties.

  13. Genetic variation in genes affecting milk composition and quality

    DEFF Research Database (Denmark)

    Bertelsen, Henriette Pasgaard

    In the past decade major advances in next generation sequencing technologies have provided new opportuneties for the detection of genetic variation. Combining the knowlegde of genetic variation with phenotypic distributions provides considerable possibilites for detection of candidate genes....... In addition, exploring genetic variation related to the major milk proteins of bovine milk indntified genetic variations with possitive effects on milk coagulation...

  14. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Science.gov (United States)

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution.

  15. Variation in the RAD51 gene and familial breast cancer

    Science.gov (United States)

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  16. Variation within the Huntington's disease gene influences normal brain structure.

    Directory of Open Access Journals (Sweden)

    Mark Mühlau

    Full Text Available Genetics of the variability of normal and diseased brain structure largely remains to be elucidated. Expansions of certain trinucleotide repeats cause neurodegenerative disorders of which Huntington's disease constitutes the most common example. Here, we test the hypothesis that variation within the IT15 gene on chromosome 4, whose expansion causes Huntington's disease, influences normal human brain structure. In 278 normal subjects, we determined CAG repeat length within the IT15 gene on chromosome 4 and analyzed high-resolution T1-weighted magnetic resonance images by the use of voxel-based morphometry. We found an increase of GM with increasing long CAG repeat and its interaction with age within the pallidum, which is involved in Huntington's disease. Our study demonstrates that a certain trinucleotide repeat influences normal brain structure in humans. This result may have important implications for the understanding of both the healthy and diseased brain.

  17. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Directory of Open Access Journals (Sweden)

    Leekitcharoenphon Pimlapas

    2012-03-01

    Full Text Available Abstract Background Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over time. The core genes--the genes that are conserved in all (or most members of a genus or species--are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher confidence. The core genes can be divided into two categories: a few highly variable genes and a larger set of conserved core genes, with low variance. For the most variable core genes, the variance in amino acid sequences is higher than for the corresponding nucleotide sequences, suggesting that there is a positive selection towards mutations leading to amino acid changes. Conclusions Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important especially in trend analysis.

  18. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    Science.gov (United States)

    Scott, Cinda P.; Williams, Dean A.; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory environment (G10). The G10 individuals have significantly less genetic variation than individuals obtained in the field and had a significantly lower variation in mRNA expression across all genes in comparison to the other two groups (p ≤ 0.001). When examining the gene specific variation, twenty-two genes had variation in expression that was significantly different among groups with lower variation in G10 individuals than in acclimated individuals. Additionally, there were fewer genes with significant differences in expression among G10 individuals versus either acclimated or field individuals: 66 genes have statistically different levels of expression versus 107 or 97 for Acclimated or Field groups. Based on the permutation of the data, these differences in the number of genes with significant differences among individuals within a group are unlikely to occur by chance (p < 0.01). Surprisingly, variation in mRNA expression in field individuals is lower than in acclimated individuals. Relative to the variation among individual within a group, few genes have significant differences in expression among groups (seven, 2.3%) and none of these are different between acclimated and field individuals. The results support the concept that genetic variation affects variation in mRNA expression and also suggests that temporal environmental variation associated with estuarine environments does not increase the variation among individuals or add to the differences among groups. PMID

  19. Vasodilation increases pulse pressure variation, mimicking hypovolemic status in rabbits

    Directory of Open Access Journals (Sweden)

    Glauco A Westphal

    2010-01-01

    Full Text Available OBJECTIVE: To test the hypothesis that pulse pressure respiratory variation (PPV amplification, observed in hypovolemia, can also be observed during sodium nitroprusside (SNP-induced vasodilation. INTRODUCTION: PPV is largely used for early identification of cardiac responsiveness, especially when hypovolemia is suspected. PPV results from respiratory variation in transpulmonary blood flow and reflects the left ventricular preload variations during respiratory cycles. Any factor that decreases left ventricular preload can be associated with PPV amplification, as seen in hypovolemia. METHODS: Ten anesthetized and mechanically ventilated rabbits underwent progressive hypotension by either controlled hemorrhage (Group 1 or intravenous SNP infusion (Group 2. Animals in Group 1 (n = 5 had graded hemorrhage induced at 10% steps until 50% of the total volume was bled. Mean arterial pressure (MAP steps were registered and assumed as pressure targets to be reached in Group 2. Group 2 (n = 5 was subjected to a progressive SNP infusion to reach similar pressure targets as those defined in Group 1. Heart rate (HR, systolic pressure variation (SPV and PPV were measured at each MAP step, and the values were compared between the groups. RESULTS: SPV and PPV were similar between the experimental models in all steps (p > 0.16. SPV increased earlier in Group 2. CONCLUSION: Both pharmacologic vasodilation and graded hemorrhage induced PPV amplification similar to that observed in hypovolemia, reinforcing the idea that amplified arterial pressure variation does not necessarily represent hypovolemic status but rather potential cardiovascular responsiveness to fluid infusion.

  20. Global properties and functional complexity of human gene regulatory variation.

    Directory of Open Access Journals (Sweden)

    Daniel J Gaffney

    2013-05-01

    Full Text Available Identification and functional interpretation of gene regulatory variants is a major focus of modern genomics. The application of genetic mapping to molecular and cellular traits has enabled the detection of regulatory variation on genome-wide scales and revealed an enormous diversity of regulatory architecture in humans and other species. In this review I summarise the insights gained and questions raised by a decade of genetic mapping of gene expression variation. I discuss recent extensions of this approach using alternative molecular phenotypes that have revealed some of the biological mechanisms that drive gene expression variation between individuals. Finally, I highlight outstanding problems and future directions for development.

  1. Caenorhabditis elegans Genes Affecting Interindividual Variation in Life-span Biomarker Gene Expression.

    Science.gov (United States)

    Mendenhall, Alexander; Crane, Matthew M; Tedesco, Patricia M; Johnson, Thomas E; Brent, Roger

    2017-10-01

    Genetically identical organisms grown in homogenous environments differ in quantitative phenotypes. Differences in one such trait, expression of a single biomarker gene, can identify isogenic cells or organisms that later manifest different fates. For example, in isogenic populations of young adult Caenorhabditis elegans, differences in Green Fluorescent Protein (GFP) expressed from the hsp-16.2 promoter predict differences in life span. Thus, it is of interest to determine how interindividual differences in biomarker gene expression arise. Prior reports showed that the thermosensory neurons and insulin signaling systems controlled the magnitude of the heat shock response, including absolute expression of hsp-16.2. Here, we tested whether these regulatory signals might also influence variation in hsp-16.2 reporter expression. Genetic experiments showed that the action of AFD thermosensory neurons increases interindividual variation in biomarker expression. Further genetic experimentation showed the insulin signaling system acts to decrease interindividual variation in life-span biomarker expression; in other words, insulin signaling canalizes expression of the hsp-16.2-driven life-span biomarker. Our results show that specific signaling systems regulate not only expression level, but also the amount of interindividual expression variation for a life-span biomarker gene. They raise the possibility that manipulation of these systems might offer means to reduce heterogeneity in the aging process. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

    2012-01-01

    Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...... that there is a positive selection towards mutations leading to amino acid changes. Conclusions: Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important...

  3. Theories of Population Variation in Genes and Genomes

    DEFF Research Database (Denmark)

    Christiansen, Freddy

    genetics, while emphasizing the close interplay between theory and empiricism. Traditional topics such as genetic and phenotypic variation, mutation, migration, and linkage are covered and advanced by contemporary coalescent theory, which describes the genealogy of genes in a population, ultimately...

  4. Tandem gene arrays in Trypanosoma brucei: Comparative phylogenomic analysis of duplicate sequence variation

    Directory of Open Access Journals (Sweden)

    Jackson Andrew P

    2007-04-01

    Full Text Available Abstract Background The genome sequence of the protistan parasite Trypanosoma brucei contains many tandem gene arrays. Gene duplicates are created through tandem duplication and are expressed through polycistronic transcription, suggesting that the primary purpose of long, tandem arrays is to increase gene dosage in an environment where individual gene promoters are absent. This report presents the first account of the tandem gene arrays in the T. brucei genome, employing several related genome sequences to establish how variation is created and removed. Results A systematic survey of tandem gene arrays showed that substantial sequence variation existed across the genome; variation from different regions of an array often produced inconsistent phylogenetic affinities. Phylogenetic relationships of gene duplicates were consistent with concerted evolution being a widespread homogenising force. However, tandem duplicates were not usually identical; therefore, any homogenising effect was coincident with divergence among duplicates. Allelic gene conversion was detected using various criteria and was apparently able to both remove and introduce sequence variation. Tandem arrays containing structural heterogeneity demonstrated how sequence homogenisation and differentiation can occur within a single locus. Conclusion The use of multiple genome sequences in a comparative analysis of tandem gene arrays identified substantial sequence variation among gene duplicates. The distribution of sequence variation is determined by a dynamic balance of conservative and innovative evolutionary forces. Gene trees from various species showed that intraspecific duplicates evolve in concert, perhaps through frequent gene conversion, although this does not prevent sequence divergence, especially where structural heterogeneity physically separates a duplicate from its neighbours. In describing dynamics of sequence variation that have consequences beyond gene dosage, this

  5. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  6. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  7. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  8. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    , conidia are produced and discharged when humidity gets high—usually during night. In an earlier secretome study of field-collected grain aphids (Sitobion avenae) infected with entomophthoralean fungi, a number of pathogenesis-related, secreted enzymes were discovered (Fungal Genetics and Biology 2011, vol...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  9. Genes controlling mimetic colour pattern variation in butterflies.

    Science.gov (United States)

    Nadeau, Nicola J

    2016-10-01

    Butterfly wing patterns are made up of arrays of coloured scales. There are two genera in which within-species variation in wing patterning is common and has been investigated at the molecular level, Heliconius and Papilio. Both of these species have mimetic relationships with other butterfly species that increase their protection from predators. Heliconius have a 'tool-kit' of five genetic loci that control colour pattern, three of which have been identified at the gene level, and which have been repeatedly used to modify colour pattern by different species in the genus. By contrast, the three Papilio species that have been investigated each have different genetic mechanisms controlling their polymorphic wing patterns.

  10. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovari...

  11. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-03-11

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations.

  12. Genetic variations of the endothelial nitric oxide synthase gene are related to increased levels of C-reactive protein and macrophage-colony stimulating-factor in patients with coronary artery disease.

    Science.gov (United States)

    Lekakis, John P; Ikonomidis, Ignatios; Tsibida, Maria; Protogerou, Athanasios; Papada, Aggeliki; Papapanagiotou, Aggeliki; Revela, Ioanna; Papamichael, Christos M; Kalofoutis, Anastasios T; Kremastinos, Dimitrios T

    2006-10-01

    It was the objective of this study to investigate the relation between nitric oxide synthase (NOS3) gene polymorphisms, vascular inflammation, endothelial function, and atherosclerosis. We examined the effects of a variable nucleotide tandem repeats (VNTR) in intron 4, G894T in exon 7 and T-786C at the promoter region of NOS3 on i) C-reactive protein (CRP) and macrophage-colony stimulating-factor (MCSF), and ii) augmentation index (AI) measured by pulse-wave analysis , flow-mediated dilation (FMD) of the brachial artery, intima-media thickness (IMT) of the carotid and femoral artery using ultrasonography and ankle-brachial index (ABI) in 122 patients with chronic coronary artery disease (CAD) who underwent coronary angiography. MCSF and CRP were increased in patients withT-786C (77/122) or VNTR (40/122) allele compared to those without (F = 10.8, p = 0.002 and F = 3.8, p = 0.04 for T-786C and F = 3.65, p = 0.04 and F = 3.2 p = 0.049 forVNTR), even after adjustment for traditional risk factors and medication. Patients with combination of VNTR and T-786C (31/122) had higher MCSF or CRP than patients with one or none of these alleles (p 262 pg/ml or CRP>3.2 mg/l (n = 33/77) had a higher femoral and carotid IMT and number of plaques in the peripheral arteries than those with lower values of these inflammatory indices (p 262 pg/ml had also lower FMD and higher Gensini score than those with lower MCSF (p < 0.05). The intron 4-VNTR and T-786C mutation of NOS3 gene enhance the inflammatory process in patients with chronic CAD.

  13. CDHR3 gene variation and childhood bronchiolitis

    DEFF Research Database (Denmark)

    Husby, A; Pasanen, A; Waage, J

    2017-01-01

    This genetic study combining data from five countries shows that the CDHR3 rs6967330 polymorphism is not associated to bronchiolitis triggered by RSV but might increase risk of bronchiolitis triggered by other infectious agents.......This genetic study combining data from five countries shows that the CDHR3 rs6967330 polymorphism is not associated to bronchiolitis triggered by RSV but might increase risk of bronchiolitis triggered by other infectious agents....

  14. Variation in the Ace Gene in Elite Polish Football Players

    Directory of Open Access Journals (Sweden)

    Cięszczyk Paweł

    2016-12-01

    Full Text Available Purpose. A common polymorphism in the angiotensin converting enzyme I gene (the ACE I/D variant represents one of the first characterized and the most widely studied genetic variants in the context of elite athletes status and performance related traits. The aim of the study was to determine the genotype and allele distribution of the allele and genotype of the ACE gene in Polish male football players. Methods. The total of 106 Polish male professional football players were recruited. They were divided into groups according to the position in the field: forwards, defenders, midfielders, and goalkeepers. For controls, samples were prepared with 115 unrelated volunteers. DNA was extracted from the buccal cells donated by the subjects, and the PCR amplification of the polymorphic region of the ACE gene containing either the insertion (I or deletion (D fragment was performed. Results. The genotype distribution and allele frequencies among all football players did not differ significantly when compared with sedentary control individuals (p = 0.887, p = 0.999, respectively. Likewise, the analysis of forwards, defenders, midfielders, and goalkeepers revealed no significant differences in either ACE genotype or allele frequencies. Conclusions. We did not provide evidence for difference of variation of the ACE I/D polymorphism between Polish football players and controls, as we did not obtain any statistically significantly higher frequency of either of the analysed alleles (I and D or genotypes (DD, ID, and II in the studied subgroups. It may be suspected that harbouring of I/D allelic variants of the ACE gene neither decreases nor increases the probability of being a professional football player in Poland.

  15. Propagation of genetic variation in gene regulatory networks.

    Science.gov (United States)

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W

    2013-08-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing how genetic variation in a locus is propagated through the network, and show how their derivatives are related to the network's feedback structure. Similarly, feedback functions describe the effect of genotypic variation of a locus on itself, either directly or mediated by the network. A simple sign rule relates the sign of the derivative of the feedback function of any locus to the feedback loops involving that particular locus. We show that the sign of the phenotypically manifested interaction between alleles at a diploid locus is equal to the sign of the dominant feedback loop involving that particular locus, in accordance with recent results for a single locus system. Our results provide tools by which one can use observable equilibrium concentrations of gene products to disclose structural properties of the network architecture. Our work is a step towards a theory capable of explaining the pleiotropy and epistasis features of genetic variation in complex regulatory networks as functions of regulatory anatomy and functional location of the genetic variation.

  16. Increasing Crop Diversity Mitigates Weather Variations and Improves Yield Stability

    Science.gov (United States)

    Gaudin, Amélie C. M.; Tolhurst, Tor N.; Ker, Alan P.; Janovicek, Ken; Tortora, Cristina; Martin, Ralph C.; Deen, William

    2015-01-01

    Cropping sequence diversification provides a systems approach to reduce yield variations and improve resilience to multiple environmental stresses. Yield advantages of more diverse crop rotations and their synergistic effects with reduced tillage are well documented, but few studies have quantified the impact of these management practices on yields and their stability when soil moisture is limiting or in excess. Using yield and weather data obtained from a 31-year long term rotation and tillage trial in Ontario, we tested whether crop rotation diversity is associated with greater yield stability when abnormal weather conditions occur. We used parametric and non-parametric approaches to quantify the impact of rotation diversity (monocrop, 2-crops, 3-crops without or with one or two legume cover crops) and tillage (conventional or reduced tillage) on yield probabilities and the benefits of crop diversity under different soil moisture and temperature scenarios. Although the magnitude of rotation benefits varied with crops, weather patterns and tillage, yield stability significantly increased when corn and soybean were integrated into more diverse rotations. Introducing small grains into short corn-soybean rotation was enough to provide substantial benefits on long-term soybean yields and their stability while the effects on corn were mostly associated with the temporal niche provided by small grains for underseeded red clover or alfalfa. Crop diversification strategies increased the probability of harnessing favorable growing conditions while decreasing the risk of crop failure. In hot and dry years, diversification of corn-soybean rotations and reduced tillage increased yield by 7% and 22% for corn and soybean respectively. Given the additional advantages associated with cropping system diversification, such a strategy provides a more comprehensive approach to lowering yield variability and improving the resilience of cropping systems to multiple environmental

  17. Increasing crop diversity mitigates weather variations and improves yield stability.

    Directory of Open Access Journals (Sweden)

    Amélie C M Gaudin

    Full Text Available Cropping sequence diversification provides a systems approach to reduce yield variations and improve resilience to multiple environmental stresses. Yield advantages of more diverse crop rotations and their synergistic effects with reduced tillage are well documented, but few studies have quantified the impact of these management practices on yields and their stability when soil moisture is limiting or in excess. Using yield and weather data obtained from a 31-year long term rotation and tillage trial in Ontario, we tested whether crop rotation diversity is associated with greater yield stability when abnormal weather conditions occur. We used parametric and non-parametric approaches to quantify the impact of rotation diversity (monocrop, 2-crops, 3-crops without or with one or two legume cover crops and tillage (conventional or reduced tillage on yield probabilities and the benefits of crop diversity under different soil moisture and temperature scenarios. Although the magnitude of rotation benefits varied with crops, weather patterns and tillage, yield stability significantly increased when corn and soybean were integrated into more diverse rotations. Introducing small grains into short corn-soybean rotation was enough to provide substantial benefits on long-term soybean yields and their stability while the effects on corn were mostly associated with the temporal niche provided by small grains for underseeded red clover or alfalfa. Crop diversification strategies increased the probability of harnessing favorable growing conditions while decreasing the risk of crop failure. In hot and dry years, diversification of corn-soybean rotations and reduced tillage increased yield by 7% and 22% for corn and soybean respectively. Given the additional advantages associated with cropping system diversification, such a strategy provides a more comprehensive approach to lowering yield variability and improving the resilience of cropping systems to multiple

  18. An increased coronary risk is paradoxically associated with common cholesteryl ester transfer protein gene variations that relate to higher high-density lipoprotein cholesterol: A population-based study

    NARCIS (Netherlands)

    S.E. Borggreve (Susanna); H.L. Hillege (Hans); B.H.R. Wolffenbuttel (Bruce); P. de Jong (Paul); M.W. Zuurman (Mike); G. van der Steege (Gerrit); A. van Tol (Arie); R.P.F. Dullaart (Robin)

    2006-01-01

    textabstractBackground: Several cholesteryl ester transfer protein (CETP) polymorphisms affect high-density lipoprotein (HDL) cholesterol, but the impact of CETP gene variants on incident coronary disease in the general population is uncertain after correction for their effect on HDL cholesterol. De

  19. Copy number variations exploration of multiple genes in Graves' disease.

    Science.gov (United States)

    Song, Rong-Hua; Shao, Xiao-Qing; Li, Ling; Wang, Wen; Zhang, Jin-An

    2017-01-01

    Few previous published papers reported copy number variations of genes could affect the predisposition of Graves' disease (GD). Herein, the aim of this study was to explore the association between copy number variations (CNV) profile and GD. The preliminary copy number microarray used to screen copy number variant genes was performed in 6 GD patients. Five CNV candidate genes (CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17) were then validated in an independent set of samples (50 GD patients and 50 matched healthy ones) by the Accucopy assay method. The CNV of the other 2 genes TRY6 and CCL3L1 was investigated in 144 GD patients and 144 healthy volunteers by the definitive genotyping technique using the Taqman quantitative polymerase-chain-reaction (Taqman qPCR). TRY6 gene-associated single nucleotide polymorphism (SNP), rs13230029, was genotyped by the PCR-ligase detection reaction (LDR) in 675 GD patients and 898 healthy controls. There were no correlation of the gene copy number (GCN) of CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17 with GD. In comparison with that of controls, the GCN distribution of TRY6 and CCL3L1 in GD patients did not show significantly differ (P > 0.05). Furthermore, TRY6-related polymorphism (rs13230029) showed no difference between GD patients and controls. No correlation was found between CNV or SNP genotype and clinical phenotypes. Generally, there were no link of the copy numbers of several genes, including CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1 to GD. Our results clearly indicated that the copy number variations of multiple genes, namely CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1, were not associated with the development of GD.

  20. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  1. Association of variation in Fc gamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples

    NARCIS (Netherlands)

    McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.

    2010-01-01

    Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of polymorphonucl

  2. Chimpanzee sociability is associated with vasopressin (Avpr1a) but not oxytocin receptor gene (OXTR) variation.

    Science.gov (United States)

    Staes, Nicky; Koski, Sonja E; Helsen, Philippe; Fransen, Erik; Eens, Marcel; Stevens, Jeroen M G

    2015-09-01

    The importance of genes in regulating phenotypic variation of personality traits in humans and animals is becoming increasingly apparent in recent studies. Here we focus on variation in the vasopressin receptor gene 1a (Avpr1a) and oxytocin receptor gene (OXTR) and their effects on social personality traits in chimpanzees. We combine newly available genetic data on Avpr1a and OXTR allelic variation of 62 captive chimpanzees with individual variation in personality, based on behavioral assessments. Our study provides support for the positive association of the Avpr1a promoter region, in particular the presence of DupB, and sociability in chimpanzees. This complements findings of previous studies on adolescent chimpanzees and studies that assessed personality using questionnaire data. In contrast, no significant associations were found for the single nucleotide polymorphism (SNP) ss1388116472 of the OXTR and any of the personality components. Most importantly, our study provides additional evidence for the regulatory function of the 5' promoter region of Avpr1a on social behavior and its evolutionary stable effect across species, including rodents, chimpanzees and humans. Although it is generally accepted that complex social behavior is regulated by a combination of genes, the environment and their interaction, our findings highlight the importance of candidate genes with large effects on behavioral variation.

  3. Simulations of airglow variations induced by the CO2 increase and solar cycle variation from 1980 to 1991

    Science.gov (United States)

    Huang, Tai-Yin

    2016-09-01

    Airglow intensity and Volume Emission Rate (VER) variations induced by the increase of CO2 gas concentration and F10.7 variation (used as a proxy for the 11-year solar cycle variation) were investigated for the period from 1980 to 1991, encompassing a full solar cycle. Two airglow models are used to simulate the induced variations of O(1S) greenline, O2(0,1) atmospheric band , and OH(8,3) airglow for this study. The results show that both the airglow intensities and peak VERs correlate positively with the F10.7 solar cycle variation and display a small linear trend due to the increase of CO2 gas concentration. The solar-cycle induced airglow intensity variations show that O(1S) greenline has the largest variation (~26%) followed by the O2(0,1) atmospheric band (~23%) and then OH(8,3) airglow (~8%) over the 11 year timespan. The magnitudes of the induced airglow intensity variations by the increase of CO2 gas concentration are about an order of magnitude smaller than those by the F10.7 solar cycle variation. In general, the F10.7 solar cycle variation and CO2 increase do not seem to systematically alter the VER peak altitude of the airglow emissions, though the OH(8,3) VER peak altitude moves up slightly during the years when the F10.7 value falls under 100 SFU.

  4. Looking on the bright side of serotonin transporter gene variation.

    Science.gov (United States)

    Homberg, Judith R; Lesch, Klaus-Peter

    2011-03-15

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for depression in interaction with psychosocial adversity across the life span. However, genetically driven deficient serotonin transporter (5-HTT) function would not have been maintained throughout evolution if it only exerted negative effects without conveying any gain of function. Here, we review recent findings that humans and nonhuman primates carrying the s variant of the 5-HTTLPR outperform subjects carrying the long allele in an array of cognitive tasks and show increased social conformity. In addition, studies in 5-HTT knockout rodents are included that provide complementary insights in the beneficial effects of the 5-HTTLPR s-allele. We postulate that hypervigilance, mediated by hyperactivity in corticolimbic structures, may be the common denominator in the anxiety-related traits and (social) cognitive superiority of s-allele carriers and that environmental conditions determine whether a response will turn out to be negative (emotional) or positive (cognitive, in conformity with the social group). Taken together, these findings urge for a conceptual change in the current deficit-oriented connotation of the 5-HTTLPR variants. In fact, these factors may counterbalance or completely offset the negative consequences of the anxiety-related traits. This notion may not only explain the modest effect size of the 5-HTTLPR and inconsistent reports but may also lead to a more refined appreciation of allelic variation in 5-HTT function. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  5. Genomic and gene variation in Mycoplasma hominis strains

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Andersen, H; Birkelund, Svend

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed...... no identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns....... These hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  6. Hypertension and genetic variation in endothelial-specific genes.

    Directory of Open Access Journals (Sweden)

    Erik Larsson

    Full Text Available Genome-wide association (GWA studies usually detect common genetic variants with low-to-medium effect sizes. Many contributing variants are not revealed, since they fail to reach significance after strong correction for multiple comparisons. The WTCCC study for hypertension, for example, failed to identify genome-wide significant associations. We hypothesized that genetic variation in genes expressed specifically in the endothelium may be important for hypertension development. Results from the WTCCC study were combined with previously published gene expression data from mice to specifically investigate SNPs located within endothelial-specific genes, bypassing the requirement for genome-wide significance. Six SNPs from the WTCCC study were selected for independent replication in 5205 hypertensive patients and 5320 population-based controls, and successively in a cohort of 16,537 individuals. A common variant (rs10860812 in the DRAM (damage-regulated autophagy modulator locus showed association with hypertension (P = 0.008 in the replication study. The minor allele (A had a protective effect (OR = 0.93; 95% CI 0.88-0.98 per A-allele, which replicates the association in the WTCCC GWA study. However, a second follow-up, in the larger cohort, failed to reveal an association with blood pressure. We further tested the endothelial-specific genes for co-localization with a panel of newly discovered SNPs from large meta-GWAS on hypertension or blood pressure. There was no significant overlap between those genes and hypertension or blood pressure loci. The result does not support the hypothesis that genetic variation in genes expressed in endothelium plays an important role for hypertension development. Moreover, the discordant association of rs10860812 with blood pressure in the case control study versus the larger Malmö Preventive Project-study highlights the importance of rigorous replication in multiple large independent studies.

  7. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  8. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  9. Common variation of the CYP17 gene in Iraqi women with endometriosis disease.

    Science.gov (United States)

    Al-Rubae'i, Salwa H N; Naji, Tamara Sami; Turki, Kisma M

    2017-03-01

    Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17), a gene that codes for a key enzyme (cytochrome P450c17a1) in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23-46), the associations between selected single-nucleotide polymorphisms (SNPs) in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01)between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01) in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  10. Common variation of the CYP17 gene in Iraqi women with endometriosis disease

    Directory of Open Access Journals (Sweden)

    Salwa H.N. Al-Rubae'i

    2017-03-01

    Full Text Available Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17, a gene that codes for a key enzyme (cytochrome P450c17a1 in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23–46, the associations between selected single-nucleotide polymorphisms (SNPs in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01 in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  11. Investigation of variation in gene expression profiling of human blood by extended principle component analysis.

    Directory of Open Access Journals (Sweden)

    Qinghua Xu

    Full Text Available BACKGROUND: Human peripheral blood is a promising material for biomedical research. However, various kinds of biological and technological factors result in a large degree of variation in blood gene expression profiles. METHODOLOGY/PRINCIPAL FINDINGS: Human peripheral blood samples were drawn from healthy volunteers and analysed using the Human Genome U133Plus2 Microarray. We applied a novel approach using the Principle Component Analysis and Eigen-R(2 methods to dissect the overall variation of blood gene expression profiles with respect to the interested biological and technological factors. The results indicated that the predominating sources of the variation could be traced to the individual heterogeneity of the relative proportions of different blood cell types (leukocyte subsets and erythrocytes. The physiological factors like age, gender and BMI were demonstrated to be associated with 5.3% to 9.2% of the total variation in the blood gene expression profiles. We investigated the gene expression profiles of samples from the same donors but with different levels of RNA quality. Although the proportion of variation associated to the RNA Integrity Number was mild (2.1%, the significant impact of RNA quality on the expression of individual genes was observed. CONCLUSIONS: By characterizing the major sources of variation in blood gene expression profiles, such variability can be minimized by modifications to study designs. Increasing sample size, balancing confounding factors between study groups, using rigorous selection criteria for sample quality, and well controlled experimental processes will significantly improve the accuracy and reproducibility of blood transcriptome study.

  12. PAX6 gene variations associated with aniridia in south India

    Directory of Open Access Journals (Sweden)

    Shashikant Shetty

    2004-04-01

    Full Text Available Abstract Background Mutations in the transcription factor gene PAX6 have been shown to be the cause of the aniridia phenotype. The purpose of this study was to analyze patients with aniridia to uncover PAX6 gene mutations in south Indian population. Methods Total genomic DNA was isolated from peripheral blood of twenty-eight members of six clinically diagnosed aniridia families and 60 normal healthy controls. The coding exons of the human PAX6 gene were amplified by PCR and allele specific variations were detected by single strand conformation polymorphism (SSCP followed by automated sequencing. Results The sequencing results revealed novel PAX6 mutations in three patients with sporadic aniridia: c.715ins5, [c.1201delA; c.1239A>G] and c.901delA. Two previously reported nonsense mutations were also found: c.482C>A, c.830G>A. A neutral polymorphism was detected (IVS9-12C>T at the boundary of intron 9 and exon 10. The two nonsense mutations found in the coding region of human PAX6 gene are reported for the first time in the south Indian population. Conclusion The genetic analysis confirms that haploinsuffiency of the PAX6 gene causes the classic aniridia phenotype. Most of the point mutations detected in our study results in stop codons. Here we add three novel PAX6 gene mutations in south Indian population to the existing spectrum of mutations, which is not a well-studied ethnic group. Our study supports the hypothesis that a mutation in the PAX6 gene correlates with expression of aniridia.

  13. Diurnal variation of hepatic antioxidant gene expression in mice.

    Directory of Open Access Journals (Sweden)

    Yi-Qiao Xu

    Full Text Available BACKGROUND: This study was aimed to examine circadian variations of hepatic antioxidant components, including the Nrf2- pathway, the glutathione (GSH system, antioxidant enzymes and metallothionein in mouse liver. METHODS AND RESULTS: Adult mice were housed in light- and temperature-controlled facilities for 2 weeks, and livers were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis. Hepatic mRNA levels of Nrf2, Keap1, Nqo1 and Gclc were higher in the light-phase than the dark-phase, and were female-predominant. Hepatic GSH presented marked circadian fluctuations, along with glutathione S-transferases (GST-α1, GST-µ, GST-π and glutathione peroxidase (GPx1. The expressions of GPx1, GST-µ and GST-π mRNA were also higher in females. Antioxidant enzymes Cu/Zn superoxide dismutase (Sod1, catalase (CAT, cyclooxygenase-2 (Cox-2 and heme oxygenase-1 (Ho-1 showed circadian rhythms, with higher expressions of Cox-2 and CAT in females. Metallothionein, a small non-enzymatic antioxidant protein, showed dramatic circadian variation in males, but higher expression in females. The circadian variations of the clock gene Brain and Muscle Arnt-like Protein-1(Bmal1, albumin site D-binding protein (Dbp, nuclear receptor Rev-Erbα (Nr1d1, period protein (Per1 and Per2 and cryptochrome 1(Cry1 were in agreement with the literature. Furthermore, acetaminophen hepatotoxicity is more severe when administered in the afternoon when hepatic GSH was lowest. CONCLUSIONS: Circadian variations and gender differences in transcript levels of antioxidant genes exist in mouse liver, which could affect body responses to oxidative stress at different times of the day.

  14. Genetic Variation in NFKBIE Is Associated With Increased Risk of Pneumococcal Meningitis in Children

    DEFF Research Database (Denmark)

    Lundbo, Lene F; Harboe, Zitta Barrella; Clausen, Louise N;

    2016-01-01

    BACKGROUND: Streptococcus pneumoniae and Neisseria meningitidis are frequent pathogens in life-threatening infections. Genetic variation in the immune system may predispose to these infections. Nuclear factor-κB is a key component of the TLR-pathway, controlled by inhibitors, encoded by the genes...... and 1273 controls were included. We included 406 cases with meningococcal meningitis, 272 with meningococcal bacteremia, and 672 controls. The NFKBIE SNP was associated with increased risk of pneumococcal meningitis (aOR 1.68; 95% CI: 1.20-2.36), but not bacteremia (aOR 1.08; 95% CI: 0.......86-1.35). The remaining SNPs were not associated with susceptibility to invasive disease. None of the SNPs were associated with risk of IMD or mortality. CONCLUSIONS: A NFKBIE polymorphism was associated with increased risk of pneumococcal meningitis....

  15. Harnessing Genetic Variation in Leaf Angle to Increase Productivity of Sorghum bicolor.

    Science.gov (United States)

    Truong, Sandra K; McCormick, Ryan F; Rooney, William L; Mullet, John E

    2015-11-01

    The efficiency with which a plant intercepts solar radiation is determined primarily by its architecture. Understanding the genetic regulation of plant architecture and how changes in architecture affect performance can be used to improve plant productivity. Leaf inclination angle, the angle at which a leaf emerges with respect to the stem, is a feature of plant architecture that influences how a plant canopy intercepts solar radiation. Here we identify extensive genetic variation for leaf inclination angle in the crop plant Sorghum bicolor, a C4 grass species used for the production of grain, forage, and bioenergy. Multiple genetic loci that regulate leaf inclination angle were identified in recombinant inbred line populations of grain and bioenergy sorghum. Alleles of sorghum dwarf-3, a gene encoding a P-glycoprotein involved in polar auxin transport, are shown to change leaf inclination angle by up to 34° (0.59 rad). The impact of heritable variation in leaf inclination angle on light interception in sorghum canopies was assessed using functional-structural plant models and field experiments. Smaller leaf inclination angles caused solar radiation to penetrate deeper into the canopy, and the resulting redistribution of light is predicted to increase the biomass yield potential of bioenergy sorghum by at least 3%. These results show that sorghum leaf angle is a heritable trait regulated by multiple loci and that genetic variation in leaf angle can be used to modify plant architecture to improve sorghum crop performance.

  16. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  17. AGTR1 gene variation: association with depression and frontotemporal morphology.

    Science.gov (United States)

    Taylor, Warren D; Benjamin, Sophiya; McQuoid, Douglas R; Payne, Martha E; Krishnan, Ranga R; MacFall, James R; Ashley-Koch, Allison

    2012-05-31

    The renin-angiotensin system (RAS) is implicated in the response to physiological and psychosocial stressors, but its role in stress-related psychiatric disorders is poorly understood. We examined if variation in AGTR1, the gene coding for the type 1 angiotensin II receptor (AT(1)R), is associated with a diagnosis of depression and differences in white matter hyperintensities and frontotemporal brain volumes. Participants comprised 257 depressed and 116 nondepressed elderly Caucasian subjects who completed clinical assessments and provided blood samples for genotyping. We used a haplotype-tagging single nucleotide polymorphism (htSNP) analysis to test for variation in AGTR1. For measurement of hyperintense lesions, 1.5 Tesla magnetic resonance imaging (MRI) data were available on 33 subjects. For measurements of the hippocampus and dorsolateral prefrontal cortex (dlPFC), 3 Tesla MRI data were available on 70 subjects. Two htSNPs exhibited statistically significant frequency differences between diagnostic cohorts: rs10935724 and rs12721331. Although hyperintense lesion volume did not significantly differ by any htSNP, dlPFC and hippocampus volume differed significantly for several htSNPs. Intriguingly, for those htSNPs differing significantly for both dlPFC and hippocampus volume, the variant associated with smaller dlPFC volume was associated with larger hippocampal volume. This supports the idea that genetic variation in AGTR1 is associated with depression and differences in frontotemporal morphology. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. The Increasing Importance of Gene-Based Analyses.

    Directory of Open Access Journals (Sweden)

    Elizabeth T Cirulli

    2016-04-01

    Full Text Available In recent years, genome and exome sequencing studies have implicated a plethora of new disease genes with rare causal variants. Here, I review 150 exome sequencing studies that claim to have discovered that a disease can be caused by different rare variants in the same gene, and I determine whether their methods followed the current best-practice guidelines in the interpretation of their data. Specifically, I assess whether studies appropriately assess controls for rare variants throughout the entire gene or implicated region as opposed to only investigating the specific rare variants identified in the cases, and I assess whether studies present sufficient co-segregation data for statistically significant linkage. I find that the proportion of studies performing gene-based analyses has increased with time, but that even in 2015 fewer than 40% of the reviewed studies used this method, and only 10% presented statistically significant co-segregation data. Furthermore, I find that the genes reported in these papers are explaining a decreasing proportion of cases as the field moves past most of the low-hanging fruit, with 50% of the genes from studies in 2014 and 2015 having variants in fewer than 5% of cases. As more studies focus on genes explaining relatively few cases, the importance of performing appropriate gene-based analyses is increasing. It is becoming increasingly important for journal editors and reviewers to require stringent gene-based evidence to avoid an avalanche of misleading disease gene discovery papers.

  19. Looking on the bright side of serotonin transporter gene variation.

    NARCIS (Netherlands)

    Homberg, J.R.; Lesch, K.P.

    2011-01-01

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for

  20. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Science.gov (United States)

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder.

  1. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Onouchi

    Full Text Available Kawasaki disease (KD; MIM#61175 is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+ release activated Ca(2+ (CRAC channel mediating store-operated Ca(2+ entry (SOCE on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596 was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls, P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method. Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012. These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+/NFAT pathway in the pathogenesis of this disorder.

  2. Variations in ORAI1 Gene Associated with Kawasaki Disease

    Science.gov (United States)

    Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca2+ release activated Ca2+ (CRAC) channel mediating store-operated Ca2+ entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca2+/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  3. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  4. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  5. Increased complexity of gene structure and base composition in vertebrates

    Institute of Scientific and Technical Information of China (English)

    Ying Wu; Huizhong Yuan; Shengjun Tan; Jian-Qun Chen; Dacheng Tian; Haiwang Yang

    2011-01-01

    How the structure and base composition of genes changed with the evolution of vertebrates remains a puzzling question. Here we analyzed 895 orthologous protein-coding genes in six multicellular animals: human, chicken, zebrafish, sea squirt, fruit fly, and worm. Our analyses reveal that many gene regions, particularly intron and 3' UTR, gradually expanded throughout the evolution of vertebrates from their invertebrate ancestors, and that the number of exons per gene increased. Studies based on all protein-coding genes in each genome provide consistent results.We also find that GC-content increased in many gene regions (especially 5' UTR) in the evolution of endotherms, except in coding-exons.Analysis of individual genomes shows that 3′ UTR demonstrated stronger length and CC-content correlation with intron than 5' UTR, and gene with large intron in all six species demonstrated relatively similar GC-content. Our data indicates a great increase in complexity in vertebrate genes and we propose that the requirement for morphological and functional changes is probably the driving force behind the evolution of structure and base composition complexity in multicellular animal genes.

  6. Immune response gene expression increases in the aging murine hippocampus.

    Science.gov (United States)

    Terao, Akira; Apte-Deshpande, Anjali; Dousman, Linda; Morairty, Stephen; Eynon, Barrett P; Kilduff, Thomas S; Freund, Yvonne R

    2002-11-01

    Using GeneChips, basal and lipopolysaccharide (LPS)-induced gene expression was examined in the hippocampus of 3-, 12-, 18- and 24-month-old male C57BL/6 mice to identify genes whose altered expression could influence hippocampal function in advanced age. Gene elements that changed with age were selected with a t-statistic and specific expression patterns were confirmed with real-time quantitative PCR. Basal expression of 128 gene elements clearly changed with age in the hippocampus. Fourteen gene elements showed increased expression with age and these increases were validated after LPS stimulation. Major histocompatibility complex (MHC) TL region and thymic shared antigen (TSA-1) gene expression increased, suggesting T cell activation in the hippocampus with age. Cytokine (interleukin (IL)-1beta, tumor necrosis factor (TNF)-alpha) and chemokine (macrophage chemotactic protein-1) expression increased sharply in 24-month-old mice. These findings are in contrast to a decrease in the peripheral immune response, documented by decreased T cell proliferation and decreased ratios of naive to memory T cells. Age-related increases in inflammatory potential in the brain may contribute to neurodegenerative diseases of the aged.

  7. Identifying the genetic variation of gene expression using gene sets: application of novel gene Set eQTL approach to PharmGKB and KEGG.

    Directory of Open Access Journals (Sweden)

    Ryan Abo

    Full Text Available Genetic variation underlying the regulation of mRNA gene expression in humans may provide key insights into the molecular mechanisms of human traits and complex diseases. Current statistical methods to map genetic variation associated with mRNA gene expression have typically applied standard linkage and/or association methods; however, when genome-wide SNP and mRNA expression data are available performing all pair wise comparisons is computationally burdensome and may not provide optimal power to detect associations. Consideration of different approaches to account for the high dimensionality and multiple testing issues may provide increased efficiency and statistical power. Here we present a novel approach to model and test the association between genetic variation and mRNA gene expression levels in the context of gene sets (GSs and pathways, referred to as gene set - expression quantitative trait loci analysis (GS-eQTL. The method uses GSs to initially group SNPs and mRNA expression, followed by the application of principal components analysis (PCA to collapse the variation and reduce the dimensionality within the GSs. We applied GS-eQTL to assess the association between SNP and mRNA expression level data collected from a cell-based model system using PharmGKB and KEGG defined GSs. We observed a large number of significant GS-eQTL associations, in which the most significant associations arose between genetic variation and mRNA expression from the same GS. However, a number of associations involving genetic variation and mRNA expression from different GSs were also identified. Our proposed GS-eQTL method effectively addresses the multiple testing limitations in eQTL studies and provides biological context for SNP-expression associations.

  8. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  9. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Science.gov (United States)

    Li, Zhenkun; Huo, Xueyun; Zhang, Shuangyue; Lu, Jing; Li, Changlong; Guo, Meng; Fu, Rui; He, Zhengming; Du, Xiaoyan; Chen, Zhenwen

    2015-01-01

    Deformities in the Circle of Willis (CoW) can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH). After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR) on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2) associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  10. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Directory of Open Access Journals (Sweden)

    Zhenkun Li

    Full Text Available Deformities in the Circle of Willis (CoW can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH. After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2 associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  11. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    OpenAIRE

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  12. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  13. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga

    2009-01-01

    -binding protein), which is induced by glucose, and SREBP-1 (sterol response element-binding protein-1), which is stimulated by insulin through the PI3K/Akt signal transduction pathway. We investigated whether the genetic variability of the genes encoding for ChREBP, SREBP and FAS (respectively, MLXIPL, SREBF1...... and FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall...

  14. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  15. Major inter-personal variation in the increase and maximal level of 25-hydroxy vitamin D induced by UVB.

    Science.gov (United States)

    Datta, Pameli; Philipsen, Peter A; Olsen, Peter; Petersen, Bibi; Johansen, Peter; Morling, Niels; Wulf, Hans C

    2016-04-01

    Vitamin D influences skeletal health as well as other aspects of human health. Even when the most obvious sources of variation such as solar UVB exposure, latitude, season, clothing habits, skin pigmentation and ethnicity are selected for, variation in the serum 25-hydroxy vitamin D (25(OH)D) response to UVB remains extensive and unexplained. Our study assessed the inter-personal variation in 25(OH)D response to UVR and the maximal obtainable 25(OH)D level in 22 healthy participants (220 samples) with similar skin pigmentation during winter with negligible ambient UVB. Participants received identical UVB doses on identical body areas until a maximal level of 25(OH)D was reached. Major inter-personal variation in both the maximal obtainable UVB-induced 25(OH)D level (range 85-216 nmol l(-1), mean 134 nmol l(-1)) and the total increase in 25(OH)D (range 3-139 nmol l(-1), mean 48 nmol l(-1)) was found. A linear model including measured 25(OH)D baselines as personal intercepts explained 54.9% of the variation. By further including personal slopes in the model, as much as 90.8% of the variation could be explained. The explained variation constituted by personal differences in slopes thus represented 35.9%. Age, vitamin D receptor gene polymorphisms, height and constitutive skin pigmentation (a skin area not exposed to UVB) explained 15.1% of this variation. Despite elimination of most known external sources of variation, our study demonstrated inter-personal variation corresponding to an observed maximal difference of 136 nmol l(-1) in the total increase of 25(OH)D and 131 nmol l(-1) in the maximal level of 25(OH)D.

  16. Development of EMS-induced mutation population for amylose and resistant starch variation in bread wheat (Triticum aestivum) and identification of candidate genes responsible for amylose variation.

    Science.gov (United States)

    Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy

    2016-10-06

    Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and

  17. Quantitative gene-gene and gene-environment mapping for leaf shape variation using tree-based models

    Science.gov (United States)

    Leaf shape traits have long been a focus of many disciplines, but searching for complex genetic and environmental interactive mechanisms regulating leaf shape variation has not yet been well developed. The question of the respective roles of gene and environment and how they interplay to modulate l...

  18. Carrying photosynthesis genes increases ecological fitness of cyanophage in silico.

    Science.gov (United States)

    Hellweger, Ferdi L

    2009-06-01

    Several viruses infecting marine cyanobacteria carry photosynthesis genes (e.g. psbA, hli) that are expressed, yield proteins (D1, HLIP) and help maintain the cell's photosynthesis apparatus during the latent period. This increases energy and speeds up virus production, allowing for a reduced latent period (a fitness benefit), but it also increases the DNA size, which slows down new virus production and reduces burst size (a fitness cost). How do these genes affect the net ecological fitness of the virus? Here, this question is explored using a combined systems biology and systems ecology ('systems bioecology') approach. A novel agent-based model simulates individual cyanobacteria cells and virus particles, each with their own genes, transcripts, proteins and other properties. The effect of D1 and HLIP proteins is explicitly considered using a mechanistic photosynthesis component. The model is calibrated to the available database for Prochlorococcus ecotype MED4 and podovirus P-SSP7. Laboratory- and field-scale in silico survival, competition and evolution (gene packaging error) experiments with wild type and genetically engineered viruses are performed to develop vertical survival and fitness profiles, and to determine the optimal gene content. The results suggest that photosynthesis genes are nonessential, increase fitness in a manner correlated with irradiance, and that the wild type has an optimal gene content.

  19. Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Megan C. McDonald

    2016-04-01

    Full Text Available Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene.

  20. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    Science.gov (United States)

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, ppopulation. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  1. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  2. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  3. Increased risk of venous thromboembolism is associated with genetic variation in heme oxygenase-1 in Blacks

    Science.gov (United States)

    Bean, Christopher J.; Boulet, Sheree L.; Ellingsen, Dorothy; Trau, Heidi; Ghaji, Nafisa; Hooper, W. Craig; Austin, Harland

    2015-01-01

    Background Venous thromboembolism (VTE) affects as many as 1 in 1000 individuals in the United States. Although Blacks are disproportionately affected by VTE, few genetic risk factors have been identified in this population. The inducible heme oxygenase-1 (HMOX1) gene encodes a key cytoprotective enzyme with anti-inflammatory, antioxidant and anticoagulant activity acting in the vascular system. A (GT)n microsatellite located in the promoter of the HMOX1 gene influences the level of response. Methods and Results Using the Genetic Attributes and Thrombosis Epidemiology (GATE) study, we examined the association between HMOX1 repeat length and VTE events in 883 Black and 927 White patients and matched controls. We found no association between HMOX1 genotypes and VTE in Whites. However, in Black patients, carrying two long (L) alleles (≥34 repeats) was significantly associated with provoked (odds ratio (OR) 1.86, 95% confidence interval (CI): 1.19–2.90) or recurrent (OR 3.13, 95% CI: 1.77–5.53) VTE events. Conclusions We have demonstrated for the first time an association between genetic variation in HMOX1, and VTE in Blacks. Our results support a key role for the heme oxygenase system in protecting patients at increased risk for thrombosis and suggest a potential mechanism for targeted screening and intervention. PMID:22959128

  4. Threshold-dominated regulation hides genetic variation in gene expression networks

    Directory of Open Access Journals (Sweden)

    Plahte Erik

    2007-12-01

    Full Text Available Abstract Background In dynamical models with feedback and sigmoidal response functions, some or all variables have thresholds around which they regulate themselves or other variables. A mathematical analysis has shown that when the dose-response functions approach binary or on/off responses, any variable with an equilibrium value close to one of its thresholds is very robust to parameter perturbations of a homeostatic state. We denote this threshold robustness. To check the empirical relevance of this phenomenon with response function steepnesses ranging from a near on/off response down to Michaelis-Menten conditions, we have performed a simulation study to investigate the degree of threshold robustness in models for a three-gene system with one downstream gene, using several logical input gates, but excluding models with positive feedback to avoid multistationarity. Varying parameter values representing functional genetic variation, we have analysed the coefficient of variation (CV of the gene product concentrations in the stable state for the regulating genes in absolute terms and compared to the CV for the unregulating downstream gene. The sigmoidal or binary dose-response functions in these models can be considered as phenomenological models of the aggregated effects on protein or mRNA expression rates of all cellular reactions involved in gene expression. Results For all the models, threshold robustness increases with increasing response steepness. The CVs of the regulating genes are significantly smaller than for the unregulating gene, in particular for steep responses. The effect becomes less prominent as steepnesses approach Michaelis-Menten conditions. If the parameter perturbation shifts the equilibrium value too far away from threshold, the gene product is no longer an effective regulator and robustness is lost. Threshold robustness arises when a variable is an active regulator around its threshold, and this function is maintained by

  5. Copy number variations in alternative splicing gene networks impact lifespan.

    Directory of Open Access Journals (Sweden)

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  6. Evolution of variation in presence and absence of genes in bacterial pathways

    Directory of Open Access Journals (Sweden)

    Francis Andrew R

    2012-04-01

    Full Text Available Abstract Background Bacterial genomes exhibit a remarkable degree of variation in the presence and absence of genes, which probably extends to the level of individual pathways. This variation may be a consequence of the significant evolutionary role played by horizontal gene transfer, but might also be explained by the loss of genes through mutation. A challenge is to understand why there would be variation in gene presence within pathways if they confer a benefit only when complete. Results Here, we develop a mathematical model to study how variation in pathway content is produced by horizontal transfer, gene loss and partial exposure of a population to a novel environment. Conclusions We discuss the possibility that variation in gene presence acts as cryptic genetic variation on which selection acts when the appropriate environment occurs. We find that a high level of variation in gene presence can be readily explained by decay of the pathway through mutation when there is no longer exposure to the selective environment, or when selection becomes too weak to maintain the genes. In the context of pathway variation the role of horizontal gene transfer is probably the initial introduction of a complete novel pathway rather than in building up the variation in a genome without the pathway.

  7. Serotonergic gene variation: implications for personality traits and psychopathology.

    Science.gov (United States)

    Lesch, K P

    1999-06-01

    Serotonin 5-hydroxytryptamine (5-HT) is an important regulator of morphogenetic activities during early central nervous system development, including cell proliferation, migration, and differentiation as well as synapto-genesis. Serotonergic raphe neurons diffusely project to a variety of brain regions (e.g. cortex, amygdala, hippocampus) and play known roles in integrating emotion, cognition, motor function as well as in food intake, sleep, pain, and sexual activity. The diversity of physiologic functions is due to the fact that 5-HT acts as a master control neurotransmitter within a highly complex system of neural communication mediated by multiple pre- and postsynaptic 5-HT receptors, thus orchestrating the activity and interaction of several other neurotransmitter systems. Since proteins involved in the regulation of central serotonergic activity (e.g. enzymes, receptors, transporter) play pivotal role in brain 5-HT homeostasis, polymorphisms in the regulatory regions of their genes resulting in variation of expression and function are likely to influence complex traits, such as temperament/personality and psychopathology.

  8. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  9. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  10. Contribution of haplotypes across the fibrinogen gene cluster to variation in risk of myocardial infarction.

    Science.gov (United States)

    Mannila, Maria Nastase; Eriksson, Per; Lundman, Pia; Samnegård, Ann; Boquist, Susanna; Ericsson, Carl-Göran; Tornvall, Per; Hamsten, Anders; Silveira, Angela

    2005-03-01

    Fibrinogen has consistently been recognized as an independent predictor of myocardial infarction (MI). Multiple mechanisms link fibrinogen to MI; therefore disentangling the factors underlying variation in plasma fibrinogen concentration is essential. Candidate regions in the fibrinogen gamma (FGG), alpha (FGA) and beta (FGB) genes were screened for single nucleotide polymorphisms (SNPs). Several novel SNPs were detected in the FGG and FGA genes in addition to the previously known SNPs in the fibrinogen genes. Tight linkage disequilibrium extending over various physical distances was observed between most SNPs. Consequently, eight SNPs were chosen and determined in 377 postinfarction patients and 387 healthy individuals. None of the SNPs were associated with plasma fibrinogen concentration or MI. Haplotype analyses revealed a consistent pattern of haplotypes associated with variation in risk of MI. Of the four haplotypes inferred using the FGA -58G>A and FGG 1299 +79T>C SNPs, the most frequent haplotype, FGG-FGA*1 (prevalence 46.6%), was associated with increased risk of MI (OR 1.51; 95%CI 1.18, 1.93), whereas the least frequent haplotype, FGG-FGA*4 (11.8%), was associated with lower risk of MI (OR 0.79 95%CI 0.64, 0.98). In conclusion, fibrinogen haplotypes, but not SNPs in isolation, are associated with variation in risk of MI.

  11. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Directory of Open Access Journals (Sweden)

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  12. GeneFisher-P: variations of GeneFisher as processes in Bio-jETI

    Science.gov (United States)

    Lamprecht, Anna-Lena; Margaria, Tiziana; Steffen, Bernhard; Sczyrba, Alexander; Hartmeier, Sven; Giegerich, Robert

    2008-01-01

    Background PCR primer design is an everyday, but not trivial task requiring state-of-the-art software. We describe the popular tool GeneFisher and explain its recent restructuring using workflow techniques. We apply a service-oriented approach to model and implement GeneFisher-P, a process-based version of the GeneFisher web application, as a part of the Bio-jETI platform for service modeling and execution. We show how to introduce a flexible process layer to meet the growing demand for improved user-friendliness and flexibility. Results Within Bio-jETI, we model the process using the jABC framework, a mature model-driven, service-oriented process definition platform. We encapsulate remote legacy tools and integrate web services using jETI, an extension of the jABC for seamless integration of remote resources as basic services, ready to be used in the process. Some of the basic services used by GeneFisher are in fact already provided as individual web services at BiBiServ and can be directly accessed. Others are legacy programs, and are made available to Bio-jETI via the jETI technology. The full power of service-based process orientation is required when more bioinformatics tools, available as web services or via jETI, lead to easy extensions or variations of the basic process. This concerns for instance variations of data retrieval or alignment tools as provided by the European Bioinformatics Institute (EBI). Conclusions The resulting service- and process-oriented GeneFisher-P demonstrates how basic services from heterogeneous sources can be easily orchestrated in the Bio-jETI platform and lead to a flexible family of specialized processes tailored to specific tasks. PMID:18460174

  13. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Directory of Open Access Journals (Sweden)

    Slavé Petrovski

    2015-09-01

    Full Text Available Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS, termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1 genes that are known to cause disease through haploinsufficiency, 2 genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3 genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4 genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding

  14. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Science.gov (United States)

    Petrovski, Slavé; Gussow, Ayal B; Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H; Allen, Andrew S; Goldstein, David B

    2015-09-01

    Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, nc

  15. A potato NOA gene increased salinity tolerance in Arabidopsis ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... in Arabidopsis thaliana salt stress responses and increased its salinity tolerance. Key words: ... response by comparing transgenic Atnoa1 plants with ..... approach for the identification of essential bacterial genes. Nat. ... Reactive oxygen species as signals that modulate plant stress ... Innate immunity in.

  16. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    Science.gov (United States)

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

  17. Potential of gene drives with genome editing to increase genetic gain in livestock breeding programs.

    Science.gov (United States)

    Gonen, Serap; Jenko, Janez; Gorjanc, Gregor; Mileham, Alan J; Whitelaw, C Bruce A; Hickey, John M

    2017-01-04

    This paper uses simulation to explore how gene drives can increase genetic gain in livestock breeding programs. Gene drives are naturally occurring phenomena that cause a mutation on one chromosome to copy itself onto its homologous chromosome. We simulated nine different breeding and editing scenarios with a common overall structure. Each scenario began with 21 generations of selection, followed by 20 generations of selection based on true breeding values where the breeder used selection alone, selection in combination with genome editing, or selection with genome editing and gene drives. In the scenarios that used gene drives, we varied the probability of successfully incorporating the gene drive. For each scenario, we evaluated genetic gain, genetic variance [Formula: see text], rate of change in inbreeding ([Formula: see text]), number of distinct quantitative trait nucleotides (QTN) edited, rate of increase in favourable allele frequencies of edited QTN and the time to fix favourable alleles. Gene drives enhanced the benefits of genome editing in seven ways: (1) they amplified the increase in genetic gain brought about by genome editing; (2) they amplified the rate of increase in the frequency of favourable alleles and reduced the time it took to fix them; (3) they enabled more rapid targeting of QTN with lesser effect for genome editing; (4) they distributed fixed editing resources across a larger number of distinct QTN across generations; (5) they focussed editing on a smaller number of QTN within a given generation; (6) they reduced the level of inbreeding when editing a subset of the sires; and (7) they increased the efficiency of converting genetic variation into genetic gain. Genome editing in livestock breeding results in short-, medium- and long-term increases in genetic gain. The increase in genetic gain occurs because editing increases the frequency of favourable alleles in the population. Gene drives accelerate the increase in allele frequency

  18. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  19. Adenovirus with DNA Packaging Gene Mutations Increased Virus Release

    Science.gov (United States)

    Wechman, Stephen L.; Rao, Xiao-Mei; McMasters, Kelly M.; Zhou, Heshan Sam

    2016-01-01

    Adenoviruses (Ads) have been extensively manipulated for the development of cancer selective replication, leading to cancer cell death or oncolysis. Clinical studies using E1-modified oncolytic Ads have shown that this therapeutic platform was safe, but with limited efficacy, indicating the necessity of targeting other viral genes for manipulation. To improve the therapeutic efficacy of oncolytic Ads, we treated the entire Ad genome repeatedly with UV-light and have isolated AdUV which efficiently lyses cancer cells as reported previously (Wechman, S. L. et al. Development of an Oncolytic Adenovirus with Enhanced Spread Ability through Repeated UV Irradiation and Cancer Selection. Viruses 2016, 8, 6). In this report, we show that no mutations were observed in the early genes (E1 or E4) of AdUV while several mutations were observed within the Ad late genes which have structural or viral DNA packaging functions. This study also reported the increased release of AdUV from cancer cells. In this study, we found that AdUV inhibits tumor growth following intratumoral injection. These results indicate the potentially significant role of the viral late genes, in particular the DNA packaging genes, to enhance Ad oncolysis. PMID:27999391

  20. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Directory of Open Access Journals (Sweden)

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  1. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Science.gov (United States)

    Anderson, Mark T; Seifert, H Steven

    2013-01-01

    Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae when investigating

  2. Molecular cloning and daily variations of the Period gene in a reef fish Siganus guttatus.

    Science.gov (United States)

    Park, Ji-Gweon; Park, Yong-Ju; Sugama, Nozomi; Kim, Se-Jae; Takemura, Akihiro

    2007-04-01

    As the first step in understanding the molecular oscillation of the circa rhythms in the golden rabbitfish Siganus guttatus--a reef fish with a definite lunar-related rhythmicity--we cloned and sequenced a Period gene (rfPer). The rfPer gene contained an open reading frame that encodes a protein consisting of 1,452 amino acids; this protein is highly homologous to PER proteins of vertebrates including zebrafish. Phylogenetic analyses indicated that the rfPER protein is related to the zebrafish PER1 and PER4. The expression of rfPer mRNA in the whole brain, retina, and liver under light/dark (LD) conditions increased at 06:00 h and decreased at 18:00 h, suggesting that its robust circadian rhythm occurs in neural and peripheral tissues. When daily variation in the expression in rfPer mRNA in the whole brain and cultured pineal gland were examined under LD conditions, similar expression patterns of the gene were observed with an increase around dawn. Under constant light condition, the increased expression of rfPer mRNA in the whole brain disappeared around dawn. The present results demonstrate that rfPer is related to zPer4 and possibly zPer1. The present study is the first report on the Period gene from a marine fish.

  3. Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of Prostate Cancer

    Science.gov (United States)

    2015-10-01

    occupation, and smoking . 2. To examine the modifying effect of genetic variants in ITC-metabolizing genes on the associations between cruciferous...AWARD NUMBER: W81XWH-14-1-0453 TITLE: Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of...COVERED 15 Sep 2014 - 14 Sep 2015 4. TITLE AND SUBTITLE Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in

  4. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Directory of Open Access Journals (Sweden)

    Karen E Sears

    2015-08-01

    Full Text Available Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11 and late (expansion and elongation; E11-13 limb development in mouse. This resulted in an Early (ESN and Late (LSN Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species.

  5. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Science.gov (United States)

    Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D

    2016-01-01

    Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  6. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  7. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Science.gov (United States)

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; Hasler, Brant P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2013-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30–54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p seasonal patterns of recurrence or exacerbation. PMID:22881342

  8. Can exploiting natural genetic variation in leaf photosynthesis contribute to increasing rice productivity? A simulation analysis.

    Science.gov (United States)

    Gu, Junfei; Yin, Xinyou; Stomph, Tjeerd-Jan; Struik, Paul C

    2014-01-01

    Rice productivity can be limited by available photosynthetic assimilates from leaves. However, the lack of significant correlation between crop yield and leaf photosynthetic rate (A) is noted frequently. Engineering for improved leaf photosynthesis has been argued to yield little increase in crop productivity because of complicated constraints and feedback mechanisms when moving up from leaf to crop level. Here we examined the extent to which natural genetic variation in A can contribute to increasing rice productivity. Using the mechanistic model GECROS, we analysed the impact of genetic variation in A on crop biomass production, based on the quantitative trait loci for various photosynthetic components within a rice introgression line population. We showed that genetic variation in A of 25% can be scaled up equally to crop level, resulting in an increase in biomass of 22-29% across different locations and years. This was probably because the genetic variation in A resulted not only from Rubisco (ribulose 1,5-bisphosphate carboxylase/oxygenase)-limited photosynthesis but also from electron transport-limited photosynthesis; as a result, photosynthetic rates could be improved for both light-saturated and light-limited leaves in the canopy. Rice productivity could be significantly improved by mining the natural variation in existing germ-plasm, especially the variation in parameters determining light-limited photosynthesis.

  9. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo-

  10. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo- an

  11. Increased expression of PIN1 gene in papillary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Lewiński Andrzej

    2011-01-01

    Full Text Available Abstract Background Peptidyl-prolyl cis/trans isomerase (Pin1, encoded by PIN1 gene with locus in chromosome 19p13, is an enzyme that catalytically induces conformational changes in proteins after phosphorylation on serine or threonine residues preceding proline (pSer/Thr-Pro motifs; in this way, it has an influence on protein interactions and intracellular localizations of proteins. The aim of the study were: 1 an assessment of PIN1 gene expression level in benign and malignant thyroid lesions; 2 the evaluation of possible correlations between gene expression and histopathological variants of papillary thyroid carcinoma (PTC or tumour size, classified according to TNM classification of primary tumours (in case of PTC only; 3 the estimation of possible relationships between expression of the gene in question and patients' sex or age. Methods Seventy (70 tissue samples were analyzed: 32 cases of PTC, 7 cases of medullary thyroid carcinoma (MTC, 7 cases of follicular adenoma (FA, and 24 cases of nodular goitre (NG. In real-time polymerase chain reaction (real-time PCR, two-step RT-PCR (reverse transcriptase-polymerase chain reaction in an ABI PRISM 7500 Sequence Detection System was employed. The PIN1 gene expression level was assessed, calculating the mean relative quantification rate (RQ rate increase for each sample. Results The level of PIN1 gene expression (compared to that in macroscopically unchanged thyroid tissue was higher in PTC group than those in FA, MTC and/or NG groups, but the statistical significance was noted for difference between PTC and NG groups only. On the other hand, the differences of RQ rate value between different PTC variants were statistically insignificant. No correlations were found between RQ values and tumour size, as well as between RQ values and patients' sex or age in PTC group. Conclusions The PIN1 gene expression may have - in future - an important meaning in the diagnostics of PTC and in understanding its

  12. Gene diversity and genetic variation in lung flukes (genus Paragonimus).

    Science.gov (United States)

    Blair, David; Nawa, Yukifumi; Mitreva, Makedonka; Doanh, Pham Ngoc

    2016-01-01

    Paragonimiasis caused by lung flukes (genus Paragonimus) is a neglected disease occurring in Asia, Africa and the Americas. The genus is species-rich, ancient and widespread. Genetic diversity is likely to be considerable, but investigation of this remains confined to a few populations of a few species. In recent years, studies of genetic diversity have moved from isoenzyme analysis to molecular phylogenetic analysis based on selected DNA sequences. The former offered better resolution of questions relating to allelic diversity and gene flow, whereas the latter is more suitable for questions relating to molecular taxonomy and phylogeny. A picture is emerging of a highly diverse taxon of parasites, with the greatest diversity found in eastern and southern Asia where ongoing speciation might be indicated by the presence of several species complexes. Diversity of lung flukes in Africa and the Americas is very poorly sampled. Functional molecules that might be of value for immunodiagnosis, or as targets for medical intervention, are of great interest. Characterisation of these from Paragonimus species has been ongoing for a number of years. However, the imminent release of genomic and transcriptomic data for several species of Paragonimus will dramatically increase the rate of discovery of such molecules, and illuminate their diversity within and between species.

  13. [Association of schizophrenia with variations in genes encoding transcription factors].

    Science.gov (United States)

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  14. Natural variation in abiotic stress responsive gene expression and local adaptation to climate in Arabidopsis thaliana.

    Science.gov (United States)

    Lasky, Jesse R; Des Marais, David L; Lowry, David B; Povolotskaya, Inna; McKay, John K; Richards, James H; Keitt, Timothy H; Juenger, Thomas E

    2014-09-01

    Gene expression varies widely in natural populations, yet the proximate and ultimate causes of this variation are poorly known. Understanding how variation in gene expression affects abiotic stress tolerance, fitness, and adaptation is central to the field of evolutionary genetics. We tested the hypothesis that genes with natural genetic variation in their expression responses to abiotic stress are likely to be involved in local adaptation to climate in Arabidopsis thaliana. Specifically, we compared genes with consistent expression responses to environmental stress (expression stress responsive, "eSR") to genes with genetically variable responses to abiotic stress (expression genotype-by-environment interaction, "eGEI"). We found that on average genes that exhibited eGEI in response to drought or cold had greater polymorphism in promoter regions and stronger associations with climate than those of eSR genes or genomic controls. We also found that transcription factor binding sites known to respond to environmental stressors, especially abscisic acid responsive elements, showed significantly higher polymorphism in drought eGEI genes in comparison to eSR genes. By contrast, eSR genes tended to exhibit relatively greater pairwise haplotype sharing, lower promoter diversity, and fewer nonsynonymous polymorphisms, suggesting purifying selection or selective sweeps. Our results indicate that cis-regulatory evolution and genetic variation in stress responsive gene expression may be important mechanisms of local adaptation to climatic selective gradients.

  15. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  16. Genetic variations in the KIR gene family may contribute to susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Zuo, Hai-Ning; Wang, Zhi-Long; Cui, Dao-Ran; Xin, Da-Jiang

    2014-08-01

    The present meta-analysis of relevant case-control studies was conducted to investigate the possible relationships between genetic variations in the killer cell immunoglobulin-like receptor (KIR) gene clusters of the human KIR gene family and susceptibility to ankylosing spondylitis (AS). The following electronic databases were searched for relevant articles without language restrictions: the Web of Science, the Cochrane Library Database, PubMed, EMBASE, CINAHL, the Chinese Biomedical Database (CBM) and Chinese National Knowledge Infrastructure (CNKI) databases, covering all papers published until 2013. STATA statistical software was adopted in this meta-analysis as well. We also calculated the crude odds ratios (OR) and its 95% confidence intervals (95 % CI). Seven case-control studies with 1,004 patients diagnosed with AS and 2,138 healthy cases were implicated in our meta-analysis, and 15 genes in the KIR gene family were also evaluated. The results of our meta-analysis show statistical significance between the genetic variations in the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes and an increased susceptibility to AS (KIR2DL1: OR 7.82, 95% CI 3.87-15.81, P0.05). The current meta-analysis provides reliable evidence that genetic variations in the KIR gene family may contribute to susceptibility to AS, especially for the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes.

  17. Increasing secondary and renewable material use: a chance constrained modeling approach to manage feedstock quality variation.

    Science.gov (United States)

    Olivetti, Elsa A; Gaustad, Gabrielle G; Field, Frank R; Kirchain, Randolph E

    2011-05-01

    The increased use of secondary (i.e., recycled) and renewable resources will likely be key toward achieving sustainable materials use. Unfortunately, these strategies share a common barrier to economical implementation - increased quality variation compared to their primary and synthetic counterparts. Current deterministic process-planning models overestimate the economic impact of this increased variation. This paper shows that for a range of industries from biomaterials to inorganics, managing variation through a chance-constrained (CC) model enables increased use of such variable raw materials, or heterogeneous feedstocks (hF), over conventional, deterministic models. An abstract, analytical model and a quantitative model applied to an industrial case of aluminum recycling were used to explore the limits and benefits of the CC formulation. The results indicate that the CC solution can reduce cost and increase potential hF use across a broad range of production conditions through raw materials diversification. These benefits increase where the hFs exhibit mean quality performance close to that of the more homogeneous feedstocks (often the primary and synthetic materials) or have large quality variability. In terms of operational context, the relative performance grows as intolerance for batch error increases and as the opportunity to diversify the raw material portfolio increases.

  18. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Science.gov (United States)

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. Published by Oxford University Press on behalf of Kazusa DNA Research Institute 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  19. Genetic Variation in Osteopontin Gene Is Associated with Susceptibility to Sarcoidosis in Slovenian Population

    Directory of Open Access Journals (Sweden)

    A. Maver

    2009-01-01

    Full Text Available Sarcoidosis is a systemic inflammatory disease characterised by appearance of granulomas. Precise etiology has not been elucidated. Osteopontin (Opn is a Th1 cytokine whose levels have been found increased in granulomas and serum samples from patients with sarcoidosis. We investigated whether genetic variation in Osteopontin gene (OPN gene contributes to susceptibility to sarcoidosis. Haplotype-block structure in the OPN gene region was investigated using data from HapMap project. Three representative SNPs have been selected from each block of SNPs in linkage disequilibrium (rs11730582-C/T, rs11728697-C/T and rs4754-C/T. Genotyping was performed using TaqMan SNP Genotyping Assays on a sample of 165 patients and 284 controls. Statistical analyses of association were performed using Chi-Square test and algorithms implemented in the haplo.stats and PHASE packages. Genotyping analysis revealed a significant difference in genotype frequencies at rs4754 polymorphism in groups of patients and controls under recessive genetic model (p=0.036, OR=1.99, 95%CI=1.04-3.82, CC homozygotes being significantly over-represented in the patients group. However these results failed to reach significance after correction for multiple testing (p=0.25. The frequencies of predicted haplotypes differed between patient and control groups, frequency of TTT haplotype was found to be significantly decreased in the group of patients with sarcoidosis (p=0.014, OR=0.40, 95%CI=0.20-0.79. Our results suggest that variation in the OPN gene might be significantly associated with sarcoidosis and that the TTT haplotype in OPN may act as a protective factor in sarcoidosis.

  20. Case Study of Somaclonal Variation in Resistance Genes Mlo and Pme3 in Flaxseed (Linum usitatissimum L.) Induced by Nanoparticles

    Science.gov (United States)

    Kokina, Inese; Jermaļonoka, Marija; Bankovska, Linda; Gerbreders, Vjačeslavs; Ogurcovs, Andrejs; Jahundoviča, Inese

    2017-01-01

    Nanoparticles influence on genome is investigated worldwide. The appearance of somaclonal variation is a cause of great concern for any micropropagation system. Somaclonal variation describes the tissue-culture-induced phenotypic and genotypic variations. This paper shows the results of somaclonal variation in two resistance genes pectin methylesterase and Mlo-like protein in all tissue culture development stages, as donor plant, calluses, and regenerants of Linum usitatissimum induced by gold and silver nanoparticles. In this paper, it was essential to obtain DNA material from all tissue culture development stages from one donor plant to record changes in each nucleotide sequence. Gene region specific primers were developed for resistance genes such as Mlo and Pme3 to define the genetic variability in tissue culture of L. usitatissimum. In recent years, utilization of gold and silver nanoparticles in tissue culture is increased and the mechanisms of changes in genome induced by nanoparticles still remain unclear. Obtained data show the somaclonal variation increase in calluses obtained from one donor plant and grown on medium supplemented by gold nanoparticles (Mlo 14.68 ± 0.98; Pme3 2.07 ± 0.87) or silver nanoparticles (Mlo 12.01 ± 0.43; Pme3 10.04 ± 0.46) and decrease in regenerants. Morphological parameters of calluses showed a number of differences between each investigated culture group. PMID:28326314

  1. Theoretical studies of gene substitution, geographic variation, and speciation

    Energy Technology Data Exchange (ETDEWEB)

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  2. The identification of informative genes from multiple datasets with increasing complexity

    Directory of Open Access Journals (Sweden)

    't Hoen Peter AC

    2010-01-01

    Full Text Available Abstract Background In microarray data analysis, factors such as data quality, biological variation, and the increasingly multi-layered nature of more complex biological systems complicates the modelling of regulatory networks that can represent and capture the interactions among genes. We believe that the use of multiple datasets derived from related biological systems leads to more robust models. Therefore, we developed a novel framework for modelling regulatory networks that involves training and evaluation on independent datasets. Our approach includes the following steps: (1 ordering the datasets based on their level of noise and informativeness; (2 selection of a Bayesian classifier with an appropriate level of complexity by evaluation of predictive performance on independent data sets; (3 comparing the different gene selections and the influence of increasing the model complexity; (4 functional analysis of the informative genes. Results In this paper, we identify the most appropriate model complexity using cross-validation and independent test set validation for predicting gene expression in three published datasets related to myogenesis and muscle differentiation. Furthermore, we demonstrate that models trained on simpler datasets can be used to identify interactions among genes and select the most informative. We also show that these models can explain the myogenesis-related genes (genes of interest significantly better than others (P et al. in identifying informative genes from multiple datasets with increasing complexity whilst additionally modelling the interaction between genes. Conclusions We show that Bayesian networks derived from simpler controlled systems have better performance than those trained on datasets from more complex biological systems. Further, we present that highly predictive and consistent genes, from the pool of differentially expressed genes, across independent datasets are more likely to be fundamentally

  3. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    OpenAIRE

    Cinda P Scott; Williams, Dean A; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory...

  4. HbF增高合并β地中海贫血患者的α-珠蛋白基因拷贝数变异分析%Analysis of copy number variations in α-globin gene in the cases with combined increased levels of HbF with β thalassemia

    Institute of Scientific and Technical Information of China (English)

    刘思平; 宋兰林; 熊丽; 王克; 申洪; 钟梅

    2015-01-01

    目的 阐述α珠蛋白基因拷贝数丢失与增加对胎儿血红蛋白(fetal hemoglobin,HbF)水平的影响.方法 收集15例HbF增高合并β地中海贫血的患者,首先采用Gap-PCR检测常见α-地中海贫血的3种缺失型,之后应用多重探针连接扩增技术对α-珠蛋白基因簇行片段缺失与重复分析.结果 15例患者中,检出-SEA缺失杂合子3例,-α3.7缺失杂合子1例,-α4.2缺失纯合子1例,-α3.7与-SEA双重缺失杂合子1例,α珠蛋白基因簇大片段重复1例,类α-珠蛋白基因杂合缺失1例,7例样本未见α拷贝数的丢失与增加.结论 α拷贝数的增多会生成过多的α链,加重α与β链的不平衡性,同时过量的α链与γ链组成过多的HbF,导致HbF水平的升高;α拷贝数的减少会修正α与β链比例的失衡,减轻β0/β0或β0/β+的贫血症状,这类病例归为中间型β地中海贫血,一般具有较高的HbF水平.%Objective To detect copy number changes of α-globin gene,and analyze molecular mechanism of the impacts of fetal hemoglobin (HbF) levels for α-globin gene copy numbers loss or increase.Methods A total of 15 cases with combined increased levels of fetal hemoglobin with β thalassemia were collected.Firstly,three common α-thalassemia deletions were validated by Gap-PCR.Secondly,the largest deletions of the ββ-globin gene cluster were detected by multiplex ligation-dependent probe amplification (MLPA).Result Among the 15 cases,there was 1 case with duplication of the α-globin gene cluster,3 cases of SEA heterozygote deletion of the α-globin gene,1 cases of alpha 3.7 deletion heterozygote of the α-globin gene,1 case of alpha 4.2 deletion homozygote of the α-globin gene,1 case of deletion homozygote in the like α-globin gene.A compound heterozygous for SEA and alpha 3.7 of the α-globin gene was also detected.However,7 cases showed no copy numbers loss and increase of the the α-globin gene cluster.Conclusion Additional α-globin gene can produce

  5. Integrated analyses of copy number variations and gene expression in lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Tzu-Pin Lu

    Full Text Available Numerous efforts have been made to elucidate the etiology and improve the treatment of lung cancer, but the overall five-year survival rate is still only 15%. Identification of prognostic biomarkers for lung cancer using gene expression microarrays poses a major challenge in that very few overlapping genes have been reported among different studies. To address this issue, we have performed concurrent genome-wide analyses of copy number variation and gene expression to identify genes reproducibly associated with tumorigenesis and survival in non-smoking female lung adenocarcinoma. The genomic landscape of frequent copy number variable regions (CNVRs in at least 30% of samples was revealed, and their aberration patterns were highly similar to several studies reported previously. Further statistical analysis for genes located in the CNVRs identified 475 genes differentially expressed between tumor and normal tissues (p<10(-5. We demonstrated the reproducibility of these genes in another lung cancer study (p = 0.0034, Fisher's exact test, and showed the concordance between copy number variations and gene expression changes by elevated Pearson correlation coefficients. Pathway analysis revealed two major dysregulated functions in lung tumorigenesis: survival regulation via AKT signaling and cytoskeleton reorganization. Further validation of these enriched pathways using three independent cohorts demonstrated effective prediction of survival. In conclusion, by integrating gene expression profiles and copy number variations, we identified genes/pathways that may serve as prognostic biomarkers for lung tumorigenesis.

  6. Common variation in fatty acid metabolic genes and risk of incident sudden cardiac arrest

    NARCIS (Netherlands)

    R.N. Lemaitre (Rozenn ); C.O. Johnson (Catherine); S. Hesselson (Stephanie); N. Sotoodhenia (Nona); B. McKnight (Barbara); C.M. Sitlani (Colleen); D. Rea (Dan); I.B. King (Irena); P.-Y. Kwok (Pui-Yan); A. Mak (Angel); G. Li (Guo); J. Brody (Jennifer); E.B. Larson (Eric); D. Mozaffarian (Dariush); B.M. Psaty (Bruce); A. Huertas-Vazquez (Adriana); J.-C. Tardif (Jean-Claude); C.M. Albert (Christine); L.-P. Lyytikäinen (Leo-Pekka); D.E. Arking (Dan); S. Kääb (Stefan); H.V. Huikuri (Heikki); B.P. Krijthe (Bouwe); M. Eijgelsheim (Mark); Y.A. Wang (Ying); K. Reinier (Kyndaron); T. Lehtimäki (Terho); S.L. Pulit (Sara); R. Brugada (Ramon); M. Müller-Nurasyid (Martina); C. Newton-Cheh (Christopher); P.J. Karhunen (Pekka); B.H.Ch. Stricker (Bruno); P. Goyette (Philippe); J.I. Rotter (Jerome); S.S. Chugh (Sumeet); A. Chakravarti (Aravinda); X. Jouven (Xavier); D.S. Siscovick (David)

    2014-01-01

    textabstractBackground There is limited information on genetic factors associated with sudden cardiac arrest (SCA). Objective To assess the association of common variation in genes in fatty acid pathways with SCA risk. Methods We selected 85 candidate genes and 1155 single nucleotide polymorphisms (

  7. Unraveling the regulatory mechanisms underlying tissue-dependent genetic variation of gene expression

    NARCIS (Netherlands)

    Fu, Jingyuan; Wolfs, Marcel G M; Deelen, Patrick; Westra, Harm Jan; Fehrmann, Rudolf S N; te Meerman, Gerhardus; Buurman, Wim A; Rensen, Sander S M; Groen, Hendricus; Weersma, Rinse K; van den Berg, Leonard H; Veldink, Jan; Ophoff, Roel A; Snieder, Harold; van Heel, David; Jansen, Ritsert C; Hofker, Marten H; Wijmenga, Cisca; Franke, Lude

    2012-01-01

    It is known that genetic variants can affect gene expression, but it is not yet completely clear through what mechanisms genetic variation mediate this expression. We therefore compared the cis-effect of single nucleotide polymorphisms (SNPs) on gene expression between blood samples from 1,240 human

  8. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    DEFF Research Database (Denmark)

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  9. Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment

    Science.gov (United States)

    Xu, Qin; Zhu, Caiyun; Fan, Yangyang; Song, Zhihong; Xing, Shilai; Liu, Wei; Yan, Juan; Sang, Tao

    2016-01-01

    Expression variation plays an important role in plant adaptation, but little is known about the factors impacting the expression variation when population adapts to changing environment. We used RNA-seq data from 80 individuals in 14 Miscanthus lutarioriparius populations, which were transplanted into a harsh environment from native habitat, to investigate the expression level, expression diversity and genetic diversity for genes expressed in both environments. The expression level of genes with lower expression level or without SNP tended to be more changeable in new environment, which suggested highly expressed genes experienced stronger purifying selection than those at lower level. Low proportion of genes with population effect confirmed the weak population structure and frequent gene flow in these populations. Meanwhile, the number of genes with environment effect was the most frequent compared with that with population effect. Our results showed that environment and genetic diversity were the main factors determining gene expression variation in population. This study could facilitate understanding the mechanisms of global gene expression variation when plant population adapts to changing environment. PMID:27150248

  10. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  11. NMDA receptor gene variations as modifiers in Huntington disease : a replication study

    NARCIS (Netherlands)

    Saft, Carsten; Epplen, Jörg T; Wieczorek, Stefan; Landwehrmeyer, G Bernhard; Roos, Raymund A C; de Yebenes, Justo Garcia; Dose, Matthias; Tabrizi, Sarah J; Craufurd, David; Arning, Larissa; Kremer, Berry

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN

  12. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  13. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    Science.gov (United States)

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  14. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  15. Neuropeptide Y (NPY): genetic variation in the human promoter alters glucocorticoid signaling, yielding increased NPY secretion and stress responses

    National Research Council Canada - National Science Library

    Zhang, Kuixing; Rao, Fangwen; Miramontes-Gonzalez, Jose Pablo; Hightower, C Makena; Vaught, Brian; Chen, Yuhong; Greenwood, Tiffany A; Schork, Andrew J; Wang, Lei; Mahata, Manjula; Stridsberg, Mats; Khandrika, Srikrishna; Biswas, Nilima; Fung, Maple M; Waalen, Jill; Middelberg, Rita P; Heath, Andrew C; Montgomery, Grant W; Martin, Nicholas G; Whitfield, John B; Baker, Dewleen G; Schork, Nicholas J; Nievergelt, Caroline M; O'Connor, Daniel T

    2012-01-01

    This study sought to understand whether genetic variation at the Neuropeptide Y (NPY) locus governs secretion and stress responses in vivo as well as NPY gene expression in sympathochromaffin cells...

  16. Expression of epithelial-mesenchymal transition-related genes increases with copy number in multiple cancer types.

    Science.gov (United States)

    Zhao, Min; Liu, Yining; Qu, Hong

    2016-04-26

    Epithelial-mesenchymal transition (EMT) is a cellular process through which epithelial cells transform into mesenchymal cells. EMT-implicated genes initiate and promote cancer metastasis because mesenchymal cells have greater invasive and migration capacities than epithelial cells. In this pan-cancer analysis, we explored the relationship between gene expression changes and copy number variations (CNVs) for EMT-implicated genes. Based on curated 377 EMT-implicated genes from the literature, we identified 212 EMT-implicated genes associated with more frequent copy number gains (CNGs) than copy number losses (CNLs) using data from The Cancer Genome Atlas (TCGA). Then by correlating these CNV data with TCGA gene expression data, we identified 71 EMT-implicated genes with concordant CNGs and gene up-regulation in 20 or more tumor samples. Of those, 14 exhibited such concordance in over 110 tumor samples. These 14 genes were predominantly apoptosis regulators, which may implies that apoptosis is critical during EMT. Moreover, the 71 genes with concordant CNG and up-regulation were largely involved in cellular functions such as phosphorylation cascade signaling. This is the first observation of concordance between CNG and up-regulation of specific genes in hundreds of samples, which may indicate that somatic CNGs activate gene expression by increasing the gene dosage.

  17. Increased temperature variation poses a greater risk to species than climate warming

    Science.gov (United States)

    Vasseur, David A.; DeLong, John P.; Gilbert, Benjamin; Greig, Hamish S.; Harley, Christopher D. G.; McCann, Kevin S.; Savage, Van; Tunney, Tyler D.; O'Connor, Mary I.

    2014-01-01

    Increases in the frequency, severity and duration of temperature extremes are anticipated in the near future. Although recent work suggests that changes in temperature variation will have disproportionately greater effects on species than changes to the mean, much of climate change research in ecology has focused on the impacts of mean temperature change. Here, we couple fine-grained climate projections (2050–2059) to thermal performance data from 38 ectothermic invertebrate species and contrast projections with those of a simple model. We show that projections based on mean temperature change alone differ substantially from those incorporating changes to the variation, and to the mean and variation in concert. Although most species show increases in performance at greater mean temperatures, the effect of mean and variance change together yields a range of responses, with temperate species at greatest risk of performance declines. Our work highlights the importance of using fine-grained temporal data to incorporate the full extent of temperature variation when assessing and projecting performance. PMID:24478296

  18. Increased temperature variation poses a greater risk to species than climate warming.

    Science.gov (United States)

    Vasseur, David A; DeLong, John P; Gilbert, Benjamin; Greig, Hamish S; Harley, Christopher D G; McCann, Kevin S; Savage, Van; Tunney, Tyler D; O'Connor, Mary I

    2014-03-22

    Increases in the frequency, severity and duration of temperature extremes are anticipated in the near future. Although recent work suggests that changes in temperature variation will have disproportionately greater effects on species than changes to the mean, much of climate change research in ecology has focused on the impacts of mean temperature change. Here, we couple fine-grained climate projections (2050-2059) to thermal performance data from 38 ectothermic invertebrate species and contrast projections with those of a simple model. We show that projections based on mean temperature change alone differ substantially from those incorporating changes to the variation, and to the mean and variation in concert. Although most species show increases in performance at greater mean temperatures, the effect of mean and variance change together yields a range of responses, with temperate species at greatest risk of performance declines. Our work highlights the importance of using fine-grained temporal data to incorporate the full extent of temperature variation when assessing and projecting performance.

  19. NUCLEOTIDE SEQUENCE VARIATION IN LEPTIN GENE OF MURRAH BUFFALO (BUBALUS BUBALIS

    Directory of Open Access Journals (Sweden)

    Sanjoy Datta

    2012-12-01

    Full Text Available Leptin is a 16 kD protein, synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility and immune functions. Present study was undertaken with the objectives of sequence characterization and studying the nucleotide variation in leptin gene in Murrah buffalo. The leptin gene consists of three exons and two introns which spans about 18.9kb, of which the first exon is not transcribed into protein. In buffaloes, the leptin gene is located on chromosome eight and maps to BBU 8q32. The leptin gene was amplified by PCR using oligonucleotide primers to obtain 289 bp fragment comprising of exon 2 and 405 bp fragment containing exon 3 of leptin gene. The amplicons were sequenced to identify variation at nucleotide level. Sequence comparison of buffalo with cattle reveals variation at five nucleotide sequences at positions 983, 1083, 1147, 1152, 1221 and all the SNPs are synonymous resulting no in change in amino acids. Three of these eight nucleotide variations have been reported for the first time in buffalo. The results indicate conservation of DNA sequence between cattle and buffalo. Nucleotide sequence variations observed at leptin gene between Bubalus bubalis and Bos taurus species revealed 97% nucleotide identity.

  20. Common Polymorphism in the LRP5 Gene May Increase the Risk of Bone Fracture and Osteoporosis

    Directory of Open Access Journals (Sweden)

    Guang-Yue Xu

    2014-01-01

    Full Text Available The low-density lipoprotein receptor-related protein 5 gene (LRP5 was identified to be linked to the variation in bone mineral density and types of bone diseases. The present study was aimed at examining the association of LRP5 rs3736228 C>T gene with bone fracture and osteoporosis by meta-analysis. A systematic electronic search of literature was conducted to identify all published studies in English or Chinese on the association of the LRP5 gene with bone fracture and osteoporosis risks. All analyses were calculated using the Version 12.0 STATA software. Odds ratios (ORs and their corresponding 95% confidence interval (95% CI were calculated. An updated meta-analysis was currently performed, including seven independent case-control studies. Results identified that carriers of rs3736228 C>T variant in the LRP5 gene were associated with an increased risk of developing osteoporosis and fractures under 4 genetic models but not under the dominant model (OR = 1.19, 95% CI = 0.97~1.46, and P=0.103. Ethnicity-subgroup analysis implied that LRP5 rs3736228 C>T mutation was more likely to develop osteoporosis and fractures among Asians and Caucasians in majority of subgroups. These results suggest that there is a modest effect of the LRP5 rs3736228 C>T on the increased susceptibility of bone fracture and osteoporosis.

  1. Associations between Variation in X Chromosome Male Reproductive Genes and Sperm Competitive Ability in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Leah Greenspan

    2011-01-01

    Full Text Available Variation in reproductive success has long been thought to be mediated in part by genes encoding seminal proteins. Here we explore the effect on male reproductive phenotypes of X-linked polymorphisms, a chromosome that is depauperate in genes encoding seminal proteins. Using 57 X chromosome substitution lines, sperm competition was tested both when the males from the wild-extracted line were the first to mate (“defense” crosses, followed by a tester male, and when extracted-line males were the second to mate, after a tester male (“offfense” crosses. We scored the proportion of progeny sired by each male, the fecundity, the remating rate and refractoriness to remating, and tested the significance of variation among lines. Eleven candidate genes were chosen based on previous studies, and portions of these genes were sequenced in all 57 lines. A total of 131 polymorphisms were tested for associations with the reproductive phenotypes using linear models. Nine polymorphisms in 4 genes were found to show significant associations (at a 5% FDR. Overall, it appears that the X chromosomes harbor abundant variation in sperm competition, especially considering the paucity of seminal protein genes. This suggests that much of the male reproductive variation lies outside of genes that encode seminal proteins.

  2. Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago.

    Science.gov (United States)

    Tezuka, A; Kasagi, S; van Oosterhout, C; McMullan, M; Iwasaki, W M; Kasai, D; Yamamichi, M; Innan, H; Kawamura, S; Kawata, M

    2014-11-01

    The guppy is known to exhibit remarkable interindividual variations in spectral sensitivity of middle to long wavelength-sensitive (M/LWS) cone photoreceptor cells. The guppy has four M/LWS-type opsin genes (LWS-1, LWS-2, LWS-3 and LWS-4) that are considered to be responsible for this sensory variation. However, the allelic variation of the opsin genes, particularly in terms of their absorption spectrum, has not been explored in wild populations. Thus, we examined nucleotide variations in the four M/LWS opsin genes as well as blue-sensitive SWS2-B and ultraviolet-sensitive SWS1 opsin genes for comparison and seven non-opsin nuclear loci as reference genes in 10 guppy populations from various light environments in Trinidad and Tobago. For the first time, we discovered a potential spectral variation (180 Ser/Ala) in LWS-1 that differed at an amino acid site known to affect the absorption spectra of opsins. Based on a coalescent simulation of the nucleotide variation of the reference genes, we showed that the interpopulation genetic differentiation of two opsin genes was significantly larger than the neutral expectation. Furthermore, this genetic differentiation was significantly related to differences in dissolved oxygen (DO) level, and it was not explained by the spatial distance between populations. The DO levels are correlated with eutrophication that possibly affects the color of aquatic environments. These results suggest that the population diversity of opsin genes is significantly driven by natural selection and that the guppy could adapt to various light environments through color vision changes.

  3. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Science.gov (United States)

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments.

  4. SEARCH COST REDUCTION INCREASES VARIATION IN HOTELS OCCUPANCY RATE: A THEORETICAL AND EMPIRICAL ANALYSIS

    OpenAIRE

    Marianna Succurro; Federico Boffa

    2010-01-01

    This study explores how direct online booking affects the variation in hotel bed-places occupancy rate between peak and off-peak periods, thereby contributing to three strands of literature, respectively the determinants of seasonality, the tourist information acquisition process and the impact of the internet on tourism. The empirical analysis, covering 18 countries over the 1997-2007 period, investigates the impact of an increase in the use of the internet by consumers on the seasonal varia...

  5. Genetic Variations in Inflammatory Response Genes and Their Association with the Risk of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Xin Cui

    2015-01-01

    Full Text Available Prostate cancer is a common cancer in men. Genetic variations in inflammatory response genes can potentially influence the risk of prostate cancer. We aimed to examine the association between PPARG Pro12Ala, NFKB1 -94 ins/del, NFKBIA -826C/T, COX-1 (50C>T, and COX-2 (-1195G>A polymorphisms on prostate cancer risk. The genotypes of the polymorphisms were ascertained in 543 prostate cancer patients and 753 controls through PCR-RFLP and the risk association was evaluated statistically using logistic regression analysis. The NFKB1 -94 polymorphism was shown to decrease prostate cancer risk in both heterozygous and homozygous comparison models (odds ratios of 0.74 (95% CI = 0.58–0.96 (P=0.02 and 0.57 (95% CI = 0.42–0.78 (PA polymorphisms may be, respectively, associated with decreased and increased prostate cancer risk in the Chinese population.

  6. A new approach to quantify the adaptive potential of gene expression variation in gymnosperms.

    Science.gov (United States)

    Renaut, Sébastien

    2013-05-01

    Variation in patterns of gene expression contributes to phenotypic diversity and can ultimately predict adaptive responses. However, in many cases, the consequences of regulatory mutations on patterns of gene expression and ultimately phenotypic differences remain elusive. A standard way to study the genetic architecture of expression variation in model systems has been to map gene expression variation to genetic loci (Fig. 1a). At the same time, in many nonmodel species, especially for long-lived organisms, controlled crosses are not feasible. If we are to expand our understanding of the role of regulatory mutations on phenotypes, we need to develop new methodologies to study species under ecologically relevant conditions. In this issue of Molecular Ecology, Verta et al. (2013) present a new approach to analyse gene expression variation and regulatory networks in gymnosperms (Fig. 1b). They capitalized on the fact that gymnosperm seeds contain an energy storage tissue (the megagametophyte) that is directly derived from a single haploid cell (the megaspore). The authors identified over 800 genes for which expression segregated in this maternally inherited haploid tissue. Based on the observed segregation patterns, these genes (Mendelian Expression Traits) are most probably controlled by biallelic variants at a single locus. Most of these genes also belonged to different regulatory networks, except for one large group of 180 genes under the control of a putative trans-acting factor. In addition, the approach developed here may also help to uncover the effect of rare recessive mutations, which usually remain hidden in a heterozygous state in diploid individuals. The appeal of the work by Verta et al. (2013) to study gene expression variation is in its simplicity, which circumvents several of the hurdles behind traditional expression quantitative trait locus (eQTL) studies, and could potentially be applied to a large number of species.

  7. Consequences of intraspecific niche variation: phenotypic similarity increases competition among recently metamorphosed frogs.

    Science.gov (United States)

    Benard, Michael F; Middlemis Maher, Jessica

    2011-07-01

    Phenotype is often correlated with resource use, which suggests that as phenotypic variation in a population increases, intraspecific competition will decrease. However, few studies have experimentally tested the prediction that increased intraspecific phenotypic variation leads to reduced competitive effects (e.g., on growth rate, survival or reproductive rate). We investigated this prediction with two experiments on wood frogs (Rana sylvatica). In the first experiment, we found that a frog's size was positively correlated with the size of its preferred prey, indicating that the feeding niche of the frogs changed with size. In the second experiment, we used an experimental design in which we held the initial mass of "focal" frogs constant, but varied the initial mass of their competitors. We found a significant quadratic effect of the average mass of competitors: focal frog growth was lowest when raised with similar-sized competitors, and highest when raised with competitors that were larger or smaller. Our results demonstrate that growth rates increase (i.e., competitive intensity decreases) when individuals are less similar to other members of the population and exhibit less overlap in resource use. Thus, changes in the amount of phenotypic variation in a population may ultimately affect population-level processes, such as population growth rate and extinction risk.

  8. Allelic variation in the NPY gene in 14 Indian populations.

    Science.gov (United States)

    Bhaskar, L V K S; Thangaraj, K; Shah, Anish M; Pardhasaradhi, G; Praveen Kumar, K; Reddy, A G; Papa Rao, A; Mulligan, C J; Singh, Lalji; Rao, V R

    2007-01-01

    NPY is a 36-aminoacid peptide expressed in several areas of the nervous system. Neuropeptide Y (NPY) receptors represent a widely diffused system that is involved in the regulation of multiple biological functions. The human NPY gene is located in chromosome 7. The functional significance of coding Leu7Pro polymorphism in the signal peptide of preproNPY is known. Six hundred and fifty four individuals of 14 ethnic Indian populations were screened for three mutations in the NPY gene, including Leu7Pro. We found that the Pro7 frequencies among the studied populations were much higher than in previous studies from other parts of the world. The highest allele frequency of Pro7 was detected in the Kota population in the Nilgiri Hill region of south India, and this may reflect a founder event in the past or genetic drift. All populations followed the Hardy-Weinberg equilibrium for the assayed markers. A total of five haplotypes were observed, only two of which were found to occur with a high frequency in all populations. No linkage disequilibrium (LD) was observed across the tested alleles in any population with the exception of Leu7Pro and Ser50Ser in the Badaga population (chi(2) = 13.969; p = 0.0001).

  9. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Valeria Paula Carreira

    Full Text Available Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may

  10. Clinical associations of host genetic variations in the genes of cytokines in critically ill patients.

    Science.gov (United States)

    Belopolskaya, O B; Smelaya, T V; Moroz, V V; Golubev, A M; Salnikova, L E

    2015-06-01

    Host genetic variations may influence a changing profile of biochemical markers and outcome in patients with trauma/injury. The objective of this study was to assess clinical associations of single nucleotide polymorphisms (SNPs) in the genes of cytokines in critically ill patients. A total of 430 patients were genotyped for SNPs in the genes of pro- (IL1B, IL6, IL8) and anti-inflammatory (IL4, IL10, IL13) cytokines. The main end-points were sepsis, mortality and adult respiratory distress syndrome (ARDS). We evaluated the dynamic levels of bilirubin, blood urea nitrogen, creatine kinase, creatinine and lactate dehydrogenase in five points of measurements (between 1 and 14 days after admission) and correlated them with SNPs. High-producing alleles of proinflammatory cytokines protected patients against sepsis (IL1B -511A and IL8 -251A) and mortality (IL1B -511A). High-producing alleles of anti-inflammatory cytokines IL4 -589T and IL13 431A (144Gln) were less frequent in ARDS patients. The carriers of IL6 -174C/C genotypes were prone to the increased levels of biochemical markers and acute kidney and liver insufficiency. Genotype-dependent differences in the levels of biochemical indicators gradually increased to a maximal value on the 14th day after admission. These findings suggest that genetic variability in pro- and anti-inflammatory cytokines may contribute to different clinical phenotypes in patients at high risk of critical illness.

  11. Antisense expression increases gene expression variability and locus interdependency

    OpenAIRE

    Xu, Zhenyu; Wei, Wu; Gagneur, Julien; Clauder-Münster, Sandra; Smolik, Miłosz; Huber, Wolfgang; Steinmetz, Lars M.

    2011-01-01

    Genome-wide transcription profiling has revealed extensive expression of non-coding RNAs antisense to genes, yet their functions, if any, remain to be understood. In this study, we perform a systematic analysis of sense–antisense expression in response to genetic and environmental changes in yeast. We find that antisense expression is associated with genes of larger expression variability. This is characterized by more ‘switching off' at low levels of expression for genes with antisense compa...

  12. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2012-06-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is transformed via the didactic transposition into school science textbooks. The results indicate that a common textbook discourse on genes and their function exist in textbooks from the different countries. The structure of science as represented by conceptual variation and the use of multiple models was present in all the textbooks. However, the existence of conceptual variation and multiple models is implicit in these textbooks, i.e., the phenomenon of conceptual variation and multiple models are not addressed explicitly, nor its consequences and, thus, it ends up introducing conceptual incoherence about the gene concept and its function within the textbooks. We conclude that within the found textbook-discourse ontological aspects of the academic disciplines of genetics and molecular biology were retained, but without their epistemological underpinnings; these are lost in the didactic transposition. These results are of interest since students might have problems reconstructing the correct scientific understanding from the transformed school science knowledge as depicted within the high school textbooks. Implications for textbook writing as well as teaching are discussed in the paper.

  13. Degranulation of rat cerebellum induces selective variations in gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Eliyahu, D.; Soreq, H.

    1982-02-01

    Selective variations in the composition of poly(A)-containing mRNA were found to be induced in the rat cerebellum by X-irradiation. mRNA populations prepared from normal and X-irradiated rat cerebella at different stages of their development displayed equal efficiencies when translated in vitro in reticulocyte lysates. Specific differences were revealed, however, when the labeled translation products of both mRNA preparations were subjected to two-dimensional gel electrophoresis followed by fluorography of the dried gels. Of more than 100 polypeptide products, several showed marked intensity differences, indicating changes in the abundance of their directing mRNA species. These differences appear both in developing and in mature cerebellar mRNA, and the extent of modification in mRNA is much higher than the consequent changes in the composition of proteins in the irradiated cerebellum. The degranulation-induced modifications in levels of specific cerebellar mRNA species can be used to identify proteins whose biosynthesis depends on the presence of interneurons.

  14. Gene Silencing and Antigenic Variation in Malaria Parasites

    Directory of Open Access Journals (Sweden)

    Kirk W. Deitsch

    2001-01-01

    Full Text Available Malaria remains one of the most important infectious diseases in the world today, infecting 300 to 500 million people yearly and resulting in 1 to 2 million deaths, primarily of young African children[1]. The most severe form of this disease is caused by infection with the mosquito borne protozoan parasite Plasmodium falciparum. This parasite lives by invading and multiplying within the red blood cells of its host, causing disease through anemia resulting from red cell destruction, and also through modifications made to the surface of infected red cells. These modifications make infected cells cytoadherent or “sticky”, allowing them to adhere to the walls of blood vessels, leading to obstruction of blood flow and such clinical manifestations as the often fatal syndrome of cerebral malaria[2]. In addition, parasites are capable of undergoing antigenic variation, a process of continually changing the identity of proteins on the surface of infected cells and thus avoiding the immune response mounted by the host[3]. This process promotes a long term, persistent infection that is difficult to clear.

  15. Promoting Increased Pitch Variation in Oral Presentations with Transient Visual Feedback

    Directory of Open Access Journals (Sweden)

    Rebecca Hincks

    2009-10-01

    Full Text Available This paper investigates learner response to a novel kind of intonation feedback generated from speech analysis. Instead of displays of pitch curves, our feedback is flashing lights that show how much pitch variation the speaker has produced. The variable used to generate the feedback is the standard deviation of fundamental frequency as measured in semitones. Flat speech causes the system to show yellow lights, while more expressive speech that has used pitch to give focus to any part of an utterance generates green lights. Participants in the study were 14 Chinese students of English at intermediate and advanced levels. A group that received visual feedback was compared with a group that received audio feedback. Pitch variation was measured at four stages: in a baseline oral presentation; for the first and second halves of three hours of training; and finally in the production of a new oral presentation. Both groups increased their pitch variation with training, and the effect lasted after the training had ended. The test group showed a significantly higher increase than the control group, indicating that the feedback is effective. These positive results imply that the feedback could be beneficially used in a system for practicing oral presentations.

  16. Telomere length and variation in telomere biology genes in individuals with osteosarcoma.

    Science.gov (United States)

    Mirabello, Lisa; Richards, Elliott G; Duong, Linh M; Yu, Kai; Wang, Zhaoming; Cawthon, Richard; Berndt, Sonja I; Burdett, Laurie; Chowdhury, Salma; Teshome, Kedest; Douglass, Chester; Savage, Sharon A

    2011-01-01

    Osteosarcoma, the most common primary bone tumor, occurs most frequently in adolescents. Chromosomal aneuploidy is common in osteosarcoma cells, suggesting underlying chromosomal instability. Telomeres, located at chromosome ends, are essential for genomic stability; several studies have suggested that germline telomere length (TL) is associated with cancer risk. We hypothesized that TL and/or common genetic variation in telomere biology genes may be associated with risk of osteosarcoma. We investigated TL in peripheral blood DNA and 713 single nucleotide polymorphisms (SNPs) from 39 telomere biology genes in 98 osteosarcoma cases and 69 orthopedic controls. For the genotyping component, we added 1363 controls from the Prostate, Lung, Colorectal, and Ovarian Cancer ScreeningTrial. Short TL was not associated with osteosarcoma risk overall (OR 1.39, P=0.67), although there was a statistically significant association in females (OR 4.35, 95% Cl 1.20-15.74, P=0.03). Genotype analyses identified seven SNPs in TERF1 significantly associated with osteosarcoma risk after Bonferroni correction by gene. These SNPs were highly linked and associated with a reduced risk of osteosarcoma (OR 0.48-0.53, P=0.0001-0.0006). We also investigated associations between TL and telomere gene SNPs in osteosarcoma cases and orthopedic controls. Several SNPs were associated with TL prior to Bonferroni correction; one SNP in NOLA2 and one in MEN1 were marginally non-significant after correction (P(adj)=0.057 and 0.066, respectively). This pilot-study suggests that females with short telomeres may be at increased risk of osteosarcoma, and that SNPs in TERF1 are inversely associated with osteosarcoma risk.

  17. Genetic variation in the epidermal transglutaminase genes is not associated with atopic dermatitis.

    Directory of Open Access Journals (Sweden)

    Agne Liedén

    Full Text Available BACKGROUND: Atopic dermatitis (AD is a common chronic inflammatory skin disorder where epidermal barrier dysfunction is a major factor in the pathogenesis. The identification of AD susceptibility genes related to barrier dysfunction is therefore of importance. The epidermal transglutaminases (TGM1, TGM3 and TGM5 encodes essential cross-linking enzymes in the epidermis. OBJECTIVE: To determine whether genetic variability in the epidermal transglutaminases contributes to AD susceptibility. METHODS: Forty-seven single nucleotide polymorphisms (SNPs in the TGM1, TGM3 and TGM5 gene region were tested for genetic association with AD, independently and in relation to FLG genotype, using a pedigree disequilibrium test (PDT in a Swedish material consisting of 1753 individuals from 539 families. In addition, a German case-control material, consisting of 533 AD cases and 1996 controls, was used for in silico analysis of the epidermal TGM regions. Gene expression of the TGM1, TGM3 and TGM5 gene was investigated by relative quantification with Real Time PCR (qRT-PCR. Immunohistochemical (IHC analysis was performed to detect TG1, TG3 and TG5 protein expression in the skin of patients and healthy controls. RESULTS: PDT analysis identified a significant association between the TGM1 SNP rs941505 and AD with allergen-specific IgE in the Swedish AD family material. However, the association was not replicated in the German case-control material. No significant association was detected for analyzed SNPs in relation to FLG genotype. TG1, TG3 and TG5 protein expression was detected in AD skin and a significantly increased TGM3 mRNA expression was observed in lesional skin by qRT-PCR. CONCLUSION: Although TGM1 and TGM3 may be differentially expressed in AD skin, the results from the genetic analysis suggest that genetic variation in the epidermal transglutaminases is not an important factor in AD susceptibility.

  18. Variation in fibrinogen FGG and FGA genes and risk of stroke: the Rotterdam Study.

    Science.gov (United States)

    Cheung, Elim Y L; Bos, Michiel J; Leebeek, Frank W G; Koudstaal, Peter J; Hofman, Albert; de Maat, Moniek P M; Breteler, Monique M B

    2008-08-01

    Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

  19. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  20. Genetic and epigenetic variation in the DNMT3B and MTHFR genes and colorectal adenoma risk.

    Science.gov (United States)

    Ho, Vikki; Ashbury, Janet E; Taylor, Sherryl; Vanner, Stephen; King, Will D

    2016-05-01

    Polymorphisms in DNMT3B and MTHFR have been implicated in cancer etiology; however, it is increasingly clear that gene-specific DNA methylation also affects gene expression. A cross-sectional study (N = 272) investigated the main and joint effects of polymorphisms and DNA methylation in DNMT3B and MTHFR on colorectal adenoma risk. Polymorphisms examined included DNMT3B c.-6-1045G > T, and MTHFR c.665C > T and c.1286A > C. DNA methylation of 66 and 28 CpG sites in DNMT3B and MTHFR, respectively, was quantified in blood leukocytes using Sequenom EpiTYPER®. DNA methylation was conceptualized using two approaches: (1) average methylation and (2) unsupervised principal component analysis to identify variables that represented methylation around the transcription start site and the gene coding area of both genes. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) associated with the main and joint effects of polymorphisms and DNA methylation. DNA methyltransferase 3B (DNMT3B) TT versus GG/GT genotypes was associated with increased colorectal adenoma risk (OR = 2.12; 95% CI: 1.03-4.34). In addition, increasing DNA methylation in the gene-coding area of DNMT3B was associated with higher risk of colorectal adenomas (OR = 1.34; 95% CI: 1.01-1.79 per SD). In joint effect analyses, synergistic effects were observed among those with both the DNMT3B TT genotype and higher DNMT3B methylation levels compared to those with GT/GG genotypes and lower methylation levels (OR = 4.19; 95% CI: 1.45-12.13 for average methylation; OR = 4.26; 95%CI: 1.31-13.87 for methylation in the transcription start site). This research provides novel evidence that genetic and epigenetic variations contribute to colorectal adenoma risk, precursor to the majority of colorectal cancer (CRC).

  1. Genetic variation in V gene of class II Newcastle disease virus.

    Science.gov (United States)

    Hao, Huafang; Chen, Shengli; Liu, Peng; Ren, Shanhui; Gao, Xiaolong; Wang, Yanping; Wang, Xinglong; Zhang, Shuxia; Yang, Zengqi

    2016-01-01

    The genetic variation and molecular evolution of the V gene of the class II Newcastle disease virus (NDV) isolates with genotypes I-XVIII were determined using bioinformatics. Results indicated that low homology existed in different genotype viruses, whereas high homology often for the same genotypes, exception may be existed within genotypes I, V, VI, and XII. Sequence analysis showed that the genetic variation of V protein was consistent with virus genotype, and specific signatures on the V protein for nine genotypes were identified. Phylogenetic analysis demonstrated that the phylogenetic trees were highly consistent between the V and F genes, with slight discrepancies in the sub-genotypes. Evolutionary rate analyses based on V and F genes revealed the evolution rates varied in genotypes. These data indicate that the genetic variation of V protein is genotype-related and will help in elucidating the molecular evolution of NDV.

  2. Genetic variation within the TRPM5 locus associates with prediabetic phenotypes in subjects at increased risk for type 2 diabetes

    DEFF Research Database (Denmark)

    Ketterer, Caroline; Müssig, Karsten; Heni, Martin;

    2011-01-01

    glucagon-like peptide-1 levels at 30 minutes during the OGTT compared with major allele homozygotes (P = .0124), whereas in male subjects, no significant differences were found (P = .3). In our German population, the common TRPM5 variants are likely to be associated with prediabetic phenotypes......The functional knockout of the calcium-sensitive, nonselective cation channel TRPM5 alters glucose-induced insulin secretion and glucose tolerance. We hypothesized that genetic variation in the TRPM5 gene may contribute to prediabetic phenotypes, including pancreatic ß-cell dysfunction. We...... genotyped 1798 white subjects at increased type 2 diabetes mellitus risk for 9 TRPM5 single nucleotide polymorphisms (namely, rs2301696, rs800344, rs800345, rs800347, rs800348, rs2074234, rs2301698, rs886277, and rs2301699) and also performed correlational analyses with metabolic traits. An oral glucose...

  3. Natural variations in expression of regulatory and detoxification related genes under limiting phosphate and arsenate stress in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Tapsi eShukla

    2015-10-01

    Full Text Available Abiotic stress including nutrient deficiency and heavy metal toxicity severely affects plant growth, development, and productivity. Genetic variations within and in between species are one of the important factors in establishing interactions and responses of plants with the environment. In the recent past, natural variations in Arabidopsis thaliana have been used to understand plant development and response towards different stresses at genetic level. Phosphorus (Pi deficiency negatively affects plant growth and metabolism and modulates expression of the genes involved in Pi homeostasis. Arsenate, As(V, a chemical analogue of Pi, is taken up by the plants via phosphate transport system. Studies suggest that during Pi deficiency, enhanced As(V uptake leads to increased toxicity in plants. Here, the natural variations in Arabidopsis have been utilized to study the As(V stress response under limiting Pi condition. The primary root length was compared to identify differential response of three Arabidopsis accessions (Col-0, Sij-1 and Slavi-1 under limiting Pi and As(V stress. To study the molecular mechanisms responsible for the differential response, comprehensive expression profiling of the genes involved in uptake, detoxification and regulatory mechanisms was carried out. Analysis suggests genetic variation-dependent regulatory mechanisms may affect differential response of Arabidopsis natural variants towards As(V stress under limiting Pi condition. Therefore, it is hypothesized that detailed analysis of the natural variations under multiple stress conditions might help in the better understanding of the biological processes involved in stress tolerance and adaptation.

  4. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency.

    Directory of Open Access Journals (Sweden)

    Xiumei Zhen

    Full Text Available Primary ovarian insufficiency (POI, also known as premature ovarian failure (POF, is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH levels (at least 1 month apart falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63 and age-matched healthy female controls (n=63 using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1 missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042. Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI.

  5. Variation in Maturity-Onset Diabetes of the Young Genes Influence Response to Interventions for Diabetes Prevention.

    Science.gov (United States)

    Billings, Liana K; Jablonski, Kathleen A; Warner, A Sofia; Cheng, Yu-Chien; McAteer, Jarred B; Tipton, Laura; Shuldiner, Alan R; Ehrmann, David A; Manning, Alisa K; Dabelea, Dana; Franks, Paul W; Kahn, Steven E; Pollin, Toni I; Knowler, William C; Altshuler, David; Florez, Jose C

    2017-08-01

    Variation in genes that cause maturity-onset diabetes of the young (MODY) has been associated with diabetes incidence and glycemic traits. This study aimed to determine whether genetic variation in MODY genes leads to differential responses to insulin-sensitizing interventions. This was a secondary analysis of a multicenter, randomized clinical trial, the Diabetes Prevention Program (DPP), involving 27 US academic institutions. We genotyped 22 missense and 221 common variants in the MODY-causing genes in the participants in the DPP. The study included 2806 genotyped DPP participants randomized to receive intensive lifestyle intervention (n = 935), metformin (n = 927), or placebo (n = 944). Association of MODY genetic variants with diabetes incidence at a median of 3 years and measures of 1-year β-cell function, insulinogenic index, and oral disposition index. Analyses were stratified by treatment group for significant single-nucleotide polymorphism × treatment interaction (Pint < 0.05). Sequence kernel association tests examined the association between an aggregate of rare missense variants and insulinogenic traits. After 1 year, the minor allele of rs3212185 (HNF4A) was associated with improved β-cell function in the metformin and lifestyle groups but not the placebo group; the minor allele of rs6719578 (NEUROD1) was associated with an increase in insulin secretion in the metformin group but not in the placebo and lifestyle groups. These results provide evidence that genetic variation among MODY genes may influence response to insulin-sensitizing interventions.

  6. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.

    2002-01-01

    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  7. Temperature increase prevails over acidification in gene expression modulation of amastigote differentiation in Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Larraga Vicente

    2010-01-01

    Full Text Available Abstract Background The extracellular promastigote and the intracellular amastigote stages alternate in the digenetic life cycle of the trypanosomatid parasite Leishmania. Amastigotes develop inside parasitophorous vacuoles of mammalian phagocytes, where they tolerate extreme environmental conditions. Temperature increase and pH decrease are crucial factors in the multifactorial differentiation process of promastigotes to amastigotes. Although expression profiling approaches for axenic, cell culture- and lesion-derived amastigotes have already been reported, the specific influence of temperature increase and acidification of the environment on developmental regulation of genes has not been previously studied. For the first time, we have used custom L. infantum genomic DNA microarrays to compare the isolated and the combined effects of both factors on the transcriptome. Results Immunofluorescence analysis of promastigote-specific glycoprotein gp46 and expression modulation analysis of the amastigote-specific A2 gene have revealed that concomitant exposure to temperature increase and acidification leads to amastigote-like forms. The temperature-induced gene expression profile in the absence of pH variation resembles the profile obtained under combined exposure to both factors unlike that obtained for exposure to acidification alone. In fact, the subsequent fold change-based global iterative hierarchical clustering analysis supports these findings. Conclusions The specific influence of temperature and pH on the differential regulation of genes described in this study and the evidence provided by clustering analysis is consistent with the predominant role of temperature increase over extracellular pH decrease in the amastigote differentiation process, which provides new insights into Leishmania physiology.

  8. Performance and microbial community variations of anaerobic digesters under increasing tetracycline concentrations

    KAUST Repository

    Xiong, Yanghui

    2017-04-01

    The impact of different concentrations of tetracycline on the performance of anaerobic treatment was evaluated. Results revealed that for all of the tested tetracycline concentrations, no major sustained impact on methane production was observed. Instead, a significant increase in propionic acid was observed in the reactor subjected to the highest concentration of tetracycline (20 mg/L). Microbial community analyses suggest that an alternative methanogenic pathway, specifically that of methanol-utilizing methanogens, may be important for ensuring the stability of methane production in the presence of high tetracycline concentrations. In addition, the accumulation of propionate was due to an increase in volatile fatty acids (VFA)-producing bacteria coupled with a reduction in propionate utilizers. An increase in the abundance of tetracycline resistance genes associated with ribosomal protection proteins was observed after 30 days of exposure to high concentrations of tetracycline, while other targeted resistance genes showed no significant changes. These findings suggest that anaerobic treatment processes can robustly treat wastewater with varying concentrations of antibiotics while also deriving value-added products and minimizing the dissemination of associated antibiotic resistance genes.

  9. NMDA receptor gene variations as modifiers in Huntington disease: a replication study

    OpenAIRE

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN2A and GRIN2B in the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). The analyses did replicate the association reported between the GRIN2A rs2650427 variation and AO in the ...

  10. Genetic variation in telomere maintenance genes in relation to ovarian cancer survival.

    Science.gov (United States)

    Harris, Holly R; Vivo, Immaculata De; Titus, Linda J; Vitonis, Allison F; Wong, Jason Y Y; Cramer, Daniel W; Terry, Kathryn L

    2012-01-01

    Telomeres are repetitive non-coding DNA sequences at the ends of chromosomes that provide protection against chromosomal instability. Telomere length and stability are influenced by proteins, including telomerase which is partially encoded by the TERT gene. Genetic variation in the TERT gene is associated with ovarian cancer risk, and predicts survival in lung cancer and glioma. We investigated whether genetic variation in five telomere maintenance genes was associated with survival among 1480 cases of invasive epithelial ovarian cancer in the population-based New England Case-Control Study. Cox proportional hazard models were used to calculate hazard ratios and 95% confidence intervals. Overall we observed no significant associations between SNPs in telomere maintenance genes and mortality using a significance threshold of p=0.001. However, we observed some suggestive associations in subgroup analyses. Future studies with larger populations may further our understanding of what role telomeres play in ovarian cancer survival.

  11. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  12. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Directory of Open Access Journals (Sweden)

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  13. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Science.gov (United States)

    Porto-Neto, Laercio R.; Fortes, Marina R. S.; McWilliam, Sean M.; Lehnert, Sigrid A.; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10−5). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  14. Copy number variation of KIR genes influences HIV-1 control

    DEFF Research Database (Denmark)

    Pelak, Kimberly; Need, Anna C; Fellay, Jacques;

    2011-01-01

    A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses...... the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3......DS1 count associates with a lower viral set point if its putative ligand is present (p = 0.00028), as does an increase in KIR3DL1 count in the presence of KIR3DS1 and appropriate ligands for both receptors (p = 0.0015). We further provide functional data that demonstrate that NK cells from...

  15. Variation.

    Science.gov (United States)

    Hamilton City Board of Education (Ontario).

    Suggestions for studying the topic of variation of individuals and objects (balls) to help develop elementary school students' measurement, comparison, classification, evaluation, and data collection and recording skills are made. General suggestions of variables that can be investigated are made for the study of human variation. Twelve specific…

  16. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  17. Detection, Validation, and Downstream Analysis of Allelic Variation in Gene Expression

    Science.gov (United States)

    Ciobanu, Daniel C.; Lu, Lu; Mozhui, Khyobeni; Wang, Xusheng; Jagalur, Manjunatha; Morris, John A.; Taylor, William L.; Dietz, Klaus; Simon, Perikles; Williams, Robert W.

    2010-01-01

    Common sequence variants within a gene often generate important differences in expression of corresponding mRNAs. This high level of local (allelic) control—or cis modulation—rivals that produced by gene targeting, but expression is titrated finely over a range of levels. We are interested in exploiting this allelic variation to study gene function and downstream consequences of differences in expression dosage. We have used several bioinformatics and molecular approaches to estimate error rates in the discovery of cis modulation and to analyze some of the biological and technical confounds that contribute to the variation in gene expression profiling. Our analysis of SNPs and alternative transcripts, combined with eQTL maps and selective gene resequencing, revealed that between 17 and 25% of apparent cis modulation is caused by SNPs that overlap probes rather than by genuine quantitative differences in mRNA levels. This estimate climbs to 40–50% when qualitative differences between isoform variants are included. We have developed an analytical approach to filter differences in expression and improve the yield of genuine cis-modulated transcripts to ∼80%. This improvement is important because the resulting variation can be successfully used to study downstream consequences of altered expression on higher-order phenotypes. Using a systems genetics approach we show that two validated cis-modulated genes, Stk25 and Rasd2, are likely to control expression of downstream targets and affect disease susceptibility. PMID:19884314

  18. Copy number variation of KIR genes influences HIV-1 control

    DEFF Research Database (Denmark)

    Pelak, Kimberly; Need, Anna C; Fellay, Jacques

    2011-01-01

    A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses...... the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3...... individuals with multiple copies of KIR3DL1, in the presence of KIR3DS1 and the appropriate ligands, inhibit HIV-1 replication more robustly, and associated with a significant expansion in the frequency of KIR3DS1+, but not KIR3DL1+, NK cells in their peripheral blood. Our results suggest that the relative...

  19. Increasing the complexity: new genes and new types of albinism.

    Science.gov (United States)

    Montoliu, Lluís; Grønskov, Karen; Wei, Ai-Hua; Martínez-García, Mónica; Fernández, Almudena; Arveiler, Benoît; Morice-Picard, Fanny; Riazuddin, Saima; Suzuki, Tamio; Ahmed, Zubair M; Rosenberg, Thomas; Li, Wei

    2014-01-01

    Albinism is a rare genetic condition globally characterized by a number of specific deficits in the visual system, resulting in poor vision, in association with a variable hypopigmentation phenotype. This lack or reduction in pigment might affect the eyes, skin, and hair (oculocutaneous albinism, OCA), or only the eyes (ocular albinism, OA). In addition, there are several syndromic forms of albinism (e.g. Hermansky-Pudlak and Chediak-Higashi syndromes, HPS and CHS, respectively) in which the described hypopigmented and visual phenotypes coexist with more severe pathological alterations. Recently, a locus has been mapped to the 4q24 human chromosomal region and thus represents an additional genetic cause of OCA, termed OCA5, while the gene is eventually identified. In addition, two new genes have been identified as causing OCA when mutated: SLC24A5 and C10orf11, and hence designated as OCA6 and OCA7, respectively. This consensus review, involving all laboratories that have reported these new genes, aims to update and agree upon the current gene nomenclature and types of albinism, while providing additional insights from the function of these new genes in pigment cells.

  20. Increased apomixis expression concurrent with genetic and epigenetic variation in a newly synthesized Eragrostis curvula polyploid

    Science.gov (United States)

    Zappacosta, Diego C.; Ochogavía, Ana C.; Rodrigo, Juan M.; Romero, José R.; Meier, Mauro S.; Garbus, Ingrid; Pessino, Silvina C.; Echenique, Viviana C.

    2014-04-01

    Eragrostis curvula includes biotypes reproducing through obligate and facultative apomixis or, rarely, full sexuality. We previously generated a ``tetraploid-dihaploid-tetraploid'' series of plants consisting of a tetraploid apomictic plant (T), a sexual dihaploid plant (D) and a tetraploid artificial colchiploid (C). Initially, plant C was nearly 100% sexual. However, its capacity to form non-reduced embryo sacs dramatically increased over a four year period (2003-2007) to reach levels of 85-90%. Here, we confirmed high rates of apomixis in plant C, and used AFLPs and MSAPs to characterize the genetic and epigenetic variation observed in this plant in 2007 as compared to 2003. Of the polymorphic sequences, some had no coding potential whereas others were homologous to retrotransposons and/or protein-coding-like sequences. Our results suggest that in this particular plant system increased apomixis expression is concurrent with genetic and epigenetic modifications, possibly involving transposable elements.

  1. Structural variation of the ribosomal gene cluster within the class Insecta

    Energy Technology Data Exchange (ETDEWEB)

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V. [Vavilov Institute of General Genetics, Moscow (Russian Federation)] [and others

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  2. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Directory of Open Access Journals (Sweden)

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  3. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  4. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    DEFF Research Database (Denmark)

    Song, H.; Hogdall, E.; Ramus, S.J.

    2008-01-01

    PURPOSE: Somatic alterations have been shown to correlate with ovarian cancer prognosis and survival, but less is known about the effects on survival of common inherited genetic variation. Of particular interest are genes involved in cell cycle pathways, which regulate cell division and could pla...

  5. Melanopsin gene variations interact with season to predict sleep onset and chronotype.

    Science.gov (United States)

    Roecklein, Kathryn A; Wong, Patricia M; Franzen, Peter L; Hasler, Brant P; Wood-Vasey, W Michael; Nimgaonkar, Vishwajit L; Miller, Megan A; Kepreos, Kyle M; Ferrell, Robert E; Manuck, Stephen B

    2012-10-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30-54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p sleep onset among those with the TT genotype was later in the day when individuals were assessed on longer days and earlier in the day on shorter days, whereas individuals in the other genotype groups (i.e., CC and CT) did not show this interaction effect. P10L genotype also interacted in an analogous way with daylength to predict self-reported morningness (interaction p sleep onset and chronotype as a function of daylength, whereas other genotypes at P10L do not seem to have effects that vary by daylength. A better understanding of how melanopsin confers heightened responsivity to daylength may improve our understanding of a broad range of

  6. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Directory of Open Access Journals (Sweden)

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  7. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Science.gov (United States)

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  8. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    Directory of Open Access Journals (Sweden)

    Ryden Tobias

    2010-10-01

    Full Text Available Abstract Background Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. Results The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. Conclusions We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html.

  9. Gene expression profiles deciphering leaf senescence variation between early- and late-senescence cotton lines.

    Directory of Open Access Journals (Sweden)

    Xiangqiang Kong

    Full Text Available Leaf senescence varies greatly among genotypes of cotton (Gossypium hirsutium L, possibly due to the different expression of senescence-related genes. To determine genes involved in leaf senescence, we performed genome-wide transcriptional profiling of the main-stem leaves of an early- (K1 and a late-senescence (K2 cotton line at 110 day after planting (DAP using the Solexa technology. The profiling analysis indicated that 1132 genes were up-regulated and 455 genes down-regulated in K1 compared with K2 at 110 DAP. The Solexa data were highly consistent with, and thus were validated by those from real-time quantitative PCR (RT-PCR. Most of the genes related to photosynthesis, anabolism of carbohydrates and other biomolecules were down-regulated, but those for catabolism of proteins, nucleic acids, lipids and nutrient recycling were mostly up-regulated in K1 compared with K2. Fifty-one differently expressed hormone-related genes were identified, of which 5 ethylene, 3 brassinosteroid (BR, 5 JA, 18 auxin, 8 GA and 1 ABA related genes were up-regulated in K1 compared with K2, indicating that these hormone-related genes might play crucial roles in early senescence of K1 leaves. Many differently expressed transcription factor (TF genes were identified and 11 NAC and 8 WRKY TF genes were up-regulated in K1 compared with K2, suggesting that TF genes, especially NAC and WRKY genes were involved in early senescence of K1 leaves. Genotypic variation in leaf senescence was attributed to differently expressed genes, particularly hormone-related and TF genes.

  10. Variation in gene expression patterns in effusions and primary tumors from serous ovarian cancer patients

    Directory of Open Access Journals (Sweden)

    Tropè Claes G

    2005-07-01

    Full Text Available Abstract Background While numerous studies have characterized primary ovarian tumors, little information is available regarding expression patterns of metastatic sites of this cancer. To define sets of genes that distinguish primary and metastatic ovarian tumors, we used cDNA microarrays to characterize global gene expression patterns in 38 effusions (28 peritoneal, 10 pleural and 8 corresponding primary ovarian tumors, and searched for associations between expression patterns and clinical parameters. Results We observed multidimensional variation in expression patterns among the cancers. Coordinate variation in expression of genes from two chromosomal regions, 8q and 19q, was seen in subsets of the cancers indicating possible amplifications in these regions. A set of 112 unique genes of known function was differentially expressed between primary tumors and effusions using supervised analysis. Relatively few differences were seen between effusions isolated from the pleural and peritoneal cavities or between effusions from patients diagnosed with stage III and stage IV cancers. A set of 84 unique genes was identified that distinguished high from lower grade ovarian cancers. The results were corroborated using immunocytochemistry, mRNA in situ hybridization, and immunoblotting. Conclusion The extensive variation in expression patterns observed underscores the molecular heterogeneity of ovarian cancer, but suggests a similar molecular profile for ovarian carcinoma cells in serosal cavities.

  11. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  12. Role of monochromatic light on daily variation of clock gene expression in the pineal gland of chick.

    Science.gov (United States)

    Jiang, Nan; Wang, Zixu; Cao, Jing; Dong, Yulan; Chen, Yaoxing

    2016-11-01

    The avian pineal gland is a master clock that can receive external photic cues and translate them into output rhythms. To clarify whether a shift in light wavelength can influence the circadian expression in chick pineal gland, a total of 240 Arbor Acre male broilers were exposed to white light (WL), red light (RL), green light (GL) or blue light (BL). After 2weeks light illumination, circadian expressions of seven core clock genes in pineal gland and the level of melatonin in plasma were examined. The results showed after illumination with monochromatic light, 24h profiles of all clock gene mRNAs retained circadian oscillation, except that RL tended to disrupt the rhythm of cCry2. Compared to WL, BL advanced the acrophases of the negative elements (cCry1, cCry2, cPer2 and cPer3) by 0.1-1.5h and delayed those of positive elements (cClock, cBmal1 and cBmal2) by 0.2-0.8h. And, RL advanced all clock genes except cClock and cPer2 by 0.3-2.1h, while GL delayed all clock genes by 0.5-1.5h except cBmal2. Meanwhile, GL increased the amplitude and mesor of positive and reduced both parameters of negative clock genes, but RL showed the opposite pattern. Although the acrophase of plasma melatonin was advanced by both GL and RL, the melatonin level was significantly increased in GL and decreased in RL. This tendency was consistent with the variations in the positive clock gene mRNA levels under monochromatic light and contrasted with those of negative clock genes. Therefore, we speculate that GL may enhance positive clock genes expression, leading to melatonin synthesis, whereas RL may enhance negative genes expression, suppressing melatonin synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Environmental fluctuations do not select for increased variation or population-based resistance in Escherichia coli

    Indian Academy of Sciences (India)

    Shraddha Madhav Karve; Kanishka Tiwary; S Selveshwari; Sutirth Dey

    2016-03-01

    Little is known about the mechanisms that enable organisms to cope with unpredictable environments. To address this issue, we used replicate populations of Escherichia coli selected under complex, randomly changing environments. Under four novel stresses that had no known correlation with the selection environments, individual cells of the selected populations had significantly lower lag and greater yield compared to the controls. More importantly, there were no outliers in terms of growth, thus ruling out the evolution of population-based resistance. We also assayed the standing phenotypic variation of the selected populations, in terms of their growth on 94 different substrates. Contrary to expectations, there was no increase in the standing variation of the selected populations, nor was there any significant divergence from the ancestors. This suggested that the greater fitness in novel environments is brought about by selection at the level of the individuals, which restricts the suite of traits that can potentially evolve through this mechanism. Given that day-to-day climatic variability of the world is rising, these results have potential public health implications. Our results also underline the need for a very different kind of theoretical approach to study the effects of fluctuating environments.

  14. Poly(T) variation within mitochondrial protein-coding genes in Globodera (Nematoda: Heteroderidae).

    Science.gov (United States)

    Riepsamen, Angelique H; Blok, Vivian C; Phillips, Mark; Gibson, Tracey; Dowton, Mark

    2008-03-01

    We sequenced a mitochondrial subgenome from the nematode Globodera rostochiensis, in two overlapping pieces. The subgenome was 9210 bp and contained four protein-coding genes (ND4, COIII, ND3, Cytb) and two tRNA genes (tRNA(Thr), tRNA(Gln)). Genome organization was similar to that of Globodera pallida, which is multipartite. Together with the small number of genes on this subgenome, this suggests that the mitochondrial genome of G. rostochiensis is also multipartite. In the initial clones sequenced, COIII and ND3 were full-length, while ND4 and Cytb were interrupted by premature stop codons and contained point indels that disrupted the reading frame. However, sequencing of multiple clones, from DNA extracted both from multiple individuals and from single cysts, revealed a predominant source of variation-in the length of polythymidine tracts. Comparison of our genomic sequences with ESTs similarly revealed variation in the length of polythymidine tracts. We subsequently sequenced both genomic DNA and mRNA from populations of G. pallida. In each case, variation in the length of polythymidine tracts was observed. The levels of expression of mitochondrial genes in G. pallida were representative of the subgenomes present: little evidence of differential expression was observed. These observations are consistent with the operation of posttranscriptional editing in Globodera mitochondria, although this is difficult to show conclusively in the presence of intraindividual gene sequence variation. Further, alternative explanations cannot be discounted; these include the operation of slippage during translation or that genomic copies of most genes are pseudogenes with a small proportion of full-length sequences able to maintain mitochondrial function.

  15. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  16. Patterns of variation among distinct alleles of the Flag silk gene from Nephila clavipes.

    Science.gov (United States)

    Higgins, Linden E; White, Sheryl; Nuñez-Farfán, Juan; Vargas, Jesus

    2007-02-20

    Spider silk proteins and their genes are very attractive to researchers in a wide range of disciplines because they permit linking many levels of organization. However, hypotheses of silk gene evolution have been built primarily upon single sequences of each gene each species, and little is known about allelic variation within a species. Silk genes are known for their repeat structure with high levels of homogenization of nucleotide and amino acid sequence among repeated units. One common explanation for this homogeneity is gene convergence. To test this model, we sequenced multiple alleles of one intron-exon segment from the Flag gene from four populations of the spider Nephila clavipes and compared the new sequences to a published sequence. Our analysis revealed very high levels of heterozygosity in this gene, with no pattern of population differentiation. There was no evidence of gene convergence within any of these alleles, with high levels of nucleotide and amino acid substitution among the repeating motifs. Our data suggest that minimally, there is relaxed selection on mutations in this gene and that there may actually be positive selection for heterozygosity.

  17. Gene expression and variation in social aggression by queens of the harvester ant Pogonomyrmex californicus.

    Science.gov (United States)

    Helmkampf, Martin; Mikheyev, Alexander S; Kang, Yun; Fewell, Jennifer; Gadau, Jürgen

    2016-08-01

    A key requirement for social cooperation is the mitigation and/or social regulation of aggression towards other group members. Populations of the harvester ant Pogonomyrmex californicus show the alternate social phenotypes of queens founding nests alone (haplometrosis) or in groups of unrelated yet cooperative individuals (pleometrosis). Pleometrotic queens display an associated reduction in aggression. To understand the proximate drivers behind this variation, we placed foundresses of the two populations into social environments with queens from the same or the alternate population, and measured their behaviour and head gene expression profiles. A proportion of queens from both populations behaved aggressively, but haplometrotic queens were significantly more likely to perform aggressive acts, and conflict escalated more frequently in pairs of haplometrotic queens. Whole-head RNA sequencing revealed variation in gene expression patterns, with the two populations showing moderate differentiation in overall transcriptional profile, suggesting that genetic differences underlie the two founding strategies. The largest detected difference, however, was associated with aggression, regardless of queen founding type. Several modules of coregulated genes, involved in metabolism, immune system and neuronal function, were found to be upregulated in highly aggressive queens. Conversely, nonaggressive queens exhibited a striking pattern of upregulation in chemosensory genes. Our results highlight that the social phenotypes of cooperative vs. solitary nest founding tap into a set of gene regulatory networks that seem to govern aggression level. We also present a number of highly connected hub genes associated with aggression, providing opportunity to further study the genetic underpinnings of social conflict and tolerance.

  18. SDF1 gene variation is associated with circulating SDF1alpha level and endothelial progenitor cell number: the Bruneck Study.

    Directory of Open Access Journals (Sweden)

    Qingzhong Xiao

    Full Text Available BACKGROUND: Stromal cell-derived factor-1 (SDF1 and its receptor CXC chemokine receptor 4 (CXCR4 play a critical role in progenitor cell homing, mobilization and differentiation. It would be interesting to assess the predictive value of SDF-1alpha level for EPC number, and to ascertain whether there is a relationship between SDF1 gene variation, plasma SDF-1alpha level, and the number and function of circulating EPCs. We also tested whether EPC number and function was related to CXCR4 gene variation. METHODOLOGY AND PRINCIPAL FINDINGS: We genotyped a cohort of individuals who participated in the Bruneck Study for single nucleotide polymorphisms (SNPs in the SDF1 and CXCR4 genes, and measured blood SDF1alpha level as well as EPC number and function. SDF1alpha levels were correlated with age, gender, alcohol consumption, circulating reticulocyte numbers, and concentrations of matrix metalloproteinase-9, C-reactive protein, cystatin C, fibrinogen and homocytein. In blood samples taken in 2005, EPC number was inversely associated with SDF1alpha level (p<0.001. EPC number in 2005 was also inversely associated with SDF1alpha level in 2000 (p = 0.009, suggesting a predictive value of plasma SDF1alpha level for EPC number. There was an association between the SDF1 gene rs2297630 SNP A/A genotype, increased SDF1alpha level (p = 0.002 and lower EPC number (p = 0.006. CONCLUSIONS: Our data indicate that a SDF1 gene variation (rs2297630 has an influence on SDF1alpha level and circulating EPC number, and that plasma SDF1alpha level is a predictor of EPC number.

  19. Association between a variation in the phosphodiesterase 4D gene and bone mineral density

    Directory of Open Access Journals (Sweden)

    Sambrook Philip N

    2005-03-01

    Full Text Available Abstract Background Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown. Methods We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (2, n = 319 and high (> 1.11 g/cm2, n = 321 BMD at the lumbar spine. Significant findings were verified in two additional sample collections. Results Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4D gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (2 and 138 females with high (>1.04 g/cm2 lumbar spine BMD. Odds ratios were 1.5 (P = 0.035 in the original sample and 2.1 (P = 0.018 in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09. We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD. Conclusion This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in

  20. Genetic variation of the IL-28B promoter affecting gene expression.

    Directory of Open Access Journals (Sweden)

    Masaya Sugiyama

    Full Text Available The current standard of care for the treatment of chronic hepatitis C is pegylated interferon-α (PEG-IFNα and ribavirin (RBV. The treatment achieves a sustained viral clearance in only approximately 50% of patients. Recent whole genome association studies revealed that single nucleotide polymorphisms (SNPs around IL-28B have been associated with response to the standard therapy and could predict treatment responses at approximately 80%. However, it is not clear which SNP is most informative because the genomic region containing significant SNPs shows strong linkage disequilibrium. We focused on SNPs in close proximity to the IL-28B gene to evaluate the function of each and identify the SNP affecting the IL-28B expression level most. The structures of IL-28A/B from 5' to 3'-UTR were determined by complete cDNA cloning. Both IL-28A and 28B genes consisted of 6 exons, differing from the CCDS data of NCBI. Two intron SNPs and a nonsynonymous SNP did not affect IL-28B gene function and expression levels but a SNP located in the proximal promoter region influenced gene expression. A (TA dinucleotide repeat, rs72258881, located in the promoter region was discovered by our functional studies of the proximal SNPs upstream of IL-28B; the transcriptional activity of the promoter increased gradually in a (TA(n length-dependent manner following IFN-α and lipopolysaccharide stimulation. Healthy Japanese donors exhibited a broad range of (TA dinucleotide repeat numbers from 10 to 18 and the most prevalent genotype was 12/12 (75%, differing from the database (13/13. However, genetic variation of IL-28A corresponding to that of IL-28B was not detected in these Japanese donors. These findings suggest that the dinucleotide repeat could be associated with the transcriptional activity of IL-28B as well as being a marker to improve the prediction of the response to interferon-based hepatitis C virus treatment.

  1. High frequency genetic variation of purine biosynthesis genes is a mechanism of success in Campylobacter jejuni

    Science.gov (United States)

    Phenotypic variation is prevalent among progeny of the zoonotic pathogen Campylobacter jejuni, the leading agent of enterocolitis in the developed world. Heterogeneity bestows increased survival to bacterial populations because variable phenotypes ensure some cells will be protected against future s...

  2. Natural variation for gene expression responses to abiotic stress in maize.

    Science.gov (United States)

    Waters, Amanda J; Makarevitch, Irina; Noshay, Jaclyn; Burghardt, Liana T; Hirsch, Candice N; Hirsch, Cory D; Springer, Nathan M

    2017-02-01

    Plants respond to abiotic stress through a variety of physiological, biochemical, and transcriptional mechanisms. Many genes exhibit altered levels of expression in response to abiotic stress, which requires concerted action of both cis- and trans-regulatory features. In order to study the variability in transcriptome response to abiotic stress, RNA sequencing was performed using 14-day-old maize seedlings of inbreds B73, Mo17, Oh43, PH207 and B37 under control, cold and heat conditions. Large numbers of genes that responded differentially to stress between parental inbred lines were identified. RNA sequencing was also performed on similar tissues of the F1 hybrids produced by crossing B73 and each of the three other inbred lines. By evaluating allele-specific transcript abundance in the F1 hybrids, we were able to measure the abundance of cis- and trans-regulatory variation between genotypes for both steady-state and stress-responsive expression differences. Although examples of trans-regulatory variation were observed, cis-regulatory variation was more common for both steady-state and stress-responsive expression differences. The genes with cis-allelic variation for response to cold or heat stress provided an opportunity to study the basis for regulatory diversity.

  3. Variation in key genes of serotonin and norepinephrine function predicts gamma-band activity during goal-directed attention.

    Science.gov (United States)

    Enge, Sören; Fleischhauer, Monika; Lesch, Klaus-Peter; Reif, Andreas; Strobel, Alexander

    2014-05-01

    Recent evidence shows that genetic variations in key regulators of serotonergic (5-HT) signaling explain variance in executive tasks, which suggests modulatory actions of 5-HT on goal-directed selective attention as one possible underlying mechanism. To investigate this link, 130 volunteers were genotyped for the 5-HT transporter gene-linked polymorphic region (5-HTTLPR) and for a variation (TPH2-703 G/T) of the TPH2 gene coding for the rate-limiting enzyme of 5-HT synthesis in the brain. Additionally, a functional polymorphism of the norepinephrine transporter gene (NET -3081 A/T) was considered, which was recently found to predict attention and working memory processes in interaction with serotonergic genes. The flanker-based Attention Network Test was used to assess goal-directed attention and the efficiency of attentional networks. Event-related gamma-band activity served to indicate selective attention at the intermediate phenotype level. The main findings were that 5-HTTLPR s allele and TPH2 G-allele homozygotes showed increased induced gamma-band activity during target processing when combined with the NET A/A genotype compared with other genotype combinations, and that gamma activity mediates the genotype-specific effects on task performance. The results further support a modulatory role of 5-HT and NE function in the top-down attentional selection of motivationally relevant over competing or irrelevant sensory input.

  4. Mitochondrial tRNALeu/Lys and ATPase 6/8 gene variations in spinocerebellar ataxias.

    Science.gov (United States)

    Safaei, Sepideh; Houshmand, Massoud; Banoei, Mohammad Mehdi; Panahi, Mehdi Shafa Shariat; Nafisi, Shahriar; Parivar, Kazem; Rostami, Maryam; Shariati, Parvin

    2009-01-01

    The spinocerebellar ataxias (SCA) comprise a heterogeneous group of severe late-onset neurodegenerative diseases that are promoted by the expansion of a tandem-arrayed DNA sequence that modifies the primary structure of the protein. Genomic DNA of 20 patients affected with SCAs was extracted from peripheral blood and screened for deletions in mitochondrial DNA (mtDNA). Sequencing of tRNA(Leu), tRNA(Lys), cytochrome oxidase II, ATPase 6/8 and NADH dehydrogenase I (NDI) genes belonging to mtDNA from patients with SCAs was also carried out to detect the presence of variations. We identified cytosine-adenine-guanine (CAG) trinucleotide repeat expansions in 20 patients. Seven of these patients had at least one nucleotide change in mtDNA. In such cases, 5 nucleotide variations resulted in amino acid changes with two novel variations T8256G and G9010A. SCA patients showed high levels of mtDNA variations in lymphocytes. It can be proposed that the SCA gene proteins (Ataxins) are involved in the complicated intracellular mechanisms that affect cellular organelles and their components, such as the mitochondrial genome. The instability of CAG repeats in polyglutamine diseases such as SCAs and Huntington's disease might be a causative factor in mtDNA variation or possible damage. Copyright 2008 S. Karger AG, Basel.

  5. Conceptual Variation in the Depiction of Gene Function in Upper Secondary School Textbooks

    Science.gov (United States)

    Gericke, Niklas Markus; Hagberg, Mariana

    2010-10-01

    This paper explores conceptual variation in the depiction of gene function in upper secondary school textbooks. Historically, concepts in genetics have developed in various scientific frameworks, which has led to a level of incommensurability as concepts have changed over time within their respective frameworks. Since students may have difficulties in understanding concepts where there is implicit variation in descriptions of the same phenomena, we have developed a concept mapping instrument and applied it to study the gene function concepts in biology and chemistry textbooks that are widely used in Sweden, and others used in a selection of English speaking countries. The data were then further examined using content analysis. In the present paper we describe the conceptual variation of gene function as it is presented in the textbooks, and analyze the ways in which students’ understanding may be influenced. We conclude that it may be difficult for students to gain a modern, process-oriented understanding of gene function if textbooks are used as foundations for the planning and execution of lessons.

  6. Copy Number Variation of UGT 2B Genes in Indian Families Using Whole Genome Scans

    Directory of Open Access Journals (Sweden)

    Avinash M. Veerappa

    2016-01-01

    Full Text Available Background and Objectives. Uridine diphospho-glucuronosyltransferase 2B (UGT2B is a family of genes involved in metabolizing steroid hormones and several other xenobiotics. These UGT2B genes are highly polymorphic in nature and have distinct polymorphisms associated with specific regions around the globe. Copy number variations (CNVs status of UGT2B17 in Indian population is not known and their disease associations have been inconclusive. It was therefore of interest to investigate the CNV profile of UGT2B genes. Methods. We investigated the presence of CNVs in UGT2B genes in 31 members from eight Indian families using Affymetrix Genome-Wide Human SNP Array 6.0 chip. Results. Our data revealed >50% of the study members carried CNVs in UGT2B genes, of which 76% showed deletion polymorphism. CNVs were observed more in UGT2B17 (76.4% than in UGT2B15 (17.6%. Molecular network and pathway analysis found enrichment related to steroid metabolic process, carboxylesterase activity, and sequence specific DNA binding. Interpretation and Conclusion. We report the presence of UGT2B gene deletion and duplication polymorphisms in Indian families. Network analysis indicates the substitutive role of other possible genes in the UGT activity. The CNVs of UGT2B genes are very common in individuals indicating that the effect is neutral in causing any suspected diseases.

  7. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Directory of Open Access Journals (Sweden)

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  8. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    Institute of Scientific and Technical Information of China (English)

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  9. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  10. Chloroplast gene arrangement variation within a closely related group of green algae (Trebouxiophyceae, Chlorophyta).

    Science.gov (United States)

    Letsch, Molly R; Lewis, Louise A

    2012-09-01

    The 22 published chloroplast genomes of green algae, representing sparse taxonomic sampling of diverse lineages that span over one billion years of evolution, each possess a unique gene arrangement. In contrast, many of the >190 published embryophyte (land plant) chloroplast genomes have relatively conserved architectures. To determine the phylogenetic depth at which chloroplast gene rearrangements occur in green algae, a 1.5-4 kb segment of the chloroplast genome was compared across nine species in three closely related genera of Trebouxiophyceae (Chlorophyta). In total, four distinct gene arrangements were obtained for the three genera Elliptochloris, Hemichloris, and Coccomyxa. In Elliptochloris, three distinct chloroplast gene arrangements were detected, one of which is shared with members of its sister genus Hemichloris. Both species of Coccomyxa examined share the fourth arrangement of this genome region, one characterized by very long spacers. Next, the order of genes found in this segment of the chloroplast genome was compared across green algae and land plants. As taxonomic ranks are not equivalent among different groups of organisms, the maximum molecular divergence among taxa sharing a common gene arrangement in this genome segment was compared. Well-supported clades possessing a single gene order had similar phylogenetic depth in green algae and embryophytes. When the dominant gene order of this chloroplast segment in embryophytes was assumed to be ancestral for land plants, the maximum molecular divergence was found to be over two times greater in embryophytes than in trebouxiophyte green algae. This study greatly expands information about chloroplast genome variation in green algae, is the first to demonstrate such variation among congeneric green algae, and further illustrates the fluidity of green algal chloroplast genome architecture in comparison to that of many embryophytes.

  11. Gene Ontology synonym generation rules lead to increased performance in biomedical concept recognition.

    Science.gov (United States)

    Funk, Christopher S; Cohen, K Bretonnel; Hunter, Lawrence E; Verspoor, Karin M

    2016-09-09

    Gene Ontology (GO) terms represent the standard for annotation and representation of molecular functions, biological processes and cellular compartments, but a large gap exists between the way concepts are represented in the ontology and how they are expressed in natural language text. The construction of highly specific GO terms is formulaic, consisting of parts and pieces from more simple terms. We present two different types of manually generated rules to help capture the variation of how GO terms can appear in natural language text. The first set of rules takes into account the compositional nature of GO and recursively decomposes the terms into their smallest constituent parts. The second set of rules generates derivational variations of these smaller terms and compositionally combines all generated variants to form the original term. By applying both types of rules, new synonyms are generated for two-thirds of all GO terms and an increase in F-measure performance for recognition of GO on the CRAFT corpus from 0.498 to 0.636 is observed. Additionally, we evaluated the combination of both types of rules over one million full text documents from Elsevier; manual validation and error analysis show we are able to recognize GO concepts with reasonable accuracy (88 %) based on random sampling of annotations. In this work we present a set of simple synonym generation rules that utilize the highly compositional and formulaic nature of the Gene Ontology concepts. We illustrate how the generated synonyms aid in improving recognition of GO concepts on two different biomedical corpora. We discuss other applications of our rules for GO ontology quality assurance, explore the issue of overgeneration, and provide examples of how similar methodologies could be applied to other biomedical terminologies. Additionally, we provide all generated synonyms for use by the text-mining community.

  12. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  13. Increased Drought Tolerance through the Suppression of ESKMO1 Gene and Overexpression of CBF-Related Genes in Arabidopsis

    Science.gov (United States)

    Xu, Fuhui; Liu, Zhixue; Xie, Hongyan; Zhu, Jian; Zhang, Juren; Kraus, Josef; Blaschnig, Tasja; Nehls, Reinhard; Wang, Hong

    2014-01-01

    Improved drought tolerance is always a highly desired trait for agricultural plants. Significantly increased drought tolerance in Arabidopsis thaliana (Columbia-0) has been achieved in our work through the suppression of ESKMO1 (ESK1) gene expression with small-interfering RNA (siRNA) and overexpression of CBF genes with constitutive gene expression. ESK1 has been identified as a gene linked to normal development of the plant vascular system, which is assumed directly related to plant drought response. By using siRNA that specifically targets ESK1, the gene expression has been reduced and drought tolerance of the plant has been enhanced dramatically in the work. However, the plant response to external abscisic acid application has not been changed. ICE1, CBF1, and CBF3 are genes involved in a well-characterized plant stress response pathway, overexpression of them in the plant has demonstrated capable to increase drought tolerance. By overexpression of these genes combining together with suppression of ESK1 gene, the significant increase of plant drought tolerance has been achieved in comparison to single gene manipulation, although the effect is not in an additive way. Accompanying the increase of drought tolerance via suppression of ESK1 gene expression, the negative effect has been observed in seeds yield of transgenic plants in normal watering conditions comparing with wide type plant. PMID:25184213

  14. Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth

    2010-01-01

    Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...

  15. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  16. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  17. Regulation of flowering in rice: two florigen genes, a complex gene network, and natural variation.

    Science.gov (United States)

    Tsuji, Hiroyuki; Taoka, Ken-ichiro; Shimamoto, Ko

    2011-02-01

    Photoperiodic control of flowering time consists of a complicated network that converges into the generation of a mobile flowering signal called florigen. Recent advances identifying the protein FT/Hd3a as the molecular nature responsible for florigen activity have focused current research on florigen genes as the important output of this complex signaling network. Rice is a model system for short-day plants and recent progress in elucidating the flowering network from rice and Arabidopsis, a long-day plant, provides an evolutionarily comparative view of the photoperiodic flowering pathway. This review summarizes photoperiodic flowering control in rice, including the interaction of complex layers of gene networks contributed from evolutionarily unique factors and the regulatory adaptation of conserved factors.

  18. Genetic variations of glycinin subunit genes among cultivated and wild type soybean species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Glycinin is a predominant storage protein in most soybean accessions. It is a hexamer constituted by five major subunits, which can be classified into two groups. Group Ⅰ contains Gl, G2 and G3, and Group Ⅱ contains G4 and G5. The genes encoding these subunits have been designated from Gyl to Gy5, respectively. In the present study, Gyl genomic fragments were cloned from wild accessions of subgenera Glycine glycine, Glycine soja and a cultivar of Glycine max. Their sequences and the deduced amino acid sequences were compared. The residues critical for assembling of G1 subunits from the wild perennial accession were conservative. The Gy4 fragments were cloned from two wild perennial accessions and compared with that from subgenus Soja. The intron 3 of Gy4 had abundant variations between the subgenera G. Soja and G. Glycine as well as within the subgenus G. Glycine. Abundant variations existed in the disordered regions 3 and 4 of G4 subunits from two wild perennial accessions. The genomic organization of glycinin genes was analyzed in 19 accessions from subgenera Soja and Glycine. The hybridization patterns were identical among the accessions of subgenus Soja. On the contrary, abundant polymorphisms existed between the accessions from subgenus Glycine. These results indicated that glycinin genes have high degree of conservation within subgenus Soja but more variations within subgenus Glycine.

  19. Novel rare variations of the oxytocin receptor (OXTR) gene in autism spectrum disorder individuals.

    Science.gov (United States)

    Liu, Xiaoxi; Kawashima, Minae; Miyagawa, Taku; Otowa, Takeshi; Latt, Khun Zaw; Thiri, Myo; Nishida, Hisami; Sugiyama, Toshiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Mabuchi, Akihiko; Tokunaga, Katsushi; Sasaki, Tsukasa

    2015-01-01

    The oxytocin receptor (OXTR) gene has been implicated as a risk gene for autism spectrum disorder (ASD)-a neurodevelopmental disorder with essential features of impairments in social communication and reciprocal interaction. The genetic associations between common variations in OXTR and ASD have been reported in multiple ethnic populations. However, little is known about the distribution of rare variations within OXTR in ASD patients. In this study, we resequenced the full length of OXTR in 105 ASD individuals using an approach that combined the power of next-generation sequencing technology, long-range PCR and DNA pooling. We demonstrated that rare variants with minor allele frequency as low as 0.05% could be reliably detected by our method. We identified 28 novel variants including potential functional variants in the intron region and one rare missense variant (R150S). We subsequently performed Sanger sequencing and validated five novel variants located in previously suggested candidate regions in ASD individuals. Further sequencing of 312 healthy subjects showed that the burden of rare variants is significantly higher in ASDs compared with healthy individuals. Our results support that the rare variation in OXTR gene might be involved in ASD.

  20. Effects of abhydrolase domain containing 5 gene (ABHD5) expression and variations on chicken fat metabolism.

    Science.gov (United States)

    Ouyang, Hongjia; Liu, Qing; Xu, Jiguo; Zeng, Fang; Pang, Xiaolin; Jebessa, Endashaw; Liang, Shaodong; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    Abhydrolase domain containing 5 gene (ABHD5), also known as comparative gene identification 58 (CGI-58), is a member of the α/β-hydrolase family as a protein cofactor of ATGL stimulating its triacylglycerol hydrolase activity. In this study, we aim to characterize the expression and variations of ABHD5 and to study their functions in chicken fat metabolism. We compared the ABHD5 expression level in various tissues and under different nutrition conditions, identified the variations of ABHD5, and associated them with production traits in an F2 resource population of chickens. Overexpression analysis with two different genotypes and siRNA interfering analysis of ABHD5 were performed in chicken preadipocytes. Chicken ABDH5 was expressed widely and most predominantly in adipose tissue. Five SNPs of the ABHD5 gene were identified and genotyped in the F2 resource population. The c.490C > T SNP was associated with subcutaneous fat thickness (P  C SNP was also associated with chicken body weight (P chicken preadipocytes, overexpression of wild type ABDH5 did not affect the mRNA level of ATGL (adipose triglyceride lipase) but markedly decreased (P chickens with a high fat diet. These results suggest that expression and variations of ABHD5 may affect fat metabolism through regulating the activity of ATGL in chickens.

  1. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  2. miRNA and miRNA target genes in copy number variations occurring in individuals with intellectual disability.

    Science.gov (United States)

    Qiao, Ying; Badduke, Chansonette; Mercier, Eloi; Lewis, Suzanne M E; Pavlidis, Paul; Rajcan-Separovic, Evica

    2013-08-10

    MicroRNAs (miRNAs) are a family of short, non-coding RNAs modulating expression of human protein coding genes (miRNA target genes). Their dysfunction is associated with many human diseases, including neurodevelopmental disorders. It has been recently shown that genomic copy number variations (CNVs) can cause aberrant expression of integral miRNAs and their target genes, and contribute to intellectual disability (ID). To better understand the CNV-miRNA relationship in ID, we investigated the prevalence and function of miRNAs and miRNA target genes in five groups of CNVs. Three groups of CNVs were from 213 probands with ID (24 de novo CNVs, 46 familial and 216 common CNVs), one group of CNVs was from a cohort of 32 cognitively normal subjects (67 CNVs) and one group of CNVs represented 40 ID related syndromic regions listed in DECIPHER (30 CNVs) which served as positive controls for CNVs causing or predisposing to ID. Our results show that 1). The number of miRNAs is significantly higher in de novo or DECIPHER CNVs than in familial or common CNV subgroups (P genes are found in de novo, familial and DECIPHER CNVs than in the common CNV subgroup (P genes from de novo and DECIPHER CNV subgroups. Our findings reveal an increase in miRNA and miRNA target gene content in de novo versus common CNVs in subjects with ID. Their expression profile and participation in pathways support a possible role of miRNA copy number change in cognition and/or CNV-mediated developmental delay. Systematic analysis of expression/function of miRNAs in addition to coding genes integral to CNVs could uncover new causes of ID.

  3. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner

    DEFF Research Database (Denmark)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij

    2015-01-01

    The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159...... males) were on an 8-week low-calorie diet with a 6-month follow-up. Body weight was measured before and after the diet, and after follow-up. Weight maintenance scores (WMS, regained weight as percentage of lost weight) were calculated based on the weight data. Genotype data were retrieved for 2903 SNPs...... corresponding to 124 ECM-related genes. Regression analyses provided us with six significant SNPs associated with the WMS in males: 3 SNPs in the POSTN gene and a SNP in the LAMB1, COL23A1, and FBLN5 genes. For females, 1 SNP was found in the FN1 gene. The risk of weight regain was increased by: the C...

  4. Increased circulating calcitonin gene-related peptide (CGRP) in cirrhosis

    DEFF Research Database (Denmark)

    Bendtsen, Flemming; Schifter, S; Henriksen, Jens Henrik

    1991-01-01

    with minor disorders (59 vs. 46 pmol/l, p less than 0.01), as well as with 232 healthy persons (37 pmol/l, p less than 0.0001). Moreover, circulating CGRP increased significantly with the severity of cirrhosis (Child-Turcotte group A, 56; group B, 59; group C, 71 pmol/l; p less than 0.025). No significant...

  5. Genetically modified crops for biomass increase. Genes and strategies.

    Science.gov (United States)

    Rojas, Cristian Antonio; Hemerly, Adrianna Silva; Ferreira, Paulo Cavalcanti Gomes

    2010-01-01

    Genetically modified crops (GMCs) have been developed to accelerate the creation of new varieties with improved characteristics such as disease resistance, stress tolerance and higher quality composition. However, agriculture, without minimizing its role in food, feed and fiber source, has become important for the energy matrix of many countries. GMCs are also attractive systems that could fulfill the requirements for these new necessities. An increase of crop yields in an environmental friendly system is a new goal for plant biology research in the twenty-first century. In particular, biomass yield improvement is needed to render the use of biofuels economically feasible. In this context, research directed toward increasing biomass production has attracted much attention and a considerable effort is being made to reach new goals. Nonetheless, in some cases differentiated strategies are needed, as biomass improvement requires approaches other than those employed with traditional crops. This review summarizes the various approaches applied so far to modulate plant growth applying molecular biology-based strategies and increase biomass production, and it highlights several outstanding issues about the developmental constraints that must be addressed.

  6. Does NDVI reflect variation in the structural attributes associated with increasing shrub dominance in arctic tundra?

    Energy Technology Data Exchange (ETDEWEB)

    Boelman, Natalie T [Lamont-Doherty Earth Observatory, Columbia University, 61 Route 9W, Palisades, NY 10964 (United States); Gough, Laura; McLaren, Jennie R [Department of Biology, University of Texas at Arlington, Arlington, TX 76019 (United States); Greaves, Heather, E-mail: nboelman@ldeo.columbia.edu [Department of Forest Ecosystems and Society, Oregon State University, 321 Richardson Hall, Corvallis, OR 97331 (United States)

    2011-07-15

    This study explores relationships between the normalized difference vegetation index (NDVI) and structural characteristics associated with deciduous shrub dominance in arctic tundra. Our structural measures of shrub dominance are stature, branch abundance, aerial per cent woody stem cover (deciduous and evergreen species), and per cent deciduous shrub canopy cover. All measurements were taken across a suite of transects that together represent a gradient of deciduous shrub height. The transects include tussock tundra shrub and riparian shrub tundra communities located in the northern foothills of the Brooks Range, in northern Alaska. Plot-level NDVI measurements were made in 2010 during the snow-free period prior to deciduous shrub leaf-out (early June, NDVI{sub pre-leaf}), at the point in the growing season when canopy NDVI has reached half of its maximum growing season value (mid-June, NDVI{sub demi-leaf}) and during the period of maximum leaf-out (late July, NDVI{sub peak-leaf}). We found that: (1) NDVI{sub pre-leaf} is best suited to capturing variation in the per cent woody stem cover, maximum shrub height, and branch abundance, particularly between 10 and 50 cm height in the canopy; (2) NDVI{sub peak-leaf} is best suited to capturing variation in deciduous canopy cover; and (3) NDVI{sub demi-leaf} does not capture variability in any of our measures of shrub dominance. These findings suggest that in situ NDVI measurements made prior to deciduous canopy leaf-out could be used to identify small differences in maximum shrub height, woody stem cover, and branch abundance (particularly between 10 and 50 cm height in the canopy). Because shrubs are increasing in size and regional extent in several regions of the Arctic, investigation into spectrally based tools for monitoring these changes are worthwhile as they provide a first step towards development of remotely sensed techniques for quantifying associated changes in regional carbon cycling, albedo, radiative

  7. Sweet taste receptor gene variation and aspartame taste in primates and other species.

    Science.gov (United States)

    Li, Xia; Bachmanov, Alexander A; Maehashi, Kenji; Li, Weihua; Lim, Raymond; Brand, Joseph G; Beauchamp, Gary K; Reed, Danielle R; Thai, Chloe; Floriano, Wely B

    2011-06-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, T1R2 and T1R3, we sequenced these genes in 9 aspartame taster and nontaster primate species. We then compared these sequences with sequences of their orthologs in 4 other nontasters species. We identified 9 variant sites in the gene encoding T1R2 and 32 variant sites in the gene encoding T1R3 that distinguish aspartame tasters and nontasters. Molecular docking of aspartame to computer-generated models of the T1R2 + T1R3 receptor dimer suggests that species variation at a secondary, allosteric binding site in the T1R2 protein is the most likely origin of differences in perception of the sweetness of aspartame. These results identified a previously unknown site of aspartame interaction with the sweet receptor and suggest that the ability to taste aspartame might have developed during evolution to exploit a specialized food niche.

  8. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....... and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according...

  9. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Science.gov (United States)

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species.

  10. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    Science.gov (United States)

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama

    2014-01-01

    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  11. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  12. Copy number variation of age-related macular degeneration relevant genes in the Korean population.

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    Full Text Available PURPOSE: Studies that analyzed single nucleotide polymorphisms (SNP in various genes have shown that genetic factors are strongly associated with age-related macular degeneration (AMD susceptibility. Copy number variation (CNV may be an additional type of genetic variation that contributes to AMD pathogenesis. This study investigated CNV in 4 AMD-relevant genes in Korean AMD patients and control subjects. METHODS: Four CNV candidate regions located in AMD-relevant genes (VEGFA, ARMS2/HTRA1, CFH and VLDLR, were selected based on the outcomes of our previous study which elucidated common CNVs in the Asian populations. Real-time PCR based TaqMan Copy Number Assays were performed on CNV candidates in 273 AMD patients and 257 control subjects. RESULTS: The predicted copy number (PCN, 0, 1, 2 or 3+ of each region was called using the CopyCaller program. All candidate genes except ARMS2/HTRA1 showed CNV in at least one individual, in which losses of VEGFA and VLDLR represent novel findings in the Asian population. When the frequencies of PCN were compared, only the gain in VLDLR showed significant differences between AMD patients and control subjects (p = 0.025. Comparisons of the raw copy values (RCV revealed that 3 of 4 candidate genes showed significant differences (2.03 vs. 1.92 for VEGFA, p<0.01; 2.01 vs. 1.97 for CFH, p<0.01; 1.97 vs. 2.01, p<0.01 for ARMS2/HTRA1. CONCLUSION: CNVs located in AMD-relevant genes may be associated with AMD susceptibility. Further investigations encompassing larger patient cohorts are needed to elucidate the role of CNV in AMD pathogenesis.

  13. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Science.gov (United States)

    Purrington, Kristen S.; Slettedahl, Seth; Bolla, Manjeet K.; Michailidou, Kyriaki; Czene, Kamila; Nevanlinna, Heli; Bojesen, Stig E.; Andrulis, Irene L.; Cox, Angela; Hall, Per; Carpenter, Jane; Yannoukakos, Drakoulis; Haiman, Christopher A.; Fasching, Peter A.; Mannermaa, Arto; Winqvist, Robert; Brenner, Hermann; Lindblom, Annika; Chenevix-Trench, Georgia; Benitez, Javier; Swerdlow, Anthony; Kristensen, Vessela; Guénel, Pascal; Meindl, Alfons; Darabi, Hatef; Eriksson, Mikael; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Wang, Xianshu; Olswold, Curtis; Olson, Janet E.; Mulligan, Anna Marie; Knight, Julia A.; Tchatchou, Sandrine; Reed, Malcolm W.R.; Cross, Simon S.; Liu, Jianjun; Li, Jingmei; Humphreys, Keith; Clarke, Christine; Scott, Rodney; Fostira, Florentia; Fountzilas, George; Konstantopoulou, Irene; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Ekici, Arif B.; Hartmann, Arndt; Beckmann, Matthias W.; Hartikainen, Jaana M.; Kosma, Veli-Matti; Kataja, Vesa; Jukkola-Vuorinen, Arja; Pylkäs, Katri; Kauppila, Saila; Dieffenbach, Aida Karina; Stegmaier, Christa; Arndt, Volker; Margolin, Sara; Balleine, Rosemary; Arias Perez, Jose Ignacio; Pilar Zamora, M.; Menéndez, Primitiva; Ashworth, Alan; Jones, Michael; Orr, Nick; Arveux, Patrick; Kerbrat, Pierre; Truong, Thérèse; Bugert, Peter; Toland, Amanda E.; Ambrosone, Christine B.; Labrèche, France; Goldberg, Mark S.; Dumont, Martine; Ziogas, Argyrios; Lee, Eunjung; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Long, Jirong; Shrubsole, Martha; Deming-Halverson, Sandra; Ficarazzi, Filomena; Barile, Monica; Peterlongo, Paolo; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Brüning, Thomas; Ko, Yon-Dschun; Van Deurzen, Carolien H.M.; Martens, John W.M.; Kriege, Mieke; Figueroa, Jonine D.; Chanock, Stephen J.; Lissowska, Jolanta; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Schneeweiss, Andreas; Tapper, William J.; Gerty, Susan M.; Durcan, Lorraine; Mclean, Catriona; Milne, Roger L.; Baglietto, Laura; dos Santos Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Van'T Veer, Laura J.; Cornelissen, Sten; Försti, Asta; Torres, Diana; Rüdiger, Thomas; Rudolph, Anja; Flesch-Janys, Dieter; Nickels, Stefan; Weltens, Caroline; Floris, Giuseppe; Moisse, Matthieu; Dennis, Joe; Wang, Qin; Dunning, Alison M.; Shah, Mitul; Brown, Judith; Simard, Jacques; Anton-Culver, Hoda; Neuhausen, Susan L.; Hopper, John L.; Bogdanova, Natalia; Dörk, Thilo; Zheng, Wei; Radice, Paolo; Jakubowska, Anna; Lubinski, Jan; Devillee, Peter; Brauch, Hiltrud; Hooning, Maartje; García-Closas, Montserrat; Sawyer, Elinor; Burwinkel, Barbara; Marmee, Frederick; Eccles, Diana M.; Giles, Graham G.; Peto, Julian; Schmidt, Marjanka; Broeks, Annegien; Hamann, Ute; Chang-Claude, Jenny; Lambrechts, Diether; Pharoah, Paul D.P.; Easton, Douglas; Pankratz, V. Shane; Slager, Susan; Vachon, Celine M.; Couch, Fergus J.

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymorphisms (SNPs) from 194 mitotic genes and breast cancer risk, overall and by histologic grade, in the Breast Cancer Association Consortium (BCAC) iCOGS study (n = 39 067 cases; n = 42 106 controls). SNPs in TACC2 [rs17550038: odds ratio (OR) = 1.24, 95% confidence interval (CI) 1.16–1.33, P = 4.2 × 10−10) and EIF3H (rs799890: OR = 1.07, 95% CI 1.04–1.11, P = 8.7 × 10−6) were significantly associated with risk of low-grade breast cancer. The TACC2 signal was retained (rs17550038: OR = 1.15, 95% CI 1.07–1.23, P = 7.9 × 10−5) after adjustment for breast cancer risk SNPs in the nearby FGFR2 gene, suggesting that TACC2 is a novel, independent genome-wide significant genetic risk locus for low-grade breast cancer. While no SNPs were individually associated with high-grade disease, a pathway-level gene set analysis showed that variation across the 194 mitotic genes was associated with high-grade breast cancer risk (P = 2.1 × 10−3). These observations will provide insight into the contribution of mitotic defects to histological grade and the etiology of breast cancer. PMID:24927736

  14. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  15. Increase of Expression Levels of Reporter Gene in Transgenic Tobaccos by Matrix Attachment Regions

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The matrix attachment region (MAR) located downstream of Plastocyanin gene was isolated from the genome of pea. To study the effect of MARs on foreign gene expression in transgenic plants, T-DNA vector was constructed in which MARs flanked bothβ-glucuronidase(GUS) gene and selectable marker neomycin phosphotransferase (NPT-II) gene. The plant expression vectors were transferred into leaf discs via Agrobacterium-mediated transformation procedure. The result of GUS measurement showed that pea MAR could increase transgene expression level. The mean expression levels of GUS gene expression in population containing MARs could be increased twofold when compared with that of population without MARs.

  16. Antigen-presenting genes and genomic copy number variations in the Tasmanian devil MHC

    Directory of Open Access Journals (Sweden)

    Cheng Yuanyuan

    2012-03-01

    Full Text Available Abstract Background The Tasmanian devil (Sarcophilus harrisii is currently under threat of extinction due to an unusual fatal contagious cancer called Devil Facial Tumour Disease (DFTD. DFTD is caused by a clonal tumour cell line that is transmitted between unrelated individuals as an allograft without triggering immune rejection due to low levels of Major Histocompatibility Complex (MHC diversity in Tasmanian devils. Results Here we report the characterization of the genomic regions encompassing MHC Class I and Class II genes in the Tasmanian devil. Four genomic regions approximately 960 kb in length were assembled and annotated using BAC contigs and physically mapped to devil Chromosome 4q. 34 genes and pseudogenes were identified, including five Class I and four Class II loci. Interestingly, when two haplotypes from two individuals were compared, three genomic copy number variants with sizes ranging from 1.6 to 17 kb were observed within the classical Class I gene region. One deletion is particularly important as it turns a Class Ia gene into a pseudogene in one of the haplotypes. This deletion explains the previously observed variation in the Class I allelic number between individuals. The frequency of this deletion is highest in the northwestern devil population and lowest in southeastern areas. Conclusions The third sequenced marsupial MHC provides insights into the evolution of this dynamic genomic region among the diverse marsupial species. The two sequenced devil MHC haplotypes revealed three copy number variations that are likely to significantly affect immune response and suggest that future work should focus on the role of copy number variations in disease susceptibility in this species.

  17. Genetic variations in the osteopontin promoters T-443C and G-156GG increase carotid intima–media thickness

    Science.gov (United States)

    Yueniwati, Yuyun; Yurina, Valentina; Sobah, Nurus; Rahayu, Endang

    2016-01-01

    Carotid intima–media thickness (CIMT) is a clear predictor of atherosclerosis. The increase of CIMT is affected by mutations in the osteopontin (OPN) promoters. The purpose of this study was to examine genetic variations in OPN promoters T-443C and G-156GG, identified in Javanese children with ischemic stroke parents, and to investigate their relationship with the increase of CIMT. A case–control analytic study was performed on 20 case and 12 control samples. Case samples were Javanese children aged between 10 to 21 years with ischemic stroke parents. Control samples were children with healthy parents. Mutations of T-443C and G-156GG were determined by employing polymerase chain reaction. Results of sequencing were analyzed using CLC Main Workbench 6.0. CIMT was defined using ultrasound. Genetic variations of T-443C were identified in six samples. Likewise, genetic variations of G-156GG were identified in six samples. Genetic variations in the OPN promoters T-443C and G-156GG were not potential risk factors in an increase of CIMT (P=0.654 and P=0.654). This study proves that genetic variations could be identified at the points of T-443C and G-156GG in children with ischemic stroke parents. Although statistically insignificant, the tendency to increase CIMT occurs in children with genetic variations. Children with ischemic stroke parents have thicker CIMT than children of healthy parents. PMID:27274305

  18. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Directory of Open Access Journals (Sweden)

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  19. Low AMY1 Gene Copy Number Is Associated with Increased Body Mass Index in Prepubertal Boys.

    Directory of Open Access Journals (Sweden)

    M Loredana Marcovecchio

    Full Text Available Genome-wide association studies have identified more than 60 single nucleotide polymorphisms associated with Body Mass Index (BMI. Additional genetic variants, such as copy number variations (CNV, have also been investigated in relation to BMI. Recently, the highly polymorphic CNV in the salivary amylase (AMY1 gene, encoding an enzyme implicated in the first step of starch digestion, has been associated with obesity in adults and children. We assessed the potential association between AMY1 copy number and a wide range of BMI in a population of Italian school-children.744 children (354 boys, 390 girls, mean age (±SD: 8.4±1.4years underwent anthropometric assessments (height, weight and collection of saliva samples for DNA extraction. AMY1 copies were evaluated by quantitative PCR.A significant increase of BMI z-score by decreasing AMY1 copy number was observed in boys (β: -0.117, p = 0.033, but not in girls. Similarly, waist circumference (β: -0.155, p = 0.003, adjusted for age was negatively influenced by AMY1 copy number in boys. Boys with 8 or more AMY1 copy numbers presented a significant lower BMI z-score (p = 0.04 and waist circumference (p = 0.01 when compared to boys with less than 8 copy numbers.In this pediatric-only, population-based study, a lower AMY1 copy number emerged to be associated with increased BMI in boys. These data confirm previous findings from adult studies and support a potential role of a higher copy number of the salivary AMY1 gene in protecting from excess weight gain.

  20. Low AMY1 Gene Copy Number Is Associated with Increased Body Mass Index in Prepubertal Boys

    Science.gov (United States)

    Verginelli, Fabio; De Lellis, Laura; Capelli, Cristian; Verzilli, Delfina; Chiarelli, Francesco; Mohn, Angelika; Cama, Alessandro

    2016-01-01

    Background Genome-wide association studies have identified more than 60 single nucleotide polymorphisms associated with Body Mass Index (BMI). Additional genetic variants, such as copy number variations (CNV), have also been investigated in relation to BMI. Recently, the highly polymorphic CNV in the salivary amylase (AMY1) gene, encoding an enzyme implicated in the first step of starch digestion, has been associated with obesity in adults and children. We assessed the potential association between AMY1 copy number and a wide range of BMI in a population of Italian school-children. Methods 744 children (354 boys, 390 girls, mean age (±SD): 8.4±1.4years) underwent anthropometric assessments (height, weight) and collection of saliva samples for DNA extraction. AMY1 copies were evaluated by quantitative PCR. Results A significant increase of BMI z-score by decreasing AMY1 copy number was observed in boys (β: -0.117, p = 0.033), but not in girls. Similarly, waist circumference (β: -0.155, p = 0.003, adjusted for age) was negatively influenced by AMY1 copy number in boys. Boys with 8 or more AMY1 copy numbers presented a significant lower BMI z-score (p = 0.04) and waist circumference (p = 0.01) when compared to boys with less than 8 copy numbers. Conclusions In this pediatric-only, population-based study, a lower AMY1 copy number emerged to be associated with increased BMI in boys. These data confirm previous findings from adult studies and support a potential role of a higher copy number of the salivary AMY1 gene in protecting from excess weight gain. PMID:27149670

  1. Multidrug Resistance 1 Gene Variants, Pesticide Exposure, and Increased Risk of DNA Damage

    Directory of Open Access Journals (Sweden)

    Chun-Chieh Chen

    2014-01-01

    Full Text Available The P-glycoprotein, encoded by the multidrug resistance (MDR1 gene, extrudes fat-soluble compounds to the extracellular environment. However, the DNA damage of pesticides in subjects with genetic variation in MDR1 has not been investigated. In this study, the comet assay was applied to examine the extent of DNA damage in the peripheral blood of 195 fruit growers who had been exposed to pesticides and 141 unexposed controls. The MDR1 polymorphisms were identified. Questionnaires were administered to obtain demographic data and occupational history. Results showed subjects experiencing high (2.14 μm/cell, P<0.01 or low pesticide exposure (2.18 μm/cell, P<0.01 had a significantly greater DNA tail moment than controls (1.28 μm/cell. Compared to the MDR1 T-129C (rs3213619 TC/CC carriers, the TT carriers had increased DNA tail moment in controls (1.30 versus 1.12 μm/cell, P<0.01. Similar results were observed in the high and low pesticide-exposed groups. Combined analysis revealed that pesticide-exposed fruit growers with MDR1 -129 TT genotype had the greatest DNA damage in the subjects with the combinations of pesticide exposure and MDR1 -129 genotypes. In conclusion, pesticide exposed individuals with susceptible MDR1 -129 genotypes may experience increased risk of DNA damage.

  2. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Directory of Open Access Journals (Sweden)

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  3. Genetic variation within the interleukin-1 gene cluster and ischemic stroke.

    Science.gov (United States)

    Olsson, Sandra; Holmegaard, Lukas; Jood, Katarina; Sjögren, Marketa; Engström, Gunnar; Lövkvist, Håkan; Blomstrand, Christian; Norrving, Bo; Melander, Olle; Lindgren, Arne; Jern, Christina

    2012-09-01

    Evidence is emerging that inflammation plays a key role in the pathophysiology of ischemic stroke (IS). The aim of this study was to investigate whether genetic variation in the interleukin-1α, interleukin-1β, and interleukin-1 receptor antagonist genes (IL1A, IL1B, and IL1RN) is associated with IS and/or any etiologic subtype of IS. Twelve tagSNPs were analyzed in the Sahlgrenska Academy Study on Ischemic Stroke (SAHLSIS), which comprises 844 patients with IS and 668 control subjects. IS subtypes were defined according to the Trial of Org 10172 in Acute Stroke Treatment criteria in SAHLSIS. The Lund Stroke Register and the Malmö Diet and Cancer study were used as a replication sample for overall IS (in total 3145 patients and 1793 control subjects). The single nucleotide polymorphism rs380092 in IL1RN showed an association with overall IS in SAHLSIS (OR, 1.21; 95% CI, 1.02-1.43; P=0.03), which was replicated in the Lund Stroke Register and the Malmö Diet and Cancer study sample. An association was also detected in all samples combined (OR, 1.12; 95% CI, 1.04-1.21; P=0.03). Three single nucleotide polymorphisms in IL1RN (including rs380092) were nominally associated with the subtype of cryptogenic stroke in SAHLSIS, but the statistical significance did not remain after correction for multiple testing. Furthermore, increased plasma levels of interleukin-1 receptor antagonist were observed in the subtype of cryptogenic stroke compared with controls. This comprehensive study, based on a tagSNP approach and replication, presents support for the role of IL1RN in overall IS.

  4. [Genetic variation analysis of canine parvovirus VP2 gene in China].

    Science.gov (United States)

    Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

    2009-11-01

    To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

  5. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome.

    Science.gov (United States)

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal models suggest a role for oxytocin (OXT) and oxytocin receptor (OXTR) genes in social-emotional behaviors, and several studies indicate that the oxytocin/oxytocin receptor system is altered in individuals with ASC. Previous studies have reported associations between genetic variations in the OXTR gene and ASC. The present study tested for an association between nine single nucleotide polymorphisms (SNPs) in the OXTR gene and AS in 530 individuals of Caucasian origin, using SNP association test and haplotype analysis. There was a significant association between rs2268493 in OXTR and AS. Multiple haplotypes that include this SNP (rs2268493-rs2254298, rs2268490-rs2268493-rs2254298, rs2268493-rs2254298-rs53576, rs237885-rs2268490-rs2268493-rs2254298, rs2268490-rs2268493-rs2254298-rs53576) were also associated with AS. rs2268493 has been previously associated with ASC and putatively alters several transcription factor-binding sites and regulates chromatin states, either directly or through other variants in linkage disequilibrium (LD). This study reports a significant association of the sequence variant rs2268493 in the OXTR gene and associated haplotypes with AS.

  6. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  7. Systematic variation in gene expression patterns in human cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ross, Douglas T.; Scherf, Uwe; Eisen, Michael B.; Perou, Charles M.; Rees, Christian; Spellman, Paul; Iyer, Vishwanath; Jeffrey, Stefanie S.; Van de Rijn, Matt; Waltham, Mark; Pergamenschikov, Alexander; Lee, Jeffrey C.F.; Lashkari, Deval; Shalon, Dari; Myers, Timothy G.; Weinstein, John N.; Botstein, David; Brown, Patrick O.

    2000-01-01

    We used cDNA micro arrays to explore the variation in expression of approximately 8,000 unique genes among the 60 cell lines used in the National Cancer Institute s screen for anti-cancer drugs. Classification of the cell lines based solely on the observed patterns of gene expression revealed a correspondence to the ostensible origins of the tumors from which the cell lines were derived. The consistent relationship between the gene expression patterns and the tissue of origin allowed us to recognize outliers whose previous classification appeared incorrect. Specific features of the gene expression patterns appeared to be related to physiological properties of the cell lines, such as their doubling time in culture, drug metabolism or the interferon response. Comparison of gene expression patterns in the cell lines to those observed in normal breast tissue or in breast tumor specimens revealed features of the expression patterns in the tumors that had recognizable counterparts in specific cell lines, reflecting the tumor, stromal and inflammatory components of the tumor tissue. These results provided a novel molecular characterization of this important group of human cell lines and their relationships to tumors in vivo.

  8. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  9. Genetic variation in telomere maintenance genes, telomere length, and lung cancer susceptibility.

    Science.gov (United States)

    Hosgood, H Dean; Cawthon, Richard; He, Xingzhou; Chanock, Stephen; Lan, Qing

    2009-11-01

    Telomeres are responsible for the protection of the chromosome ends and shortened telomere length has been associated with risk of multiple cancers. Genetic variation in telomere-related genes may alter cancer risk associated with telomere length. Using lung cancer cases (n=120) and population-based controls (n=110) from Xuanwei, China, we analyzed telomere length separately and in conjunction with single nucleotide polymorphisms in the telomere maintenance genes POT1, TERT, and TERF2, which we have previously reported were associated with risk of lung cancer in this study. POT1 rs10244817, TERT rs2075786, and TERF2 rs251796 were significantly associated with lung cancer (p(trend)telomere length was not significantly associated with risk of lung cancer (OR=1.58; 95% CI=0.79-3.18) when compared to the longest tertile of telomere length. When stratified by genotype, there was a suggestion of a dose-response relationship between tertiles of telomere length and risk of lung cancer among the POT1 rs10244817 common variant carriers (OR (95% CI)=1.33 (0.47-3.75), 3.30 (1.14-9.56), respectively) but not among variant genotype carriers (p(interaction)=0.05). Our findings provide evidence that telomere length and genetic variation in telomere maintenance genes may be associated with risk of lung cancer susceptibility and warrant replication in larger studies.

  10. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  11. Genetic variations of the dihydrofolate reductase gene of Plasmodium vivax in Mandalay Division, Myanmar.

    Science.gov (United States)

    Na, Byoung-Kuk; Lee, Hyeong-Woo; Moon, Sung-Ung; In, Tae-Suk; Lin, Khin; Maung, Maung; Chung, Gyung-Tae; Lee, Jong-Koo; Kim, Tong-Soo; Kong, Yoon

    2005-07-01

    Dihydrofolate reductase (DHFR; EC1.5.1.3) is a known target enzyme for antifolate agents, which are used as alternative chemotherapeutics for chloroquine-resistant malaria. Mutations in the dhfr gene of Plasmodium vivax are thought to be associated with resistance to the antifolate drugs. In this study, we have analyzed genetic variations in the dhfr genes of clinical isolates of P. vivax (n=21) in Myanmar, to monitor antifolate resistance in this country. Sequence variations within the entire dhfr gene were highly restricted to codons from 57 to 117, and the GGDN tandem repeat region. Double (S58R and S117N/T) or quadruple mutations (F57L/I, S58R, T61M, and S117N/T), which may be closely related to the drug resistance, were recognized in most of the isolates (20/21 cases). Our results suggest that antifolate-resistant P. vivax is becoming widespread in Myanmar, as it also is in the neighboring countries in Southeast Asia. It appears that the drug resistance situation may be worsening in the country.

  12. Genetic variation of Taenia pisiformis collected from Sichuan, China, based on the mitochondrial cytochrome B gene.

    Science.gov (United States)

    Yang, Deying; Ren, Yongjun; Fu, Yan; Xie, Yue; Nie, Huaming; Nong, Xiang; Gu, Xiaobin; Wang, Shuxian; Peng, Xuerong; Yang, Guangyou

    2013-08-01

    Taenia pisiformis is one of the most important parasites of canines and rabbits. T. pisiformis cysticercus (the larval stage) causes severe damage to rabbit breeding, which results in huge economic losses. In this study, the genetic variation of T. pisiformis was determined in Sichuan Province, China. Fragments of the mitochondrial cytochrome b (cytb) (922 bp) gene were amplified in 53 isolates from 8 regions of T. pisiformis. Overall, 12 haplotypes were found in these 53 cytb sequences. Molecular genetic variations showed 98.4% genetic variation derived from intra-region. FST and Nm values suggested that 53 isolates were not genetically differentiated and had low levels of genetic diversity. Neutrality indices of the cytb sequences showed the evolution of T. pisiformis followed a neutral mode. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. These findings indicate that 53 isolates of T. pisiformis keep a low genetic variation, which provide useful knowledge for monitoring changes in parasite populations for future control strategies.

  13. Left ventricular mass in relation to genetic variation in angiotensin II receptors, renin system genes, and sodium excretion.

    Science.gov (United States)

    Kuznetsova, Tatiana; Staessen, Jan A; Thijs, Lutgarde; Kunath, Christiane; Olszanecka, Agnieszka; Ryabikov, Andrew; Tikhonoff, Valérie; Stolarz, Katarzyna; Bianchi, Giuseppe; Casiglia, Edoardo; Fagard, Robert; Brand-Herrmann, Stefan-Martin; Kawecka-Jaszcz, Kalina; Malyutina, Sofia; Nikitin, Yuri; Brand, Eva

    2004-10-26

    In the European Project On Genes in Hypertension (EPOGH), we investigated in 3 populations to what extent left ventricular mass (LVM) was associated with genetic variation in the angiotensin II receptors type 1 (AGTR1 A1166C) and type 2 (AGTR2 G1675A) while accounting for possible gene-gene interactions with the angiotensin-converting enzyme (ACE D/I) and angiotensinogen (AGT -532C/T) polymorphisms. We randomly recruited 221 nuclear families (384 parents, 431 offspring) in Cracow (Poland), Novosibirsk (Russia), and Mirano (Italy). Echocardiographic LVM was indexed to body surface area, adjusted for covariates, and subjected to multivariate analyses using generalized estimating equations and quantitative transmission disequilibrium tests in a population-based and family-based approach, respectively. For AGTR1 and AGTR2, there was no heterogeneity in the phenotype-genotype relations across populations. LVM index was unrelated to the AGTR1 A1166C polymorphism. In men, in the population- and family-based analyses, the allelic effects of the AGTR2 polymorphism on LVM index differed (P=0.01) according to sodium excretion. In women, this gene-environment interaction did not reach statistical significance. In untreated men, LVM index (4.2 g/m2 per 100 mmol) and left ventricular internal diameter (0.73 mm/100 mmol) increased (Pinfluence LVM and that salt intake modulates these genetic effects.

  14. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation.

    Science.gov (United States)

    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw

    2016-12-31

    Host-pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Common genetic variations in the CYP2R1 and GC genes are determinants of vitamin D status in Danes

    DEFF Research Database (Denmark)

    Nissen, Ioanna

    ), after 6 months intake of vitamin D3-fortified bread and milk (paper II) and in 92 participants in the VitDgen study after artificial UVB irradiation during winter (paper III). Common genetic variations in the CYP2R1 and GC genes were found to be important determinants of vitamin D status in three out...... by genetic variation in vitamin D modulating genes. Twin and family-based studies indicate that genetic variation may have an appreciable influence on vitamin D status. Moreover, several candidate gene studies including two genome-wide association studies (GWAS) have found single nucleotide polymorphisms...... (SNPs) in CYP2R1, CYP24A1, CYP27B1, C10orf88, DHCR7/NADSYN1, GC and VDR genes to be associated with vitamin D status. The main hypothesis of this work was that genetically determined variation in vitamin D metabolism would influence the effect of vitamin D sources (vitamin D...

  16. An obesity-associated FTO gene variant and increased energy intake in children.

    Science.gov (United States)

    Cecil, Joanne E; Tavendale, Roger; Watt, Peter; Hetherington, Marion M; Palmer, Colin N A

    2008-12-11

    Variation in the fat mass and obesity-associated (FTO) gene has provided the most robust associations with common obesity to date. However, the role of FTO variants in modulating specific components of energy balance is unknown. We studied 2726 Scottish children, 4 to 10 years of age, who underwent genotyping for FTO variant rs9939609 and were measured for height and weight. A subsample of 97 children was examined for possible association of the FTO variant with adiposity, energy expenditure, and food intake. In the total study group and the subsample, the A allele of rs9939609 was associated with increased weight (P=0.003 and P=0.049, respectively) and body-mass index (P=0.003 and P=0.03, respectively). In the intensively phenotyped subsample, the A allele was also associated with increased fat mass (P=0.01) but not with lean mass. Although total and resting energy expenditures were increased in children with the A allele (P=0.009 and P=0.03, respectively), resting energy expenditure was identical to that predicted for the age and weight of the child, indicating that there is no defect in metabolic adaptation to obesity in persons bearing the risk-associated allele. The A allele was associated with increased energy intake (P=0.006) independently of body weight. In contrast, the weight of food ingested by children who had the allele was similar to that in children who did not have the allele (P=0.82). The FTO variant that confers a predisposition to obesity does not appear to be involved in the regulation of energy expenditure but may have a role in the control of food intake and food choice, suggesting a link to a hyperphagic phenotype or a preference for energy-dense foods. 2008 Massachusetts Medical Society

  17. FTO gene variation and measures of body mass in an African population

    Directory of Open Access Journals (Sweden)

    Hattersley Andrew T

    2009-03-01

    Full Text Available Abstract Background Variation in the fat mass and obesity associated (FTO gene has been reproducibly associated with body mass index (BMI and obesity in populations of White European origin. Data from Asians and African-Americans is less conclusive. Methods We assessed the effect of 16 FTO polymorphisms on body mass in a large population of predominantly lean Gambians (Nmax 2208 participating in a long-term surveillance program providing contemporary and early-life anthropometric measurements. Results Sixteen FTO tagSNPs screened here, including several associated with BMI in Europeans, were not associated with birth weight (BWT, early weight gain in 1–2 year olds, BMI in adults (≥ 18 y, or weight-for-height (WFH z-score across all ages. No association was seen between genotype and WFH z-score or other measures of body mass. The confidence limits indicate that the effect size for WFH z-score never exceeded 0.17 units per allele copy for any SNP (excluding the three SNPs with allele Conclusion To our knowledge this is the first study of FTO gene variation in a well-characterised African population. Our results suggest that FTO gene variation does not influence measures of body mass in Gambians living a traditional lifestyle, or has a smaller effect than that detected in Europeans. These findings are not directly comparable to results from previous studies in African-Americans due to differences in study design and analysis. It is also possible that any effect of FTO genotype on body mass is of limited relevance in a lean population where little excess food is available, compared to similar ethnic populations where food supply is plentiful.

  18. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Directory of Open Access Journals (Sweden)

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  19. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  20. Genome-Wide Analysis Shows Increased Frequency of Copy Number Variation Deletions in Dutch Schizophrenia Patients

    NARCIS (Netherlands)

    Buizer-Voskamp, Jacobine E.; Muntjewerff, Jan-Willem; Strengman, Eric; Sabatti, Chiara; Stefansson, Hreinn; Vorstman, Jacob A. S.; Ophoff, Roel A.; GROUP investigators, [No Value

    2011-01-01

    Background: Since 2008, multiple studies have reported on copy number variations (CNVs) in schizophrenia. However, many regions are unique events with minimal overlap between studies. This makes it difficult to gain a comprehensive overview of all CNVs involved in the etiology of schizophrenia. We p

  1. Using Video Modeling to Increase Variation in the Conversation of Children with Autism

    Science.gov (United States)

    Charlop, Marjorie H.; Gilmore, Laura; Chang, Gina T.

    2009-01-01

    The present study assessed the effects of video modeling on acquisition and generalization of variation in the conversational speech of two boys with autism. A video was made showing several versions of several topics of conversation, thus providing multiple exemplars of each conversation. Video modeling consisted of showing each child a video…

  2. Promoting Increased Pitch Variation in Oral Presentations with Transient Visual Feedback

    Science.gov (United States)

    Hincks, Rebecca; Edlund, Jens

    2009-01-01

    This paper investigates learner response to a novel kind of intonation feedback generated from speech analysis. Instead of displays of pitch curves, our feedback is flashing lights that show how much pitch variation the speaker has produced. The variable used to generate the feedback is the standard deviation of fundamental frequency as measured…

  3. From Structural Variation of Gene Molecules to Chromatin Dynamics and Transcriptional Bursting

    Directory of Open Access Journals (Sweden)

    Hinrich Boeger

    2015-06-01

    Full Text Available Transcriptional activation of eukaryotic genes is accompanied, in general, by a change in the sensitivity of promoter chromatin to endonucleases. The structural basis of this alteration has remained elusive for decades; but the change has been viewed as a transformation of one structure into another, from “closed” to “open” chromatin. In contradistinction to this static and deterministic view of the problem, a dynamical and probabilistic theory of promoter chromatin has emerged as its solution. This theory, which we review here, explains observed variation in promoter chromatin structure at the level of single gene molecules and provides a molecular basis for random bursting in transcription—the conjecture that promoters stochastically transition between transcriptionally conducive and inconducive states. The mechanism of transcriptional regulation may be understood only in probabilistic terms.

  4. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  5. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2016-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  6. Variation in the sequence and modification state of the human insulin gene flanking regions.

    Science.gov (United States)

    Ullrich, A; Dull, T J; Gray, A; Philips, J A; Peter, S

    1982-04-10

    The nucleotide sequence of a highly repetitive sequence region upstream from the human insulin gene is reported. The length of this region varies between alleles in the population, and appears to be stably transmitted to the next generation in a Mendelian fashion. There is no significant correlation between the length of this sequence and two types of diabetes mellitus. We observe variation in the cleavability of a BglI recognition site downstream from the human insulin gene, which is probably due to variable nucleotide modification. This presumed modification state appears not to be inherited, and varies between tissues within an individual and between individuals for a given tissue. Both alleles in a given tissue DNA sample are modified to the same extent.

  7. Multidrug resistance 1 gene variants, pesticide exposure, and increased risk of DNA damage.

    Science.gov (United States)

    Chen, Chun-Chieh; Huang, Chun-Huang; Wu, Man-Tzu Marcie; Chou, Chia-Hsuan; Huang, Chia-Chen; Tseng, Tzu-Yen; Chang, Fang-Yu; Li, Ying-Ti; Tsai, Chun-Cheng; Wang, Tsung-Shing; Wong, Ruey-Hong

    2014-01-01

    The P-glycoprotein, encoded by the multidrug resistance (MDR)1 gene, extrudes fat-soluble compounds to the extracellular environment. However, the DNA damage of pesticides in subjects with genetic variation in MDR1 has not been investigated. In this study, the comet assay was applied to examine the extent of DNA damage in the peripheral blood of 195 fruit growers who had been exposed to pesticides and 141 unexposed controls. The MDR1 polymorphisms were identified. Questionnaires were administered to obtain demographic data and occupational history. Results showed subjects experiencing high (2.14 μm/cell, P pesticide exposure (2.18 μm/cell, P pesticide-exposed groups. Combined analysis revealed that pesticide-exposed fruit growers with MDR1 -129 TT genotype had the greatest DNA damage in the subjects with the combinations of pesticide exposure and MDR1 -129 genotypes. In conclusion, pesticide exposed individuals with susceptible MDR1 -129 genotypes may experience increased risk of DNA damage.

  8. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory.

  9. Drd4 gene polymorphisms are associated with personality variation in a passerine bird.

    Science.gov (United States)

    Fidler, Andrew E; van Oers, Kees; Drent, Piet J; Kuhn, Sylvia; Mueller, Jakob C; Kempenaers, Bart

    2007-07-22

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, genotype-environment interactions and confounding environmental factors all act to obscure genotype-personality relationships. Such problems can be addressed by measuring personality under standardized conditions and by selection experiments, with both approaches only feasible with non-human animals. Looking for similar Drd4 genotype-personality associations in a free-living bird, the great tit (Parus major), we detected 73 polymorphisms (66 SNPs, 7 indels) in the P. major Drd4 orthologue. Two of the P. major Drd4 gene polymorphisms were investigated for evidence of association with novelty-seeking behaviour: a coding region synonymous single nucleotide polymorphism (SNP830) and a 15bp indel (ID15) located 5' to the putative transcription initiation site. Frequencies of the three Drd4 SNP830 genotypes, but not the ID15 genotypes, differed significantly between two P. major lines selected over four generations for divergent levels of 'early exploratory behaviour' (EEB). Strong corroborating evidence for the significance of this finding comes from the analysis of free-living, unselected birds where we found a significant association between SNP830 genotypes and differing mean EEB levels. These findings suggest that an association between Drd4 gene polymorphisms and animal personality variation predates the divergence of the avian and mammalian lineages. Furthermore, this work heralds the possibility of following microevolutionary changes in frequencies of behaviourally relevant Drd4 polymorphisms within populations where natural selection acts differentially on different personality types.

  10. Increase in expression level of alpha-tubulin gene in Arabidopsis seedlings under hypergravity conditions.

    Science.gov (United States)

    Saito, Yuka; Soga, Kouichi; Wakabayashi, Kazuyuki; Hoson, Takayuki

    2003-10-01

    Under hypergravity conditions, elongation growth of plant shoots is suppressed. The analysis of the changes in gene expression by hypergravity treatment in Arabidopsis hypocotyls by the differential display method showed that a gene encoding alpha-tubulin, which is a component of microtubules, was up-regulated by hypergravity. In Arabidopsis six genes encoding alpha-tubulin (TUA1-TUA6) have been identified. In the present study, we examined the dose-response and the time course relations of the changes in the expression of all six alpha-tubulin genes in Arabidopsis hypocotyls grown under hypergravity conditions. The expression levels of all six alpha-tubulin genes, TUA1-TUA6, were increased by increasing gravity, although the extent was variable among genes. The increase in expression of all alpha-tubulin genes was detected within a few hours, when the seedlings grown at 1 g were transferred to 300 g condition. These results suggest that Arabidopsis hypocotyls regulate the expression level of six alpha-tubulin genes promptly in response to gravity stimuli. The increase in the amount of microtubules due to the activation of tubulin gene expression may be involved in the regulation by gravity signal of shoot growth.

  11. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. ...... imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). CONCLUSION: These results, generated on a large cohort of women, revealed associations between inherited cellular transport gene variants and risk of EOC histologic subtypes.......BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes....... As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. METHODS: In total, DNA samples were obtained from 14,525 case subjects with invasive EOC...

  12. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  13. Promoting Increased Pitch Variation in Oral Presentations with Transient Visual Feedback

    OpenAIRE

    Rebecca Hincks; Jens Edlund

    2009-01-01

    This paper investigates learner response to a novel kind of intonation feedback generated from speech analysis. Instead of displays of pitch curves, our feedback is flashing lights that show how much pitch variation the speaker has produced. The variable used to generate the feedback is the standard deviation of fundamental frequency as measured in semitones. Flat speech causes the system to show yellow lights, while more expressive speech that has used pitch to give focus to any part of an u...

  14. Gene expression profiling of Spodoptera frugiperda hemocytes and fat body using cDNA microarray reveals polydnavirus-associated variations in lepidopteran host genes transcript levels

    Directory of Open Access Journals (Sweden)

    Feyereisen R

    2006-06-01

    Full Text Available Abstract Background Genomic approaches provide unique opportunities to study interactions of insects with their pathogens. We developed a cDNA microarray to analyze the gene transcription profile of the lepidopteran pest Spodoptera frugiperda in response to injection of the polydnavirus HdIV associated with the ichneumonid wasp Hyposoter didymator. Polydnaviruses are associated with parasitic ichneumonoid wasps and are required for their development within the lepidopteran host, in which they act as potent immunosuppressive pathogens. In this study, we analyzed transcriptional variations in the two main effectors of the insect immune response, the hemocytes and the fat body, after injection of filter-purified HdIV. Results Results show that 24 hours post-injection, about 4% of the 1750 arrayed host genes display changes in their transcript levels with a large proportion (76% showing a decrease. As a comparison, in S. frugiperda fat body, after injection of the pathogenic JcDNV densovirus, 8 genes display significant changes in their transcript level. They differ from the 7 affected by HdIV and, as opposed to HdIV injection, are all up-regulated. Interestingly, several of the genes that are modulated by HdIV injection have been shown to be involved in lepidopteran innate immunity. Levels of transcripts related to calreticulin, prophenoloxidase-activating enzyme, immulectin-2 and a novel lepidopteran scavenger receptor are decreased in hemocytes of HdIV-injected caterpillars. This was confirmed by quantitative RT-PCR analysis but not observed after injection of heat-inactivated HdIV. Conversely, an increased level of transcripts was found for a galactose-binding lectin and, surprisingly, for the prophenoloxidase subunits. The results obtained suggest that HdIV injection affects transcript levels of genes encoding different components of the host immune response (non-self recognition, humoral and cellular responses. Conclusion This analysis of the

  15. Polymorphic variation of genes in the fibrinolytic system and the risk of ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Yaakov Bentov

    Full Text Available INTRODUCTION: The etiology of ovarian cancer is largely unknown. One hypothesis is that the inefficient removal of the blood clots and fibrin products which are deposited in the vicinity of the ovary by retrograde menstruation might be associated with an increased risk of ovarian cancer. Several single nucleotide polymorphisms within genes which comprise the fibrinolytic system have been shown to have functional effects on the rate of blood clot degradation. These were considered to be candidate genes in the present study. AIM: We studied the genotype distributions of 12 functional SNPs of four genes (tPA, uPA PAI1 and TAFI among 775 ovarian cancer cases and 889 controls. RESULTS: No significant associations were seen between any of the ten SNPs and the risk of ovarian cancer as a whole, or in any histologic subgroup. DISCUSSION: Germline known functional variants of genes in the fibrinolytic system are not associated with risk of ovarian cancer.

  16. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    LENUS (Irish Health Repository)

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  17. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Indian Academy of Sciences (India)

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  18. The impact of osteopontin gene variations on multiple sclerosis development and progression.

    Science.gov (United States)

    Comi, Cristoforo; Cappellano, Giuseppe; Chiocchetti, Annalisa; Orilieri, Elisabetta; Buttini, Sara; Ghezzi, Laura; Galimberti, Daniela; Guerini, Franca; Barizzone, Nadia; Perla, Franco; Leone, Maurizio; D'Alfonso, Sandra; Caputo, Domenico; Scarpini, Elio; Cantello, Roberto; Dianzani, Umberto

    2012-01-01

    Osteopontin is a proinflammatory molecule, modulating TH1 and TH17 responses. Several reports suggest its involvement in multiple sclerosis (MS) pathogenesis. We previously reported that OPN gene variations at the 3' end are a predisposing factor for MS development and evolution. In this paper, we extended our analysis to a gene variation at the 5' end on the -156G > GG single nucleotide polymorphism (SNP) and replicated our previous findings at the 3' end on the +1239A > C SNP. We found that only +1239A > C SNP displayed a statistically significant association with MS development, but both +1239A > C and -156G > GG had an influence on MS progression, since patients homozygous for both +1239A and -156GG alleles displayed slower progression of disability and slower switch to secondary progression than those carrying +1239C and/or -156G and those homozygous for +1239A only. Moreover, patients homozygous for +1239A also displayed a significantly lower relapse rate than those carrying +1239C, which is in line with the established role of OPN in MS relapses.

  19. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Directory of Open Access Journals (Sweden)

    Helle Ruff Laursen

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  20. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  1. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A

  2. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the

  3. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A a

  4. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    2012-01-01

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the pre

  5. Multidrug Resistance 1 Gene Variants, Pesticide Exposure, and Increased Risk of DNA Damage

    OpenAIRE

    Chun-Chieh Chen; Chun-Huang Huang; Man-Tzu Marcie Wu; Chia-Hsuan Chou; Chia-Chen Huang; Tzu-Yen Tseng; Fang-Yu Chang; Ying-Ti Li; Chun-Cheng Tsai; Tsung-Shing Wang; Ruey-Hong Wong

    2014-01-01

    The P-glycoprotein, encoded by the multidrug resistance (MDR)1 gene, extrudes fat-soluble compounds to the extracellular environment. However, the DNA damage of pesticides in subjects with genetic variation in MDR1 has not been investigated. In this study, the comet assay was applied to examine the extent of DNA damage in the peripheral blood of 195 fruit growers who had been exposed to pesticides and 141 unexposed controls. The MDR1 polymorphisms were identified. Questionnaires were administ...

  6. Pseudomonas aeruginosa AES-1 exhibits increased virulence gene expression during chronic infection of cystic fibrosis lung.

    Directory of Open Access Journals (Sweden)

    Sharna Naughton

    Full Text Available Pseudomonas aeruginosa, the leading cause of morbidity and mortality in people with cystic fibrosis (CF, adapts for survival in the CF lung through both mutation and gene expression changes. Frequent clonal strains such as the Australian Epidemic Strain-1 (AES-1, have increased ability to establish infection in the CF lung and to superimpose and replace infrequent clonal strains. Little is known about the factors underpinning these properties. Analysis has been hampered by lack of expression array templates containing CF-strain specific genes. We sequenced the genome of an acute infection AES-1 isolate from a CF infant (AES-1R and constructed a non-redundant micro-array (PANarray comprising AES-1R and seven other sequenced P. aeruginosa genomes. The unclosed AES-1R genome comprised 6.254Mbp and contained 6957 putative genes, including 338 not found in the other seven genomes. The PANarray contained 12,543 gene probe spots; comprising 12,147 P. aeruginosa gene probes, 326 quality-control probes and 70 probes for non-P. aeruginosa genes, including phage and plant genes. We grew AES-1R and its isogenic pair AES-1M, taken from the same patient 10.5 years later and not eradicated in the intervening period, in our validated artificial sputum medium (ASMDM and used the PANarray to compare gene expression of both in duplicate. 675 genes were differentially expressed between the isogenic pairs, including upregulation of alginate, biofilm, persistence genes and virulence-related genes such as dihydroorotase, uridylate kinase and cardiolipin synthase, in AES-1M. Non-PAO1 genes upregulated in AES-1M included pathogenesis-related (PAGI-5 genes present in strains PACS2 and PA7, and numerous phage genes. Elucidation of these genes' roles could lead to targeted treatment strategies for chronically infected CF patients.

  7. Significantly increased risk of carotid atherosclerosis with arsenic exposure and polymorphisms in arsenic metabolism genes

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, Yi-Chen [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, 250 Wusing St., Taipei 11031, Taiwan (China); Lien, Li-Ming [Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Department of Neurology, Shin Kong WHS Memorial Hospital, Taipei, Taiwan (China); Chung, Wen-Ting [Department of Neurology, Wanfang Hospital, Taipei Medical University, Taipei, Taiwan (China); Graduate Institute of Clinical Medicine, Taipei Medical University, Taipei, Taiwan (China); Hsieh, Fang-I; Hsieh, Pei-Fan [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, 250 Wusing St., Taipei 11031, Taiwan (China); Wu, Meei-Maan [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, 250 Wusing St., Taipei 11031, Taiwan (China); Graduate Institute of Basic Medicine, College of Medicine, Fu-Jen Catholic University, Taipei, Taiwan (China); Tseng, Hung-Pin [Department of Neurology, Lotung Poh-Ai Hospital, I-Lan, Taiwan (China); Chiou, Hung-Yi, E-mail: hychiou@tmu.edu.tw [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, 250 Wusing St., Taipei 11031, Taiwan (China); Chen, Chien-Jen [Genomics Research Center, Academia Sinica, Taipei, Taiwan (China)

    2011-08-15

    Individual susceptibility to arsenic-induced carotid atherosclerosis might be associated with genetic variations in arsenic metabolism. The purpose of this study is to explore the interaction effect on risk of carotid atherosclerosis between arsenic exposure and risk genotypes of purine nucleoside phosphorylase (PNP), arsenic (+3) methyltransferase (As3MT), and glutathione S-transferase omega 1 (GSTO1) and omega 2 (GSTO2). A community-based case-control study was conducted in northeastern Taiwan to investigate the arsenic metabolic-related genetic susceptibility to carotid atherosclerosis. In total, 863 subjects, who had been genotyped and for whom the severity of carotid atherosclerosis had been determined, were included in the present study. Individual well water was collected and arsenic concentration determined using hydride generation combined with flame atomic absorption spectrometry. The result showed that a significant dose-response trend (P=0.04) of carotid atherosclerosis risk associated with increasing arsenic concentration. Non-significant association between genetic polymorphisms of PNP Gly51Ser, Pro57Pro, As3MT Met287Thr, GSTO1 Ala140Asp, and GSTO2 A-183G and the risk for development of carotid atherosclerosis were observed. However, the significant interaction effect on carotid atherosclerosis risk was found for arsenic exposure (>50 {mu}g/l) and the haplotypes of PNP (p=0.0115). A marked elevated risk of carotid atherosclerosis was observed in subjects with arsenic exposure of >50 {mu}g/l in drinking water and those who carried the PNP A-T haplotype and at least either of the As3MT risk polymorphism or GSTO risk haplotypes (OR, 6.43; 95% CI, 1.79-23.19). In conclusion, arsenic metabolic genes, PNP, As3MT, and GSTO, may exacerbate the formation of atherosclerosis in individuals with high levels of arsenic concentration in well water (>50 {mu}g/l). - Highlights: {yields}Arsenic metabolic genes might be associated with carotid atherosclerosis. {yields

  8. Expression of flavonoid biosynthesis genes vis-à-vis rutin content variation in different growth stages of Fagopyrum species.

    Science.gov (United States)

    Gupta, Nidhi; Sharma, Sunil K; Rana, Jai C; Chauhan, Rajinder S

    2011-11-15

    Buckwheat is one of the field crops with the highest concentration of rutin, an important flavonoid of medicinal value. Two species of buckwheat, Fagopyrum esculentum and Fagopyrum tataricum, are the major sources of rutin. Seeds of latter contain 40-50× higher rutin compared to the former. The physiological and molecular bases of rutin content variation between Fagopyrum species are not known. The current study investigated the differences in rutin content in seeds and in other tissues and growth stages of two Fagopyrum species, and also correlated those differences with the expression of flavonoid pathway genes. The analysis of rutin content dynamics at different growth stages, S1-S9 (from seed germination to mature seed formation) of Fagopyrum species revealed that rutin content was higher during seedling stages of F. tataricum (3.5 to 4.6-fold) compared to F. esculentum and then increased exponentially from stages S3 to S6 (different leaf maturing stages and inflorescence) of F. esculentum, whereas it fluctuated in F. tataricum. The rutin content was highest in the inflorescence stage (S6) of both species, with a relatively higher biosynthesis and accumulation during post-flowering stages of F. tataricum compared to F. esculentum. The expression of flavonoid pathway genes, through qRT-PCR, in different growth stages vis-à-vis rutin content variation showed differential expression for four genes, PAL, CHS, CHI and FLS with the amounts of transcripts relatively higher in F. tataricum compared to F. esculentum, thereby, correlating these genes with the biosynthesis and accumulation of rutin. The expression of PAL was highest, 7.69 and 8.96-fold in Stages 2 (seedling stage) and 9 (fully developed seeds) of F. tataricum compared to F. esculentum, respectively. The expression of the CHS gene correlated with the rutin content because it was highest in the flowers (S6) and fully developed seeds (S9) of both Fagopyrum species, with relatively higher transcript amounts

  9. Investigating the potential role of genetic and epigenetic variation of DNA methyltransferase genes in hyperplastic polyposis syndrome.

    Directory of Open Access Journals (Sweden)

    Musa Drini

    Full Text Available BACKGROUND: Hyperplastic Polyposis Syndrome (HPS is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC. At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP, potentially linked to aberrant DNA methyltransferase (DNMT activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT, and negative regulators of Wnt signaling (such as WIF1. In this study, we investigated the potential for interaction of genetic and epigenetic variation in DNMT genes, in the aetiology of HPS. METHODS: We utilized high resolution melting (HRM analysis to screen 45 cases with HPS for novel sequence variants in DNMT1, DNMT3A, DNMT3B, and DNMT3L. 21 polyps from 13 patients were screened for BRAF and KRAS mutations, with assessment of promoter methylation in the DNMT1, DNMT3A, DNMT3B, DNMT3L MLH1, MGMT, and WIF1 gene promoters. RESULTS: No pathologic germline mutations were observed in any DNA-methyltransferase gene. However, the T allele of rs62106244 (intron 10 of DNMT1 gene was over-represented in cases with HPS (p<0.01 compared with population controls. The DNMT1, DNMT3A and DNMT3B promoters were unmethylated in all instances. Interestingly, the DNMT3L promoter showed low levels of methylation in polyps and normal colonic mucosa relative to matched disease free cells with methylation level negatively correlated to expression level in normal colonic tissue. DNMT3L promoter hypomethylation was more often found in polyps harbouring KRAS mutations (p = 0.0053. BRAF mutations were common (11 out of 21 polyps, whilst KRAS mutations were identified in 4 of 21 polyps. CONCLUSIONS: Genetic or epigenetic alterations in DNMT genes do not appear to be associated with HPS, but further investigation of genetic variation at rs62106244 is justified given the high frequency of the minor allele in this case series.

  10. Polymorphic genes of major effect: consequences for variation, selection and evolution in Arabidopsis thaliana.

    Science.gov (United States)

    Stinchcombe, John R; Weinig, Cynthia; Heath, Katy D; Brock, Marcus T; Schmitt, Johanna

    2009-07-01

    The importance of genes of major effect for evolutionary trajectories within and among natural populations has long been the subject of intense debate. For example, if allelic variation at a major-effect locus fundamentally alters the structure of quantitative trait variation, then fixation of a single locus can have rapid and profound effects on the rate or direction of subsequent evolutionary change. Using an Arabidopsis thaliana RIL mapping population, we compare G-matrix structure between lines possessing different alleles at ERECTA, a locus known to affect ecologically relevant variation in plant architecture. We find that the allele present at ERECTA significantly alters G-matrix structure-in particular the genetic correlations between branch number and flowering time traits-and may also modulate the strength of natural selection on these traits. Despite these differences, however, when we extend our analysis to determine how evolution might differ depending on the ERECTA allele, we find that predicted responses to selection are similar. To compare responses to selection between allele classes, we developed a resampling strategy that incorporates uncertainty in estimates of selection that can also be used for statistical comparisons of G matrices.

  11. Increase in winter haze over eastern China in recent decades: Roles of variations in meteorological parameters and anthropogenic emissions: INCREASE IN WINTER HAZE IN EASTERN CHINA

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yang [Atmospheric Science and Global Change Division, Pacific Northwest National Laboratory, Richland Washington USA; Liao, Hong [School of Environmental Science and Engineering, Nanjing University of Information Science and Technology, Nanjing China; Joint International Research Laboratory of Climate and Environment Change, Nanjing University of Information Science and Technology, Nanjing China; Lou, Sijia [Atmospheric Science and Global Change Division, Pacific Northwest National Laboratory, Richland Washington USA

    2016-11-05

    The increase in winter haze over eastern China in recent decades due to variations in meteorological parameters and anthropogenic emissions was quantified using observed atmospheric visibility from the National Climatic Data Center Global Summary of Day database for 1980–2014 and simulated PM2.5 concentrations for 1985–2005 from the Goddard Earth Observing System (GEOS) chemical transport model (GEOS-Chem). Observed winter haze days averaged over eastern China (105–122.5°E, 20–45°N) increased from 21 d in 1980 to 42 d in 2014, and from 22 to 30 d between 1985 and 2005. The GEOS-Chem model captured the increasing trend of winter PM2.5 concentrations for 1985–2005, with concentrations averaged over eastern China increasing from 16.1 μg m-3 in 1985 to 38.4 μg m-3 in 2005. Considering variations in both anthropogenic emissions and meteorological parameters, the model simulated an increase in winter surface-layer PM2.5 concentrations of 10.5 (±6.2) μg m-3 decade-1 over eastern China. The increasing trend was only 1.8 (±1.5) μg m-3 decade-1 when variations in meteorological parameters alone were considered. Among the meteorological parameters, the weakening of winds by -0.09 m s-1 decade-1 over 1985–2005 was found to be the dominant factor leading to the decadal increase in winter aerosol concentrations and haze days over eastern China during recent decades.

  12. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  13. Neuropeptide Y (NPY): genetic variation in the human promoter alters glucocorticoid signaling, yielding increased NPY secretion and stress responses.

    Science.gov (United States)

    Zhang, Kuixing; Rao, Fangwen; Miramontes-Gonzalez, Jose Pablo; Hightower, C Makena; Vaught, Brian; Chen, Yuhong; Greenwood, Tiffany A; Schork, Andrew J; Wang, Lei; Mahata, Manjula; Stridsberg, Mats; Khandrika, Srikrishna; Biswas, Nilima; Fung, Maple M; Waalen, Jill; Middelberg, Rita P; Heath, Andrew C; Montgomery, Grant W; Martin, Nicholas G; Whitfield, John B; Baker, Dewleen G; Schork, Nicholas J; Nievergelt, Caroline M; O'Connor, Daniel T

    2012-10-23

    This study sought to understand whether genetic variation at the Neuropeptide Y (NPY) locus governs secretion and stress responses in vivo as well as NPY gene expression in sympathochromaffin cells. The NPY is a potent pressor peptide co-released with catecholamines during stress by sympathetic axons. Genome-wide linkage on NPY secretion identified a LOD (logarithm of the odds ratio) peak spanning the NPY locus on chromosome 7p15. Our approach began with genomics (linkage and polymorphism determination), extended into NPY genetic control of heritable stress traits in twin pairs, established transcriptional mechanisms in transfected chromaffin cells, and concluded with observations on blood pressure (BP) in the population. Systematic polymorphism tabulation at NPY (by re-sequencing across the locus: promoter, 4 exons, exon/intron borders, and untranslated regions; on 2n = 160 chromosomes of diverse biogeographic ancestries) identified 16 variants, of which 5 were common. We then studied healthy twin/sibling pairs (n = 399 individuals), typing 6 polymorphisms spanning the locus. Haplotype and single nucleotide polymorphism analyses indicated that proximal promoter variant ∇-880Δ (2-bp TG/-, Ins/Del, rs3037354) minor/Δ allele was associated with several heritable (h(2)) stress traits: higher NPY secretion (h(2) = 73 ± 4%) as well as greater BP response to environmental (cold) stress, and higher basal systemic vascular resistance. Association of ∇-880Δ and plasma NPY was replicated in an independent sample of 361 healthy young men, with consistent allelic effects; genetic variation at NPY also associated with plasma NPY in another independent series of 2,212 individuals derived from Australia twin pairs. Effects of allele -880Δ to increase NPY expression were directionally coordinate in vivo (on human traits) and in cells (transfected NPY promoter/luciferase reporter activity). Promoter -880Δ interrupts a novel glucocorticoid response element motif, an effect

  14. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt

    2011-01-01

    Recently, two large, and independent genome wide association studies of late-onset Alzheimer's disease (AD) established association with the same rs11136000 variation in the clusterin (CLU) gene. In addition, one variation, rs3851179, in the phosphatidylinositol binding clathrin assembly protein...... (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...

  15. Autism and increased paternal age related changes in global levels of gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Mark D Alter

    Full Text Available A causal role of mutations in multiple general transcription factors in neurodevelopmental disorders including autism suggested that alterations in global levels of gene expression regulation might also relate to disease risk in sporadic cases of autism. This premise can be tested by evaluating for changes in the overall distribution of gene expression levels. For instance, in mice, variability in hippocampal-dependent behaviors was associated with variability in the pattern of the overall distribution of gene expression levels, as assessed by variance in the distribution of gene expression levels in the hippocampus. We hypothesized that a similar change in variance might be found in children with autism. Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL of children with autism (n = 82 and controls (n = 64. Variance in the distribution of gene expression levels from each microarray was compared between groups of children. Also tested was whether a risk factor for autism, increased paternal age, was associated with variance. A decrease in the variance in the distribution of gene expression levels in PBL was associated with the diagnosis of autism and a risk factor for autism, increased paternal age. Traditional approaches to microarray analysis of gene expression suggested a possible mechanism for decreased variance in gene expression. Gene expression pathways involved in transcriptional regulation were down-regulated in the blood of children with autism and children of older fathers. Thus, results from global and gene specific approaches to studying microarray data were complimentary and supported the hypothesis that alterations at the global level of gene expression regulation are related to autism and increased paternal age. Global regulation of transcription, thus, represents a possible point of convergence for multiple etiologies of autism and other

  16. Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation.

    Science.gov (United States)

    Zhao, Yan; Huang, Jin; Wang, Zhizheng; Jing, Shengli; Wang, Yang; Ouyang, Yidan; Cai, Baodong; Xin, Xiu-Fang; Liu, Xin; Zhang, Chunxiao; Pan, Yufang; Ma, Rui; Li, Qiaofeng; Jiang, Weihua; Zeng, Ya; Shangguan, Xinxin; Wang, Huiying; Du, Bo; Zhu, Lili; Xu, Xun; Feng, Yu-Qi; He, Sheng Yang; Chen, Rongzhi; Zhang, Qifa; He, Guangcun

    2016-10-24

    Brown planthopper (BPH), Nilaparvata lugens Stål, is one of the most devastating insect pests of rice (Oryza sativa L.). Currently, 30 BPH-resistance genes have been genetically defined, most of which are clustered on specific chromosome regions. Here, we describe molecular cloning and characterization of a BPH-resistance gene, BPH9, mapped on the long arm of rice chromosome 12 (12L). BPH9 encodes a rare type of nucleotide-binding and leucine-rich repeat (NLR)-containing protein that localizes to the endomembrane system and causes a cell death phenotype. BPH9 activates salicylic acid- and jasmonic acid-signaling pathways in rice plants and confers both antixenosis and antibiosis to BPH. We further demonstrated that the eight BPH-resistance genes that are clustered on chromosome 12L, including the widely used BPH1, are allelic with each other. To honor the priority in the literature, we thus designated this locus as BPH1/9 These eight genes can be classified into four allelotypes, BPH1/9-1, -2, -7, and -9 These allelotypes confer varying levels of resistance to different biotypes of BPH. The coding region of BPH1/9 shows a high level of diversity in rice germplasm. Homologous fragments of the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains exist, which might have served as a repository for generating allele diversity. Our findings reveal a rice plant strategy for modifying the genetic information to gain the upper hand in the struggle against insect herbivores. Further exploration of natural allelic variation and artificial shuffling within this gene may allow breeding to be tailored to control emerging biotypes of BPH.

  17. Genetic variation in the Catechol-O-Methyltransferase (COMT gene and morphine requirements in cancer patients with pain

    Directory of Open Access Journals (Sweden)

    Kaasa Stein

    2008-12-01

    Full Text Available Abstract Background Genetic variation contributes to differences in pain sensitivity and response to different analgesics. Catecholamines are involved in the modulation of pain and are partly metabolized by the catechol-O-methyltransferase (COMT enzyme. Genetic variability in the COMT gene may therefore contribute to differences in pain sensitivity and response to analgesics. It is shown that a polymorphism in the COMT gene, Rs4680 (Val158Met, influence pain sensitivity in human experimental pain and the efficacy for morphine in cancer pain treatment. In this study we wanted to investigate if variability in other regions in the COMT gene also contributes to interindividual variability in morphine efficacy. Results We genotyped 11 single nucleotide polymorphisms (SNPs throughout the COMT gene, and constructed haplotypes from these 11 SNPs, which were in Hardy-Weinberg equilibrium. We compared both genotypes and haplotypes against pharmacological, demographical and patient symptoms measurements in a Caucasian cancer patient cohort (n = 197 receiving oral morphine treatment for cancer pain. There were two frequent haplotypes (34.5% and 17.8% in our cohort. Multivariate analyses showed that patients carrying the most frequent haplotype (34.5% needed lower morphine doses than patients not carrying the haplotype, with a reduction factor of 0.71 (p = 0.005. On the allele level, carriers of alleles for six of the SNPs show weak associations in respect to morphine dose and the alleles associated with the lowest morphine doses constitute part of the most frequent haplotype. Conclusion This study suggests that genetic variability in the COMT gene influence the efficacy of morphine in cancer patients with pain, and that increased understanding of this variability is reached by expanding from analyses of single SNPs to haplotype construction and analyses.

  18. Genetic variation in exon 5 of troponin - I gene in hypertrophic cardiomyopathy cases

    Directory of Open Access Journals (Sweden)

    Annapurna S

    2007-01-01

    Full Text Available Background: Cardiomyopathies are a heterogeneous group of heart muscle disorders and are classified as 1 Hypertrophic Cardiomyopathy (HCM 2 Dilated cardiomyopathy (DCM 3 Restrictive cardiomyopathy (RCM and 4 Arrhythmogenic right ventricular dysplasia (ARVD as per WHO classification, of which HCM and DCM are common. HCM is a complex but relatively common form of inherited heart muscle disease with prevalence of 1 in 500 individuals and is commonly associated with sarcomeric gene mutations. Cardiac muscle troponin I (TNNI-3 is one such sarcomeric protein and is a subunit of the thin filament-associated troponin-tropomyosin complex involved in calcium regulation of skeletal and cardiac muscle contraction. Mutations in this gene were found to be associated with a history of sudden cardiac death in HCM patients. Aim: Therefore the present study aims to identify for mutations associated with troponin I gene in a set of HCM patients from Indian population. Materials and Methods: Mutational analyses of 92 HCM cases were carried out following PCR based SSCP analysis. Results: The study revealed band pattern variation in 3 cases from a group of 92 HCM patients. This band pattern variation, on sequencing revealed base changes, one at nt 2560 with G>T transversion in exon-5 region with a wobble and others at nt 2479 and nt 2478 with G>C and C>G transversions in the intronic region upstream of the exon 5 on sequencing. Further analysis showed that one of the probands showed apical form of hypertrophy, two others showing asymmetric septal hypertrophy. Two of these probands showed family history of the condition. Conclusions: Hence, the study supports earlier reports of involvement of TNNI-3 in the causation of apical and asymmetrical forms of hypertrophy.

  19. Genomic imprinting variations in the mouse type 3 deiodinase gene between tissues and brain regions.

    Science.gov (United States)

    Martinez, M Elena; Charalambous, Marika; Saferali, Aabida; Fiering, Steven; Naumova, Anna K; St Germain, Donald; Ferguson-Smith, Anne C; Hernandez, Arturo

    2014-11-01

    The Dio3 gene, which encodes for the type 3 deiodinase (D3), controls thyroid hormone (TH) availability. The lack of D3 in mice results in tissue overexposure to TH and a broad neuroendocrine phenotype. Dio3 is an imprinted gene, preferentially expressed from the paternally inherited allele in the mouse fetus. However, heterozygous mice with paternal inheritance of the inactivating Dio3 mutation exhibit an attenuated phenotype when compared with that of Dio3 null mice. To investigate this milder phenotype, the allelic expression of Dio3 was evaluated in different mouse tissues. Preferential allelic expression of Dio3 from the paternal allele was observed in fetal tissues and neonatal brain regions, whereas the biallelic Dio3 expression occurred in the developing eye, testes, and cerebellum and in the postnatal brain neocortex, which expresses a larger Dio3 mRNA transcript. The newborn hypothalamus manifests the highest degree of Dio3 expression from the paternal allele, compared with other brain regions, and preferential allelic expression of Dio3 in the brain relaxed in late neonatal life. A methylation analysis of two regulatory regions of the Dio3 imprinted domain revealed modest but significant differences between tissues, but these did not consistently correlate with the observed patterns of Dio3 allelic expression. Deletion of the Dio3 gene and promoter did not result in significant changes in the tissue-specific patterns of Dio3 allelic expression. These results suggest the existence of unidentified epigenetic determinants of tissue-specific Dio3 imprinting. The resulting variation in the Dio3 allelic expression between tissues likely explains the phenotypic variation that results from paternal Dio3 haploinsufficiency.

  20. Identification, expression and variation of the GNPDA2 gene, and its association with body weight and fatness traits in chicken.

    Science.gov (United States)

    Ouyang, Hongjia; Zhang, Huan; Li, Weimin; Liang, Sisi; Jebessa, Endashaw; Abdalla, Bahareldin A; Nie, Qinghua

    2016-01-01

    Background. The GNPDA2 (glucosamine-6-phosphate deaminase 2) gene is a member of Glucosamine-6-phosphate (GlcN6P) deaminase subfamily, which encoded an allosteric enzyme of GlcN6P. Genome-wide association studies (GWAS) have shown that variations of human GNPDA2 are associated with body mass index and obesity risk, but its function and metabolic implications remain to be elucidated.The object of this study was to characterize the gene structure, expression, and biological functions of GNPDA2 in chickens. Methods. Variant transcripts of chicken GNPDA2 and their expression were investigated using rapid amplification of cDNA ends (RACE) system and real-time quantitative PCR technology. We detected the GNPDA2 expression in hypothalamic, adipose, and liver tissue of Xinghua chickens with fasting and high-glucose-fat diet treatments, and performed association analysis of variations of GNPDA2 with productive traits in chicken. The function of GNPDA2 was further studied by overexpression and small interfering RNA (siRNA) methods in chicken preadipocytes. Results.Four chicken GNPDA2 transcripts (cGNPDA2-a∼cGNPDA2-d) were identified in this study. The complete transcript GNPDA2-a was predominantly expressed in adipose tissue (subcutaneous fat and abdominal fat), hypothalamus, and duodenum. In fasting chickens, the mRNA level of GNPDA2 was decreased by 58.8% (P Chicken fed a high-glucose-fat diet increased GNPDA2 gene expression about 2-fold higher in adipose tissue (P chicken (P chickens.

  1. Genetic variation in the NBS1, MRE11, RAD50 and BLM genes and susceptibility to non-Hodgkin lymphoma

    Directory of Open Access Journals (Sweden)

    Gascoyne Randy D

    2009-11-01

    Full Text Available Abstract Background Translocations are hallmarks of non-Hodgkin lymphoma (NHL genomes. Because lymphoid cell development processes require the creation and repair of double stranded breaks, it is not surprising that disruption of this type of DNA repair can cause cancer. The members of the MRE11-RAD50-NBS1 (MRN complex and BLM have central roles in maintenance of DNA integrity. Severe mutations in any of these genes cause genetic disorders, some of which are characterized by increased risk of lymphoma. Methods We surveyed the genetic variation in these genes in constitutional DNA of NHL patients by means of gene re-sequencing, then conducted genetic association tests for susceptibility to NHL in a population-based collection of 797 NHL cases and 793 controls. Results 114 SNPs were discovered in our sequenced samples, 61% of which were novel and not previously reported in dbSNP. Although four variants, two in RAD50 and two in NBS1, showed association results suggestive of an effect on NHL, they were not significant after correction for multiple tests. Conclusion These results suggest an influence of RAD50 and NBS1 on susceptibility to diffuse large B-cell lymphoma and marginal zone lymphoma. Larger association and functional studies could confirm such a role.

  2. Copy number variations of the ATP-binding cassette transporter ABCC6 gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Kringen Marianne K

    2012-08-01

    Full Text Available Abstract Background The ATP-binding cassette transporter ABCC6 gene is located on chromosome 16 between its two pseudogenes (ABCC6P1 and ABCC6P2. Previously, we have shown that ABCC6P1 is transcribed and affects ABCC6 at the transcriptional level. In this study we aimed to determine copy number variations of ABCC6, ABCC6P1 and ABCC6P2 in different populations. Moreover, we sought to study the transcription pattern of ABCC6 and ABCC6 pseudogenes in 39 different human tissues. Findings Genomic DNA from healthy individuals from five populations, Chinese (n = 24, Middle East (n = 20, Mexicans (n = 24, Caucasians (n = 50 and Africans (n = 24, were examined for copy number variations of ABCC6 and its pseudogenes by pyrosequencing and quantitative PCR. Copy number variation of ABCC6 was very rare (2/142; 1.4%. However, one or three copies of ABCC6P1 were relatively common (3% and 8%, respectively. Only one person had a single copy of ABCC6P2 while none had three copies. In Chinese, deletions or duplications of ABCC6P1 were more frequent than in any other population (9/24; 37.5%. The transcription pattern of ABCC6P2 was highly similar to ABCC6 and ABCC6P1, with highest transcription in liver and kidney. Interestingly, the total transcription level of pseudogenes, ABCC6P1 + ABCC6P2, was higher than ABCC6 in most tissues, including liver and kidney. Conclusions Copy number variations of the ABCC6 pseudogenes are quite common, especially in populations of Chinese ancestry. The expression pattern of ABCC6P2 in 39 human tissues was highly similar to that of ABCC6 and ABCC6P1 suggesting similar regulatory mechanisms for ABCC6 and its pseudogenes.

  3. Genes and quantitative genetic variation involved with senescence in cells, organs and the whole plant

    Directory of Open Access Journals (Sweden)

    Benoit ePujol

    2015-02-01

    Full Text Available Senescence, the deterioration of morphological, physiological and reproductive functions with age that ends with the death of the organism, was widely studied in plants. Genes were identified that are linked to the deterioration of cells, organs and the whole plant. It is however unclear whether those genes are the source of age dependent deterioration or get activated to regulate such deterioration. Furthermore, it is also unclear whether such genes are active as a direct consequence of age or because they are specifically involved in some developmental stages. At the individual level, it is the relationship between quantitative genetic variation and age that can be used to detect the genetic signature of senescence. Surprisingly, the latter approach was only scarcely applied to plants. This may be the consequence of the demanding requirements for such approaches and/or the fact that most research interest was directed towards plants that avoid senescence. Here, I review those aspects in turn and call for an integrative genetic theory of senescence in plants. Such conceptual development would have implications for the management of plant genetic resources and generate progress on fundamental questions raised by ageing research.

  4. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    Institute of Scientific and Technical Information of China (English)

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  5. Overexpression of UDP-glucose pyrophosphorylase gene could increase cellulose content in Jute (Corchorus capsularis L.).

    Science.gov (United States)

    Zhang, Gaoyang; Qi, Jianmin; Xu, Jiantang; Niu, Xiaoping; Zhang, Yujia; Tao, Aifen; Zhang, Liwu; Fang, Pingping; Lin, Lihui

    2013-12-13

    In this study, the full-length cDNA of the UDP-glucose pyrophosphorylase gene was isolated from jute by homologous cloning (primers were designed according to the sequence of UGPase gene of other plants) and modified RACE techniques; the cloned gene was designated CcUGPase. Using bioinformatic analysis, the gene was identified as a member of the UGPase gene family. Real-time PCR analysis revealed differential spatial and temporal expression of the CcUGPase gene, with the highest expression levels at 40 and 120d. PCR and Southern hybridization results indicate that the gene was integrated into the jute genome. Overexpression of CcUGPase gene in jute revealed increased height and cellulose content compared with control lines, although the lignin content remained unchanged. The results indicate that the jute UGPase gene participates in cellulose biosynthesis. These data provide an important basis for the application of the CcUGPase gene in the improvement of jute fiber quality. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth

    2010-01-01

    Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...... and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals...

  7. Aerobic conditions increase isoprenoid biosynthesis pathway gene expression levels for carotenoid production in Enterococcus gilvus.

    Science.gov (United States)

    Hagi, Tatsuro; Kobayashi, Miho; Nomura, Masaru

    2015-06-01

    Some lactic acid bacteria that harbour carotenoid biosynthesis genes (crtNM) can produce carotenoids. Although aerobic conditions can increase carotenoid production and crtNM expression levels, their effects on the pathways that synthesize carotenoid precursors such as mevalonate and isoprene are not completely understood. In this study, we investigated whether aerobic conditions affected gene expression levels involved in the isoprenoid biosynthesis pathway that includes the mevalonate and isoprene biosynthesis pathways in Enterococcus gilvus using real-time quantitative reverse transcription PCR. NADH oxidase (nox) and superoxide dismutase (sod) gene expression levels were investigated as controls for aerobic conditions. The expression levels of nox and sod under aerobic conditions were 7.2- and 8.0-fold higher, respectively, than those under anaerobic conditions. Aerobic conditions concomitantly increased the expression levels of crtNM carotenoid biosynthesis genes. HMG-CoA synthase gene expression levels in the mevalonate pathway were only slightly increased under aerobic conditions, whereas the expression levels of HMG-CoA reductase and five other genes in the isoprene biosynthesis pathways were 1.2-2.3-fold higher than those under anaerobic conditions. These results demonstrated that aerobic conditions could increase the expression levels of genes involved in the isoprenoid biosynthesis pathway via mevalonate in E. gilvus.

  8. Molecular variation at a candidate gene implicated in the regulation of fire ant social behavior.

    Directory of Open Access Journals (Sweden)

    Dietrich Gotzek

    Full Text Available The fire ant Solenopsis invicta and its close relatives display an important social polymorphism involving differences in colony queen number. Colonies are headed by either a single reproductive queen (monogyne form or multiple queens (polygyne form. This variation in social organization is associated with variation at the gene Gp-9, with monogyne colonies harboring only B-like allelic variants and polygyne colonies always containing b-like variants as well. We describe naturally occurring variation at Gp-9 in fire ants based on 185 full-length sequences, 136 of which were obtained from S. invicta collected over much of its native range. While there is little overall differentiation between most of the numerous alleles observed, a surprising amount is found in the coding regions of the gene, with such substitutions usually causing amino acid replacements. This elevated coding-region variation may result from a lack of negative selection acting to constrain amino acid replacements over much of the protein, different mutation rates or biases in coding and non-coding sequences, negative selection acting with greater strength on non-coding than coding regions, and/or positive selection acting on the protein. Formal selection analyses provide evidence that the latter force played an important role in the basal b-like lineages coincident with the emergence of polygyny. While our data set reveals considerable paraphyly and polyphyly of S. invicta sequences with respect to those of other fire ant species, the b-like alleles of the socially polymorphic species are monophyletic. An expanded analysis of colonies containing alleles of this clade confirmed the invariant link between their presence and expression of polygyny. Finally, our discovery of several unique alleles bearing various combinations of b-like and B-like codons allows us to conclude that no single b-like residue is completely predictive of polygyne behavior and, thus, potentially causally

  9. High copy number variation of cancer-related microRNA genes and frequent amplification of DICER1 and DROSHA in lung cancer

    Science.gov (United States)

    Czubak, Karol; Lewandowska, Marzena Anna; Klonowska, Katarzyna; Roszkowski, Krzysztof; Kowalewski, Janusz; Figlerowicz, Marek; Kozlowski, Piotr

    2015-01-01

    A growing body of evidence indicates that miRNAs may be a class of genetic elements that can either drive or suppress oncogenesis. In this study we analyzed the somatic copy number variation of 14 miRNA genes frequently found to be either over- or underexpressed in lung cancer, as well as two miRNA biogenesis genes, DICER1 and DROSHA, in non-small-cell lung cancer (NSCLC). Our analysis showed that most analyzed miRNA genes undergo substantial copy number alteration in lung cancer. The most frequently amplified miRNA genes include the following: miR-30d, miR-21, miR-17 and miR-155. We also showed that both DICER1 and DROSHA are frequently amplified in NSCLC. The copy number variation of DICER1 and DROSHA correlates well with their expression and survival of NSCLC and other cancer patients. The increased expression of DROSHA and DICER1 decreases and increases the survival, respectively. In conclusion, our results show that copy number variation may be an important mechanism of upregulation/downregulation of miRNAs in cancer and suggest an oncogenic role for DROSHA. PMID:26156018

  10. Identification, expression and variation of the GNPDA2 gene, and its association with body weight and fatness traits in chicken

    Directory of Open Access Journals (Sweden)

    Hongjia Ouyang

    2016-06-01

    Full Text Available Background. The GNPDA2 (glucosamine-6-phosphate deaminase 2 gene is a member of Glucosamine-6-phosphate (GlcN6P deaminase subfamily, which encoded an allosteric enzyme of GlcN6P. Genome-wide association studies (GWAS have shown that variations of human GNPDA2 are associated with body mass index and obesity risk, but its function and metabolic implications remain to be elucidated.The object of this study was to characterize the gene structure, expression, and biological functions of GNPDA2 in chickens. Methods. Variant transcripts of chicken GNPDA2 and their expression were investigated using rapid amplification of cDNA ends (RACE system and real-time quantitative PCR technology. We detected the GNPDA2 expression in hypothalamic, adipose, and liver tissue of Xinghua chickens with fasting and high-glucose-fat diet treatments, and performed association analysis of variations of GNPDA2 with productive traits in chicken. The function of GNPDA2 was further studied by overexpression and small interfering RNA (siRNA methods in chicken preadipocytes. Results.Four chicken GNPDA2 transcripts (cGNPDA2-a∼cGNPDA2-d were identified in this study. The complete transcript GNPDA2-a was predominantly expressed in adipose tissue (subcutaneous fat and abdominal fat, hypothalamus, and duodenum. In fasting chickens, the mRNA level of GNPDA2 was decreased by 58.8% (P < 0.05 in hypothalamus, and returned to normal level after refeeding. Chicken fed a high-glucose-fat diet increased GNPDA2 gene expression about 2-fold higher in adipose tissue (P < 0.05 than that in the control (fed a basal diet, but decreased its expression in hypothalamus. Two single-nucleotide polymorphisms of the GNPDA2 gene were significantly associated with body weight and a number of fatness traits in chicken (P < 0.05. Conclusion. Our findings indicated that the GNPDA2 gene has a potential role in the regulation of body weight, fat and energy metabolism in chickens.

  11. Common genetic variation in the Estrogen Receptor Beta (ESR2 gene and osteoarthritis: results of a meta-analysis

    Directory of Open Access Journals (Sweden)

    Rivadeneira Fernando

    2010-11-01

    Full Text Available Abstract Background The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis. Methods In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs were genotyped and tested for association with hip (284 cases, 2772 controls, knee (665 cases, 2075 controls, and hand OA (874 cases, 2184 controls using an additive model. In the replication stage one SNP (rs1256031 was tested in an additional 2080 hip, 1318 knee and 557 hand OA cases and 4001, 2631 and 1699 controls respectively. Fixed- and random-effects meta-analyses were performed over the complete dataset including 2364 hip, 1983 knee and 1431 hand OA cases and approximately 6000 controls. Results The C allele of rs1256031 was associated with a 36% increased odds of hip OA in women of the Rotterdam Study-I (OR 1.36, 95% CI 1.08-1.70, p = 0.009. Haplotype analysis and analysis of knee- and hand OA did not give additional information. With the replication studies, the meta-analysis did not show a significant effect of this SNP on hip OA in the total population (OR 1.06, 95% CI 0.99-1.15, p = 0.10. Stratification according to gender did not change the results. In this study, we had 80% power to detect an odds ratio of at least 1.14 for hip OA (α = 0.05. Conclusion This study showed that common genetic variation in the ESR2 gene is not likely to influence the risk of osteoarthritis with effects smaller than a 13% increase.

  12. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Directory of Open Access Journals (Sweden)

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  13. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Directory of Open Access Journals (Sweden)

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  14. Changes in transcriptional orientation are associated with increases in evolutionary rates of enterobacterial genes

    Directory of Open Access Journals (Sweden)

    Hsiung Chao

    2011-10-01

    Full Text Available Abstract Background Changes in transcriptional orientation (“CTOs” occur frequently in prokaryotic genomes. Such changes usually result from genomic inversions, which may cause a conflict between the directions of replication and transcription and an increase in mutation rate. However, CTOs do not always lead to the replication-transcription confrontation. Furthermore, CTOs may cause deleterious disruptions of operon structure and/or gene regulations. The currently existing CTOs may indicate relaxation of selection pressure. Therefore, it is of interest to investigate whether CTOs have an independent effect on the evolutionary rates of the affected genes, and whether these genes are subject to any type of selection pressure in prokaryotes. Methods Three closely related enterbacteria, Escherichia coli, Klebsiella pneumoniae and Salmonella enterica serovar Typhimurium, were selected for comparisons of synonymous (dS and nonsynonymous (dN substitution rate between the genes that have experienced changes in transcriptional orientation (changed-orientation genes, “COGs” and those that do not (same-orientation genes, “SOGs”. The dN/dS ratio was also derived to evaluate the selection pressure on the analyzed genes. Confounding factors in the estimation of evolutionary rates, such as gene essentiality, gene expression level, replication-transcription confrontation, and decreased dS at gene terminals were controlled in the COG-SOG comparisons. Results We demonstrate that COGs have significantly higher dN and dS than SOGs when a series of confounding factors are controlled. However, the dN/dS ratios are similar between the two gene groups, suggesting that the increase in dS can sufficiently explain the increase in dN in COGs. Therefore, the increases in evolutionary rates in COGs may be mainly mutation-driven. Conclusions Here we show that CTOs can increase the evolutionary rates of the affected genes. This effect is independent of the

  15. Interspecific hybridization and bioactive alkaloid variation increases diversity in endophytic Epichloë species of Bromus laevipes.

    Science.gov (United States)

    Charlton, Nikki D; Craven, Kelly D; Afkhami, Michelle E; Hall, Bradley A; Ghimire, Sita R; Young, Carolyn A

    2014-10-01

    Studying geographic variation of microbial mutualists, especially variation in traits related to benefits they provide their host, is critical for understanding how these associations impact key ecological processes. In this study, we investigate the phylogenetic population structure of Epichloë species within Bromus laevipes, a native cool-season bunchgrass found predominantly in California. Phylogenetic classification supported inference of three distinct Epichloë taxa, of which one was nonhybrid and two were interspecific hybrids. Inheritance of mating-type idiomorphs revealed that at least one of the hybrid species arose from independent hybridization events. We further investigated the geographic variation of endophyte-encoded alkaloid genes, which is often associated with key benefits of natural enemy protection for the host. Marker diversity at the ergot alkaloid, loline, indole-diterpene, and peramine loci revealed four alkaloid genotypes across the three identified Epichloë species. Predicted chemotypes were tested using endophyte-infected plant material that represented each endophyte genotype, and 11 of the 13 predicted alkaloids were confirmed. This multifaceted approach combining phylogenetic, genotypic, and chemotypic analyses allowed us to reconstruct the diverse evolutionary histories of Epichloë species present within B. laevipes and highlight the complex and dynamic processes underlying these grass-endophyte symbioses.

  16. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  17. Membrane fusion inducers, chloroquine and spermidine increase lipoplex-mediated gene transfection

    Energy Technology Data Exchange (ETDEWEB)

    Wong-Baeza, Carlos; Bustos, Israel; Serna, Manuel; Tescucano, Alonso; Alcantara-Farfan, Veronica; Ibanez, Miguel [Biochemistry Department, National Polytechnic Institute (IPN), Mexico City 11340 (Mexico); Montanez, Cecilia [Department of Genetics and Molecular Biology, Centre for Research and Advanced Studies (CINVESTAV), IPN, Mexico City 07360 (Mexico); Wong, Carlos [Biochemistry Department, National Polytechnic Institute (IPN), Mexico City 11340 (Mexico); Baeza, Isabel, E-mail: ibaeza@encb.ipn.mx [Biochemistry Department, National Polytechnic Institute (IPN), Mexico City 11340 (Mexico)

    2010-05-28

    Gene transfection into mammalian cells can be achieved with viral and non-viral vectors. Non-viral vectors, such as cationic lipids that form lipoplexes with DNA, are safer and more stable than viral vectors, but their transfection efficiencies are lower. Here we describe that the simultaneous treatment with a membrane fusion inducer (chlorpromazine or procainamide) plus the lysosomotropic agent chloroquine increases lipoplex-mediated gene transfection in human (HEK293 and C-33 A) and rat (PC12) cell lines (up to 9.2-fold), as well as in situ in BALB/c mice spleens and livers (up to 6-fold); and that the polyamine spermidine increases lipoplex-mediated gene transfection and expression in cell cultures. The use of these four drugs provides a novel, safe and relatively inexpensive way to considerably increase lipoplex-mediated gene transfection efficiency.

  18. Circadian variations of clock gene Per2 and cell cycle genes in different stages of carcinogenesis in golden hamster buccal mucosa.

    Science.gov (United States)

    Tan, Xue-Mei; Ye, Hua; Yang, Kai; Chen, Dan; Wang, Qing-Qing; Tang, Hong; Zhao, Ning-Bo

    2015-05-07

    Previous studies have suggested that the expression of clock genes have circadian rhythms, and many cell cycle genes are regulated by clock genes. The disruption of circadian rhythms appears to be associated with the acceleration of cancer development. To investigate the circadian patterns of the clock gene Per2 and of cell cycle genes p53, Cyclin D1, CDK1 and Cyclin B1 in different stages of carcinogenesis, the daily mRNA profiles of these genes were detected by real-time RT-PCR in dimethylbenzanthracene-induced cancer, in precancerous lesions and in normal tissues. Per2, p53, Cyclin D1 and CDK1 showed circadian rhythms in the 3 different stages of carcinogenesis, whereas the circadian rhythm of Cyclin B1 was absent in the precancerous lesions. The mesors and amplitudes of Per2 and p53 were decreased (P circadian pattern variations of these genes in different stages of carcinogenesis.

  19. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  20. Association between common variation in 120 candidate genes and breast cancer risk.

    Directory of Open Access Journals (Sweden)

    Paul D P Pharoah

    2007-03-01

    Full Text Available Association studies in candidate genes have been widely used to search for common low penetrance susceptibility alleles, but few definite associations have been established. We have conducted association studies in breast cancer using an empirical single nucleotide polymorphism (SNP tagging approach to capture common genetic variation in genes that are candidates for breast cancer based on their known function. We genotyped 710 SNPs in 120 candidate genes in up to 4,400 breast cancer cases and 4,400 controls using a staged design. Correction for population stratification was done using the genomic control method, on the basis of data from 280 genomic control SNPs. Evidence for association with each SNP was assessed using a Cochran-Armitage trend test (p-trend and a two-degrees of freedom chi(2 test for heterogeneity (p-het. The most significant single SNP (p-trend = 8 x 10(-5 was not significant at a nominal 5% level after adjusting for population stratification and multiple testing. To evaluate the overall evidence for an excess of positive associations over the proportion expected by chance, we applied two global tests: the admixture maximum likelihood (AML test and the rank truncated product (RTP test corrected for population stratification. The admixture maximum likelihood experiment-wise test for association was significant for both the heterogeneity test (p = 0.0031 and the trend test (p = 0.017, but no association was observed using the rank truncated product method for either the heterogeneity test or the trend test (p = 0.12 and p = 0.24, respectively. Genes in the cell-cycle control pathway and genes involved in steroid hormone metabolism and signalling were the main contributors to the association. These results suggest that a proportion of SNPs in these candidate genes are associated with breast cancer risk, but that the effects of individual SNPs is likely to be small. Large sample sizes from multicentre collaboration will be needed

  1. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas

    2008-01-01

    . Furthermore, human AFAR1 catalyses the rate limiting step in the synthesis of the neuromodulator gamma-hydroxybutyrate (GHB) and was found elevated in neurodegenerative diseases such as Alzheimer's and dementia with Lewy bodies (DLB). The human AFAR gene family maps to a genomic region in 1p36 of frequent...... samples, we identified nine different amino acid changes; two were in AFAR1 and seven in AFAR2. In AFAR1, we found genetic variation in the proposed substrate-binding amino acid 113, encoding Ala(113) or Thr(113). An AFAR2 variant had a Glu(55) substituted by Lys(55) at a position that is conserved among...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  2. Plasma Fetuin-A concentration, genetic variation in the AHSG gene and risk of colorectal cancer

    DEFF Research Database (Denmark)

    Nimptsch, Katharina; Aleksandrova, Krasimira; Boeing, Heiner

    2015-01-01

    .93-1.22) in women, 1.13 (1.00-1.27) for colon cancer and 1.12 (0.94-1.32) for rectal cancer. To improve causal inference in a Mendelian Randomization approach, five tagging single nucleotide polymorphisms of the AHSG gene were genotyped in a subset of 456 case-control pairs. The AHSG allele-score explained 21......% of the interindividual variation in plasma fetuin-A concentrations. In instrumental variable analysis, genetically raised fetuin-A was not associated with colorectal cancer risk (relative risk per 40 µg/mL genetically determined higher fetuin-A was 0.98, 95% confidence interval: 0.73-1.33). The findings of our study...

  3. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    DEFF Research Database (Denmark)

    Meidtner, Karina; Fisher, Eva; Angquist, Lars

    2014-01-01

    ) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were followed up...... for 6.9 ± 2.5 years. Association of 69 tagSNPs with baseline BMI and annual changes in weight as well as waist circumference were investigated using linear regression analysis. Interactions with sex, GI and intake of carbohydrates, fat as well as saturated, monounsaturated and polyunsaturated fatty...... acids were examined by including multiplicative SNP-covariate terms into the regression model. Neither baseline BMI nor annual weight or waist circumference changes were significantly associated with variation in the selected genes in the entire study population after correction for multiple testing...

  4. Identification of PLCL1 gene for hip bone size variation in females in a genome-wide association study.

    Directory of Open Access Journals (Sweden)

    Yao-Zhong Liu

    Full Text Available Osteoporosis, the most prevalent metabolic bone disease among older people, increases risk for low trauma hip fractures (HF that are associated with high morbidity and mortality. Hip bone size (BS has been identified as one of the key measurable risk factors for HF. Although hip BS is highly genetically determined, genetic factors underlying the trait are still poorly defined. Here, we performed the first genome-wide association study (GWAS of hip BS interrogating approximately 380,000 SNPs on the Affymetrix platform in 1,000 homogeneous unrelated Caucasian subjects, including 501 females and 499 males. We identified a gene, PLCL1 (phospholipase c-like 1, that had four SNPs associated with hip BS at, or approaching, a genome-wide significance level in our female subjects; the most significant SNP, rs7595412, achieved a p value of 3.72x10(-7. The gene's importance to hip BS was replicated using the Illumina genotyping platform in an independent UK cohort containing 1,216 Caucasian females. Two SNPs of the PLCL1 gene, rs892515 and rs9789480, surrounded by the four SNPs identified in our GWAS, achieved p values of 8.62x10(-3 and 2.44x10(-3, respectively, for association with hip BS. Imputation analyses on our GWAS and the UK samples further confirmed the replication signals; eight SNPs of the gene achieved combined imputed p values<10(-5 in the two samples. The PLCL1 gene's relevance to HF was also observed in a Chinese sample containing 403 females, including 266 with HF and 177 control subjects. A SNP of the PLCL1 gene, rs3771362 that is only approximately 0.6 kb apart from the most significant SNP detected in our GWAS (rs7595412, achieved a p value of 7.66x10(-3 (odds ratio = 0.26 for association with HF. Additional biological support for the role of PLCL1 in BS comes from previous demonstrations that the PLCL1 protein inhibits IP3 (inositol 1,4,5-trisphosphate-mediated calcium signaling, an important pathway regulating mechanical sensing of

  5. Identification of novel candidate gene loci and increased sex chromosome aneuploidy among infants with conotruncal heart defects.

    Science.gov (United States)

    Osoegawa, Kazutoyo; Iovannisci, David M; Lin, Bin; Parodi, Christina; Schultz, Kathleen; Shaw, Gary M; Lammer, Edward J

    2014-02-01

    Congenital heart defects (CHDs) are common malformations, affecting four to eight per 1,000 total births. Conotruncal defects are an important pathogenetic subset of CHDs, comprising nearly 20% of the total. Although both environmental and genetic factors are known to contribute to the occurrence of conotruncal defects, the causes remain unknown for most. To identify novel candidate genes/loci, we used array comparative genomic hybridization to detect chromosomal microdeletions/duplications. From a population base of 974,579 total births born during 1999-2004, we screened 389 California infants born with tetralogy of Fallot or d-transposition of the great arteries. We found that 1.7% (5/288) of males with a conotruncal defect had sex chromosome aneuploidy, a sevenfold increased frequency (relative risk = 7.0; 95% confidence interval 2.9-16.9). We identified eight chromosomal microdeletions/duplications for conotruncal defects. From these duplications and deletions, we found five high priority candidate genes (GATA4, CRKL, BMPR1A, SNAI2, and ZFHX4). This is the initial report that sex chromosome aneuploidy is associated with conotruncal defects among boys. These chromosomal microduplications/deletions provide evidence that GATA4, SNAI2, and CRKL are highly dosage sensitive genes involved in outflow tract development. Genome wide screening for copy number variation can be productive for identifying novel genes/loci contributing to non-syndromic common malformations.

  6. Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L.

    Directory of Open Access Journals (Sweden)

    Shengxue Liu

    Full Text Available The worldwide production of maize (Zea mays L. is frequently impacted by water scarcity and as a result, increased drought tolerance is a priority target in maize breeding programs. While DREB transcription factors have been demonstrated to play a central role in desiccation tolerance, whether or not natural sequence variations in these genes are associated with the phenotypic variability of this trait is largely unknown. In the present study, eighteen ZmDREB genes present in the maize B73 genome were cloned and systematically analyzed to determine their phylogenetic relationship, synteny with rice, maize and sorghum genomes; pattern of drought-responsive gene expression, and protein transactivation activity. Importantly, the association between the nucleic acid variation of each ZmDREB gene with drought tolerance was evaluated using a diverse population of maize consisting of 368 varieties from tropical and temperate regions. A significant association between the genetic variation of ZmDREB2.7 and drought tolerance at seedling stage was identified. Further analysis found that the DNA polymorphisms in the promoter region of ZmDREB2.7, but not the protein coding region itself, was associated with different levels of drought tolerance among maize varieties, likely due to distinct patterns of gene expression in response to drought stress. In vitro, protein-DNA binding assay demonstrated that ZmDREB2.7 protein could specifically interact with the target DNA sequences. The transgenic Arabidopsis overexpressing ZmDREB2.7 displayed enhanced tolerance to drought stress. Moreover, a favorable allele of ZmDREB2.7, identified in the drought-tolerant maize varieties, was effective in imparting plant tolerance to drought stress. Based upon these findings, we conclude that natural variation in the promoter of ZmDREB2.7 contributes to maize drought tolerance, and that the gene and its favorable allele may be an important genetic resource for the genetic

  7. The architecture of gene regulatory variation across multiple human tissues: the MuTHER study.

    Directory of Open Access Journals (Sweden)

    Alexandra C Nica

    Full Text Available While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL, skin, and fat. The samples (156 LCL, 160 skin, 166 fat were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes. In addition, we apply factor analysis (FA to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes. The unique study design (Matched Co-Twin Analysis--MCTA permits immediate replication of eQTLs using co-twins (93%-98% and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%-20% have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits.

  8. The Architecture of Gene Regulatory Variation across Multiple Human Tissues: The MuTHER Study

    Science.gov (United States)

    Nica, Alexandra C.; Parts, Leopold; Glass, Daniel; Nisbet, James; Barrett, Amy; Sekowska, Magdalena; Travers, Mary; Potter, Simon; Grundberg, Elin; Small, Kerrin; Hedman, Åsa K.; Bataille, Veronique; Tzenova Bell, Jordana; Surdulescu, Gabriela; Dimas, Antigone S.; Ingle, Catherine; Nestle, Frank O.; di Meglio, Paola; Min, Josine L.; Wilk, Alicja; Hammond, Christopher J.; Hassanali, Neelam; Yang, Tsun-Po; Montgomery, Stephen B.; O'Rahilly, Steve; Lindgren, Cecilia M.; Zondervan, Krina T.; Soranzo, Nicole; Barroso, Inês; Durbin, Richard; Ahmadi, Kourosh; Deloukas, Panos; McCarthy, Mark I.; Dermitzakis, Emmanouil T.; Spector, Timothy D.

    2011-01-01

    While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL), skin, and fat. The samples (156 LCL, 160 skin, 166 fat) were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes). In addition, we apply factor analysis (FA) to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes). The unique study design (Matched Co-Twin Analysis—MCTA) permits immediate replication of eQTLs using co-twins (93%–98%) and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%–20%) have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits. PMID:21304890

  9. Sequence Variation of the Pertussis Toxin S1 Subunit Encoding Gene in the Clinical Isolates of Bordetella pertussis in Iran

    Directory of Open Access Journals (Sweden)

    Hosseinpour

    2015-08-01

    Full Text Available Background Whooping cough (pertussis is an acute respiratory disease caused by Bordetella pertussis (B. pertussis. Pertussis toxin is an important virulence factor of B. pertussis and plays a major role in the immune and inflammatory responses. Likewise, allelic variations in the genes of virulence factors have led to the non-responsiveness of the new strains to both whole-cell and acellular vaccines. Given the importance of pertussis vaccine, we sought to address the lack of fundamental studies on the polymorphisms of the virulence genes of B. pertussis in Iran. Objectives The aim of this study was to identify the polymorphisms of the pertussis toxin S1 subunit (ptxS1 gene in the circulating strains and compare them to the vaccine strain. Patients and Methods In this study, 50 strains of B. pertussis isolated from patients with pertussis were investigated in the pertussis reference laboratory of Pasteur institute of Iran. Cultivation, biochemical tests, and the specific antisera were used to confirm B. pertussis. The sequencing of the polymerase chain reaction products was performed to determine the ptxS1 alleles, and B. pertussis 134 was studied as the vaccine strain. Results The results showed that all the strains had the dominant allele ptxS1A. There were differences between the alleles of the clinical strains and the vaccine strain. Conclusions In recent years, a significant increase in the incidence of pertussis has been reported worldwide. Our findings regarding the allelic shift of the ptxS1 gene are similar to those reported in many European and American countries showing the difference of the dominant allele of ptxS1 between the circulating isolates and the vaccine strains.

  10. Variation in oxytocin receptor gene (OXTR) polymorphisms is associated with emotional and behavioral reactions to betrayal.

    Science.gov (United States)

    Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L

    2014-06-01

    Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction.

  11. Variation at genes influencing facial morphology are not associated with developmental imprecision in human faces.

    Directory of Open Access Journals (Sweden)

    Sonja Windhager

    Full Text Available Facial asymmetries are commonly used as a proxy for human developmental imprecision resulting from inbreeding, and thus reduced genetic heterozygosity. Several environmental factors influence human facial asymmetry (e.g., health care, parasites, but the generalizability of findings on genetic stressors has been limited in humans by sample characteristics (island populations, endogamy and indirect genetic assessment (inference from pedigrees. In a sample of 3215 adult humans from the Rotterdam Study, we therefore studied the relationship of facial asymmetry, estimated from nine mid-facial landmarks, with genetic variation at 102 single nucleotide polymorphism (SNP loci recently associated with facial shape variation. We further tested whether the degree of individual heterozygosity is negatively correlated with facial asymmetry. An ANOVA tree regression did not identify any SNP relating to either fluctuating asymmetry or total asymmetry. In a general linear model, only age and sex--but neither heterozygosity nor any SNP previously reported to covary with facial shape--was significantly related to total or fluctuating asymmetry of the midface. Our study does not corroborate the common assumption in evolutionary and behavioral biology that morphological asymmetries reflect heterozygosity. Our results, however, may be affected by a relatively small degree of inbreeding, a relatively stable environment, and an advanced age in the Rotterdam sample. Further large-scale genetic studies, including gene expression studies, are necessary to validate the genetic and developmental origin of morphological asymmetries.

  12. Post-polyploidisation morphotype diversification associates with gene copy number variation

    Science.gov (United States)

    Schiessl, Sarah; Huettel, Bruno; Kuehn, Diana; Reinhardt, Richard; Snowdon, Rod

    2017-01-01

    Genetic models for polyploid crop adaptation provide important information relevant for future breeding prospects. A well-suited model is Brassica napus, a recent allopolyploid closely related to Arabidopsis thaliana. Flowering time is a major adaptation trait determining life cycle synchronization with the environment. Here we unravel natural genetic variation in B. napus flowering time regulators and investigate associations with evolutionary diversification into different life cycle morphotypes. Deep sequencing of 35 flowering regulators was performed in 280 diverse B. napus genotypes. High sequencing depth enabled high-quality calling of single-nucleotide polymorphisms (SNPs), insertion-deletions (InDels) and copy number variants (CNVs). By combining these data with genotyping data from the Brassica 60 K Illumina® Infinium SNP array, we performed a genome-wide marker distribution analysis across the 4 ecogeographical morphotypes. Twelve haplotypes, including Bna.FLC.A10, Bna.VIN3.A02 and the Bna.FT promoter on C02_random, were diagnostic for the diversification of winter and spring types. The subspecies split between oilseed/kale (B. napus ssp. napus) and swedes/rutabagas (B. napus ssp. napobrassica) was defined by 13 haplotypes, including genomic rearrangements encompassing copies of Bna.FLC, Bna.PHYA and Bna.GA3ox1. De novo variation in copies of important flowering-time genes in B. napus arose during allopolyploidisation, enabling sub-functionalisation that allowed different morphotypes to appropriately fine-tune their lifecycle. PMID:28165502

  13. Intra-retinal variation of opsin gene expression in the guppy (Poecilia reticulata).

    Science.gov (United States)

    Rennison, Diana J; Owens, Gregory L; Allison, W Ted; Taylor, John S

    2011-10-01

    Although behavioural experiments demonstrate that colouration influences mate choice in many species, a complete understanding of this form of signalling requires information about colour vision in the species under investigation. The guppy (Poecilia reticulata) has become a model species for the study of colour-based sexual selection. To investigate the role of opsin gene duplication and divergence in the evolution of colour-based mate choice, we used in situ hybridization to determine where the guppy's nine cone opsins are expressed in the retina. Long wavelength-sensitive (LWS) opsins were more abundant in the dorsal retina than in the ventral retina. One of the middle wavelength-sensitive opsins (RH2-1) exhibited the opposite pattern, while the other middle wavelength-sensitive opsin (RH2-2) and the short wavelength-sensitive opsins (SWS1, SWS2A and SWS2B) were expressed throughout the retina. We also found variation in LWS opsin expression among individuals. These observations suggest that regions of the guppy retina are specialized with respect to wavelength discrimination and/or sensitivity. Intra-retinal variability in opsin expression, which has been observed in several fish species, might be an adaptation to variation in the strength and spectral composition of light entering the eye from above and below. The discovery that opsin expression varies in the guppy retina may motivate new behavioural experiments designed to study its role in mate choice.

  14. Human brain harbors single nucleotide somatic variations in functionally relevant genes possibly mediated by oxidative stress [version 3; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Anchal Sharma

    2017-01-01

    Full Text Available Somatic variation in DNA can cause cells to deviate from the preordained genomic path in both disease and healthy conditions. Here, using exome sequencing of paired tissue samples, we show that the normal human brain harbors somatic single base variations measuring up to 0.48% of the total variations. Interestingly, about 64% of these somatic variations in the brain are expected to lead to non-synonymous changes, and as much as 87% of these represent G:C>T:A transversion events. Further, the transversion events in the brain were mostly found in the frontal cortex, whereas the corpus callosum from the same individuals harbors the reference genotype. We found a significantly higher amount of 8-OHdG (oxidative stress marker in the frontal cortex compared to the corpus callosum of the same subjects (pT:A transversions in the cortex. We found significant enrichment for axon guidance and related pathways for genes harbouring somatic variations. This could represent either a directed selection of genetic variations in these pathways or increased susceptibility of some loci towards oxidative stress. This study highlights that oxidative stress possibly influence single nucleotide somatic variations in normal human brain.

  15. Calcium gluconate in phosphate buffered saline increases gene delivery with adenovirus type 5.

    Directory of Open Access Journals (Sweden)

    Marko T Ahonen

    Full Text Available BACKGROUND: Adenoviruses are attractive vectors for gene therapy because of their stability in vivo and the possibility of production at high titers. Despite exciting preclinical data with various approaches, there are only a few examples of clear efficacy in clinical trials. Effective gene delivery to target cells remains the key variable determining efficacy and thus enhanced transduction methods are important. METHODS/RESULTS: We found that heated serum could enhance adenovirus 5 mediated gene delivery up to twentyfold. A new protein-level interaction was found between fiber knob and serum transthyretin, but this was not responsible for the observed effect. Instead, we found that heating caused the calcium and phosphate present in the serum mix to precipitate, and this was responsible for enhanced gene delivery. This finding could have relevance for designing preclinical experiments with adenoviruses, since calcium and phosphate are present in many solutions. To translate this into an approach potentially testable in patients, we used calcium gluconate in phosphate buffered saline, both of which are clinically approved, to increase adenoviral gene transfer up to 300-fold in vitro. Gene transfer was increased with or without heating and in a manner independent from the coxsackie-adenovirus receptor. In vivo, in mouse studies, gene delivery was increased 2-, 110-, 12- and 13-fold to tumors, lungs, heart and liver and did not result in increased pro-inflammatory cytokine induction. Antitumor efficacy of a replication competent virus was also increased significantly. CONCLUSION: In summary, adenoviral gene transfer and antitumor efficacy can be enhanced by calcium gluconate in phosphate buffered saline.

  16. Calcium Gluconate in Phosphate Buffered Saline Increases Gene Delivery with Adenovirus Type 5

    Science.gov (United States)

    Ahonen, Marko T.; Diaconu, Iulia; Pesonen, Sari; Kanerva, Anna; Baumann, Marc; Parviainen, Suvi T.; Spiller, Brad

    2010-01-01

    Background Adenoviruses are attractive vectors for gene therapy because of their stability in vivo and the possibility of production at high titers. Despite exciting preclinical data with various approaches, there are only a few examples of clear efficacy in clinical trials. Effective gene delivery to target cells remains the key variable determining efficacy and thus enhanced transduction methods are important. Methods/Results We found that heated serum could enhance adenovirus 5 mediated gene delivery up to twentyfold. A new protein-level interaction was found between fiber knob and serum transthyretin, but this was not responsible for the observed effect. Instead, we found that heating caused the calcium and phosphate present in the serum mix to precipitate, and this was responsible for enhanced gene delivery. This finding could have relevance for designing preclinical experiments with adenoviruses, since calcium and phosphate are present in many solutions. To translate this into an approach potentially testable in patients, we used calcium gluconate in phosphate buffered saline, both of which are clinically approved, to increase adenoviral gene transfer up to 300-fold in vitro. Gene transfer was increased with or without heating and in a manner independent from the coxsackie-adenovirus receptor. In vivo, in mouse studies, gene delivery was increased 2-, 110-, 12- and 13-fold to tumors, lungs, heart and liver and did not result in increased pro-inflammatory cytokine induction. Antitumor efficacy of a replication competent virus was also increased significantly. Conclusion In summary, adenoviral gene transfer and antitumor efficacy can be enhanced by calcium gluconate in phosphate buffered saline. PMID:20927353

  17. IBD-associated TL1A gene (TNFSF15 haplotypes determine increased expression of TL1A protein.

    Directory of Open Access Journals (Sweden)

    Kathrin S Michelsen

    Full Text Available BACKGROUND: The recently identified member of the TNF superfamily TL1A (TNFSF15 increases IFN-gamma production by T cells in peripheral and mucosal CCR9+ T cells. TL1A and its receptor DR3 are up-regulated during chronic intestinal inflammation in ulcerative colitis and Crohn's disease (CD. TL1A gene haplotypes increase CD susceptibility in Japanese, European, and US cohorts. METHODOLOGY AND PRINCIPAL FINDINGS: Here we report that the presence of TL1A gene haplotype B increases risk in Jewish CD patients with antibody titers for the E. coli outer membrane porin C (OmpC+ (Haplotype B frequency in Jewish CD patients: 24.9% for OmpC negative and 41.9% for OmpC positive patients, respectively, P< or =0.001. CD14+ monocytes isolated from Jewish OmpC+ patients homozygous for TL1A gene haplotype B express higher levels of TL1A in response to FcgammaR stimulation, a known inducing pathway of TL1A, as measured by ELISA. Furthermore, the membrane expression of TL1A is increased on peripheral monocytes from Jewish but not non-Jewish CD patients with the risk haplotype. CONCLUSIONS AND SIGNIFICANCE: These findings suggest that TL1A gene variation exacerbates induction of TL1A in response to FcgammaR stimulation in Jewish CD patients and this may lead to chronic intestinal inflammation via overwhelming T cell responses. Thus, TL1A may provide an important target for therapeutic intervention in this subgroup of IBD patients.

  18. Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico.

    Science.gov (United States)

    Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

    2014-01-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease.

  19. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  20. The association between ace gene variation and aerobic capacity in winter endurance disciplines.

    Science.gov (United States)

    Orysiak, J; Zmijewski, P; Klusiewicz, A; Kaliszewski, P; Malczewska-Lenczowska, J; Gajewski, J; Pokrywka, A

    2013-12-01

    The aim of the study was to examine the possible relationship between I/D polymorphism of ACE gene and selected indices of aerobic capacity among male and female athletes practising winter endurance sports. Sixty-six well-trained athletes (female n = 26, male n = 40), aged 18.4 ± 2.8 years, representing winter endurance sports (cross-country skiing, n = 48; biathlon, n = 8; Nordic combined, n = 10) participated in the study. Genotyping for ACE I/D polymorphism was performed using polymerase chain reaction. Maximal oxygen consumption (VO2max), maximal running velocity (Vmax) and running velocity at anaerobic threshold (VAT4) were determined in an incremental test to volitional exhaustion on a motorized treadmill. The ACE genotype had no significant effect on absolute VO2max, relative VO2max (divided by body mass or fat free body mass), VAT4 or Vmax. No interaction effect of gender x ACE genotype was found for each of the examined aerobic capacity indices. ACE gene variation was not found to be a determinant of aerobic capacity in either female or male Polish, well-trained endurance athletes participating in winter sports.

  1. Variation in the Oxytocin Receptor Gene Is Associated with Face Recognition and its Neural Correlates

    Science.gov (United States)

    Westberg, Lars; Henningsson, Susanne; Zettergren, Anna; Svärd, Joakim; Hovey, Daniel; Lin, Tian; Ebner, Natalie C.; Fischer, Håkan

    2016-01-01

    The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala—a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR) has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging (fMRI) during incidental encoding of faces. The OXTR 3′ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors. PMID:27713694

  2. Variation in the Oxytocin Receptor Gene is associated with Face Recognition and its neural correlates

    Directory of Open Access Journals (Sweden)

    Lars Westberg

    2016-09-01

    Full Text Available The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala – a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging during incidental encoding of faces. The OXTR 3’ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors.

  3. Chromosomal localisation and genetic variation of the SLC11A1 gene in goats (Capra hircus).

    Science.gov (United States)

    Vacca, G M; Pazzola, M; Pisano, C; Carcangiu, V; Diaz, M L; Nieddu, M; Robledo, R; Mezzanotte, R; Dettori, M L

    2011-10-01

    The solute carrier family 11 member A1 (SLC11A1) gene is associated with resistance to infectious diseases. Chromosomal localisation, genomic regions corresponding to functional domains and the genetic variability of microsatellites in the 3' untranslated region (3'-UTR) of this gene were investigated in 427 goats (Capra hircus) of six breeds. Using dual colour fluorescence in situ hybridisation, SLC11A1 was localised to goat chromosome 2. Single strand conformation polymorphism was used to screen for polymorphisms in SLC11A1 exons 2, 10 and 15. There was no variation among goat breeds in the sarcoma homology 3 (SH3) binding motif, the protein kinase C phosphorylation site or the two N-linked glycosylation sites. Exon 15 exhibited variability due to the presence of two polymorphic microsatellites. Genotyping of the upstream guanine-thymine repeat (GTn) at 3'-UTR revealed eight alleles (GT11, GT12, GT14-GT19) in goats, whereas GT13 (present in cattle) was absent. Most goats carried the GT16 allele and no allele was found to be exclusive to only one breed. The coefficient of genetic differentiation value (G(ST)) was 0.084. This microsatellite appears to be an informative DNA marker for genetic linkage analysis in goats.

  4. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    Science.gov (United States)

    Klann, Marleen; Stollewerk, Angelika

    2017-02-24

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  5. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  6. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O’Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  7. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  8. Genetic variation of the Fc gamma receptor 3B gene and association with rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Rute B Marques

    Full Text Available BACKGROUND: Fc gamma receptors (FcγRs play a crucial role in immunity by linking IgG antibody-mediated responses with cellular effector and regulatory functions. Genetic variants in these receptors have been previously identified as risk factors for several chronic inflammatory conditions. The present study aimed to investigate the presence of copy number variations (CNVs in the FCGR3B gene and its potential association with the autoimmune disease rheumatoid arthritis (RA. METHODOLOGY/PRINCIPAL FINDINGS: CNV of the FCGR3B gene was studied using Multiplex Ligation Dependent Probe Amplification (MLPA in 518 Dutch RA patients and 304 healthy controls. Surprisingly, three independent MLPA probes targeting the FCGR3B promoter measured different CNV frequencies, with probe#1 and #2 measuring 0 to 5 gene copies and probe#3 showing little evidence of CNV. Quantitative-PCR correlated with the copy number results from MLPA probe#2, which detected low copy number (1 copy in 6.7% and high copy number (≥3 copies in 9.4% of the control population. No significant difference was observed between RA patients and the healthy controls, neither in the low copy nor the high copy number groups (p-values = 0.36 and 0.71, respectively. Sequencing of the FCGR3B promoter region revealed an insertion/deletion (indel that explained the disparate CNV results of MLPA probe#1. Finally, a non-significant trend was found between the novel -256A>TG indel and RA (40.7% in healthy controls versus 35.9% in RA patients; P = 0.08. CONCLUSIONS/SIGNIFICANCE: The current study highlights the complexity and poor characterization of the FCGR3B gene sequence, indicating that the design and interpretation of genotyping assays based on specific probe sequences must be performed with caution. Nonetheless, we confirmed the presence of CNV and identified novel polymorphisms in the FCGR3B gene in the Dutch population. Although no association was found between RA and FCGR3B CNV, the

  9. Genome-wide association implicates numerous genes underlying ecological trait variation in natural populations of Populus trichocarpa.

    Science.gov (United States)

    McKown, Athena D; Klápště, Jaroslav; Guy, Robert D; Geraldes, Armando; Porth, Ilga; Hannemann, Jan; Friedmann, Michael; Muchero, Wellington; Tuskan, Gerald A; Ehlting, Jürgen; Cronk, Quentin C B; El-Kassaby, Yousry A; Mansfield, Shawn D; Douglas, Carl J

    2014-07-01

    In order to uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa) from much of its range in western North America. Extensive data from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34 K Populus single nucleotide polymorphism (SNP) array) of all accessions were used for gene discovery in a genome-wide association study (GWAS). We performed GWAS with 40 biomass, ecophysiology and phenology traits and 29,355 filtered SNPs representing 3518 genes. The association analyses were carried out using a Unified Mixed Model accounting for population structure effects among accessions. We uncovered 410 significant SNPs using a Bonferroni-corrected threshold (P<1.7×10(-6)). Markers were found across 19 chromosomes, explained 1-13% of trait variation, and implicated 275 unique genes in trait associations. Phenology had the largest number of associated genes (240 genes), followed by biomass (53 genes) and ecophysiology traits (25 genes). The GWAS results propose numerous loci for further investigation. Many traits had significant associations with multiple genes, underscoring their genetic complexity. Genes were also identified with multiple trait associations within and/or across trait categories. In some cases, traits were genetically correlated while in others they were not.

  10. Seasonal Variations in Antibiotic Resistance Gene Transport in the Almendares River, Havana, Cuba

    OpenAIRE

    Knapp, Charles W.; Lazaro eLima; Susana eOlivares-Rieumont; Emma eBowen; David eWerner; David W eGraham

    2012-01-01

    Numerous studies have quantified antibiotic resistance genes (ARG) in rivers and streams around the world, and significant relationships have been shown that relate different pollutant outputs and increased local ARG levels. However, most studies have not considered ambient flow conditions, which can vary dramatically especially in tropical countries. Here, ARG were quantified in water column and sediment samples during the dry- and wet-seasons to assess how seasonal and other factors influen...

  11. REM sleep deprivation increases the expression of interleukin genes in mice hypothalamus.

    Science.gov (United States)

    Kang, Won Sub; Park, Hae Jeong; Chung, Joo-Ho; Kim, Jong Woo

    2013-11-27

    Recently, evidence has suggested the possible involvement of inflammatory cytokines in sleep deprivation (SD). In this study, we assessed the patterns of inflammatory gene regulation in the hypothalamus of REM SD mice. C57BL/6 mice were randomly assigned to two groups, SD (n=15) and control groups (n=15). Mice in the SD group were sleep-deprived for 72h using modified multiple platforms. Microarray analysis on inflammatory genes was performed in mice hypothalamus. In addition, interleukin 1 beta (IL1β) protein expression was analyzed by the immunochemistry method. Through microarray analysis, we found that expressions of IL subfamily genes, such as IL1β (2.55-fold), IL18 (1.92-fold), IL11 receptor alpha chain 1 (1.48-fold), IL5 (1.41-fold), and IL17E genes (1.31-fold), were up-regulated in the hypothalamus of SD mice compared to the control. The increase in the expression of these genes was also confirmed by RT-PCR. Among these genes, the expression of IL1β was particularly increased in the hypothalamus of SD mice. Interestingly, we found that the protein expression of endogenous IL1β was also elevated in the hypothalamus of SD mice compared to the control mice. These results implicate that IL subfamily genes, and in particular, IL1β, may play a role in sleep regulation in the hypothalamus of REM SD mice.

  12. Streptomycin use in apple orchards did not increase abundance of mobile resistance genes.

    Science.gov (United States)

    Duffy, Brion; Holliger, Eduard; Walsh, Fiona

    2014-01-01

    Streptomycin is used as a first-line defense and tetracycline as a second-line defense, in the fight against fire blight disease in apple and pear orchards. We have performed the first study to quantitatively analyze the influence of streptomycin use in agriculture on the abundance of streptomycin and tetracycline resistance genes in apple orchards. Flowers, leaves, and soil were collected from three orchard sites in 2010, 2011, and 2012. Gene abundance distribution was analyzed using two-way anova and principal component analysis to investigate relationships between gene abundance data over time and treatment. The mobile antibiotic resistance genes, strA, strB, tetB, tetM, tetW, and the insertion sequence IS1133, were detected prior to streptomycin treatment in almost all samples, indicating the natural presence of these resistance genes in nature. Statistically significant increases in the resistance gene abundances were occasional, inconsistent, and not reproducible from one year to the next. We conclude that the application of streptomycin in these orchards was not associated with sustained increases in streptomycin or tetracycline resistance gene abundances.

  13. Toll-like receptors gene polymorphisms may confer increased susceptibility to breast cancer development.

    Science.gov (United States)

    Theodoropoulos, George E; Saridakis, Vasilios; Karantanos, Theodoros; Michalopoulos, Nikolaos V; Zagouri, Flora; Kontogianni, Panagiota; Lymperi, Maria; Gazouli, Maria; Zografos, George C

    2012-08-01

    Toll-like receptor (TLR) activation may be an important event in tumor cell immune evasion. TLR2 and TLR4 gene polymorphisms have been related to increased susceptibility to cancer development in various organs. 261 patients and 480 health individuals were investigated for genotype and allelic frequencies of a 22-bp nucleotide deletion (-196 to -174del) in the promoter of TLR2 gene as well as two polymorphisms causing amino acid substitutions (Asp299Gly and Thr399Ile) in TLR4 gene. As far as (-196 to -174del) in TLR2 gene is concerned ins/del and del/del genotypes and del allele were significantly more frequent in breast cancer patients compared to healthy controls. Considering Asp299Gly replacement of TLR4 gene, Gly carriers (Asp/Gly & Gly/Gly genotype) and Gly allele were overrepresented among the breast cancer cases. The -174 to -196del of TLR2 gene and Asp299Gly of TLR4 gene polymorphisms may confer an increased susceptibility to breast cancer development.

  14. Dramatic Increases of Soil Microbial Functional Gene Diversity at the Treeline Ecotone of Changbai Mountain.

    Science.gov (United States)

    Shen, Congcong; Shi, Yu; Ni, Yingying; Deng, Ye; Van Nostrand, Joy D; He, Zhili; Zhou, Jizhong; Chu, Haiyan

    2016-01-01

    The elevational and latitudinal diversity patterns of microbial taxa have attracted great attention in the past decade. Recently, the distribution of functional attributes has been in the spotlight. Here, we report a study profiling soil microbial communities along an elevation gradient (500-2200 m) on Changbai Mountain. Using a comprehensive functional gene microarray (GeoChip 5.0), we found that microbial functional gene richness exhibited a dramatic increase at the treeline ecotone, but the bacterial taxonomic and phylogenetic diversity based on 16S rRNA gene sequencing did not exhibit such a similar trend. However, the β-diversity (compositional dissimilarity among sites) pattern for both bacterial taxa and functional genes was similar, showing significant elevational distance-decay patterns which presented increased dissimilarity with elevation. The bacterial taxonomic diversity/structure was strongly influenced by soil pH, while the functional gene diversity/structure was significantly correlated with soil dissolved organic carbon (DOC). This finding highlights that soil DOC may be a good predictor in determining the elevational distribution of microbial functional genes. The finding of significant shifts in functional gene diversity at the treeline ecotone could also provide valuable information for predicting the responses of microbial functions to climate change.

  15. Dramatic increases of soil microbial functional gene diversity at the treeline ecotone of Changbai Mountain

    Directory of Open Access Journals (Sweden)

    Congcong Shen

    2016-07-01

    Full Text Available The elevational and latitudinal diversity patterns of microbial taxa have attracted great attention in the past decade. Recently, the distribution of functional attributes has been in the spotlight. Here, we report a study profiling soil microbial communities along an elevation gradient (500 to 2200 m on Changbai Mountain. Using a comprehensive functional gene microarray (GeoChip 5.0, we found that microbial functional gene richness exhibited a dramatic increase at the treeline ecotone, but the bacterial taxonomic and phylogenetic diversity based on 16S rRNA gene sequencing did not exhibit such a similar trend. However, the β-diversity (compositional dissimilarity among sites for both bacterial taxa and functional genes was similar, showing significant elevational distance-decay patterns which presented increased dissimilarity with elevation. The bacterial taxonomic diversity/structure was strongly influenced by soil pH, while the functional gene diversity/structure was significantly correlated with soil dissolved organic carbon (DOC. This finding highlights that soil DOC may be a good predictor in determining the elevational distribution of microbial functional genes. The finding of significant shifts in functional gene diversity at the treeline ecotone could also provide valuable information for predicting the responses of microbial functions to climate change.

  16. Adaptive models for operational use in dairy farming : increasing economic results utilising individual variation in response

    NARCIS (Netherlands)

    Andre, G.

    2011-01-01

    During the last century in the Netherlands milk production per cow has almost tripled. Accordingly, the amount of concentrates yearly fed per cow strongly increased. Furthermore, automation and robotisation has changed dairy management, especially by the introduction of automatic concentrate feeders

  17. A mechanistic account of increasing seasonal variations in the rate of ocean uptake of anthropogenic carbon

    Directory of Open Access Journals (Sweden)

    T. Gorgues

    2010-01-01

    Full Text Available A three-dimensional circulation model that includes a representation of anthropogenic carbon as a passive tracer is forced with climatological surface fluxes. This simulation is then used to compute offline the anthropogenic ΔpCO2 (defined as the difference between the atmospheric CO2 and its seawater partial pressure trends over three decades between the years 1970 and 2000. It is shown that the mean increasing trends in ΔpCO2 reflects an increase of the seasonal amplitude of ΔpCO2. In particular, the ocean uptake of anthropogenic CO2 is decreasing (negative trends in ΔpCO2 in boreal (austral summer in the Northern (Southern Hemisphere in the subtropical gyres between 20° N(S and 40° N(S. In our simulation, the increased amplitude of the seasonal trends of the ΔpCO2 is mainly explained by the seasonal sea surface temperature (SST acting on the anthropogenic increase of the dissolved inorganic carbon (DIC. It is also shown that the seasonality of the anthropogenic DIC has very little effect on the decadal trends. This study underscores the need for surface CO2 measurements that resolve the seasonal cycle throughout much of the extratropical oceans.

  18. Can exploiting natural genetic variation in leaf photosynthesis contribute to increasing rice productivity? A simulation analysis

    NARCIS (Netherlands)

    Gu, J.; Yin, X.; Stomph, T.J.; Struik, P.C.

    2014-01-01

    Rice productivity can be limited by available photosynthetic assimilates from leaves. However, the lack of significant correlation between crop yield and leaf photosynthetic rate (A) is noted frequently. Engineering for improved leaf photosynthesis has been argued to yield little increase in crop pr

  19. Economic impacts of increasing seasonal precipitation variation on southeast Wyoming cow-calf enterprises

    Science.gov (United States)

    Economic impacts of predicted increases in precipitation variability on cow-calf enterprises, through influences of precipitation on both forage and cattle productivity, are needed by land managers for risk management strategies. Here we utilize existing forage production and cattle performance data...

  20. Genetic variations of the porcine PRKAG3 gene in Chinese indigenous pig breeds

    Directory of Open Access Journals (Sweden)

    Zhou Li-Hua

    2004-07-01

    Full Text Available Abstract Four missense substitutions (T30N, G52S, V199I and R200Q in the porcine PRKAG3 gene were considered as the likely candidate loci affecting meat quality. In this study, the R200Q substitution was investigated in a sample of 62 individuals from Hampshire, Chinese Min and Erhualian pigs, and the genetic variations of T30N, G52S and V199I substitutions were detected in 1505 individuals from 21 Chinese indigenous breeds, 5 Western commercial pig breeds, and the wild pig. Allele 200R was fixed in Chinese Min and Erhualian pigs. Haplotypes II-QQ and IV-QQ were not observed in the Hampshire population, supporting the hypothesis that allele 200Q is tightly linked with allele 199V. Significant differences in allele frequencies of the three substitutions (T30N, G52S and V199I between Chinese indigenous pigs and Western commercial pigs were observed. Obvious high frequencies of the "favorable" alleles 30T and 52G in terms of meat quality were detected in Chinese indigenous pigs, which are well known for high meat quality. However, the frequency of the "favorable" allele 199I, which was reported to have a greater effect on meat quality in comparison with 30T and 52G, was very low in all of the Chinese indigenous pigs except for the Min pig. The reasons accounting for this discrepancy remain to be addressed. The presence of the three substitutions in purebred Chinese Tibetan pigs indicates that the three substitutions were ancestral mutations. A novel A/G substitution at position 51 in exon 1 was identified. The results suggest that further studies are required to investigate the associations of these substitutions in the PRKAG3 gene with meat quality of Chinese indigenous pigs, and to uncover other polymorphisms in the PRKAG3 gene with potential effects on meat quality in Chinese indigenous pigs.

  1. The influence of genetic variations in HHEX gene on insulin metabolism in the German MESYBEPO cohort.

    Science.gov (United States)

    Pivovarova, Olga; Nikiforova, Victoria J; Pfeiffer, Andreas F H; Rudovich, Natalia

    2009-02-01

    In the present study, we aimed to validate the type 2 diabetes (T2DM) susceptibility alleles identified in the first genome-wide association study in the hematopoietically expressed homeobox protein (HHEX) gene region (rs1111875 and rs7923837). Furthermore, we investigated quantitative metabolic risk phenotypes of these two variants for association with three key components of the insulin metabolism: insulin secretion, insulin sensitivity and insulin degradation. Two HHEX polymorphisms were genotyped in 1026 subjects from the German MESYBEPO cohort. Complete OGTT data were available for a subset of 420 with normal glucose tolerance (NGT), 282 with impaired glucose tolerance/impaired fasting glucose (IGT/IFG) and 146 diabetic subjects. We validated association of both HHEX polymorphisms with T2DM. In the non-diabetic subcohort including NGT and IFG/IGT subjects, the risk alleles of rs7923837 and rs1111875 were significantly associated with decreased first and second phases of insulin secretion and lower insulinogenic index after oral glucose loading. In healthy, normal glucose-tolerant subjects, the same association of HHEX SNP rs1111875 with OGTT-derived phases of insulin secretion were detectable, however, rs7923837 was only weakly associated with reduced insulinogenic index. For both polymorphisms, no significant correlations with insulin sensitivity were obtained. Reduced insulin clearance was also observed in heterozygous carriers of rs1111875. We validated the association of polymorphisms of the HHEX gene with T2DM in the MESYBEPO cohort. Importantly, variations within the HHEX gene conferred the impaired insulin secretion and changes of insulin degradation but no alteration in insulin sensitivity in carriers of risk alleles. Copyright (c) 2008 John Wiley & Sons, Ltd.

  2. Variations of the angiotensin II type 1 receptor gene are associated with extreme human longevity.

    Science.gov (United States)

    Benigni, Ariela; Orisio, Silvia; Noris, Marina; Iatropoulos, Paraskevas; Castaldi, Davide; Kamide, Kei; Rakugi, Hiromi; Arai, Yasumichi; Todeschini, Marta; Ogliari, Giulia; Imai, Enyu; Gondo, Yasuyuki; Hirose, Nobuyoshi; Mari, Daniela; Remuzzi, Giuseppe

    2013-06-01

    Longevity phenotype in humans results from the influence of environmental and genetic factors. Few gene polymorphisms have been identified so far with a modest effect on lifespan leaving room for the search of other players in the longevity game. It has been recently demonstrated that targeted disruption of the mouse homolog of the human angiotensin II type 1 receptor (AT1R) gene (AGTR1) translates into marked prolongation of animal lifespan (Benigni et al., J Clin Invest 119(3):524-530, 2009). Based on the above study in mice, here we sought to search for AGTR1 variations associated to reduced AT1 receptor protein levels and to prolonged lifespan in humans. AGTR1 was sequenced in 173 Italian centenarians and 376 younger controls. A novel non-synonymous mutation was detected in a centenarian. Two polymorphisms in AGTR1 promoter, rs422858 and rs275653, in complete linkage disequilibrium, were significantly associated with the ability to attain extreme old age. We then replicated the study of rs275653 in a large independent cohort of Japanese origin (598 centenarians and semi-supercentenarians, 422 younger controls) and indeed confirmed its association with exceptional old age. In combined analyses, rs275653 was associated to extreme longevity either at recessive model (P = 0.007, odds ratio (OR) 3.57) or at genotype level (P = 0.015). Significance was maintained after correcting for confounding factors. Fluorescence activated cell sorting analysis revealed that subjects homozygous for the minor allele of rs275653 had less AT1R-positive peripheral blood polymorphonuclear cells. Moreover, rs275653 was associated to lower blood pressure in centenarians. These findings highlight the role of AGTR1 as a possible candidate among longevity-enabling genes.

  3. Increased fat oxidation and regulation of metabolic genes with ultraendurance exercise

    DEFF Research Database (Denmark)

    Helge, Jørn Wulff; Rehrer, N J; Pilegaard, H

    2007-01-01

    AIM: Regular endurance exercise stimulates muscle metabolic capacity, but effects of very prolonged endurance exercise are largely unknown. This study examined muscle substrate availability and utilization during prolonged endurance exercise, and associated metabolic genes. METHODS: Data were...... exercise markedly increases plasma fatty acid availability and fat utilization during exercise. Exercise-induced regulation of genes encoding proteins involved in fatty acid recruitment and oxidation may contribute to these changes....

  4. Fight or flight? - Flight increases immune gene expression but does not help to fight an infection.

    Science.gov (United States)

    Woestmann, L; Kvist, J; Saastamoinen, M

    2017-03-01

    Flight represents a key trait in most insects, being energetically extremely demanding, yet often necessary for foraging and reproduction. Additionally, dispersal via flight is especially important for species living in fragmented landscapes. Even though, based on life-history theory, a negative relationship may be expected between flight and immunity, a number of previous studies have indicated flight to induce an increased immune response. In this study, we assessed whether induced immunity (i.e. immune gene expression) in response to 15-min forced flight treatment impacts individual survival of bacterial infection in the Glanville fritillary butterfly (Melitaea cinxia). We were able to confirm previous findings of flight-induced immune gene expression, but still observed substantially stronger effects on both gene expression levels and life span due to bacterial infection compared to flight treatment. Even though gene expression levels of some immunity-related genes were elevated due to flight, these individuals did not show increased survival of bacterial infection, indicating that flight-induced immune activation does not completely protect them from the negative effects of bacterial infection. Finally, an interaction between flight and immune treatment indicated a potential trade-off: flight treatment increased immune gene expression in naïve individuals only, whereas in infected individuals no increase in immune gene expression was induced by flight. Our results suggest that the up-regulation of immune genes upon flight is based on a general stress response rather than reflecting an adaptive response to cope with potential infections during flight or in new habitats.

  5. Evolutionary variations in the expression of dorso-ventral patterning genes and the conservation of pioneer neurons in Tribolium castaneum.

    Science.gov (United States)

    Biffar, Lucia; Stollewerk, Angelika

    2015-04-01

    Insects are ideally suited for gaining insight into the evolutionary developmental mechanisms that have led to adaptive changes of the nervous system since the specific structure of the nervous system can be directly linked to the neural stem cell (neuroblast) lineages, which in turn can be traced back to the last common ancestor of insects. The recent comparative analysis of the Drosophila melanogaster and Tribolium castaneum neuroblast maps revealed substantial differences in the expression profiles of neuroblasts. Here we show that despite the overall conservation of the dorso-ventral expression domains of muscle segment homeobox, intermediate neuroblasts defective and ventral nervous system defective, the expression of these genes relative to the neuroblasts in the respective domains has changed considerably during insect evolution. Furthermore, functional studies show evolutionary changes in the requirement of ventral nervous system defective in the formation of neuroblast 1-1 and the correct differentiation of its presumptive progeny, the pioneer neurons aCC and pCC. The inclusion of the expression data of the dorso-ventral genes into the recently established T. castaneum neuroblast map further increases the differences in the neuroblast expression profiles between D. melanogaster and T. castaneum. Despite these molecular variations, the Even-skipped positive pioneer neurons show an invariant arrangement, except for an additional Even-skipped positive cluster that we discovered in T. castaneum. Given the importance of these pioneer neurons in establishing the intersegmental nerves and the longitudinal tracts, which are part of the conserved axonal scaffold of arthropods, we discuss internal buffering mechanisms that might ensure that neuroblast lineages invariantly generate pioneer neurons over a wide range of molecular variations.

  6. Common variations in the FTO gene and obesity in Thais: a family-based study.

    Science.gov (United States)

    Chuenta, Wanida; Phonrat, Benjaluck; Tungtrongchitr, Anchalee; Limwongse, Chanin; Chongviriyaphan, Nalinee; Santiprabhob, Jeerunda; Tungtrongchitr, Rungsunn

    2015-03-01

    Several studies have revealed the association between single nucleotide polymorphisms (SNPs) in the first intron of fat mass and obesity-associated (FTO) gene and obesity. To date, more than 100 SNPs in the FTO gene have been identified in various populations. Nevertheless, this association has not yet been confirmed in Thai populations. The aim of this study was to investigate whether FTO variants are associated with obesity in Thais. We analyzed ten variants in the FTO gene (rs9939609, rs9926289, rs8050136, rs9930501, rs9930506, rs9940646, rs9940128, rs1421085, rs17817449, and rs8043757) in 12 families (83 persons); composed of 12 proband cases and 71 associated family members. All participants were genotyped using polymerase chain reaction (PCR) method and DNA sequencing assay. We found significant associations between three SNPs located in the first intron of FTO gene (rs1421085, rs17817449, and rs8043757) and obesity. The odds ratios were 2.82 (95% CI, 1.16-6.90, p=0.02) for rs1421085 and rs17817449, and 3.15 (95% CI, 1.28-7.76, p=0.01) for rs8043757. Strong linkage disequilibrium among ten SNPs was observed (D'>0.8). Haplotype analysis (combination of rs1421085 (T/C), rs17817449 (T/G), and rs8043757 (A/T)) showed that the CGT haplotype is associated with an increased risk of obesity (OR, 2.42; 95% CI, 1.18-4.97; p=0.018) when compared to the reference haplotype (TTA). The SNPs rs1421085, rs17817449 and rs8043757 in the first intron of the FTO gene are associated with increasing risk of obesity in Thais. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Directory of Open Access Journals (Sweden)

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  8. AHSG gene variation is not associated with regional body fat distribution--a magnetic resonance study.

    Science.gov (United States)

    Müssig, K; Staiger, H; Machicao, F; Machann, J; Hennige, A M; Schick, F; Claussen, C D; Fritsche, A; Häring, H-U; Stefan, N

    2009-09-01

    Obesity-resistance in AHSG-knockout mice indicate an important role of alpha2-Heremans-Schmid glycoprotein/fetuin-A (AHSG) in the development of obesity. We studied whether genetic variation within AHSG affects whole-body adiposity and regional fat distribution in humans. We genotyped 321 subjects at increased risk for type 2 diabetes for five single nucleotide polymorphisms (SNP) rs2248690, rs4831, rs2070635, rs4917, and rs1071592. Body fat distribution and ectopic hepatic and intramyocellular lipids were assessed by magnetic resonance techniques. AHSG levels were determined by immunoturbidimetry. The five chosen SNPs covered 100% of common genetic variation (minor allele frequency >/=0.05) within AHSG (r (2)>/=0.8). All SNPs were significantly associated with AHSG levels (pbody mass index (BMI). AHSG levels were associated with liver fat content (p=0.0160) and BMI (p=0.0247) after adjustment for gender and age. While rs2248690 was nominally associated with BMI in the dominant model (p=0.0432), none of the SNPs was associated with regional fat distribution. Common genetic variation within AHSG does not appear to influence regional body fat distribution, but may affect whole-body adiposity in humans.

  9. Better stay together: pair bond duration increases individual fitness independent of age-related variation

    OpenAIRE

    Sánchez-Macouzet, Oscar; Rodríguez, Cristina; Drummond, Hugh

    2014-01-01

    Prolonged pair bonds have the potential to improve reproductive performance of socially monogamous animals by increasing pair familiarity and enhancing coordination and cooperation between pair members. However, this has proved very difficult to test robustly because of important confounds such as age and reproductive experience. Here, we address limitations of previous studies and provide a rigorous test of the mate familiarity effect in the socially monogamous blue-footed booby, Sula neboux...

  10. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner.

    Science.gov (United States)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij; Zeegers, Maurice P; Holst, Claus; Wang, Ping; Astrup, Arne; Saris, Wim H; Valsesia, Armand; Hager, Jörg; van Baak, Marleen A; Mariman, Edwin C M

    2015-11-01

    The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159 males) were on an 8-week low-calorie diet with a 6-month follow-up. Body weight was measured before and after the diet, and after follow-up. Weight maintenance scores (WMS, regained weight as percentage of lost weight) were calculated based on the weight data. Genotype data were retrieved for 2903 SNPs corresponding to 124 ECM-related genes. Regression analyses provided us with six significant SNPs associated with the WMS in males: 3 SNPs in the POSTN gene and a SNP in the LAMB1, COL23A1, and FBLN5 genes. For females, 1 SNP was found in the FN1 gene. The risk of weight regain was increased by: the C/C genotype for POSTN in a co-dominant model (OR 8.25, 95 % CI 2.85-23.88) and the T/C-C/C genotype in a dominant model (OR 4.88, 95 % CI 2.35-10.16); the A/A genotype for LAMB1 both in a co-dominant model (OR 18.43, 95 % CI 2.35-144.63) and in a recessive model (OR 16.36, 95 % CI 2.14-124.9); the G/A genotype for COL23A1 in a co-dominant model (OR 3.94, 95 % CI 1.28-12.10), or the A-allele in a dominant model (OR 2.86, 95 % CI 1.10-7.49); the A/A genotype for FBLN5 in a co-dominant model (OR 13.00, 95 % CI 1.61-104.81); and the A/A genotype for FN1 in a recessive model (OR 2.81, 95 % CI 1.40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner.

  11. Natural variation in the Pto pathogen resistance gene within species of wild tomato (Lycopersicon). I. Functional analysis of Pto alleles.

    Science.gov (United States)

    Rose, Laura E; Langley, Charles H; Bernal, Adriana J; Michelmore, Richard W

    2005-09-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene.

  12. Variation in the vitamin D receptor gene is not associated with risk of colorectal cancer in the Czech Republic.

    LENUS (Irish Health Repository)

    Hughes, David J

    2012-02-01

    PURPOSE: Increased levels of vitamin D may protect against colorectal cancer (CRC) development and recurrence. Accumulating epidemiologic evidence suggests these effects may be partly mediated by genetic variants of the vitamin D receptor (VDR) proposed to be associated with altered risk of CRC. We wished to determine if common VDR polymorphisms affected CRC risk in the Czech Republic, a homogenous European population with a high CRC incidence rate. METHODS: Frequencies of the common VDR gene polymorphisms rs2238136, rs1544410 (BsmI), rs7975232 (ApaI), and rs731236 (TaqI) were determined using allele-specific PCR in a case control analysis of a series of 754 CRC patients and 627 patients without malignant disease recruited from centers throughout the Czech Republic. Unconditional logistic regression was used to calculate odds ratios and 95% confidence intervals for the association between these variants and risk of CRC. RESULTS: None of the four polymorphisms tested had any significant effect on CRC risk. No significant differences were observed in susceptibility when the population was stratified by anatomical sub-site, sex, BMI, smoking, alcohol, or presence of polyps. CONCLUSIONS: We conclude that common variation in the VDR gene had little effect on its own on predisposition to sporadic CRC in the Czech population.

  13. Variations in inflammation-related genes may be associated with childhood febrile seizure susceptibility.

    Science.gov (United States)

    Emsley, Hedley C A; Appleton, Richard E; Whitmore, Catherine L; Jury, Francine; Lamb, Janine A; Martin, Joanne E; Ollier, William E R; de la Morandière, Katherine Potier; Southern, Kevin W; Allan, Stuart M

    2014-06-01

    To investigate whether genetic variants in inflammation-related genes are associated with increased risk of childhood-onset febrile seizures. Tagging single nucleotide polymorphisms (SNPs) from 19 inflammation-related candidate genes were identified and genotyped on the Sequenom platform in a sample of Caucasian childhood-onset febrile seizures cases (n=98) compared to ethnicity, age and gender matched febrile controls presenting without seizures (n=123). Tests for allelic association were carried out using PLINK. SNPs generating empirical P-values (Pfebrile seizures case-control analysis in the P2X7R (purinergic receptor P2X7), TLR4 (toll-like receptor 4), IL6R (interleukin 6 receptor) and PTGER3 (prostaglandin E receptor 3, subtype EP3) genes. The most significant result was for missense SNP rs208294 in P2X7R (P=0.009); this novel association was supported in the expanded case-control analysis using the 1958 Birth Cohort (pointwise P=0.009, OR=0.63, familywise P=0.039). Genetic variants in inflammation-related genes, specifically purinergic receptor P2X7, may be involved in susceptibility to childhood-onset febrile seizures. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  14. Better stay together: pair bond duration increases individual fitness independent of age-related variation

    Science.gov (United States)

    Sánchez-Macouzet, Oscar; Rodríguez, Cristina; Drummond, Hugh

    2014-01-01

    Prolonged pair bonds have the potential to improve reproductive performance of socially monogamous animals by increasing pair familiarity and enhancing coordination and cooperation between pair members. However, this has proved very difficult to test robustly because of important confounds such as age and reproductive experience. Here, we address limitations of previous studies and provide a rigorous test of the mate familiarity effect in the socially monogamous blue-footed booby, Sula nebouxii, a long-lived marine bird with a high divorce rate. Taking advantage of a natural disassociation between age and pair bond duration in this species, and applying a novel analytical approach to a 24 year database, we found that those pairs which have been together for longer establish their clutches five weeks earlier in the season, hatch more of their eggs and produce 35% more fledglings, regardless of age and reproductive experience. Our results demonstrate that pair bond duration increases individual fitness and further suggest that synergistic effects between a male and female's behaviour are likely to be involved in generating a mate familiarity effect. These findings help to explain the age- and experience-independent benefits of remating and their role in life-history evolution. PMID:24827435

  15. Variation in the ovine hormone-sensitive lipase gene (HSL) and its association with growth and carcass traits in New Zealand Suffolk sheep.

    Science.gov (United States)

    Yang, Guo; Forrest, Rachel; Zhou, Huitong; Hickford, Jonathan

    2014-01-01

    The hormone-sensitive lipase (HSL) plays an important role in the regulation of lipolysis in adipose tissues, by catalysing a rate-limiting step in triglyceride hydrolysis. Variation within the human HSL gene (HSL) has been associated with an increased risk of obesity. In this study, variation within three regions (exon 3-4, exon 5-6 and exon 9) of ovine HSL was investigated in 538 Suffolk lambs bred from 13 independent sires using PCR-SSCP. Four sequence variants of intron 5 (designated A-D) and two variants of exon 9 (designated a and b) of ovine HSL were detected. No variation was found in exon 3-4 of the gene. The associations of the variation within ovine HSL with post-weaning growth and carcass traits including eye muscle depth (EMD), eye muscle width (EMW) and fat depth above the eye muscle (FDM) were assessed in 262 of the above 538 lambs using general linear mixed-effects models. In the single variant models, the presence of intron 5 A in a lamb's genotype was associated with reduced EMD (P = 0.036) and EMW (P = 0.018), whereas the presence of intron 5 C was associated with increased EMD (P HSL intron 5 variants and post-weaning growth, or between HSL exon 9 variants, post-weaning growth or carcass traits, were found.

  16. Temporal variation in groundwater quality in the Permian Basin of Texas, a region of increasing unconventional oil and gas development.

    Science.gov (United States)

    Hildenbrand, Zacariah L; Carlton, Doug D; Fontenot, Brian E; Meik, Jesse M; Walton, Jayme L; Thacker, Jonathan B; Korlie, Stephanie; Shelor, C Phillip; Kadjo, Akinde F; Clark, Adelaide; Usenko, Sascha; Hamilton, Jason S; Mach, Phillip M; Verbeck, Guido F; Hudak, Paul; Schug, Kevin A

    2016-08-15

    The recent expansion of natural gas and oil extraction using unconventional oil and gas development (UD) practices such as horizontal drilling and hydraulic fracturing has raised questions about the potential for environmental impacts. Prior research has focused on evaluations of air and water quality in particular regions without explicitly considering temporal variation; thus, little is known about the potential effects of UD activity on the environment over longer periods of time. Here, we present an assessment of private well water quality in an area of increasing UD activity over a period of 13months. We analyzed samples from 42 private water wells located in three contiguous counties on the Eastern Shelf of the Permian Basin in Texas. This area has experienced a rise in UD activity in the last few years, and we analyzed samples in four separate time points to assess variation in groundwater quality over time as UD activities increased. We monitored general water quality parameters as well as several compounds used in UD activities. We found that some constituents remained stable over time, but others experienced significant variation over the period of study. Notable findings include significant changes in total organic carbon and pH along with ephemeral detections of ethanol, bromide, and dichloromethane after the initial sampling phase. These data provide insight into the potentially transient nature of compounds associated with groundwater contamination in areas experiencing UD activity.

  17. Increasing galactose consumption by Saccharomyces cerevisiae through metabolic engineering of the GAL gene regulatory network

    DEFF Research Database (Denmark)

    Østergaard, Simon; Olsson, Lisbeth; Johnston, M.

    2000-01-01

    in the pathway, and ultimately, increasing metabolic flux through the pathway of interest, By manipulating the GAL gene regulatory network of Saccharomyces cerevisiae, which is a tightly regulated system, we produced prototroph mutant strains, which increased the flux through the galactose utilization pathway...... media. The improved galactose consumption of the gal mutants did not favor biomass formation, but rather caused excessive respiro-fermentative metabolism, with the ethanol production rate increasing linearly with glycolytic flux....

  18. Patterns of human genetic variation inferred from comparative analysis of allelic mutations in blood group antigen genes.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Blumenfeld, Olga O

    2011-03-01

    Comparative analysis of allelic variation of a gene sheds light on the pattern and process of its diversification at the population level. Gene families for which a large number of allelic forms have been verified by sequencing provide a useful resource for such studies. In this regard, human blood group-encoding genes are unique in that differences of cell surface traits among individuals and populations can be readily detected by serological screening, and correlation between the variant cell surface phenotype and the genotype is, in most cases, unequivocal. Here, we perform a comprehensive analysis of allelic forms, compiled in the Blood Group Antigen Gene Mutation database, of ABO, RHD/CE, GYPA/B/E and FUT1/2 gene families that encode the ABO, RH, MNS, and H/h blood group system antigens, respectively. These genes are excellent illustrative examples showing distinct mutational patterns among the alleles, and leading to speculation on how their origin may have been driven by recurrent but different molecular mechanisms. We illustrate how alignment of alleles of a gene may provide an additional insight into the DNA variation process and its pathways, and how this approach may serve to catalog alleles of a gene, simplifying the task and content of mutation databases.

  19. Identification of genes related to the phenotypic variations of a synthesized Paulownia (Paulownia tomentosa×Paulownia fortunei) autotetraploid.

    Science.gov (United States)

    Li, Yongsheng; Fan, Guoqiang; Dong, Yanpeng; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Xu, Enkai; Niu, Suyan

    2014-12-15

    Paulownia is a fast-growing deciduous tree native to China. It has great economic importance for the pulp and paper industries, as well as ecological prominence in forest ecosystems. Paulownia is of much interest to plant breeder keen to explore new plant varieties by selecting on the basis of phenotype. A newly synthesized autotetraploid Paulownia exhibited advanced characteristics, such as greater yield, and higher resistance than the diploid tree. However, tissue-specific transcriptome and genomic data in public databases are not sufficient to understand the molecular mechanisms associated with genome duplication. To evaluate the effects of genome duplication on the phenotypic variations in Paulownia tomentosa×Paulownia fortunei, the transcriptomes of the autotetraploid and diploid Paulownia were compared. Using Illumina sequencing technology, a total of 82,934 All-unigenes with a mean length of 1109 bp were assembled. The data revealed numerous differences in gene expression between the two transcriptomes, including 718 up-regulated and 667 down-regulated differentially expressed genes between the two Paulownia trees. An analysis of the pathway and gene annotations revealed that genes involved in nucleotide sugar metabolism in plant cell walls were down-regulated, and genes involved in the light signal pathway and the biosynthesis of structural polymers were up-regulated in autotetraploid Paulownia. The differentially expressed genes may contribute to the observed phenotypic variations between diploid and autotetraploid Paulownia. These results provide a significant resource for understanding the variations in Paulownia polyploidization and will benefit future breeding work.

  20. Attenuation of circadian variation by combined antianginal therapy with suppression of morning and evening increases in transient myocardial ischemia

    DEFF Research Database (Denmark)

    Egstrup, K

    1991-01-01

    three 6-hour periods (p less than 0.01); a lesser peak was noted in the evening. The effects of metoprolol and combined therapy with metoprolol and nifedipine on the circadian variation of ischemic activity were studied in two subgroups of patients in a random, double-blind study design (31 patients...... receiving metoprolol and 42 receiving combined therapy). During therapy with metoprolol the morning increase in ischemic activity was attenuated, and the highest frequency of ischemia was then noted in the evening (6 AM to 12 noon compared with 6 PM to 12 midnight; p less than 0.05). Combined therapy...... abolished the morning peak as did metoprolol monotherapy, but even the evening increase in ischemic activity was attenuated (p less than 0.05). The diurnal distribution of the mean heart rate at the onset of ischemia, when patients were off therapy, showed a morning increase similar to the increase...

  1. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    Institute of Scientific and Technical Information of China (English)

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  2. Aboriginal Australian mitochondrial genome variation – an increased understanding of population antiquity and diversity

    Science.gov (United States)

    Nagle, Nano; van Oven, Mannis; Wilcox, Stephen; van Holst Pellekaan, Sheila; Tyler-Smith, Chris; Xue, Yali; Ballantyne, Kaye N.; Wilcox, Leah; Papac, Luka; Cooke, Karen; van Oorschot, Roland A. H.; McAllister, Peter; Williams, Lesley; Kayser, Manfred; Mitchell, R. John; Adhikarla, Syama; Adler, Christina J.; Balanovska, Elena; Balanovsky, Oleg; Bertranpetit, Jaume; Clarke, Andrew C.; Comas, David; Cooper, Alan; Der Sarkissian, Clio S. I.; Dulik, Matthew C.; Gaieski, Jill B.; GaneshPrasad, ArunKumar; Haak, Wolfgang; Haber, Marc; Hobbs, Angela; Javed, Asif; Jin, Li; Kaplan, Matthew E.; Li, Shilin; Martínez-Cruz, Begoña; Matisoo-Smith, Elizabeth A.; Melé, Marta; Merchant, Nirav C.; Owings, Amanda C.; Parida, Laxmi; Pitchappan, Ramasamy; Platt, Daniel E.; Quintana-Murci, Lluis; Renfrew, Colin; Royyuru, Ajay K.; Santhakumari, Arun Varatharajan; Santos, Fabrício R.; Schurr, Theodore G.; Soodyall, Himla; Soria Hernanz, David F.; Swamikrishnan, Pandikumar; Vilar, Miguel G.; Wells, R. Spencer; Zalloua, Pierre A.; Ziegle, Janet S.

    2017-01-01

    Aboriginal Australians represent one of the oldest continuous cultures outside Africa, with evidence indicating that their ancestors arrived in the ancient landmass of Sahul (present-day New Guinea and Australia) ~55 thousand years ago. Genetic studies, though limited, have demonstrated both the uniqueness and antiquity of Aboriginal Australian genomes. We have further resolved known Aboriginal Australian mitochondrial haplogroups and discovered novel indigenous lineages by sequencing the mitogenomes of 127 contemporary Aboriginal Australians. In particular, the more common haplogroups observed in our dataset included M42a, M42c, S, P5 and P12, followed by rarer haplogroups M15, M16, N13, O, P3, P6 and P8. We propose some major phylogenetic rearrangements, such as in haplogroup P where we delinked P4a and P4b and redefined them as P4 (New Guinean) and P11 (Australian), respectively. Haplogroup P2b was identified as a novel clade potentially restricted to Torres Strait Islanders. Nearly all Aboriginal Australian mitochondrial haplogroups detected appear to be ancient, with no evidence of later introgression during the Holocene. Our findings greatly increase knowledge about the geographic distribution and phylogenetic structure of mitochondrial lineages that have survived in contemporary descendants of Australia’s first settlers. PMID:28287095

  3. Aboriginal Australian mitochondrial genome variation - an increased understanding of population antiquity and diversity

    Science.gov (United States)

    Nagle, Nano; van Oven, Mannis; Wilcox, Stephen; van Holst Pellekaan, Sheila; Tyler-Smith, Chris; Xue, Yali; Ballantyne, Kaye N.; Wilcox, Leah; Papac, Luka; Cooke, Karen; van Oorschot, Roland A. H.; McAllister, Peter; Williams, Lesley; Kayser, Manfred; Mitchell, R. John; Adhikarla, Syama; Adler, Christina J.; Balanovska, Elena; Balanovsky, Oleg; Bertranpetit, Jaume; Clarke, Andrew C.; Comas, David; Cooper, Alan; der Sarkissian, Clio S. I.; Dulik, Matthew C.; Gaieski, Jill B.; Ganeshprasad, Arunkumar; Haak, Wolfgang; Haber, Marc; Hobbs, Angela; Javed, Asif; Jin, Li; Kaplan, Matthew E.; Li, Shilin; Martínez-Cruz, Begoña; Matisoo-Smith, Elizabeth A.; Melé, Marta; Merchant, Nirav C.; Owings, Amanda C.; Parida, Laxmi; Pitchappan, Ramasamy; Platt, Daniel E.; Quintana-Murci, Lluis; Renfrew, Colin; Royyuru, Ajay K.; Santhakumari, Arun Varatharajan; Santos, Fabrício R.; Schurr, Theodore G.; Soodyall, Himla; Soria Hernanz, David F.; Swamikrishnan, Pandikumar; Vilar, Miguel G.; Wells, R. Spencer; Zalloua, Pierre A.; Ziegle, Janet S.

    2017-03-01

    Aboriginal Australians represent one of the oldest continuous cultures outside Africa, with evidence indicating that their ancestors arrived in the ancient landmass of Sahul (present-day New Guinea and Australia) ~55 thousand years ago. Genetic studies, though limited, have demonstrated both the uniqueness and antiquity of Aboriginal Australian genomes. We have further resolved known Aboriginal Australian mitochondrial haplogroups and discovered novel indigenous lineages by sequencing the mitogenomes of 127 contemporary Aboriginal Australians. In particular, the more common haplogroups observed in our dataset included M42a, M42c, S, P5 and P12, followed by rarer haplogroups M15, M16, N13, O, P3, P6 and P8. We propose some major phylogenetic rearrangements, such as in haplogroup P where we delinked P4a and P4b and redefined them as P4 (New Guinean) and P11 (Australian), respectively. Haplogroup P2b was identified as a novel clade potentially restricted to Torres Strait Islanders. Nearly all Aboriginal Australian mitochondrial haplogroups detected appear to be ancient, with no evidence of later introgression during the Holocene. Our findings greatly increase knowledge about the geographic distribution and phylogenetic structure of mitochondrial lineages that have survived in contemporary descendants of Australia’s first settlers.

  4. Comparison of Affymetrix Gene Array with the Exon Array shows potential application for detection of transcript isoform variation

    Directory of Open Access Journals (Sweden)

    Coulombe-Huntington Jasmin

    2009-11-01

    Full Text Available Abstract Background The emergence of isoform-sensitive microarrays has helped fuel in-depth studies of the human transcriptome. The Affymetrix GeneChip Human Exon 1.0 ST Array (Exon Array has been previously shown to be effective in profiling gene expression at the isoform level. More recently, the Affymetrix GeneChip Human Gene 1.0 ST Array (Gene Array has been released for measuring gene expression and interestingly contains a large subset of probes from the Exon Array. Here, we explore the potential of using Gene Array probes to assess expression variation at the sub-transcript level. Utilizing datasets of the high quality Microarray Quality Control (MAQC RNA samples previously assayed on the Exon Array and Gene Array, we compare the expression measurements of the two platforms to determine the performance of the Gene Array in detecting isoform variations. Results Overall, we show that the Gene Array is comparable to the Exon Array in making gene expression calls. Moreover, to examine expression of different isoforms, we modify the Gene Array probe set definition file to enable summarization of probe intensity values at the exon level and show that the expression profiles between the two platforms are also highly correlated. Next, expression calls of previously known differentially spliced genes were compared and also show concordant results. Splicing index analysis, representing estimates of exon inclusion levels, shows a lower but good correlation between platforms. As the Gene Array contains a significant subset of probes from the Exon Array, we note that, in comparison, the Gene Array overlaps with fewer but still a high proportion of splicing events annotated in the Known Alt Events UCSC track, with abundant coverage of cassette exons. We discuss the ability of the Gene Array to detect alternative splicing and isoform variation and address its limitations. Conclusion The Gene Array is an effective expression profiling tool at gene and

  5. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  6. Global genome splicing analysis reveals an increased number of alternatively spliced genes with aging.

    Science.gov (United States)

    Rodríguez, Sofía A; Grochová, Diana; McKenna, Tomás; Borate, Bhavesh; Trivedi, Niraj S; Erdos, Michael R; Eriksson, Maria

    2016-04-01

    Alternative splicing (AS) is a key regulatory mechanism for the development of different tissues; however, not much is known about changes to alternative splicing during aging. Splicing events may become more frequent and widespread genome-wide as tissues age and the splicing machinery stringency decreases. Using skin, skeletal muscle, bone, thymus, and white adipose tissue from wild-type C57BL6/J male mice (4 and 18 months old), we examined the effect of age on splicing by AS analysis of the differential exon usage of the genome. The results identified a considerable number of AS genes in skeletal muscle, thymus, bone, and white adipose tissue between the different age groups (ranging from 27 to 246 AS genes corresponding to 0.3-3.2% of the total number of genes analyzed). For skin, skeletal muscle, and bone, we included a later age group (28 months old) that showed that the number of alternatively spliced genes increased with age in all three tissues (P aging disease Hutchinson-Gilford progeria syndrome was performed. The results show that expression of the mutant protein, progerin, is associated with an impaired developmental splicing. As progerin accumulates, the number of genes with AS increases compared to in wild-type skin. Our results indicate the existence of a mechanism for increased AS during aging in several tissues, emphasizing that AS has a more important role in the aging process than previously known.

  7. Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins.

    Science.gov (United States)

    Wickham, T J; Tzeng, E; Shears, L L; Roelvink, P W; Li, Y; Lee, G M; Brough, D E; Lizonova, A; Kovesdi, I

    1997-11-01

    Alteration of the natural tropism of adenovirus (Ad) will permit gene transfer into specific cell types and thereby greatly broaden the scope of target diseases that can be treated by using Ad. We have constructed two Ad vectors which contain modifications to the Ad fiber coat protein that redirect virus binding to either alpha(v) integrin [AdZ.F(RGD)] or heparan sulfate [AdZ.F(pK7)] cellular receptors. These vectors were constructed by a novel method involving E4 rescue of an E4-deficient Ad with a transfer vector containing both the E4 region and the modified fiber gene. AdZ.F(RGD) increased gene delivery to endothelial and smooth muscle cells expressing alpha(v) integrins. Likewise, AdZ.F(pK7) increased transduction 5- to 500-fold in multiple cell types lacking high levels of Ad fiber receptor, including macrophage, endothelial, smooth muscle, fibroblast, and T cells. In addition, AdZ.F(pK7) significantly increased gene transfer in vivo to vascular smooth muscle cells of the porcine iliac artery following balloon angioplasty. These vectors may therefore be useful in gene therapy for vascular restenosis or for targeting endothelial cells in tumors. Although binding to the fiber receptor still occurs with these vectors, they demonstrate the feasibility of tissue-specific receptor targeting in cells which express low levels of Ad fiber receptor.

  8. Common Variation in the NOS1AP Gene Is Associated With Drug-Induced QT Prolongation and Ventricular Arrhythmia

    NARCIS (Netherlands)

    Jamshidi, Yalda; Nolte, Ilja M.; Dalageorgou, Chrysoula; Zheng, Dongling; Johnson, Toby; Bastiaenen, Rachel; Ruddy, Suzanne; Talbott, Daniel; Norris, Kris J.; Snieder, Harold; George, Alfred L.; Marshall, Vanessa; Shakir, Saad; Kannankeril, Prince J.; Munroe, Patricia B.; Camm, A. John; Jeffery, Steve; Roden, Dan M.; Behr, Elijah R.

    2012-01-01

    Objectives This study sought to determine whether variations in NOS1AP affect drug-induced long QT syndrome (LQTS). Background Use of antiarrhythmic drugs is limited by the high incidence of serious adverse events including QT prolongation and torsades de pointes. NOS1AP gene variants play a role in

  9. Genetic Variation and the Risk of Haloperidol-Related Parkinsonism in Elderly Patients A Candidate Gene Approach

    NARCIS (Netherlands)

    Knol, Wilma; van Marum, Rob J.; Jansen, Paul A. F.; Strengman, Eric; Al Hadithy, Asmar F. Y.; Wilffert, Bob; Schobben, Alfred F. A. M.; Ophoff, Roel A.; Egberts, Toine C. G.

    2013-01-01

    Factors that influence the variation in occurrence of antipsychotic-related parkinsonism in elderly have not been well elucidated. The aim of this study was to investigate whether previous identified and studied genetic polymorphisms at DRD2, ANKK1, DRD3, HTR2A, HTR2C, RGS2, COMT, and BDNF genes are

  10. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, L S; Wod, M; Grarup, Niels;

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...... diabetes susceptibility or influences diabetes-related metabolic traits....

  11. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas;

    2012-01-01

    3918342 and rs1421292, were significantly associated with CSF HVA concentrations. Rs3918342 was found to be nominally associated with CSF 5-HIAA concentrations. None of the polymorphisms were significantly associated with MHPG concentrations. Our results indicate that DAOA gene variation affects dopamine...

  12. Common genetic variation in the Estrogen Receptor Beta (ESR2) gene and osteoarthritis: Results of a meta-analysis

    NARCIS (Netherlands)

    J.M. Kerkhof (Hanneke); I. Meulenbelt (Ingrid); A. Gonzalez (Antonio); D.J. Hart (Deborah); A. Hofman (Albert); M. Kloppenburg (Margreet); N.E. Lane; J. Loughlin (John); M.C. Nevitt (Michael); H.A.P. Pols (Huib); F. Rivadeneira Ramirez (Fernando); E. Slagboom (Eline); T.D. Spector (Tim); L. Stolk (Lisette); A. Tsezou (Aspasia); A.G. Uitterlinden (André); A.M. Valdes (Ana Maria); J.B.J. van Meurs (Joyce); A.J. Carr (Andrew Jonathan)

    2010-01-01

    textabstractBackground: The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis.Methods: In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs) were genotyped and tested for association with hip

  13. Variations in potassium channel genes are associated with breast pain in women prior to breast cancer surgery.

    Science.gov (United States)

    Langford, Dale J; West, Claudia; Elboim, Charles; Cooper, Bruce A; Abrams, Gary; Paul, Steven M; Schmidt, Brian L; Levine, Jon D; Merriman, John D; Dhruva, Anand; Neuhaus, John; Leutwyler, Heather; Baggott, Christina; Sullivan, Carmen Ward; Aouizerat, Bradley E; Miaskowski, Christine

    2014-01-01

    Preoperative breast pain in women with breast cancer may result from a number of causes. Previous work from our team found that breast pain occurred in 28.2% of women (n = 398) who were about to undergo breast cancer surgery. The occurrence of preoperative breast pain was associated with a number of demographic and clinical characteristics, as well as variation in two cytokine genes. Given that ion channels regulate excitability of sensory neurons, we hypothesized that variations in potassium channel genes would be associated with preoperative breast pain in these patients. Therefore, in this study, we evaluated for associations between single-nucleotide polymorphisms and inferred haplotypes among 10 potassium channel genes and the occurrence of preoperative breast pain in patients scheduled to undergo breast cancer surgery. Multivariable logistic regression analyses were used to identify those genetic variations that were associated with the occurrence of preoperative breast pain while controlling for age and genomic estimates of and self-reported race/ethnicity. Variations in four potassium channel genes: (1) potassium voltage-gated channel, delayed rectifier, subfamily S, member 1 (KCNS1); (2) potassium inwardly rectifying channel, subfamily J, member 3 (KCNJ3); (3) KCNJ6; and (4) potassium channel, subfamily K, member 9 (KCNK9) were associated with the occurrence of breast pain. Findings from this study warrant replication in an independent sample of women who report breast pain following one or more breast biopsies.

  14. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  15. Gene variations of nitric oxide synthase regulate the effects of a saturated fat rich meal on endothelial function

    Science.gov (United States)

    Objective: Endothelial nitric oxide synthase gene variations have been linked to a higher risk for cardiovascular diseases by unknown mechanisms. Our aim was to determine if two SNPs located in NOS3 (E298D and i19342) interfere with microvascular endothelial function (MEF) and/or oxidative stress du...

  16. A positive feedback-based gene circuit to increase the production of a membrane protein

    Directory of Open Access Journals (Sweden)

    Gennis Robert B

    2010-05-01

    Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.

  17. Nonallelic homologous recombination of the FCGR2/3 locus results in copy number variation and novel chimeric FCGR2 genes with aberrant functional expression.

    Science.gov (United States)

    Nagelkerke, S Q; Tacke, C E; Breunis, W B; Geissler, J; Sins, J W R; Appelhof, B; van den Berg, T K; de Boer, M; Kuijpers, T W

    2015-09-01

    The human FCGR2/3 locus, containing five highly homologous genes encoding the major IgG receptors, shows extensive copy number variation (CNV) associated with susceptibility to autoimmune diseases. Having genotyped >4000 individuals, we show that all CNV at this locus can be explained by nonallelic homologous recombination (NAHR) of the two paralogous repeats that constitute the majority of the locus, and describe four distinct CNV regions (CNRs) with a highly variable prevalence in the population. Apart from CNV, NAHR events also created several hitherto unidentified chimeric FCGR2 genes. These include an FCGR2A/2C chimeric gene that causes a decreased expression of FcγRIIa on phagocytes, resulting in a decreased production of reactive oxygen species in response to immune complexes, compared with wild-type FCGR2A. Conversely, FCGR2C/2A chimeric genes were identified to lead to an increased expression of FCGR2C. Finally, a rare FCGR2B null-variant allele was found, in which a polymorphic stop codon of FCGR2C is introduced into one FCGR2B gene, resulting in a 50% reduction in protein expression. Our study on CNRs and the chimeric genes is essential for the correct interpretation of association studies on FCGR genes as a determinant for disease susceptibility, and may explain some as yet unidentified extreme phenotypes of immune-mediated disease.

  18. Overexpression of several Arabidopsis histone genes increases agrobacterium-mediated transformation and transgene expression in plants.

    Science.gov (United States)

    Tenea, Gabriela N; Spantzel, Joerg; Lee, Lan-Ying; Zhu, Yanmin; Lin, Kui; Johnson, Susan J; Gelvin, Stanton B

    2009-10-01

    The Arabidopsis thaliana histone H2A-1 is important for Agrobacterium tumefaciens-mediated plant transformation. Mutation of HTA1, the gene encoding histone H2A-1, results in decreased T-DNA integration into the genome of Arabidopsis roots, whereas overexpression of HTA1 increases transformation frequency. To understand the mechanism by which HTA1 enhances transformation, we investigated the effects of overexpression of numerous Arabidopsis histones on transformation and transgene expression. Transgenic Arabidopsis containing cDNAs encoding histone H2A (HTA), histone H4 (HFO), and histone H3-11 (HTR11) displayed increased transformation susceptibility, whereas histone H2B (HTB) and most histone H3 (HTR) cDNAs did not increase transformation. A parallel increase in transient gene expression was observed when histone HTA, HFO, or HTR11 overexpression constructs were cotransfected with double- or single-stranded forms of a gusA gene into tobacco (Nicotiana tabacum) protoplasts. However, these cDNAs did not increase expression of a previously integrated transgene. We identified the N-terminal 39 amino acids of H2A-1 as sufficient to increase transient transgene expression in plants. After transfection, transgene DNA accumulates more rapidly in the presence of HTA1 than with a control construction. Our results suggest that certain histones enhance transgene expression, protect incoming transgene DNA during the initial stages of transformation, and subsequently increase the efficiency of Agrobacterium-mediated transformation.

  19. Absence of functional TolC protein causes increased stress response gene expression in Sinorhizobium meliloti

    Directory of Open Access Journals (Sweden)

    Moreira Leonilde M

    2010-06-01

    Full Text Available Abstract Background The TolC protein from Sinorhizobium meliloti has previously been demonstrated to be required for establishing successful biological nitrogen fixation symbiosis with Medicago sativa. It is also needed in protein and exopolysaccharide secretion and for protection against osmotic and oxidative stresses. Here, the transcriptional profile of free-living S. meliloti 1021 tolC mutant is described as a step toward understanding its role in the physiology of the cell. Results Comparison of tolC mutant and wild-type strains transcriptomes showed 1177 genes with significantly increased expression while 325 had significantly decreased expression levels. The genes with an increased expression suggest the activation of a cytoplasmic and extracytoplasmic stress responses possibly mediated by the sigma factor RpoH1 and protein homologues of the CpxRA two-component regulatory system of Enterobacteria, respectively. Stress conditions are probably caused by perturbation of the cell envelope. Consistent with gene expression data, biochemical analysis indicates that the tolC mutant suffers from oxidative stress. This is illustrated by the elevated enzyme activity levels detected for catalase, superoxide dismutase and glutathione reductase. The observed increase in the expression of genes encoding products involved in central metabolism and transporters for nutrient uptake suggests a higher metabolic rate of the tolC mutant. We also demonstrated increased swarming motility in the tolC mutant strain. Absence of functional TolC caused decreased expression mainly of genes encoding products involved in nitrogen metabolism and transport. Conclusion This work shows how a mutation in the outer membrane protein TolC, common to many bacterial transport systems, affects expression of a large number of genes that act in concert to restore cell homeostasis. This finding further underlines the fundamental role of this protein in Sinorhizobium meliloti biology.

  20. The impact of heat shock protein 70 gene variations on clinical presentation and outcome in schizophrenic inpatients.

    Science.gov (United States)

    Pae, Chi-Un; Drago, Antonio; Kim, Jung-Jin; Mandelli, Laura; De Ronchi, Diana; Serretti, Alessandro

    2009-01-01

    We previously investigated a group of single-nucleotide polymorphisms of a set of genes coding for heat shock proteins (HSPA1A, HSPA1B and HSPA1L) and found a significant association between one HSPA1B variation and schizophrenia (SZ). We now report an association between a set of variations (rs2227956, rs2075799, rs1043618, rs562047 and rs539689) within the same genes and a larger sample of schizophrenic inpatients. A single variation, rs539689 (HSPA1B), was found to be marginally associated with Positive and Negative Syndrome Scale (PANSS) positive scores at discharge, and haplotype analysis revealed a significant association between improvement in PANSS scores with both A-C-G-G and A-C-G-G haplotypes. These findings further support a role of heat shock proteins in the pathophysiology of SZ.

  1. Variation among genotypes in responses to increasing temperature in a marine parasite: evolutionary potential in the face of global warming?

    Science.gov (United States)

    Berkhout, Boris W; Lloyd, Melanie M; Poulin, Robert; Studer, Anja

    2014-11-01

    Climates are changing worldwide, and populations are under selection to adapt to these changes. Changing temperature, in particular, can directly impact ectotherms and their parasites, with potential consequences for whole ecosystems. The potential of parasite populations to adapt to climate change largely depends on the amount of genetic variation they possess in their responses to environmental fluctuations. This study is, to our knowledge, the first to look at differences among parasite genotypes in response to temperature, with the goal of quantifying the extent of variation among conspecifics in their responses to increasing temperature. Snails infected with single genotypes of the trematode Maritrema novaezealandensis were sequentially acclimatised to two different temperatures, 'current' (15°C) and 'elevated' (20°C), over long periods. These temperatures are based on current average field conditions in the natural habitat and those predicted to occur during the next few decades. The output and activity of cercariae (free-swimming infective stages emerging from snails) were assessed for each genotype at each temperature. The results indicate that, on average, both cercarial output and activity are higher at the elevated acclimation temperature. More importantly, the output and activity of cercariae are strongly influenced by a genotype-by-temperature interaction, such that different genotypes show different responses to increasing temperature. Both the magnitude and direction (increase or decrease) of responses to temperature varied widely among genotypes. Therefore, there is much potential for natural selection to act on this variation, and predicting how the trematode M. novaezealandensis will respond to the climate changes predicted for the next century will prove challenging.

  2. Gene expression profiling in the Cynomolgus macaque Macaca fascicularis shows variation within the normal birth range

    Directory of Open Access Journals (Sweden)

    Vickers Mark H

    2011-10-01

    Full Text Available Abstract Background Although an adverse early-life environment has been linked to an increased risk of developing the metabolic syndrome, the molecular mechanisms underlying altered disease susceptibility as well as their relevance to humans are largely unknown. Importantly, emerging evidence suggests that these effects operate within the normal range of birth weights and involve mechanisms of developmental palsticity rather than pathology. Method To explore this further, we utilised a non-human primate model Macaca fascicularis (Cynomolgus macaque which shares with humans the same progressive history of the metabolic syndrome. Using microarray we compared tissues from neonates in the average birth weight (50-75th centile to those of lower birth weight (5-25th centile and studied the effect of different growth trajectories within the normal range on gene expression levels in the umbilical cord, neonatal liver and skeletal muscle. Results We identified 1973 genes which were differentially expressed in the three tissue types between average and low birth weight animals (P Conclusion These differences in gene expression levels between animals in the upper and lower percentiles of the normal birth weight range may point towards early life metabolic adaptations that in later life result in differences in disease risk.

  3. Genetic variation of the FMR1 gene among four Mexican populations: Mestizo, Huichol, Purepecha, and Tarahumara.

    Science.gov (United States)

    Barros-Núñez, Patricio; Rosales-Reynoso, Mónica Alejandra; Sandoval, Lucila; Romero-Espinoza, Pavel; Troyo-Sanromán, Rogelio; Ibarra, Bertha

    2008-01-01

    Fragile X syndrome is the most common cause of inherited mental retardation; it is caused by expansion of CGG repeats in the first exon of the FMR1 gene. The number of CGG repeats varies between 6 and 50 triplets in normal individuals; the most common alleles have 29 or 30 repeats. Allelic patterns in the global populations are similar; however; some reports show statistical differences among several populations. In Mexico, except by a single report on a western Mestizo population, the allelic frequencies of the FMR1 gene are unknown. In this study, we analyze 207, 140, 138, and 40 chromosomes from Mestizos, Tarahumaras, Huichols, and Purepechas respectively. After PCR amplification on DNA modified by sodium bisulfite treatment, molecular analysis of the FMR1 gene showed 30 different alleles among the 525 chromosomes evaluated. Trinucleotide repeat number in the different Mexican populations varied from 15 to 87, with modal numbers of 32 and 30 in Mestizos and Tarahumaras, 29 and 32 in Purepechas and 30 among Huichols. Together, these allelic patterns differ significantly from those reported for Caucasian, Chinese, African, Indonesian, Brazilian, and Chilean populations. The increased number of the unusual allele of 32 repeats observed in the Mexican mestizo population can be explained from its frequency in at least two Mexican native populations.

  4. Non-Steroidal Anti-Inflammatory Drugs, Variation in Inflammatory Genes, and Aggressive Prostate Cancer

    Directory of Open Access Journals (Sweden)

    John S. Witte

    2010-10-01

    Full Text Available Increasing evidence suggests that prostatic inflammation plays a key role in the development of prostate cancer. It remains controversial whether non-steroidal anti-inflammatory drugs (NSAIDs reduce the risk of prostate cancer. Here, we investigate how a previously reported inverse association between NSAID use and the risk of aggressive prostate cancer is modulated by variants in several inflammatory genes. We found that NSAIDs may have differential effects on prostate cancer development, depending on one’s genetic makeup. Further study of these inflammatory pathways may clarify the mechanisms through which NSAIDs impact prostate cancer risk.

  5. Assessment of PD-1 gene variation in patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Shadmehri AA

    2010-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with presumed autoimmune origin. T cells are considered to play a pivotal role in orchestrating the self-reactive immune responses in multiple sclerosis (MS. This study was performed to investigate the role of polymorphisms of the programmed cell death 1 (PD-1 gene on susceptibility to ankylosing spondylitis. This gene codes an immunoreceptor named PD-1, which has a cytoplasmic domain containing two tyrosine residues located within immunoreceptor tyrosine-based inhibitory and switch motifs (ITIM and ITSM, suggesting that PD-1 is predominantly inhibitory which responsible for the negative regulation in T cell activation and peripheral tolerance. We investigated whether PD-1 gene polymorphism is a genetic modifier for risk and progression of MS."n"n Methods: Blood samples from 150 Iranian Relapsing-Remitting MS patients (mean age, 34.98 years and 202 healthy controls (mean age, 30 years were enrolled in this study. The PD-1.3 (7146 G/A Intron 4 and PD-1.9 (7625 C/T Exon 5 polymorphisms were detected by Polymerase Chain Reaction and Restriction Enzyme digestion or Restriction Fragment Length Polymorphism (PCR

  6. Inherited Variation in Vitamin D Genes and Type 1 Diabetes Predisposition

    Science.gov (United States)

    Penna-Martinez, Marissa; Badenhoop, Klaus

    2017-01-01

    The etiology and pathophysiology of type 1 diabetes remain largely elusive with no established concepts for a causal therapy. Efforts to clarify genetic susceptibility and screening for environmental factors have identified the vitamin D system as a contributory pathway that is potentially correctable. This review aims at compiling all genetic studies addressing the vitamin D system in type 1 diabetes. Herein, association studies with case control cohorts are presented as well as family investigations with transmission tests, meta-analyses and intervention trials. Additionally, rare examples of inborn errors of vitamin D metabolism manifesting with type 1 diabetes and their immune status are discussed. We find a majority of association studies confirming a predisposing role for vitamin D receptor (VDR) polymorphisms and those of the vitamin D metabolism, particularly the CYP27B1 gene encoding the main enzyme for vitamin D activation. Associations, however, are tenuous in relation to the ethnic background of the studied populations. Intervention trials identify the specific requirements of adequate vitamin D doses to achieve vitamin D sufficiency. Preliminary evidence suggests that doses may need to be individualized in order to achieve target effects due to pharmacogenomic variation. PMID:28425954

  7. Common Variation in the LRRK2 Gene is a Risk Factor for Parkinson’s Disease

    Science.gov (United States)

    Mata, Ignacio F.; Checkoway, Harvey; Hutter, Carolyn M.; Samii, Ali; Roberts, John W.; Kim, Hojoong M.; Agarwal, Pinky; Alvarez, Victoria; Ribacoba, Renee; Pastor, Pau; Lorenzo-Betancor, Oswaldo; Infante, Jon; Sierra, María; Gómez-Garre, Pilar; Mir, Pablo; Ritz, Beate; Rhodes, Shannon L; Colcher, Amy; Van Deerlin, Vivianna; Chung, Kathryn A.; Quinn, Joseph F.; Yearout, Dora; Martinez, Erica; Farin, Federico M.; Wan, Jia Y.; Edwards, Karen L.; Zabetian, Cyrus P.

    2012-01-01

    Background Common variants in the LRRK2 gene influence risk of Parkinson’s disease (PD) in Asians, but whether the same is true in European-derived populations is less clear. Methods We genotyped 66 LRRK2 tagging single nucleotide polymorphisms (SNPs) in 575 PD patients and 689 controls from the Northwestern U.S. (Tier 1). PD-associated SNPs (p<0.05) were then genotyped in an independent sample of 3617 cases and 2512 controls from the U.S. and Spain (Tier 2). Logistic regression was used to model additive SNP genotype effects adjusted for age and sex among white individuals. Results Two regions showed independent association with PD in Tier 1, and SNPs in both regions were successfully replicated in Tier 2 (rs10878226, combined odds ratio [OR], 1.20; 95% confidence interval [CI], 1.08-1.33; p=6.3×10−4; rs11176013, OR, 0.89; CI, 0.83-0.95; p=4.6×10−4). Conclusions Our data suggest that common variation within LRRK2 conveys susceptibility for PD in individuals of European ancestry. PMID:23115130

  8. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Institute of Scientific and Technical Information of China (English)

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  9. Increased methylation of interleukin 6 gene is associated with obesity in Korean women.

    Science.gov (United States)

    Na, Yeon Kyung; Hong, Hae Sook; Lee, Won Kee; Kim, Young Hun; Kim, Dong Sun

    2015-05-01

    Obesity is the fifth leading risk for death globally, and a significant challenge to global health. It is a common, complex, non-malignant disease and develops due to interactions between the genes and the environment. DNA methylation can act as a downstream effector of environmental signals; analysis of this process therefore holds substantial promise for identifying mechanisms through which genetic and environmental factors jointly contribute to disease risk. To assess the effects of excessive weight and obesity on gene-specific methylation levels of promoter regions, we determined the methylation status of four genes involved in inflammation and oxidative stress [interleukin 6 (IL6), tumor necrosis factor α (TNFα), mitochondrial transcription factor A (TFAM), and glucose transport 4 (GLUT4)] in blood cell-derived DNA from healthy women volunteers with a range of body mass indices (BMIs) by methylation-specific PCR. Interestingly, the samples from obese individuals (BMI ≥ 30 kg/m(2)) showed significantly increased hypermethylation for IL6 gene compared to normal weight (BMI genes between each group. These findings suggest that aberrant DNA methylation of IL6 gene promoter may play an important role in the etiology and pathogenesis of obesity and IL6 methylation could be used as molecular biomarker for obesity risk assessment. Further studies are required to elucidate the potential mechanisms underlying this relationship.

  10. Epigenetic variation in the serotonin transporter gene predicts resting state functional connectivity strength within the salience-network.

    Science.gov (United States)

    Muehlhan, Markus; Kirschbaum, Clemens; Wittchen, Hans-Ulrich; Alexander, Nina

    2015-11-01

    Genetic variation in the serotonin transporter gene (SLC6A4) has been associated with psychopathology and aberrant brain functioning in a plethora of clinical and imaging studies. In contrast, the neurobiological correlates of epigenetic signatures in SLC6A4, such as DNA methylation profiles, have only recently been explored in human brain imaging research. The present study is the first to apply a resting state functional magnetic resonance imaging approach to identify changes in brain networks related to SLC6A4 promoter methylation (N=74 healthy individuals). The amygdalae were defined as seed regions given that resting state functional connectivity in this brain area is under serotonergic control and relates to a broad range of psychiatric phenotypes. We further used bisulfite pyrosequencing to analyze quantitative methylation at 83 CpG sites within a promoter-associated CpG island of SLC6A4 from blood-derived DNA samples. The major finding of this study indicates a positive relation of SLC6A4 promoter methylation and amygdaloid resting state functional coupling with key nodes of the salience network (SN) including the anterior insulae and the dorsal anterior cingulate cortices. Increased intra-network connectivity in the SN is thought to facilitate the detection and subsequent processing of potentially negative stimuli and reflects a core feature of psychopathology. As such, epigenetic changes within the SLC6A4 gene predict connectivity patterns in clinically and behaviorally relevant brain networks which may in turn convey increased disease susceptibility. © 2015 Wiley Periodicals, Inc.

  11. TOP1 gene copy numbers are increased in cancers of the bile duct and pancreas

    DEFF Research Database (Denmark)

    Grunnet, Mie; Calatayud, Dan; Schultz, Nicolai Aa.

    2015-01-01

    ) poison. Top1 protein, TOP1 gene copy number and mRNA expression, respectively, have been proposed as predictive biomarkers of response to irinotecan in other cancers. Here we investigate the occurrence of TOP1 gene aberrations in cancers of the bile ducts and pancreas. Material and methods. TOP1...... and centromere 20 (CEN-20) numbers were investigated by fluorescence in situ hybridization analyses in tumor tissue from 226 patients. The frequencies of aberration in the TOP1 gene copy number, the CEN-20 copy number and the TOP1/CEN-20 ratio were analyzed. As TOP1 is located on chromosome 20, the CEN-20 probe...... was included to distinguish between chromosomal and gene amplifications. Results. In PC, 29.8% had an increased TOP1 copy number (≥3.5n gene copies per cell) and 10.8% had a TOP1/CEN-20 ratio >1.5. In bile duct cancer, 12.8 % had an increased TOP1 copy number and 6.4% had a TOP1/CEN-20 ratio >1.5. Neither...

  12. The maintenance of genetic variation due to asymmetric gene flow in dendritic metapopulations.

    Science.gov (United States)

    Morrissey, Michael B; de Kerckhove, Derrick T

    2009-12-01

    Dendritic landscapes can have ecological properties that differ importantly from simpler spatial arrangements of habitats. Most dendritic landscapes are structured by elevation, and therefore, migration is likely to be directionally biased. While the population-genetic consequences of both dendritic landscape arrangements and asymmetric migration have begun to be studied, these processes have not been considered together. Simple conceptual models predict that if migration into branch (headwater) populations is limited, such populations can act as reservoirs for potentially unique alleles. As a consequence of the fact that dendritic landscapes have, by definition, more branches than internal habitat patches, this process may lead to the maintenance of higher overall genetic diversities in metapopulations inhabiting dendritic networks where migration is directionally biased. Here we begin to address the generality of these simple predictions using genetic models and a review of empirical literature. We show, for a range of demographic parameters, that dendritic systems with asymmetric migration can maintain levels of genetic variation that are very different, sometimes very elevated, compared with more classical models of geographical population structure. Furthermore, predicted patterns of genetic variation within metapopulations--that is, stepwise increases in genetic diversity at nodes--do occur in some empirical data.

  13. Increased growth in sunflower correlates with reduced defences and altered gene expression in response to biotic and abiotic stress.

    Science.gov (United States)

    Mayrose, Maya; Kane, Nolan C; Mayrose, Itay; Dlugosch, Katrina M; Rieseberg, Loren H

    2011-11-01

    Cultivated plants have been selected by humans for increased yield in a relatively benign environment, where nutrient and water resources are often supplemented, and biotic enemy loads are kept artificially low. Agricultural weeds have adapted to this same benign environment as crops and often have high growth and reproductive rates, even though they have not been specifically selected for yield. Considering the competing demands for resources in any plant, a key question is whether adaptation to agricultural environments has been accompanied by life history trade-offs, in which resistance to (largely absent) stress has been lost in favour of growth and reproduction. The experiments reported here were designed to test for growth-defence trade-offs in agricultural weeds, crops and native varieties of common sunflower (Helianthus annuus L., Asteraceae) by comparing their performance in the presence or absence of abiotic (drought and crowding) or biotic (simulated herbivory, insect herbivory and fungal) stress. We found that growth, as well as viability of crops and weeds, was reduced by abiotic drought stress. The weakened defence in the agricultural genotypes was further evident as increased susceptibility to fungal infection and higher level of insect palatability. To uncover molecular mechanisms underlying these trade-offs, we monitored gene expression kinetics in drought-stressed plants. By correlating phenotypic observations with molecular analyses, we report the identification of several genes, including a protein phosphatase 2C and the HD-Zip transcription factor Athb-8, whose expression is associated with the observed phenotypic variation in common sunflower.

  14. Early life adversity and serotonin transporter gene variation interact to affect DNA methylation of the corticotropin-releasing factor gene promoter region in the adult rat brain

    NARCIS (Netherlands)

    Doelen, R.H. van der; Arnoldussen, I.A.C.; Ghareh, H.; Och, L. van; Homberg, J.R.; Kozicz, L.T.

    2015-01-01

    The interaction between childhood maltreatment and the serotonin transporter (5-HTT) gene linked polymorphic region has been associated with increased risk to develop major depression. This Gene x Environment interaction has furthermore been linked with increased levels of anxiety and glucocorticoid

  15. Signatures derived from increase in SHARPIN gene copy number are associated with poor prognosis in patients with breast cancer.

    Science.gov (United States)

    Ojo, Diane; Seliman, Maryam; Tang, Damu

    2017-12-01

    We report three signatures produced from SHARPIN gene copy number increase (GCN-Increase) and their effects on patients with breast cancer (BC). In the Metabric dataset (n = 2059, cBioPortal), SHARPIN GCN-Increase occurs preferentially or mutual exclusively with mutations in TP53, PIK3CA, and CDH1. These genomic alterations constitute a signature (SigMut) that significantly correlates with reductions in overall survival (OS) in BC patients (n = 1980; p = 1.081e - 6). Additionally, SHARPIN GCN-Increase is associated with 4220 differentially expressed genes (DEGs). These DEGs are enriched in activation of the pathways regulating cell cycle progression, RNA transport, ribosome biosynthesis, DNA replication, and in downregulation of the pathways related to extracellular matrix. These DEGs are thus likely to facilitate the proliferation and metastasis of BC cells. Additionally, through forward (FWD) and backward (BWD) stepwise variate selections among the top 160 downregulated and top 200 upregulated DEGs using the Cox regression model, a 6-gene (SigFWD) and a 50-gene (SigBWD) signature were derived. Both signatures robustly associate with decreases in OS in BC patients within the Curtis (n = 1980; p = 6.16e - 11 for SigFWD; p = 1.06e - 10, for SigBWD) and TCGA cohort (n = 817; p = 4.53e - 4 for SigFWD and p = 0.00525 for SigBWD). After adjusting for known clinical factors, SigMut (HR 1.21, p = 0.0297), SigBWD (HR 1.25, p = 0.0263), and likely SigFWD (HR 1.17, p = 0.062) remain independent risk factors of BC deaths. Furthermore, the proportion of patients positive for these signatures is significantly increased in ER -, Her2-enriched, basal-like, and claudin-low BCs compared to ER + and luminal BCs. Collectively, these SHARPIN GCN-Increase-derived signatures may have clinical applications in management of patients with BC.

  16. Tissue Specificity and Sex-Specific Regulatory Variation Permit the Evolution of Sex-Biased Gene Expression.

    Science.gov (United States)

    Dean, Rebecca; Mank, Judith E

    2016-09-01

    Genetic correlations between males and females are often thought to constrain the evolution of sexual dimorphism. However, sexually dimorphic traits and the underlying sexually dimorphic gene expression patterns are often rapidly evolving. We explore this apparent paradox by measuring the genetic correlation in gene expression between males and females (Cmf) across broad evolutionary timescales, using two RNA-sequencing data sets spanning multiple populations and multiple species. We find that unbiased genes have higher Cmf than sex-biased genes, consistent with intersexual genetic correlations constraining the evolution of sexual dimorphism. However, we found that highly sex-biased genes (both male and female biased) also had higher tissue specificity, and unbiased genes had greater expression breadth, suggesting that pleiotropy may constrain the breakdown of intersexual genetic correlations. Finally, we show that genes with high Cmf showed some degree of sex-specific changes in gene expression in males and females. Together, our results suggest that genetic correlations between males and females may be less important in constraining the evolution of sex-biased gene expression than pleiotropy. Sex-specific regulatory variation and tissue specificity may resolve the paradox of widespread sex bias within a largely shared genome.

  17. Bicarbonate increases binding affinity of Vibrio cholerae ToxT to virulence gene promoters.

    Science.gov (United States)

    Thomson, Joshua J; Withey, Jeffrey H

    2014-11-01

    The major Vibrio cholerae virulence gene transcription activator, ToxT, is responsible for the production of the diarrhea-inducing cholera toxin (CT) and the major colonization factor, toxin coregulated pilus (TCP). In addition to the two primary virulence factors mentioned, ToxT is responsible for the activation of accessory virulence genes, such as aldA, tagA, acfA, acfD, tcpI, and tarAB. ToxT activity is negatively modulated by bile and unsaturated fatty acids found in the upper small intestine. Conversely, previous work identified another intestinal signal, bicarbonate, which enhances the ability of ToxT to activate production of CT and TCP. The work presented here further elucidates the mechanism for the enhancement of ToxT activity by bicarbonate. Bicarbonate was found to increase the activation of ToxT-dependent accessory virulence promoters in addition to those that produce CT and TCP. Bicarbonate is taken up into the V. cholerae cell, where it positively affects ToxT activity by increasing DNA binding affinity for the virulence gene promoters that ToxT activates regardless of toxbox configuration. The increase in ToxT binding affinity in the presence of bicarbonate explains the elevated level of virulence gene transcription.

  18. Increases in the abundance of microbial genes encoding halotolerance and photosynthesis along a sediment salinity gradient

    Directory of Open Access Journals (Sweden)

    T. C. Jeffries

    2011-07-01

    Full Text Available Biogeochemical cycles are driven by the metabolic activity of microbial communities, yet the environmental parameters that underpin shifts in the functional potential coded within microbial community genomes are still poorly understood. Salinity is one of the primary determinants of microbial community structure and can vary strongly along gradients within a variety of habitats. To test the hypothesis that shifts in salinity will also alter the bulk biogeochemical potential of aquatic microbial assemblages, we generated four metagenomic DNA sequence libraries from sediment samples taken along a continuous, natural salinity gradient in the Coorong lagoon, Australia, and compared them to physical and chemical parameters. A total of 392483 DNA sequences obtained from four sediment samples were generated and used to compare genomic characteristics along the gradient. The most significant shifts along the salinity gradient were in the genetic potential for halotolerance and photosynthesis, which were more highly represented in hypersaline samples. At these sites, halotolerance was achieved by an increase in genes responsible for the acquisition of compatible solutes – organic chemicals which influence the carbon, nitrogen and methane cycles of sediment. Photosynthesis gene increases were coupled to an increase in genes matching Cyanobacteria, which are responsible for mediating CO2 and nitrogen cycles. These salinity driven shifts in gene abundance will influence nutrient cycles along the gradient, controlling the ecology and biogeochemistry of the entire ecosystem.

  19. Increases in the abundance of microbial genes encoding halotolerance and photosynthesis along a sediment salinity gradient

    Science.gov (United States)

    Jeffries, T. C.; Seymour, J. R.; Newton, K.; Smith, R. J.; Seuront, L.; Mitchell, J. G.

    2012-02-01

    Biogeochemical cycles are driven by the metabolic activity of microbial communities, yet the environmental parameters that underpin shifts in the functional potential coded within microbial community genomes are still poorly understood. Salinity is one of the primary determinants of microbial community structure and can vary strongly along gradients within a variety of habitats. To test the hypothesis that shifts in salinity will also alter the bulk biogeochemical potential of aquatic microbial assemblages, we generated four metagenomic DNA sequence libraries from sediment samples taken along a continuous, natural salinity gradient in the Coorong lagoon, Australia, and compared them to physical and chemical parameters. A total of 392483 DNA sequences obtained from four sediment samples were generated and used to compare genomic characteristics along the gradient. The most significant shifts along the salinity gradient were in the genetic potential for halotolerance and photosynthesis, which were more highly represented in hypersaline samples. At these sites, halotolerance was achieved by an increase in genes responsible for the acquisition of compatible solutes - organic chemicals which influence the carbon, nitrogen and methane cycles of sediment. Photosynthesis gene increases were coupled to an increase in genes matching Cyanobacteria, which are responsible for mediating CO2 and nitrogen cycles. These salinity driven shifts in gene abundance will influence nutrient cycles along the gradient, controlling the ecology and biogeochemistry of the entire ecosystem.

  20. Overexpression of a Chitinase Gene from Trichoderma asperellum Increases Disease Resistance in Transgenic Soybean.

    Science.gov (United States)

    Zhang, Fuli; Ruan, Xianle; Wang, Xian; Liu, Zhihua; Hu, Lizong; Li, Chengwei

    2016-12-01

    In the present study, a chi gene from Trichoderma asperellum, designated Tachi, was cloned and functionally characterized in soybean. Firstly, the effects of sodium thiosulfate on soybean Agrobacterium-mediated genetic transformation with embryonic tip regeneration system were investigated. The transformation frequency was improved by adding sodium thiosulfate in co-culture medium for three soybean genotypes. Transgenic soybean plants with constitutive expression of Tachi showed increased resistance to Sclerotinia sclerotiorum compared to WT plants. Meanwhile, overexpression of Tachi in soybean exhibited increased reactive oxygen species (ROS) level as well as peroxidase (POD) and catalase (SOD) activities, decreased malondialdehyde (MDA) content, along with diminished electrolytic leakage rate after S. sclerotiorum inoculation. These results suggest that Tachi can improve disease resistance in plants by enhancing ROS accumulation and activities of ROS scavenging enzymes and then diminishing cell death. Therefore, Tachi represents a candidate gene with potential application for increasing disease resistance in plants.

  1. A physiological increase in insulin suppresses gluconeogenic gene activation in fetal sheep with sustained hypoglycemia.

    Science.gov (United States)

    Thorn, Stephanie R; Sekar, Satya M; Lavezzi, Jinny R; O'Meara, Meghan C; Brown, Laura D; Hay, William W; Rozance, Paul J

    2012-10-15

    Reduced maternal glucose supply to the fetus and resulting fetal hypoglycemia and hypoinsulinemia activate fetal glucose production as a means to maintain cellular glucose uptake. However, this early activation of fetal glucose production may be accompanied by hepatic insulin resistance. We tested the capacity of a physiological increase in insulin to suppress fetal hepatic gluconeogenic gene activation following sustained hypoglycemia to determine whether hepatic insulin sensitivity is maintained. Control fetuses (CON), hypoglycemic fetuses induced by maternal insulin infusion for 8 wk (HG), and 8 wk HG fetuses that received an isoglycemic insulin infusion for the final 7 days (HG+INS) were studied. Glucose and insulin concentrations were 60% lower in HG compared with CON fetuses. Insulin was 50% higher in HG+INS compared with CON and four-fold higher compared with HG fetuses. Expression of the hepatic gluconeogenic genes, PCK1, G6PC, FBP1, GLUT2, and PGC1A was increased in the HG and reduced in the HG+INS liver. Expression of the insulin-regulated glycolytic and lipogenic genes, PFKL and FAS, was increased in the HG+INS liver. Total FOXO1 protein expression, a gluconeogenic activator, was 60% higher in the HG liver. Despite low glucose, insulin, and IGF1 concentrations, phosphorylation of AKT and ERK was higher in the HG liver. Thus, a physiological increase in fetal insulin is sufficient for suppression of gluconeogenic genes and activation of glycolytic and lipogenic genes in the HG fetal liver. These results demonstrate that fetuses exposed to sustained hypoglycemia have maintained hepatic insulin action in contrast to fetuses exposed to placental insufficiency.

  2. Increased expression of fatty-acid and calcium metabolism genes in failing human heart.

    Directory of Open Access Journals (Sweden)

    Vanessa García-Rúa

    Full Text Available BACKGROUND: Heart failure (HF involves alterations in metabolism, but little is known about cardiomyopathy-(CM-specific or diabetes-independent alterations in gene expression of proteins involved in fatty-acid (FA uptake and oxidation or in calcium-(Ca(2+-handling in the human heart. METHODS: RT-qPCR was used to quantify mRNA expression and immunoblotting to confirm protein expression in left-ventricular myocardium from patients with HF (n = 36 without diabetes mellitus of ischaemic (ICM, n = 16 or dilated (DCM, n = 20 cardiomyopathy aetiology, and non-diseased donors (CTL, n = 6. RESULTS: Significant increases in mRNA of genes regulating FA uptake (CD36 and intracellular transport (Heart-FA-Binding Protein (HFABP were observed in HF patients vs CTL. Significance was maintained in DCM and confirmed at protein level, but not in ICM. mRNA was higher in DCM than ICM for peroxisome-proliferator-activated-receptor-alpha (PPARA, PPAR-gamma coactivator-1-alpha (PGC1A and CD36, and confirmed at the protein level for PPARA and CD36. Transcript and protein expression of Ca(2+-handling genes (Two-Pore-Channel 1 (TPCN1, Two-Pore-Channel 2 (TPCN2, and Inositol 1,4,5-triphosphate Receptor type-1 (IP3R1 increased in HF patients relative to CTL. Increases remained significant for TPCN2 in all groups but for TPCN1 only in DCM. There were correlations between FA metabolism and Ca(2+-handling genes expression. In ICM there were six correlations, all distinct from those found in CTL. In DCM there were also six (all also different from those found in CTL: three were common to and three distinct from ICM. CONCLUSION: DCM-specific increases were found in expression of several genes that regulate FA metabolism, which might help in the design of aetiology-specific metabolic therapies in HF. Ca(2+-handling genes TPCN1 and TPCN2 also showed increased expression in HF, while HF- and CM-specific positive correlations were found among several FA and Ca(2

  3. TIMP-1 gene deficiency increases tumour cell sensitivity to chemotherapy-induced apoptosis

    DEFF Research Database (Denmark)

    Davidsen, Marie Louise; Würts, S.Ø.; Rømer, Maria Unni Koefoed;

    2006-01-01

    in cancer. In this regard, several studies have demonstrated an antiapoptotic effect of TIMP-1 in a number of different cell types. Since chemotherapy works by inducing apoptosis in cancer cells, we raised the hypothesis that TIMP-1 promotes resistance against chemotherapeutic drugs. In order to investigate...... this hypothesis, we have established TIMP-1 gene-deficient and TIMP-1 wild-type fibrosarcoma cells from mouse lung tissue. We have characterised these cells with regard to TIMP-1 genotype, TIMP-1 expression, malignant transformation and sensitivity to chemotherapy-induced apoptosis. We show that TIMP-1 gene...... deficiency increases the response to chemotherapy considerably, confirming that TIMP-1 protects the cells from apoptosis. This is to our knowledge the first study investigating TIMP-1 and chemotherapy-induced apoptosis employing a powerful model system comprising TIMP-1 gene-deficient cells...

  4. Transgenic Paulownia Expressing shiva-1 Gene Has Increased Resistance to Paulownia Witches' Broom Disease

    Institute of Scientific and Technical Information of China (English)

    Tao DU; Yao WANG; Qin-Xue HU; Jie CHEN; Sheng LIU; Wen-Jin HUANG; Mu-Lan LIN

    2005-01-01

    Stem segments from diseased Paulownia tomentosa×P. fortunei and leaves from healthy control were transformed with the expression vector p438PRSI via Agrobacterium tumefaciens. The p438PRSI vector contained shiva-1 gene, which encodes an antibacterial peptide under the control of a CaMV35S promoter. The regenerated plants from transformed explants were planted in a greenhouse and nursery. PCR and Southern blotting analysis showed that the shiva-1 gene was successfully integrated into the Paulownia genome. Transcription of the integrated shiva-1 gene was confirmed by RT-PCR. Bioassay in the green house and phytoplasma DNA-dot blotting demonstrated that resistance to Paulownia witch's broom disease (PWB) increased significantly in shiva-1-transgenic Paulownia. Further investigations indicated that higher Shiva-1 expression correlated with fewer phytoplasma and less symptoms in diseased transgenic Paulownia. Together, our findings strongly suggest that breeding shiva-1-Paulownia is an effective strategy to control PWB disease.

  5. A molecular footprint of limb loss: sequence variation of the autopodial identity gene Hoxa-13.

    Science.gov (United States)

    Kohlsdorf, Tiana; Cummings, Michael P; Lynch, Vincent J; Stopper, Geffrey F; Takahashi, Kazuhiko; Wagner, Günter P

    2008-12-01

    The homeobox gene Hoxa-13 codes for a transcription factor involved in multiple functions, including body axis and hand/foot development in tetrapods. In this study we investigate whether the loss of one function (e.g., limb loss in snakes) left a molecular footprint in exon 1 of Hoxa-13 that could be associated with the release of functional constraints caused by limb loss. Fragments of the Hoxa-13 exon 1 were sequenced from 13 species and analyzed, with additional published sequences of the same region, using relative rates and likelihood-ratio tests. Five amino acid sites in exon 1 of Hoxa-13 were detected as evolving under positive selection in the stem lineage of snakes. To further investigate whether there is an association between limb loss and sequence variation in Hoxa-13, we used the random forest method on an alignment that included shark, basal fish lineages, and "eu-tetrapods" such as mammals, turtle, alligator, and birds. The random forest method approaches the problem as one of classification, where we seek to predict the presence or absence of autopodium based on amino acid variation in Hoxa-13 sequences. Different alignments tested were associated with similar error rates (18.42%). The random forest method suggested that phenotypic states (autopodium present and absent) can often be correctly predicted based on Hoxa-13 sequences. Basal, nontetrapod gnat-hostomes that never had an autopodium were consistently classified as limbless together with the snakes, while eu-tetrapods without any history of limb loss in their phylogeny were also consistently classified as having a limb. Misclassifications affected mostly lizards, which, as a group, have a history of limb loss and limb re-evolution, and the urodele and caecilian in our sample. We conclude that a molecular footprint can be detected in Hoxa-13 that is associated with the lack of an autopodium; groups with classification ambiguity (lizards) are characterized by a history of repeated limb loss

  6. Genetic Variation in the HSD17B1 Gene and Risk of Prostate Cancer

    Science.gov (United States)

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Marchand, Loic Le; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-01-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17β-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Δ5-androsterone-3β,17β-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup analyses

  7. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  8. Occurrence and temporal variation of antibiotic resistance genes (ARGs) in shrimp aquaculture: ARGs dissemination from farming source to reared organisms.

    Science.gov (United States)

    Su, Haochang; Liu, Shan; Hu, Xiaojuan; Xu, Xiangrong; Xu, Wujie; Xu, Yu; Li, Zhuojia; Wen, Guoliang; Liu, Yousheng; Cao, Yucheng

    2017-12-31

    Considerable attention has been paid to the occurrence and abundance of antibiotic resistance genes (ARGs) in aquatic environments. However, the temporal variation and dissemination of ARGs in aquaculture environments and reared organisms need further study. This study investigated the abundance and diversity of ARGs and bacterial community in water source, shrimp pond water, sediment, and shrimps during the rearing period in Pearl River Delta region, South China. The results showed that sul1, qnrD, cmlA, and floR were the predominant ARGs in the aquaculture samples. A trend of decreasing abundance of ARGs was observed for pond water samples during the rearing period, whereas an increasing trend was observed in the sediment and shrimp samples. The total concentration of ARGs in water source was significantly higher than that in shrimp pond water (pshrimps were 4.48-19.0 times higher than those in juvenile shrimps. Similar to water source and pond water, cmlA and sul1 were the predominant ARGs in shrimp intestinal tract. The bacterial community in the shrimp intestinal tract changed greatly from juvenile to adult. The results of the present study indicated that the abundances of ARGs in aquaculture varied temporally during the rearing period. Water source was an important medium disseminating ARGs to the aquaculture environments and reared organisms. Sul1 could be used as a potential indicator for ARGs in both water and sediment in aquaculture in the estuary of the Pearl River Delta, South China. This study represents a case study for the temporal variation of abundance and dissemination of ARGs in aquaculture and is a reference for potential risks to food safety and human health. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Directory of Open Access Journals (Sweden)

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  10. Colony-level behavioral variation correlates with differences in expression of the foraging gene in red imported fire ants.

    Science.gov (United States)

    Bockoven, Alison A; Coates, Craig J; Eubanks, Micky D

    2017-09-13

    Among social insects, colony-level variation is likely to be widespread and have significant ecological consequences. Very few studies, however, have documented how genetic factors relate to behavior at the colony level. Differences in expression of the foraging gene have been associated with differences in foraging and activity of a wide variety of organisms. We quantified expression of the red imported fire ant foraging gene (sifor) in workers from 21 colonies collected across the natural range of Texas fire ant populations, but maintained under standardized, environmentally controlled conditions. Colonies varied significantly in their behavior. The most active colonies had up to 10 times more active foragers than the least active colony and more than 16 times as many workers outside the nest. Expression differences among colonies correlated with this colony-level behavioral variation. Colonies with higher sifor expression in foragers had, on average, significantly higher foraging activity, exploratory activity, and recruitment to nectar than colonies with lower expression. Expression of sifor was also strongly correlated with worker task (foraging versus working in the interior of the nest). These results provide insight into the genetic and physiological processes underlying collective differences in social behavior. Quantifying variation in expression of the foraging gene may provide an important tool for understanding and predicting the ecological consequences of colony-level behavioral variation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. Variations and classification of toxic epitopes related to celiac disease among α-gliadin genes from four Aegilops genomes.

    Science.gov (United States)

    Li, Jie; Wang, Shunli; Li, Shanshan; Ge, Pei; Li, Xiaohui; Ma, Wujun; Zeller, F J; Hsam, Sai L K; Yan, Yueming

    2012-07-01

    The α-gliadins are associated with human celiac disease. A total of 23 noninterrupted full open reading frame α-gliadin genes and 19 pseudogenes were cloned and sequenced from C, M, N, and U genomes of four diploid Aegilops species. Sequence comparison of α-gliadin genes from Aegilops and Triticum species demonstrated an existence of extensive allelic variations in Gli-2 loci of the four Aegilops genomes. Specific structural features were found including the compositions and variations of two polyglutamine domains (QI and QII) and four T cell stimulatory toxic epitopes. The mean numbers of glutamine residues in the QI domain in C and N genomes and the QII domain in C, N, and U genomes were much higher than those in Triticum genomes, and the QI domain in C and N genomes and the QII domain in C, M, N, and U genomes displayed greater length variations. Interestingly, the types and numbers of four T cell stimulatory toxic epitopes in α-gliadins from the four Aegilops genomes were significantly less than those from Triticum A, B, D, and their progenitor genomes. Relationships between the structural variations of the two polyglutamine domains and the distributions of four T cell stimulatory toxic epitopes were found, resulting in the α-gliadin genes from the Aegilops and Triticum genomes to be classified into three groups.

  12. Testosterone increases renal anti-aging klotho gene expression via the androgen receptor-mediated pathway.

    Science.gov (United States)

    Hsu, Shih-Che; Huang, Shih-Ming; Lin, Shih-Hua; Ka, Shuk-Man; Chen, Ann; Shih, Meng-Fu; Hsu, Yu-Juei

    2014-12-01

    Gender is known to be associated with longevity and oestrogen administration induced longevity-associated gene expression is one of the potential mechanisms underlying the benefits of oestrogen on lifespan, whereas the role of testosterone in the regulation of longevity-associated gene expressions remains largely unclear. The klotho gene, predominantly expressed in the kidney, has recently been discovered to be an aging suppressor gene. In the present study, we investigated the regulatory effects of testosterone on renal klotho gene expression in vivo and in vitro. In testosterone-administered mouse kidney and NRK-52E cells, increased klotho expression was accompanied by the up-regulation of the nuclear androgen receptor (AR). Overexpression of AR enhanced the expression of klotho mRNA and protein. Conversely, testosterone-induced klotho expression was attenuated in the presence of flutamide, an AR antagonist. A reporter assay and a chromatin immunoprecipitation (ChIP) assay demonstrated that AR directly binds to the klotho promoter via androgen response elements (AREs) which reconfirmed its importance for AR binding via the element mutation. In summary, our study demonstrates that testosterone up-regulates anti-aging klotho together with AR expression in the kidney in vivo and in vitro by recruiting AR on to the AREs of the klotho promoter.

  13. Accurately assessing the risk of schizophrenia conferred by rare copy-number variation affecting genes with brain function.

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M; McCarroll, Steven A; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J

    2010-09-09

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied "pathway" analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package.

  14. Accurately Assessing the Risk of Schizophrenia Conferred by Rare Copy-Number Variation Affecting Genes with Brain Function

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M.; McCarroll, Steven A.; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J.

    2010-01-01

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied “pathway” analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package

  15. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for v

  16. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for

  17. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob;

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups fo...

  18. Coexistence of trichome variation in a natural plant population: a combined study using ecological and candidate gene approaches.

    Directory of Open Access Journals (Sweden)

    Tetsuhiro Kawagoe

    Full Text Available The coexistence of distinct phenotypes within populations has long been investigated in evolutionary ecology. Recent studies have identified the genetic basis of distinct phenotypes, but it is poorly understood how the variation in candidate loci is maintained in natural environments. In this study, we examined fitness consequences and genetic basis of variation in trichome production in a natural population of Arabidopsis halleri subsp. gemmifera. Half of the individuals in the study population produced trichomes while the other half were glabrous, and the leaf beetle Phaedon brassicae imposed intensive damage to both phenotypes. The fitness of hairy and glabrous plants showed no significant differences in the field during two years. A similar result was obtained when sibling hairy and glabrous plants were transplanted at the same field site, whereas a fitness cost of trichome production was detected under a weak herbivory condition. Thus, equivalent fitness of hairy and glabrous plants under natural herbivory allows their coexistence in the contemporary population. The pattern of polymorphism of the candidate trichome gene GLABROUS1 (GL1 showed no evidence of long-term maintenance of trichome variation within the population. Although balancing selection under fluctuating biotic environments is often proposed to explain the maintenance of defense variation, the lack of clear evidence of balancing selection in the study population suggests that other factors such as gene flow and neutral process may have played relatively large roles in shaping trichome variation at least for the single population level.

  19. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  20. Variation in the X-linked EFHC2 gene is associated with social cognitive abilities in males.

    Science.gov (United States)

    Startin, Carla M; Fiorentini, Chiara; de Haan, Michelle; Skuse, David H

    2015-01-01

    Females outperform males on many social cognitive tasks. X-linked genes may contribute to this sex difference. Males possess one X chromosome, while females possess two X chromosomes. Functional variations in X-linked genes are therefore likely to impact more on males than females. Previous studies of X-monosomic women with Turner syndrome suggest a genetic association with facial fear recognition abilities at Xp11.3, specifically at a single nucleotide polymorphism (SNP rs7055196) within the EFHC2 gene. Based on a strong hypothesis, we investigated an association between variation at SNP rs7055196 and facial fear recognition and theory of mind abilities in males. As predicted, males possessing the G allele had significantly poorer facial fear detection accuracy and theory of mind abilities than males possessing the A allele (with SNP variant accounting for up to 4.6% of variance). Variation in the X-linked EFHC2 gene at SNP rs7055196 is therefore associated with social cognitive abilities in males.

  1. BGMUT: NCBI dbRBC database of allelic variations of genes encoding antigens of blood group systems.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Helmberg, Wolfgang; Blumenfeld, Olga O

    2012-01-01

    Analogous to human leukocyte antigens, blood group antigens are surface markers on the erythrocyte cell membrane whose structures differ among individuals and which can be serologically identified. The Blood Group Antigen Gene Mutation Database (BGMUT) is an online repository of allelic variations in genes that determine the antigens of various human blood group systems. The database is manually curated with allelic information collated from scientific literature and from direct submissions from research laboratories. Currently, the database documents sequence variations of a total of 1251 alleles of all 40 gene loci that together are known to affect antigens of 30 human blood group systems. When available, information on the geographic or ethnic prevalence of an allele is also provided. The BGMUT website also has general information on the human blood group systems and the genes responsible for them. BGMUT is a part of the dbRBC resource of the National Center for Biotechnology Information, USA, and is available online at http://www.ncbi.nlm.nih.gov/projects/gv/rbc/xslcgi.fcgi?cmd=bgmut. The database should be of use to members of the transfusion medicine community, those interested in studies of genetic variation and related topics such as human migrations, and students as well as members of the general public.

  2. Common variations within HACE1 gene and neuroblastoma susceptibility in a Southern Chinese population

    Science.gov (United States)

    Zhang, Zhuorong; Zhang, Ruizhong; Zhu, Jinhong; Wang, Fenghua; Yang, Tianyou; Zou, Yan; He, Jing; Xia, Huimin

    2017-01-01

    Neuroblastoma is a common fatal pediatric cancer of the developing sympathetic nervous system, which accounts for ~10% of all pediatric cancer deaths. To investigate genetic risk factors related to neuroblastoma, many genome-wide association studies have been performed, and single nucleotide polymorphisms (SNPs) within HACE1 gene have been identified to associate with neuroblastoma risk. However, the association of the HACE1 SNPs with neuroblastoma needs to be validated in Southern Chinese children. We genotyped five SNPs located in the HACE1 gene (rs4336470 C>T, rs9404576 T>G, rs4079063 A>G, rs2499663 T>C, and rs2499667 A>G) in 256 Southern Chinese patients in comparison with 531 ethnically matched healthy controls. Single locus analysis showed no significant association between any of HACE1 SNPs and neuroblastoma risk in Southern Chinese children. However, when all the risk genotypes were combined, we found a borderline significant trend toward an increased neuroblastoma risk with 4–5 risk genotypes (adjusted odds ratio =1.36, 95% confidence interval =0.98–1.89, P=0.065). Moreover, stratified analysis found that carriers of 4–5 risk genotypes tended to develop neuroblastoma in the retroperitoneal region and have more aggressive tumors, progressing to advanced clinical stages III/IV, when compared with those of 0–3 risk genotypes. In conclusion, HACE1 gene may have weak effect on neuroblastoma risk in Southern Chinese children. Large well-designed studies are needed to strengthen our findings.

  3. Exercise induces a transient increase in transcription of the GLUT-4 gene in skeletal muscle.

    Science.gov (United States)

    Neufer, P D; Dohm, G L

    1993-12-01

    Endurance exercise training elicits an increase in mitochondrial density as well as GLUT-4 glucose transporter protein content in skeletal muscle. Corresponding increases in mRNA for respiratory enzymes and GLUT-4 indicate that pretranslational control mechanisms are involved in this adaptive process. To directly test whether transcription of the GLUT-4 gene is activated in response to exercise training, nuclei were isolated from red hindlimb skeletal muscle of rats after 1 wk of exercise training (8% grade, 32 m/min, 40 min, twice/day). Rats were killed either 30 min, 3 h, or 24 h after the last training session. GLUT-4 transcription, determined by nuclear run-on analysis, was unaltered after 30