WorldWideScience

Sample records for gene variation spectrum

  1. Novel rare variations of the oxytocin receptor (OXTR) gene in autism spectrum disorder individuals.

    Science.gov (United States)

    Liu, Xiaoxi; Kawashima, Minae; Miyagawa, Taku; Otowa, Takeshi; Latt, Khun Zaw; Thiri, Myo; Nishida, Hisami; Sugiyama, Toshiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Mabuchi, Akihiko; Tokunaga, Katsushi; Sasaki, Tsukasa

    2015-01-01

    The oxytocin receptor (OXTR) gene has been implicated as a risk gene for autism spectrum disorder (ASD)-a neurodevelopmental disorder with essential features of impairments in social communication and reciprocal interaction. The genetic associations between common variations in OXTR and ASD have been reported in multiple ethnic populations. However, little is known about the distribution of rare variations within OXTR in ASD patients. In this study, we resequenced the full length of OXTR in 105 ASD individuals using an approach that combined the power of next-generation sequencing technology, long-range PCR and DNA pooling. We demonstrated that rare variants with minor allele frequency as low as 0.05% could be reliably detected by our method. We identified 28 novel variants including potential functional variants in the intron region and one rare missense variant (R150S). We subsequently performed Sanger sequencing and validated five novel variants located in previously suggested candidate regions in ASD individuals. Further sequencing of 312 healthy subjects showed that the burden of rare variants is significantly higher in ASDs compared with healthy individuals. Our results support that the rare variation in OXTR gene might be involved in ASD.

  2. Genetic variation in the oxytocin receptor gene is associated with a social phenotype in autism spectrum disorders.

    Science.gov (United States)

    Harrison, Ashley J; Gamsiz, Ece D; Berkowitz, Isaac C; Nagpal, Shailender; Jerskey, Beth A

    2015-12-01

    Oxytocin regulates social behavior in animal models. Research supports an association between genetic variation in the oxytocin receptor gene (OXTR) and autism spectrum disorders (ASD). In this study, we examine the association between the OXTR gene and a specific social phenotype within ASD. This genotype-phenotype investigation may provide insight into how OXTR conveys risk for social impairment. The current study investigated 10 SNPS in the OXTR gene that have been previously shown to be associated with ASD. We examine the association of these SNPs with both a social phenotype and a repetitive behavior phenotype comprised of behaviors commonly impaired in ASD in the Simons simplex collection (SSC). Using a large sample to examine the association between OXTR and ASD (n = range: 485-1002), we find evidence to support a relation between two OXTR SNPs and the examined social phenotype among children diagnosed with ASD. Greater impairment on the social responsiveness scale standardized total score and on several subdomains was observed among individuals with one or more copies of the minor frequency allele in both rs7632287 and rs237884. Linkage disequilibrium (LD) mapping suggests that these two SNPs are in LD within and overlapping the 3' untranslated region (3'-UTR) of the OXTR gene. These two SNPs were also associated with greater impairment on the repetitive behavior scale. Results of this study indicate that social impairment and repetitive behaviors in ASD are associated with genomic variation in the 3'UTR of the OXTR gene. These variants may be linked to an allele that alters stability of the mRNA message although further work is necessary to test this hypothesis.

  3. Mouse Models of Mutations and Variations in Autism Spectrum Disorder-Associated Genes: Mice Expressing Caps2/Cadps2 Copy Number and Alternative Splicing Variants

    Directory of Open Access Journals (Sweden)

    Tetsushi Sadakata

    2013-11-01

    Full Text Available Autism spectrum disorder (ASD is a neurodevelopmental disorder characterized by disturbances in interpersonal relationships and behavior. Although the prevalence of autism is high, effective treatments have not yet been identified. Recently, genome-wide association studies have identified many mutations or variations associated with ASD risk on many chromosome loci and genes. Identification of the biological roles of these mutations or variations is necessary to identify the mechanisms underlying ASD pathogenesis and to develop clinical treatments. At present, mice harboring genetic modifications of ASD-associated gene candidates are the best animal models to analyze hereditary factors involved in autism. In this report, the biological significance of ASD-associated genes is discussed by examining the phenotypes of mouse models with ASD-associated mutations or variations in mouse homologs, with a focus on mice harboring genetic modifications of the Caps2/Cadps2 (Ca2+-dependent activator protein for secretion 2 gene.

  4. Spectrum characteristics of geoelectric field variation

    Institute of Scientific and Technical Information of China (English)

    YE Qing; DU Xue-bin; ZHOU Ke-chang; LI Ning; MA Zhan-hu

    2007-01-01

    The spectrum characteristics of geoelectric diurnal variation and geoelectric storm have been identified by maximum entropy method, based on geoelectric data from seven stations in the Chinese mainland, including Jiayuguan, Changli and Chongming. The study shows that, in geoelectric diurnal variation, the amplitude of the 12 h semidiurnal wave is the largest, followed in turn by the 24~25 h diurnal wave and the 8 h periodic wave; Geoelectric storm usually occurs in a large-scale space, whose spectrum values are higher than those of geoelectric diurnal variation by 2~3 orders of magnitude. A preliminary interpretation is presented for the generative mechanism of predominant waves in geoelectric field variation.

  5. Molecular genetic analysis of the calcium sensing receptor gene in patients clinically suspected to have familial hypocalciuric hypercalcemia: phenotypic variation and mutation spectrum in a Danish population

    DEFF Research Database (Denmark)

    Nissen, Peter H; Christensen, Signe E; Heickendorff, Lene

    2007-01-01

    hyperparathyroidism and is caused by inactivating mutations in the calcium sensing receptor (CASR) gene. OBJECTIVE: We sought to define the mutation spectrum of the CASR gene in a Danish FHH population and to establish genotype-phenotype relationships regarding the different mutations. DESIGN AND PARTICIPANTS...... calcium concentrations moderately above the upper reference limit, to calcium levels more than 20% above the upper reference limit. Furthermore, the mean plasma PTH concentration was within the normal range in eight of 11 studied mutations, but mild to moderately elevated in families with the mutations p...

  6. Molecular spectrum of somatic EGFR and KRAS gene mutations in non small cell lung carcinoma: determination of frequency, distribution pattern and identification of novel variations in Indian patients.

    Science.gov (United States)

    Das, Bibhu Ranjan; Bhaumik, Sangeet; Ahmad, Firoz; Mandsaurwala, Aziz; Satam, Heena

    2015-07-01

    Somatic mutations of EGFR and KRAS gene represent the most common alterations currently known in NSCLC patients. This study explored the frequency, distribution pattern of EGFR and KRAS mutations in Indian patients. The frequencies of EGFR and KRAS mutations were 29 % (116/400) and 4.5 % (6/132) respectively. Both EGFR and KRAS mutations were prevalent in females, and a trend towards higher mutation frequency was seen in patients under ≥ 60 years age. The presence of EGFR and KRAS mutations were higher in adenocarcinomas in comparison to other histological subtype. Sequencing analysis of EGFR exon 18 revealed Inframe deletion (G709_T710 > A) and missense mutation (K713R). Among exon 19 positive cases, 49.3 % (37/75) were in-frame deletions, of which E746_A750del was frequent. Similarly, ~47 % (35/75) cases showed complex mutation involving indel. Among mutations in exon 20 (N = 9), 8 were substitutions, one showed duplication, while all exon 21 mutations were of the missense types with L858R as the most recurrent type. Sequencing analysis of KRAS exon 1 revealed three different types codon 12 substitutions resulting in c34G > T (G12C) (n = 4), c.35G > A (G12D) (n = 1), and c.35G > T (G12V) (n = 1). In conclusion, the present study is an example of molecular diversity of EGFR and KRAS gene in Indian patients and further confirms that the frequency of EGFR and KRAS mutations varies considerably globally. To the best of our knowledge, this is the first Indian study to evaluate KRAS mutation. The current study also served to identify novel variations that added new insights into the genetic heterogeneity of NSCLC.

  7. Structural variation of chromosomes in autism spectrum disorder.

    Science.gov (United States)

    Marshall, Christian R; Noor, Abdul; Vincent, John B; Lionel, Anath C; Feuk, Lars; Skaug, Jennifer; Shago, Mary; Moessner, Rainald; Pinto, Dalila; Ren, Yan; Thiruvahindrapduram, Bhooma; Fiebig, Andreas; Schreiber, Stefan; Friedman, Jan; Ketelaars, Cees E J; Vos, Yvonne J; Ficicioglu, Can; Kirkpatrick, Susan; Nicolson, Rob; Sloman, Leon; Summers, Anne; Gibbons, Clare A; Teebi, Ahmad; Chitayat, David; Weksberg, Rosanna; Thompson, Ann; Vardy, Cathy; Crosbie, Vicki; Luscombe, Sandra; Baatjes, Rebecca; Zwaigenbaum, Lonnie; Roberts, Wendy; Fernandez, Bridget; Szatmari, Peter; Scherer, Stephen W

    2008-02-01

    Structural variation (copy number variation [CNV] including deletion and duplication, translocation, inversion) of chromosomes has been identified in some individuals with autism spectrum disorder (ASD), but the full etiologic role is unknown. We performed genome-wide assessment for structural abnormalities in 427 unrelated ASD cases via single-nucleotide polymorphism microarrays and karyotyping. With microarrays, we discovered 277 unbalanced CNVs in 44% of ASD families not present in 500 controls (and re-examined in another 1152 controls). Karyotyping detected additional balanced changes. Although most variants were inherited, we found a total of 27 cases with de novo alterations, and in three (11%) of these individuals, two or more new variants were observed. De novo CNVs were found in approximately 7% and approximately 2% of idiopathic families having one child, or two or more ASD siblings, respectively. We also detected 13 loci with recurrent/overlapping CNV in unrelated cases, and at these sites, deletions and duplications affecting the same gene(s) in different individuals and sometimes in asymptomatic carriers were also found. Notwithstanding complexities, our results further implicate the SHANK3-NLGN4-NRXN1 postsynaptic density genes and also identify novel loci at DPP6-DPP10-PCDH9 (synapse complex), ANKRD11, DPYD, PTCHD1, 15q24, among others, for a role in ASD susceptibility. Our most compelling result discovered CNV at 16p11.2 (p = 0.002) (with characteristics of a genomic disorder) at approximately 1% frequency. Some of the ASD regions were also common to mental retardation loci. Structural variants were found in sufficiently high frequency influencing ASD to suggest that cytogenetic and microarray analyses be considered in routine clinical workup.

  8. Structural variation of chromosomes in autism spectrum disorder

    NARCIS (Netherlands)

    Marshall, Christian R.; Noor, Abdul; Vincent, John B.; Lionel, Anath C.; Feuk, Lars; Skaug, Jennifer; Shago, Mary; Moessner, Rainald; Pinto, Dalila; Ren, Yan; Thiruvahindrapduram, Bhoorna; Fiebig, Andreas; Schreiber, Stefan; Friedman, Jan; Ketelaars, Cees E. J.; Vos, Yvonne J.; Ficicioglu, Can; Kirkpatrick, Susan; Nicolson, Rob; Sloman, Leon; Surnmers, Anne; Gibbons, Clare A.; Teebi, Ahmad; Chitayat, David; Weksberg, Rosanna; Thompson, Ann; Vardy, Cathy; Crosbie, Vicki; Luscombe, Sandra; Baatjes, Rebecca; Zwaigenbaum, Lonnie; Roberts, Wendy; Fernandez, Bridget; Szatmari, Peter; Scherer, Stephen W.

    2008-01-01

    Structural variation (copy number variation [CNV] including deletion and duplication, translocation, inversion) of chromosomes has been identified in some individuals with autism spectrum disorder (ASD), but the full etiologic role is unknown. We performed genome-wide assessment for structural abnor

  9. Autism spectrum disorders: from genes to neurobiology.

    Science.gov (United States)

    Willsey, A Jeremy; State, Matthew W

    2015-02-01

    Advances in genome-wide technology, coupled with the availability of large cohorts, are finally yielding a steady stream of autism spectrum disorder (ASD) genes carrying mutations of large effect. These findings represent important molecular clues, but at the same time present notable challenges to traditional strategies for moving from genes to neurobiology. A remarkable degree of genetic heterogeneity, the biological pleiotropy of ASD genes, and the tremendous complexity of the human brain are prompting the development of new strategies for translating genetic discoveries into therapeutic targets. Recent developments in systems biology approaches that 'contextualize' these genetic findings along spatial, temporal, and cellular axes of human brain development are beginning to bridge the gap between high-throughput gene discovery and testable pathophysiological hypotheses.

  10. Slope spectrum variation in a simulated loess watershed

    Science.gov (United States)

    Li, Fayuan; Tang, Guoan; Wang, Chun; Cui, Lingzhou; Zhu, Rui

    2016-06-01

    A simulated loess watershed, where the loess material and relief properly represent the true loess surface, is adopted to investigate the variation in slope spectrum with loess watershed evolution. The evolution of the simulated loess watershed was driven by the exogenetic force of artificial rainfall. For a period of three months, twenty artificial rainfall events with different intensities and durations were carried out. In the process, nine DEM data sets, each with 10 mm grid resolution, were established by the method of close-range photogrammetry. The slope spectra were then extracted from these DEMs. Subsequent series of carefully designed quantitative analyses indicated a strong relationship between the slope spectrum and the evolution of the simulated loess watershed. Quantitative indices of the slope spectrum varied regularly following the evolution of the simulated loess watershed. Mean slope, slope spectrum information entropy ( H), terrain driving force ( T d ), Mean patch area ( AREA_MN), Contagion Index ( CONTAG), and Patch Cohesion Index ( COHESION) kept increasing following the evolution of the simulated watershed, while skewness ( S), Perimeter-Area Fractal Dimension ( PAFRAC), and Interspersion and Juxtaposition Index ( IJI) represented an opposite trend. All the indices changed actively in the early and active development periods, but slowly in the stable development periods. These experimental results indicate that the time series of slope spectra was able to effectively depict the slope distribution of the simulated loess watershed, thus presenting a potential method for modeling loess landforms.

  11. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important contributors...

  12. Association Between Mitochondrial DNA Haplogroup Variation and Autism Spectrum Disorders.

    Science.gov (United States)

    Chalkia, Dimitra; Singh, Larry N; Leipzig, Jeremy; Lvova, Maria; Derbeneva, Olga; Lakatos, Anita; Hadley, Dexter; Hakonarson, Hakon; Wallace, Douglas C

    2017-08-23

    Autism spectrum disorders (ASD) are characterized by impairments in social interaction, communication, and repetitive or restrictive behavior. Although multiple physiologic and biochemical studies have reported defects in mitochondrial oxidative phosphorylation in patients with ASD, the role of mitochondrial DNA (mtDNA) variation has remained relatively unexplored. To assess what impact mitochondrial lineages encompassing ancient mtDNA functional polymorphisms, termed haplogroups, have on ASD risk. In this cohort study, individuals with autism and their families were studied using the Autism Genetic Resource Exchange cohort genome-wide association studies data previously generated at the Children's Hospital of Philadelphia. From October 2010 to January 2017, we analyzed the data and used the mtDNA single-nucleotide polymorphisms interrogated by the Illumina HumanHap 550 chip to determine the mtDNA haplogroups of the individuals. Taking into account the familial structure of the Autism Genetic Resource Exchange data, we then determined whether the mtDNA haplogroups correlate with ASD risk. Odds ratios of mitochondrial haplogroup as predictors of ASD risk. Of 1624 patients with autism included in this study, 1299 were boys (80%) and 325 were girls (20%). Families in the Autism Genetic Resource Exchange collection (933 families, encompassing 4041 individuals: 1624 patients with ASD and 2417 healthy parents and siblings) had been previously recruited in the United States with no restrictions on age, sex, race/ethnicity, or socioeconomic status. Relative to the most common European haplogroup HHV, European haplogroups I, J, K, O-X, T, and U were associated with increased risk of ASD, as were Asian and Native American haplogroups A and M, with odds ratios ranging from 1.55 (95% CI, 1.16-2.06) to 2.18 (95% CI, 1.59-3) (adjusted P < .04). Hence, mtDNA haplogroup variation is an important risk factor for ASD. Because haplogroups I, J, K, O-X, T, and U encompass 55% of the

  13. Autism Spectrum Disorder and High Confidence Gene Factors

    OpenAIRE

    Mai, MOCHIZUKI

    2017-01-01

    Autism spectrum disorder (ASD) is a neurological developmental disorder whose mechanism isyet unclear. However, recent ASD studies, which employ exome- and genome-wide sequencing,have identified some high-confidence ASD genes. Those ASD studies have revealed that CHD8is likely associated with ASD. In this article, we highlight that CHD8 may regulate othercandidate ASD risk genes. Current research indicates that there exist some thousand autismsusceptibility candidate genes. Moreover, we sugge...

  14. Genome-wide copy number variation analysis in a Chinese autism spectrum disorder cohort

    Science.gov (United States)

    Guo, Hui; Peng, Yu; Hu, Zhengmao; Li, Ying; Xun, Guanglei; Ou, Jianjun; Sun, Liangdan; Xiong, Zhimin; Liu, Yanling; Wang, Tianyun; Chen, Jingjing; Xia, Lu; Bai, Ting; Shen, Yidong; Tian, Qi; Hu, Yiqiao; Shen, Lu; Zhao, Rongjuan; Zhang, Xuejun; Zhang, Fengyu; Zhao, Jingping; Zou, Xiaobing; Xia, Kun

    2017-01-01

    Autism spectrum disorder (ASD) describes a group of neurodevelopmental disorders with high heritability, although the underlying genetic determinants of ASDs remain largely unknown. Large-scale whole-genome studies of copy number variation in Han Chinese samples are still lacking. We performed a genome-wide copy number variation analysis of 343 ASD trios, 203 patients with sporadic cases and 988 controls in a Chinese population using Illumina genotyping platforms to identify CNVs and related genes that may contribute to ASD risk. We identified 32 rare CNVs larger than 1 Mb in 31 patients. ASD patients were found to carry a higher global burden of rare, large CNVs than controls. Recurrent de novo or case-private CNVs were found at 15q11-13, Xp22.3, 15q13.1–13.2, 3p26.3 and 2p12. The de novo 15q11–13 duplication was more prevalent in this Chinese population than in those with European ancestry. Several genes, including GRAMD2 and STAM, were implicated as novel ASD risk genes when integrating whole-genome CNVs and whole-exome sequencing data. We also identified several CNVs that include known ASD genes (SHANK3, CDH10, CSMD1) or genes involved in nervous system development (NYAP2, ST6GAL2, GRM6). Besides, our study also implicated Contactins-NYAPs-WAVE1 pathway in ASD pathogenesis. Our findings identify ASD-related CNVs in a Chinese population and implicate novel ASD risk genes and related pathway for further study. PMID:28281572

  15. Chromosomal Abnormalities and Putative Susceptibility Genes in Autism Spectrum Disorders

    DEFF Research Database (Denmark)

    Nielsen, Mette Gilling

    Autism spectrum disorders (ASDs) is a heterogeneous group of neurodevelopmental disorders with a significant genetic component as shown by family and twin studies. However, only a few genes have repeatedly been shown to be involved in the development of ASDs. The aim of this study has been...... to identify possible ASD susceptibility genes. Genome screens in ASD patients suggest possible susceptibility gene regions on almost every chromosome. We identified four ASD patients with chromosomal rearrangements, two of which were familial rearrangements involving one of these putative susceptibility gene......) was performed for all four patients. By combination of these methods we identified several putative susceptibility genes for ASDs. Expression patterns were established for several of these genes by Quantitative PCR (Q-PCR) or in situ hybridization and one gene was sequenced in 157 ASD patients. Our results...

  16. PAX6 gene variations associated with aniridia in south India

    Directory of Open Access Journals (Sweden)

    Shashikant Shetty

    2004-04-01

    Full Text Available Abstract Background Mutations in the transcription factor gene PAX6 have been shown to be the cause of the aniridia phenotype. The purpose of this study was to analyze patients with aniridia to uncover PAX6 gene mutations in south Indian population. Methods Total genomic DNA was isolated from peripheral blood of twenty-eight members of six clinically diagnosed aniridia families and 60 normal healthy controls. The coding exons of the human PAX6 gene were amplified by PCR and allele specific variations were detected by single strand conformation polymorphism (SSCP followed by automated sequencing. Results The sequencing results revealed novel PAX6 mutations in three patients with sporadic aniridia: c.715ins5, [c.1201delA; c.1239A>G] and c.901delA. Two previously reported nonsense mutations were also found: c.482C>A, c.830G>A. A neutral polymorphism was detected (IVS9-12C>T at the boundary of intron 9 and exon 10. The two nonsense mutations found in the coding region of human PAX6 gene are reported for the first time in the south Indian population. Conclusion The genetic analysis confirms that haploinsuffiency of the PAX6 gene causes the classic aniridia phenotype. Most of the point mutations detected in our study results in stop codons. Here we add three novel PAX6 gene mutations in south Indian population to the existing spectrum of mutations, which is not a well-studied ethnic group. Our study supports the hypothesis that a mutation in the PAX6 gene correlates with expression of aniridia.

  17. Genetic variation in genes affecting milk composition and quality

    DEFF Research Database (Denmark)

    Bertelsen, Henriette Pasgaard

    In the past decade major advances in next generation sequencing technologies have provided new opportuneties for the detection of genetic variation. Combining the knowlegde of genetic variation with phenotypic distributions provides considerable possibilites for detection of candidate genes....... In addition, exploring genetic variation related to the major milk proteins of bovine milk indntified genetic variations with possitive effects on milk coagulation...

  18. Methane absorption variations in the spectrum of Pluto

    Energy Technology Data Exchange (ETDEWEB)

    Buie, M.W.; Fink, U.

    1987-06-01

    The lightcurve phases of 0.18, 0.35, 0.49, and 0.98 covered by 5600-10,500 A absolute spectrophotometry of Pluto during four nights include minimum (0.98) light and one near-maximum (0.49) light. The spectra are noted to exhibit significant methane band absorption depth variations at 6200, 7200, 7900, 8400, 8600, 8900, and 10,000 A, with the minimum absorption occurring at minimum light and thereby indicating a 30-percent change in the methane column abundance in the course of three days. An attempt is made to model this absorption strength variation with rotational phase terms of an isotropic surface distribution of methane frost and a clear layer of CH4 gas. 34 references.

  19. Functional impact of global rare copy number variation in autism spectrum disorders.

    Science.gov (United States)

    Pinto, Dalila; Pagnamenta, Alistair T; Klei, Lambertus; Anney, Richard; Merico, Daniele; Regan, Regina; Conroy, Judith; Magalhaes, Tiago R; Correia, Catarina; Abrahams, Brett S; Almeida, Joana; Bacchelli, Elena; Bader, Gary D; Bailey, Anthony J; Baird, Gillian; Battaglia, Agatino; Berney, Tom; Bolshakova, Nadia; Bölte, Sven; Bolton, Patrick F; Bourgeron, Thomas; Brennan, Sean; Brian, Jessica; Bryson, Susan E; Carson, Andrew R; Casallo, Guillermo; Casey, Jillian; Chung, Brian H Y; Cochrane, Lynne; Corsello, Christina; Crawford, Emily L; Crossett, Andrew; Cytrynbaum, Cheryl; Dawson, Geraldine; de Jonge, Maretha; Delorme, Richard; Drmic, Irene; Duketis, Eftichia; Duque, Frederico; Estes, Annette; Farrar, Penny; Fernandez, Bridget A; Folstein, Susan E; Fombonne, Eric; Freitag, Christine M; Gilbert, John; Gillberg, Christopher; Glessner, Joseph T; Goldberg, Jeremy; Green, Andrew; Green, Jonathan; Guter, Stephen J; Hakonarson, Hakon; Heron, Elizabeth A; Hill, Matthew; Holt, Richard; Howe, Jennifer L; Hughes, Gillian; Hus, Vanessa; Igliozzi, Roberta; Kim, Cecilia; Klauck, Sabine M; Kolevzon, Alexander; Korvatska, Olena; Kustanovich, Vlad; Lajonchere, Clara M; Lamb, Janine A; Laskawiec, Magdalena; Leboyer, Marion; Le Couteur, Ann; Leventhal, Bennett L; Lionel, Anath C; Liu, Xiao-Qing; Lord, Catherine; Lotspeich, Linda; Lund, Sabata C; Maestrini, Elena; Mahoney, William; Mantoulan, Carine; Marshall, Christian R; McConachie, Helen; McDougle, Christopher J; McGrath, Jane; McMahon, William M; Merikangas, Alison; Migita, Ohsuke; Minshew, Nancy J; Mirza, Ghazala K; Munson, Jeff; Nelson, Stanley F; Noakes, Carolyn; Noor, Abdul; Nygren, Gudrun; Oliveira, Guiomar; Papanikolaou, Katerina; Parr, Jeremy R; Parrini, Barbara; Paton, Tara; Pickles, Andrew; Pilorge, Marion; Piven, Joseph; Ponting, Chris P; Posey, David J; Poustka, Annemarie; Poustka, Fritz; Prasad, Aparna; Ragoussis, Jiannis; Renshaw, Katy; Rickaby, Jessica; Roberts, Wendy; Roeder, Kathryn; Roge, Bernadette; Rutter, Michael L; Bierut, Laura J; Rice, John P; Salt, Jeff; Sansom, Katherine; Sato, Daisuke; Segurado, Ricardo; Sequeira, Ana F; Senman, Lili; Shah, Naisha; Sheffield, Val C; Soorya, Latha; Sousa, Inês; Stein, Olaf; Sykes, Nuala; Stoppioni, Vera; Strawbridge, Christina; Tancredi, Raffaella; Tansey, Katherine; Thiruvahindrapduram, Bhooma; Thompson, Ann P; Thomson, Susanne; Tryfon, Ana; Tsiantis, John; Van Engeland, Herman; Vincent, John B; Volkmar, Fred; Wallace, Simon; Wang, Kai; Wang, Zhouzhi; Wassink, Thomas H; Webber, Caleb; Weksberg, Rosanna; Wing, Kirsty; Wittemeyer, Kerstin; Wood, Shawn; Wu, Jing; Yaspan, Brian L; Zurawiecki, Danielle; Zwaigenbaum, Lonnie; Buxbaum, Joseph D; Cantor, Rita M; Cook, Edwin H; Coon, Hilary; Cuccaro, Michael L; Devlin, Bernie; Ennis, Sean; Gallagher, Louise; Geschwind, Daniel H; Gill, Michael; Haines, Jonathan L; Hallmayer, Joachim; Miller, Judith; Monaco, Anthony P; Nurnberger, John I; Paterson, Andrew D; Pericak-Vance, Margaret A; Schellenberg, Gerard D; Szatmari, Peter; Vicente, Astrid M; Vieland, Veronica J; Wijsman, Ellen M; Scherer, Stephen W; Sutcliffe, James S; Betancur, Catalina

    2010-07-15

    The autism spectrum disorders (ASDs) are a group of conditions characterized by impairments in reciprocal social interaction and communication, and the presence of restricted and repetitive behaviours. Individuals with an ASD vary greatly in cognitive development, which can range from above average to intellectual disability. Although ASDs are known to be highly heritable ( approximately 90%), the underlying genetic determinants are still largely unknown. Here we analysed the genome-wide characteristics of rare (<1% frequency) copy number variation in ASD using dense genotyping arrays. When comparing 996 ASD individuals of European ancestry to 1,287 matched controls, cases were found to carry a higher global burden of rare, genic copy number variants (CNVs) (1.19 fold, P = 0.012), especially so for loci previously implicated in either ASD and/or intellectual disability (1.69 fold, P = 3.4 x 10(-4)). Among the CNVs there were numerous de novo and inherited events, sometimes in combination in a given family, implicating many novel ASD genes such as SHANK2, SYNGAP1, DLGAP2 and the X-linked DDX53-PTCHD1 locus. We also discovered an enrichment of CNVs disrupting functional gene sets involved in cellular proliferation, projection and motility, and GTPase/Ras signalling. Our results reveal many new genetic and functional targets in ASD that may lead to final connected pathways.

  20. Functional Impact of Global Rare Copy Number Variation in Autism Spectrum Disorder

    Science.gov (United States)

    Pinto, Dalila; Pagnamenta, Alistair T.; Klei, Lambertus; Anney, Richard; Merico, Daniele; Regan, Regina; Conroy, Judith; Magalhaes, Tiago R.; Correia, Catarina; Abrahams, Brett S.; Almeida, Joana; Bacchelli, Elena; Bader, Gary D.; Bailey, Anthony J.; Baird, Gillian; Battaglia, Agatino; Berney, Tom; Bolshakova, Nadia; Bölte, Sven; Bolton, Patrick F.; Bourgeron, Thomas; Brennan, Sean; Brian, Jessica; Bryson, Susan E.; Carson, Andrew R.; Casallo, Guillermo; Casey, Jillian; Cochrane, Lynne; Corsello, Christina; Crawford, Emily L.; Crossett, Andrew; Dawson, Geraldine; de Jonge, Maretha; Delorme, Richard; Drmic, Irene; Duketis, Eftichia; Duque, Frederico; Estes, Annette; Farrar, Penny; Fernandez, Bridget A.; Filipa, Ana; Folstein, Susan E.; Fombonne, Eric; Freitag, Christine M.; Gilbert, John; Gillberg, Christopher; Glessner, Joseph T.; Goldberg, Jeremy; Green, Andrew; Green, Jonathan; Guter, Stephen J.; Hakonarson, Hakon; Heron, Elizabeth A.; Hill, Matthew; Holt, Richard; Howe, Jennifer L.; Hughes, Gillian; Hus, Vanessa; Igliozzi, Roberta; Kim, Cecilia; Klauck, Sabine M.; Kolevzon, Alexander; Korvatska, Olena; Kustanovich, Vlad; Lajonchere, Clara M.; Lamb, Janine A.; Laskawiec, Magdalena; Leboyer, Marion; Le Couteur, Ann; Leventhal, Bennett L.; Lionel, Anath C.; Liu, Xiao-Qing; Lord, Catherine; Lotspeich, Linda; Lund, Sabata C.; Maestrini, Elena; Mahoney, William; Mantoulan, Carine; Marshall, Christian R.; McConachie, Helen; McDougle, Christopher J.; McGrath, Jane; McMahon, William M.; Merikangas, Alison; Migita, Ohsuke; Minshew, Nancy J.; Mirza, Ghazala K.; Munson, Jeff; Nelson, Stanley F.; Noakes, Carolyn; Noor, Abdul; Nygren, Gudrun; Oliveira, Guiomar; Papanikolaou, Katerina; Parr, Jeremy R.; Parrini, Barbara; Paton, Tara; Pickles, Andrew; Pilorge, Marion; Piven, Joseph; Ponting, Chris P.; Posey, David J.; Poustka, Annemarie; Poustka, Fritz; Prasad, Aparna; Ragoussis, Jiannis; Renshaw, Katy; Rickaby, Jessica; Roberts, Wendy; Roeder, Kathryn; Roge, Bernadette; Rutter, Michael L.; Bierut, Laura J.; Rice, John P.; Consortium, SAGE; Salt, Jeff; Sansom, Katherine; Sato, Daisuke; Segurado, Ricardo; Senman, Lili; Shah, Naisha; Sheffield, Val C.; Soorya, Latha; Sousa, Inês; Stein, Olaf; Stoppioni, Vera; Strawbridge, Christina; Tancredi, Raffaella; Tansey, Katherine; Thiruvahindrapduram, Bhooma; Thompson, Ann P.; Thomson, Susanne; Tryfon, Ana; Tsiantis, John; Van Engeland, Herman; Vincent, John B.; Volkmar, Fred; Wallace, Simon; Wang, Kai; Wang, Zhouzhi; Wassink, Thomas H.; Webber, Caleb; Wing, Kirsty; Wittemeyer, Kerstin; Wood, Shawn; Wu, Jing; Yaspan, Brian L.; Zurawiecki, Danielle; Zwaigenbaum, Lonnie; Buxbaum, Joseph D.; Cantor, Rita M.; Cook, Edwin H.; Coon, Hilary; Cuccaro, Michael L.; Devlin, Bernie; Ennis, Sean; Gallagher, Louise; Geschwind, Daniel H.; Gill, Michael; Haines, Jonathan L.; Hallmayer, Joachim; Miller, Judith; Monaco, Anthony P.; Nurnberger, John I.; Paterson, Andrew D.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Szatmari, Peter; Vicente, Astrid M.; Vieland, Veronica J.; Wijsman, Ellen M.; Scherer, Stephen W.; Sutcliffe, James S.; Betancur, Catalina

    2010-01-01

    The autism spectrum disorders (ASDs) are a group of conditions characterized by impairments in reciprocal social interaction and communication, and the presence of restricted and repetitive behaviors1. Individuals with an ASD vary greatly in cognitive development, which can range from above average to intellectual disability (ID)2. While ASDs are known to be highly heritable (~90%)3, the underlying genetic determinants are still largely unknown. Here, we analyzed the genome-wide characteristics of rare (<1% frequency) copy number variation (CNV) in ASD using dense genotyping arrays. When comparing 996 ASD individuals of European ancestry to 1,287 matched controls, cases were found to carry a higher global burden of rare, genic CNVs (1.19 fold, P= 0.012), especially so for loci previously implicated in either ASD and/or intellectual disability (1.69 fold, P= 3.4×10−4). Among the CNVs, there were numerous de novo and inherited events, sometimes in combination in a given family, implicating many novel ASD genes like SHANK2, SYNGAP1, DLGAP2 and the X-linked DDX53-PTCHD1 locus. We also discovered an enrichment of CNVs disrupting functional gene-sets involved in cellular proliferation, projection and motility, and GTPase/Ras signaling. Our results reveal many new genetic and functional targets in ASD that may lead to final connected pathways. PMID:20531469

  1. Evidence of novel fine-scale structural variation at autism spectrum disorder candidate loci

    Directory of Open Access Journals (Sweden)

    Hedges Dale J

    2012-04-01

    Full Text Available Abstract Background Autism spectrum disorders (ASD represent a group of neurodevelopmental disorders characterized by a core set of social-communicative and behavioral impairments. Gamma-aminobutyric acid (GABA is the major inhibitory neurotransmitter in the brain, acting primarily via the GABA receptors (GABR. Multiple lines of evidence, including altered GABA and GABA receptor expression in autistic patients, indicate that the GABAergic system may be involved in the etiology of autism. Methods As copy number variations (CNVs, particularly rare and de novo CNVs, have now been implicated in ASD risk, we examined the GABA receptors and genes in related pathways for structural variation that may be associated with autism. We further extended our candidate gene set to include 19 genes and regions that had either been directly implicated in the autism literature or were directly related (via function or ancestry to these primary candidates. For the high resolution CNV screen we employed custom-designed 244 k comparative genomic hybridization (CGH arrays. Collectively, our probes spanned a total of 11 Mb of GABA-related and additional candidate regions with a density of approximately one probe every 200 nucleotides, allowing a theoretical resolution for detection of CNVs of approximately 1 kb or greater on average. One hundred and sixty-eight autism cases and 149 control individuals were screened for structural variants. Prioritized CNV events were confirmed using quantitative PCR, and confirmed loci were evaluated on an additional set of 170 cases and 170 control individuals that were not included in the original discovery set. Loci that remained interesting were subsequently screened via quantitative PCR on an additional set of 755 cases and 1,809 unaffected family members. Results Results include rare deletions in autistic individuals at JAKMIP1, NRXN1, Neuroligin4Y, OXTR, and ABAT. Common insertion/deletion polymorphisms were detected at several

  2. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Directory of Open Access Journals (Sweden)

    Leekitcharoenphon Pimlapas

    2012-03-01

    Full Text Available Abstract Background Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over time. The core genes--the genes that are conserved in all (or most members of a genus or species--are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher confidence. The core genes can be divided into two categories: a few highly variable genes and a larger set of conserved core genes, with low variance. For the most variable core genes, the variance in amino acid sequences is higher than for the corresponding nucleotide sequences, suggesting that there is a positive selection towards mutations leading to amino acid changes. Conclusions Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important especially in trend analysis.

  3. De novo mutation in the dopamine transporter gene associates dopamine dysfunction with autism spectrum disorder

    DEFF Research Database (Denmark)

    Hamilton, P J; Campbell, N G; Sharma, S

    2013-01-01

    De novo genetic variation is an important class of risk factors for autism spectrum disorder (ASD). Recently, whole-exome sequencing of ASD families has identified a novel de novo missense mutation in the human dopamine (DA) transporter (hDAT) gene, which results in a Thr to Met substitution...... at site 356 (hDAT T356M). The dopamine transporter (DAT) is a presynaptic membrane protein that regulates dopaminergic tone in the central nervous system by mediating the high-affinity reuptake of synaptically released DA, making it a crucial regulator of DA homeostasis. Here, we report the first...

  4. The variation of psychopharmacological prescription rates for people with autism spectrum disorder (ASD) in 30 countries

    NARCIS (Netherlands)

    Wong, A.Y.; Hsia, Y.; Chan, E.W.; Murphy, D.G.; Simonoff, E.; Buitelaar, J.; Wong, I.C.

    2014-01-01

    There is significant variation in prescriptions among countries in clinical practice for the treatment of comorbidities associated with autism spectrum disorder (ASD). It has been suggested that many people with mental health disorders in low-/middle-income countries do not receive adequate treatmen

  5. Estimating the Quadratic Variation Spectrum of Noisy Asset Prices Using Generalized Flat-top Realized Kernels

    DEFF Research Database (Denmark)

    Varneskov, Rasmus T.

    2014-01-01

    This paper analyzes a generalized class of flat-top realized kernels for estimation ot the quadratic variation spectrum,i.e. the decomposition of quadratic variation into integrated variance and jump variation, when the underlying, efficient price process is contaminated by addictive noise......-top estimators are shown to be consistent, asymptotically unbiased, and mixed Gaussian at the optimal rate of convergence, n1/4. Exact bound on lower order terms are obtained using maximal inequalities and these are used to derive a conservative, MSE-optimal flat-top shrinkage. Additionally, bounds...

  6. Total Variation Minimization Based Compressive Wideband Spectrum Sensing for Cognitive Radios

    CERN Document Server

    Liu, Yipeng

    2011-01-01

    Wideband spectrum sensing is a critical component of a functioning cognitive radio system. Its major challenge is the too high sampling rate requirement. Compressive sensing (CS) promises to be able to deal with it. Nearly all the current CS based compressive wideband spectrum sensing methods exploit only the frequency sparsity to perform. Motivated by the achievement of a fast and robust detection of the wideband spectrum change, total variation mnimization is incorporated to exploit the temporal and frequency structure information to enhance the sparse level. As a sparser vector is obtained, the spectrum sensing period would be shorten and sensing accuracy would be enhanced. Both theoretical evaluation and numerical experiments can demonstrate the performance improvement.

  7. Global properties and functional complexity of human gene regulatory variation.

    Directory of Open Access Journals (Sweden)

    Daniel J Gaffney

    2013-05-01

    Full Text Available Identification and functional interpretation of gene regulatory variants is a major focus of modern genomics. The application of genetic mapping to molecular and cellular traits has enabled the detection of regulatory variation on genome-wide scales and revealed an enormous diversity of regulatory architecture in humans and other species. In this review I summarise the insights gained and questions raised by a decade of genetic mapping of gene expression variation. I discuss recent extensions of this approach using alternative molecular phenotypes that have revealed some of the biological mechanisms that drive gene expression variation between individuals. Finally, I highlight outstanding problems and future directions for development.

  8. CHARACTERISTICS OF FREQUENCY SPECTRUM VARIATION OF INTRASEASONAL OSCILLATION OF CONVECTION DURING SOUTH CHINA SEA SUMMER MONSOON

    Institute of Scientific and Technical Information of China (English)

    LIN Ai-lan; LIANG Jian-yin; LI Chun-hui

    2006-01-01

    Datasets of equivalent temperature of black body (TBB) and sea surface temperature (SST) ranging from 1980 to 1997 are used to diagnose and analyze the characteristics of frequency spectrum and strength of intraseasonal variation of convection. The relationship between the strength of intraseasonal oscillation of convection, strength of convection itself and SST in the South China Sea (SCS) is studied. It is shown that, there are distinguishable annual, interannual and interdecadal variations in both strength and frequency spectrum of intraseasonal variation of convection in SCS. There are connections between strength of convection, strength of ISO1 in the summer half (s.h.) year and SST in ensuing winter half (w.h.) year in SCS.The strong (weak) convection and strong (weak) ISO1 are associated with negative (positive) bias of SST in ensuing w.h. year in SCS.

  9. Support for calcium channel gene defects in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Lu Ake Tzu-Hui

    2012-12-01

    Full Text Available Abstract Background Alternation of synaptic homeostasis is a biological process whose disruption might predispose children to autism spectrum disorders (ASD. Calcium channel genes (CCG contribute to modulating neuronal function and evidence implicating CCG in ASD has been accumulating. We conducted a targeted association analysis of CCG using existing genome-wide association study (GWAS data and imputation methods in a combined sample of parent/affected child trios from two ASD family collections to explore this hypothesis. Methods A total of 2,176 single-nucleotide polymorphisms (SNP (703 genotyped and 1,473 imputed covering the genes that encode the α1 subunit proteins of 10 calcium channels were tested for association with ASD in a combined sample of 2,781 parent/affected child trios from 543 multiplex Caucasian ASD families from the Autism Genetics Resource Exchange (AGRE and 1,651 multiplex and simplex Caucasian ASD families from the Autism Genome Project (AGP. SNP imputation using IMPUTE2 and a combined reference panel from the HapMap3 and the 1,000 Genomes Project increased coverage density of the CCG. Family-based association was tested using the FBAT software which controls for population stratification and accounts for the non-independence of siblings within multiplex families. The level of significance for association was set at 2.3E-05, providing a Bonferroni correction for this targeted 10-gene panel. Results Four SNPs in three CCGs were associated with ASD. One, rs10848653, is located in CACNA1C, a gene in which rare de novo mutations are responsible for Timothy syndrome, a Mendelian disorder that features ASD. Two others, rs198538 and rs198545, located in CACN1G, and a fourth, rs5750860, located in CACNA1I, are in CCGs that encode T-type calcium channels, genes with previous ASD associations. Conclusions These associations support a role for common CCG SNPs in ASD.

  10. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

    2012-01-01

    Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...... that there is a positive selection towards mutations leading to amino acid changes. Conclusions: Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important...

  11. Theories of Population Variation in Genes and Genomes

    DEFF Research Database (Denmark)

    Christiansen, Freddy

    genetics, while emphasizing the close interplay between theory and empiricism. Traditional topics such as genetic and phenotypic variation, mutation, migration, and linkage are covered and advanced by contemporary coalescent theory, which describes the genealogy of genes in a population, ultimately...

  12. MTHFR Gene C677T Polymorphism in Autism Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Sener

    2014-01-01

    Full Text Available Aim. Autism is a subgroup of autism spectrum disorders, classified as a heterogeneous neurodevelopmental disorder and symptoms occur in the first three years of life. The etiology of autism is largely unknown, but it has been accepted that genetic and environmental factors may both be responsible for the disease. Recent studies have revealed that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. In particular, C677T polymorphism in the MTHFR gene as a possible risk factor for autism is still controversial. We aimed to investigate the possible effect of C677T polymorphism in a Turkish cohort. Methods. Autism patients were diagnosed by child psychiatrists according to DSM-IV and DSM-V criteria. A total of 98 children diagnosed as autistic and 70 age and sex-matched children who are nonautistic were tested for C677T polymorphism. This polymorphism was studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP methods. Results. MTHFR 677T-allele frequency was found to be higher in autistic children compared with nonautistic children (29% versus 24%, but it was not found statistically significant. Conclusions. We conclude that other MTHFR polymorphisms such as A1298C or other folate/homocysteine pathway genes may be studied to show their possible role in autism.

  13. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  14. Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago.

    Science.gov (United States)

    Tezuka, A; Kasagi, S; van Oosterhout, C; McMullan, M; Iwasaki, W M; Kasai, D; Yamamichi, M; Innan, H; Kawamura, S; Kawata, M

    2014-11-01

    The guppy is known to exhibit remarkable interindividual variations in spectral sensitivity of middle to long wavelength-sensitive (M/LWS) cone photoreceptor cells. The guppy has four M/LWS-type opsin genes (LWS-1, LWS-2, LWS-3 and LWS-4) that are considered to be responsible for this sensory variation. However, the allelic variation of the opsin genes, particularly in terms of their absorption spectrum, has not been explored in wild populations. Thus, we examined nucleotide variations in the four M/LWS opsin genes as well as blue-sensitive SWS2-B and ultraviolet-sensitive SWS1 opsin genes for comparison and seven non-opsin nuclear loci as reference genes in 10 guppy populations from various light environments in Trinidad and Tobago. For the first time, we discovered a potential spectral variation (180 Ser/Ala) in LWS-1 that differed at an amino acid site known to affect the absorption spectra of opsins. Based on a coalescent simulation of the nucleotide variation of the reference genes, we showed that the interpopulation genetic differentiation of two opsin genes was significantly larger than the neutral expectation. Furthermore, this genetic differentiation was significantly related to differences in dissolved oxygen (DO) level, and it was not explained by the spatial distance between populations. The DO levels are correlated with eutrophication that possibly affects the color of aquatic environments. These results suggest that the population diversity of opsin genes is significantly driven by natural selection and that the guppy could adapt to various light environments through color vision changes.

  15. MEFV gene variations in patients with systemic lupus erythematosus.

    Science.gov (United States)

    Erer, Burak; Cosan, Fulya; Oku, Basar; Ustek, Duran; Inanc, Murat; Aral, Orhan; Gul, Ahmet

    2014-01-01

    The aim of this study was to investigate the frequency of familial Mediterranean fever (FMF)-associated MEFV gene variations in patients with systemic lupus erythematosus (SLE). The study group comprised 190 SLE patients and 101 healthy controls of Turkish origin with no clinical features of FMF. All individuals were genotyped for the four most common MEFV gene variations (M694V, M680I, V726A and E148Q) by PCR-restriction fragment length polymorphism analysis. The frequency of carrying any of the four MEFV gene variations under study was 15 % in patients with SLE and 10 % in the healthy controls (p = 0.23). After the exclusion of the less penetrant E148Q variation, re-analysis for the three penetrant mutations revealed a significant association between exon 10 variations and pericarditis [p = 0.038, odds ratio (OR) 3.5, 95 % confidence interval (CI) 1.0-12.1], and pleural effusion (p = 0.043, OR 5.2, 95 % CI 0.8-30.9). No significant association was detected between the MEFV gene variations and a higher acute phase response. The MEFV gene variations analyzed in our study do not seem to increase the overall susceptibility to SLE and do not have any strong association with its clinical manifestations. The possibility of a modest effect of penetrant exon 10 MEFV variants on the development of serosal effusions needs to be explored in a larger series of patients.

  16. Examining genotypic variation in autism spectrum disorder and its relationship to parental age and phenotype

    Directory of Open Access Journals (Sweden)

    Geier DA

    2016-07-01

    Full Text Available David A Geier,1,2 Janet K Kern,1,3 Lisa K Sykes,2 Mark R Geier1,2 1Research Department, The Institute of Chronic Illnesses, Inc, 2Research Department, CoMeD, Inc, Silver Spring, MD, 3Research Department, CONEM US Autism Research Group, Allen, TX, USA Background: Previous studies on genetic testing of chromosomal abnormalities in individuals diagnosed with autism spectrum disorder (ASD found that ~80% have negative genetic test results (NGTRs and ~20% have positive genetic test results (PGTRs, of which ~7% were probable de novo mutations (PDNMs. Research suggests that parental age is a risk factor for an ASD diagnosis. This study examined genotypic variation in ASD and its relationship to parental age and phenotype.Methods: Phenotype was derived from detailed clinical information, and genotype was derived from high-resolution blood chromosome and blood whole-genome copy number variant genetic testing on a consecutive cohort (born: 1983–2009 of subjects diagnosed with ASD (N=218.Results: Among the subjects examined, 80.3% had NGTRs and 19.7% had PGTRs, of which 6.9% had PDNMs. NGTR subjects were born more recently (the risk of PDNMs decreasing by 12% per more recent birth year and tended to have an increased male–female ratio compared to PDNM subjects. PDNM subjects had significantly increased mean parental age and paternal age at subject’s birth (the risk of a PDNM increasing by 7%–8% per year of parental or paternal age compared to NGTR subjects. PGTR and NGTR subjects showed significant improvements in speech/language/communication with increasing age. PGTR subjects showed significant improvements in sociability, a core feature of an ASD diagnosis, with increasing age, whereas NGTR subjects showed significant worsening in sociability with increasing age.Conclusion: This study helps to elucidate different phenotypic ASD subtypes and may even indicate the need for differential diagnostic classifications. Keywords: genotype, phenotype

  17. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    OpenAIRE

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  18. Time variation of emission lines structure in the spectrum of HR Delfini

    Energy Technology Data Exchange (ETDEWEB)

    Babaev, M.B. (AN Azerbajdzhanskoj SSR, Baku. Shemakhinskaya Astrofizicheskaya Observatoriya)

    1983-04-01

    It is found that H..beta.., HeII lambda4686 and (OIII)lambdalambda4959, 5007 emission lines in the spectrum of nova HR Del had in 1981 four-component structure, as they did earlier. A comparison with 1968-1978 spectra reveals the changes in relative intensities of the internal and external components of these lines. It is concluded that time variations of physical conditions occur in some condensation in the envelope of HR Del.

  19. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  20. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  1. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    , conidia are produced and discharged when humidity gets high—usually during night. In an earlier secretome study of field-collected grain aphids (Sitobion avenae) infected with entomophthoralean fungi, a number of pathogenesis-related, secreted enzymes were discovered (Fungal Genetics and Biology 2011, vol...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  2. Mutation screening of melatonin-related genes in patients with autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Thuresson Kent

    2010-04-01

    Full Text Available Abstract Background One consistent finding in autism spectrum disorders (ASD is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT, the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. Methods In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase, ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B and GPR50 (G protein-coupled receptor 50, encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD. A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Results Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C. Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Conclusions Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified

  3. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-03-11

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations.

  4. Estimating the Quadratic Variation Spectrum of Noisy Asset Prices Using Generalized Flat-top Realized Kernels

    DEFF Research Database (Denmark)

    Varneskov, Rasmus T.

    2014-01-01

    This paper analyzes a generalized class of flat-top realized kernels for estimation ot the quadratic variation spectrum,i.e. the decomposition of quadratic variation into integrated variance and jump variation, when the underlying, efficient price process is contaminated by addictive noise....... The additive noise consists of two orthogonal components, which allows for a-mixing dependent exogenous noise and an asymptoticaly non-degenerate endogenous correlation structure, respectively. Both components may exhibit polynomially decaying autocovariances. In the absence of jumps, the class of flat......-top estimators are shown to be consistent, asymptotically unbiased, and mixed Gaussian at the optimal rate of convergence, n1/4. Exact bound on lower order terms are obtained using maximal inequalities and these are used to derive a conservative, MSE-optimal flat-top shrinkage. Additionally, bounds...

  5. Spectrum

    DEFF Research Database (Denmark)

    Høgfeldt Hansen, Leif

    2016-01-01

    The publication functions as a proces description of the development and construction of an urban furniture SPECTRUM in the city of Gwangju, Republic of Korea. It is used as the cataloque for the exhibition of Spectrum.......The publication functions as a proces description of the development and construction of an urban furniture SPECTRUM in the city of Gwangju, Republic of Korea. It is used as the cataloque for the exhibition of Spectrum....

  6. Cytokine gene polymorphisms across tuberculosis clinical spectrum in Pakistani patients.

    Directory of Open Access Journals (Sweden)

    Ambreen Ansari

    Full Text Available BACKGROUND: Pakistan ranks 7(th globally in terms of tuberculosis (TB disease burden (incidence 181/100000 pop./yr; prevalence of 329/pop./yr. Reports from different populations show variable associations of TB susceptibility and severity with cytokine gene polymorphisms. Tuberculosis clinical severity is multi-factorial and cytokines play a pivotal role in the modulation of disease severity. We have recently reported that the ratio of two key cytokines (IFNgamma and IL10 show significant correlation with the severity spectrum of tuberculosis. The objective of the current study was to analyze the frequency of cytokine gene polymorphisms linked to high and low responder phenotypes (IFNgamma +874 T(hi-->A(lo and IL10 -1082 G(lo-->A(hi in tuberculosis patients. METHODS AND FINDINGS: STUDY GROUPS WERE STRATIFIED ACCORDING TO DISEASE SITE AS WELL AS DISEASE SEVERITY: Pulmonary N = 111 (Minimal, PMN = 19; Moderate, PMD = 63; Advance, PAD = 29; Extra-pulmonary N = 67 (Disseminated DTB = 20, Localized LTB = 47 and compared with healthy controls (TBNA = 188. Genotype analyses were carried out using amplification refractory mutation system-PCR (ARMS-PCR and stimulated whole blood (WB culture assay was used for assessing cytokine profiles. Our results suggest that the IFNgamma +874 TT genotype and T allele was overrepresented in PMN (p = 0.01 and PMD (p = 0.02. IFNgamma +874 TT in combination with IL10 GG(lo genotypes showed the highest association (chi(2 = 6.66, OR = 6.06, 95% CI = 1.31-28.07, p = 0.01. IFNgamma AA(lo on the other hand in combination with IL10 GG(lo increased the risk of PAD (OR = 5.26; p = 0.005 and DTB (OR = 3.59; p = 0.045. CONCLUSION: These findings are consistent with the role of IL10 in reducing collateral tissue damage and the protective role of IFNgamma in limiting disease in the lung.

  7. Reelin gene alleles and susceptibility to autism spectrum disorders.

    Science.gov (United States)

    Zhang, H; Liu, X; Zhang, C; Mundo, E; Macciardi, F; Grayson, D R; Guidotti, A R; Holden, J J A

    2002-01-01

    A polymorphic trinucleotide repeat (CGG/GCC) within the human Reelin gene (RELN) was examined as a candidate gene for autism spectrum disorders (ASDs). This gene encodes a large extracellular matrix protein that orchestrates neuronal positioning during corticogenesis. The CGG-repeat within the 5' untranslated region of RELN exon 1 was examined in 126 multiple-incidence families. The number of CGG repeats varied from three to 16 in affected individuals and controls, with no expansion or contraction observed during maternal (n = 291) or paternal (n = 287) transmissions in families with autistic probands. Although the frequencies of the RELN alleles and genotypes in affected children were not different from those in the comparison group, a family-based association test (FBAT) showed that the larger RELN alleles (> or = 11 repeats) were transmitted more often than expected to affected children (S = 43, E(S) = 34.5, P = 0.035); this was particularly the case for the 13-repeat RELN allele (S = 22, E(S) = 16, P = 0.034). Affected sib-pair (ASP) analysis found no evidence of excess sharing of RELN alleles in affected siblings. The impact of genotypes with large alleles (> or = 11 repeats) on the phenotypes in individuals with ASD was analyzed by ANOVA in a subset of the families for which results of the Autism Diagnostic Interview-Revised were available. Children with large RELN alleles did not show any difference in scores for questions related to the core symptoms of autistic disorder, but there was a tendency for children with at least one large RELN allele to have an earlier age at first phrase (chi(2) = 3.538, P = 0.06). Thus, although the case-control and affected sib-pair findings did not support a role for RELN in susceptibility to ASD, the more powerful family-based association study demonstrated that RELN alleles with larger numbers of CGG repeats may play a role in the etiology of some cases of ASD, especially in children without delayed phrase speech.

  8. Variation in the Major Surface Glycoprotein Genes in Pneumocystis jirovecii

    Science.gov (United States)

    Kutty, Geetha; Maldarelli, Frank; Achaz, Guillaume; Kovacs, Joseph A.

    2008-01-01

    The genome of Pneumocystis, which causes life-threatening pneumonia in immunosuppressed patients, contains a multi-copy gene family that encodes the major surface glycoprotein (Msg). Pneumocystis can vary the expressed Msg, presumably as a mechanism to avoid host immune responses. Analysis of 24 msg gene sequences obtained from a single human Pneumocystis isolate demonstrated that the sequences segregate into two branches. Based on a number of analyses, recombination among msg genes appears to be an important mechanism for generating msg diversity. Intra-branch recombination occurred more frequently than inter-branch recombination. Restriction fragment length polymorphism analysis demonstrated substantial variation in the repertoire of the msg gene family among isolates of human Pneumocystis, which was not observed in laboratory isolates of rat or mouse Pneumocystis; this may be the result of examining outbred vs. captive populations. Increased diversity in the Msg repertoire, generated in part by recombination, increases the potential for antigenic variation in this abundant surface protein. PMID:18627244

  9. Propagation of genetic variation in gene regulatory networks.

    Science.gov (United States)

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W

    2013-08-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing how genetic variation in a locus is propagated through the network, and show how their derivatives are related to the network's feedback structure. Similarly, feedback functions describe the effect of genotypic variation of a locus on itself, either directly or mediated by the network. A simple sign rule relates the sign of the derivative of the feedback function of any locus to the feedback loops involving that particular locus. We show that the sign of the phenotypically manifested interaction between alleles at a diploid locus is equal to the sign of the dominant feedback loop involving that particular locus, in accordance with recent results for a single locus system. Our results provide tools by which one can use observable equilibrium concentrations of gene products to disclose structural properties of the network architecture. Our work is a step towards a theory capable of explaining the pleiotropy and epistasis features of genetic variation in complex regulatory networks as functions of regulatory anatomy and functional location of the genetic variation.

  10. Global spectrum of copy number variations reveals genome organizational plasticity and proposes new migration routes.

    Science.gov (United States)

    Veerappa, Avinash M; Vishweswaraiah, Sangeetha; Lingaiah, Kusuma; Murthy, Megha; Suresh, Raviraj V; Manjegowda, Dinesh S; Ramachandra, Nallur B

    2015-01-01

    Global spectrum of CNVs is required to catalog variations to provide a high-resolution on the dynamics of genome-organization and human migration. In this study, we performed genome-wide genotyping using high-resolution arrays and identified 44,109 CNVs from 1,715 genomes across 12 populations. The study unraveled the force of independent evolutionary dynamics on genome-organizational plasticity across populations. We demonstrated the use of CNV tool to study human migration and identified a second major settlement establishing new migration routes in addition to existing ones.

  11. Exploiting natural variation to identify insect-resistance genes.

    Science.gov (United States)

    Broekgaarden, Colette; Snoeren, Tjeerd A L; Dicke, Marcel; Vosman, Ben

    2011-10-01

    Herbivorous insects are widespread and often serious constraints to crop production. The use of insect-resistant crops is a very effective way to control insect pests in agriculture, and the development of such crops can be greatly enhanced by knowledge on plant resistance mechanisms and the genes involved. Plants have evolved diverse ways to cope with insect attack that has resulted in natural variation for resistance towards herbivorous insects. Studying the molecular genetics and transcriptional background of this variation has facilitated the identification of resistance genes and processes that lead to resistance against insects. With the development of new technologies, molecular studies are not restricted to model plants anymore. This review addresses the need to exploit natural variation in resistance towards insects to increase our knowledge on resistance mechanisms and the genes involved. We will discuss how this knowledge can be exploited in breeding programmes to provide sustainable crop protection against insect pests. Additionally, we discuss the current status of genetic research on insect-resistance genes. We conclude that insect-resistance mechanisms are still unclear at the molecular level and that exploiting natural variation with novel technologies will contribute greatly to the development of insect-resistant crop varieties.

  12. Serotonin and Early Cognitive Development: Variation in the Tryptophan Hydroxylase 2 Gene Is Associated with Visual Attention in 7-Month-Old Infants

    Science.gov (United States)

    Leppanen, Jukka M.; Peltola, Mikko J.; Puura, Kaija; Mantymaa, Mirjami; Mononen, Nina; Lehtimaki, Terho

    2011-01-01

    Background: Allelic variation in the promoter region of a gene that encodes tryptophan hydroxylase isoform 2 (TPH2), a rate-limiting enzyme of serotonin synthesis in the central nervous system, has been associated with variations in cognitive function and vulnerability to affective spectrum disorders. Little is known about the effects of this gene…

  13. Copy number variations exploration of multiple genes in Graves' disease.

    Science.gov (United States)

    Song, Rong-Hua; Shao, Xiao-Qing; Li, Ling; Wang, Wen; Zhang, Jin-An

    2017-01-01

    Few previous published papers reported copy number variations of genes could affect the predisposition of Graves' disease (GD). Herein, the aim of this study was to explore the association between copy number variations (CNV) profile and GD. The preliminary copy number microarray used to screen copy number variant genes was performed in 6 GD patients. Five CNV candidate genes (CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17) were then validated in an independent set of samples (50 GD patients and 50 matched healthy ones) by the Accucopy assay method. The CNV of the other 2 genes TRY6 and CCL3L1 was investigated in 144 GD patients and 144 healthy volunteers by the definitive genotyping technique using the Taqman quantitative polymerase-chain-reaction (Taqman qPCR). TRY6 gene-associated single nucleotide polymorphism (SNP), rs13230029, was genotyped by the PCR-ligase detection reaction (LDR) in 675 GD patients and 898 healthy controls. There were no correlation of the gene copy number (GCN) of CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17 with GD. In comparison with that of controls, the GCN distribution of TRY6 and CCL3L1 in GD patients did not show significantly differ (P > 0.05). Furthermore, TRY6-related polymorphism (rs13230029) showed no difference between GD patients and controls. No correlation was found between CNV or SNP genotype and clinical phenotypes. Generally, there were no link of the copy numbers of several genes, including CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1 to GD. Our results clearly indicated that the copy number variations of multiple genes, namely CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1, were not associated with the development of GD.

  14. Convergence of Genes and Cellular Pathways Dysregulated in Autism Spectrum Disorders

    Science.gov (United States)

    Pinto, Dalila; Delaby, Elsa; Merico, Daniele; Barbosa, Mafalda; Merikangas, Alison; Klei, Lambertus; Thiruvahindrapuram, Bhooma; Xu, Xiao; Ziman, Robert; Wang, Zhuozhi; Vorstman, Jacob A.S.; Thompson, Ann; Regan, Regina; Pilorge, Marion; Pellecchia, Giovanna; Pagnamenta, Alistair T.; Oliveira, Bárbara; Marshall, Christian R.; Magalhaes, Tiago R.; Lowe, Jennifer K.; Howe, Jennifer L.; Griswold, Anthony J.; Gilbert, John; Duketis, Eftichia; Dombroski, Beth A.; De Jonge, Maretha V.; Cuccaro, Michael; Crawford, Emily L.; Correia, Catarina T.; Conroy, Judith; Conceição, Inês C.; Chiocchetti, Andreas G.; Casey, Jillian P.; Cai, Guiqing; Cabrol, Christelle; Bolshakova, Nadia; Bacchelli, Elena; Anney, Richard; Gallinger, Steven; Cotterchio, Michelle; Casey, Graham; Zwaigenbaum, Lonnie; Wittemeyer, Kerstin; Wing, Kirsty; Wallace, Simon; van Engeland, Herman; Tryfon, Ana; Thomson, Susanne; Soorya, Latha; Rogé, Bernadette; Roberts, Wendy; Poustka, Fritz; Mouga, Susana; Minshew, Nancy; McInnes, L. Alison; McGrew, Susan G.; Lord, Catherine; Leboyer, Marion; Le Couteur, Ann S.; Kolevzon, Alexander; Jiménez González, Patricia; Jacob, Suma; Holt, Richard; Guter, Stephen; Green, Jonathan; Green, Andrew; Gillberg, Christopher; Fernandez, Bridget A.; Duque, Frederico; Delorme, Richard; Dawson, Geraldine; Chaste, Pauline; Café, Cátia; Brennan, Sean; Bourgeron, Thomas; Bolton, Patrick F.; Bölte, Sven; Bernier, Raphael; Baird, Gillian; Bailey, Anthony J.; Anagnostou, Evdokia; Almeida, Joana; Wijsman, Ellen M.; Vieland, Veronica J.; Vicente, Astrid M.; Schellenberg, Gerard D.; Pericak-Vance, Margaret; Paterson, Andrew D.; Parr, Jeremy R.; Oliveira, Guiomar; Nurnberger, John I.; Monaco, Anthony P.; Maestrini, Elena; Klauck, Sabine M.; Hakonarson, Hakon; Haines, Jonathan L.; Geschwind, Daniel H.; Freitag, Christine M.; Folstein, Susan E.; Ennis, Sean; Coon, Hilary; Battaglia, Agatino; Szatmari, Peter; Sutcliffe, James S.; Hallmayer, Joachim; Gill, Michael; Cook, Edwin H.; Buxbaum, Joseph D.; Devlin, Bernie; Gallagher, Louise; Betancur, Catalina; Scherer, Stephen W.

    2014-01-01

    Rare copy-number variation (CNV) is an important source of risk for autism spectrum disorders (ASDs). We analyzed 2,446 ASD-affected families and confirmed an excess of genic deletions and duplications in affected versus control groups (1.41-fold, p = 1.0 × 10−5) and an increase in affected subjects carrying exonic pathogenic CNVs overlapping known loci associated with dominant or X-linked ASD and intellectual disability (odds ratio = 12.62, p = 2.7 × 10−15, ∼3% of ASD subjects). Pathogenic CNVs, often showing variable expressivity, included rare de novo and inherited events at 36 loci, implicating ASD-associated genes (CHD2, HDAC4, and GDI1) previously linked to other neurodevelopmental disorders, as well as other genes such as SETD5, MIR137, and HDAC9. Consistent with hypothesized gender-specific modulators, females with ASD were more likely to have highly penetrant CNVs (p = 0.017) and were also overrepresented among subjects with fragile X syndrome protein targets (p = 0.02). Genes affected by de novo CNVs and/or loss-of-function single-nucleotide variants converged on networks related to neuronal signaling and development, synapse function, and chromatin regulation. PMID:24768552

  15. Convergence of genes and cellular pathways dysregulated in autism spectrum disorders.

    Science.gov (United States)

    Pinto, Dalila; Delaby, Elsa; Merico, Daniele; Barbosa, Mafalda; Merikangas, Alison; Klei, Lambertus; Thiruvahindrapuram, Bhooma; Xu, Xiao; Ziman, Robert; Wang, Zhuozhi; Vorstman, Jacob A S; Thompson, Ann; Regan, Regina; Pilorge, Marion; Pellecchia, Giovanna; Pagnamenta, Alistair T; Oliveira, Bárbara; Marshall, Christian R; Magalhaes, Tiago R; Lowe, Jennifer K; Howe, Jennifer L; Griswold, Anthony J; Gilbert, John; Duketis, Eftichia; Dombroski, Beth A; De Jonge, Maretha V; Cuccaro, Michael; Crawford, Emily L; Correia, Catarina T; Conroy, Judith; Conceição, Inês C; Chiocchetti, Andreas G; Casey, Jillian P; Cai, Guiqing; Cabrol, Christelle; Bolshakova, Nadia; Bacchelli, Elena; Anney, Richard; Gallinger, Steven; Cotterchio, Michelle; Casey, Graham; Zwaigenbaum, Lonnie; Wittemeyer, Kerstin; Wing, Kirsty; Wallace, Simon; van Engeland, Herman; Tryfon, Ana; Thomson, Susanne; Soorya, Latha; Rogé, Bernadette; Roberts, Wendy; Poustka, Fritz; Mouga, Susana; Minshew, Nancy; McInnes, L Alison; McGrew, Susan G; Lord, Catherine; Leboyer, Marion; Le Couteur, Ann S; Kolevzon, Alexander; Jiménez González, Patricia; Jacob, Suma; Holt, Richard; Guter, Stephen; Green, Jonathan; Green, Andrew; Gillberg, Christopher; Fernandez, Bridget A; Duque, Frederico; Delorme, Richard; Dawson, Geraldine; Chaste, Pauline; Café, Cátia; Brennan, Sean; Bourgeron, Thomas; Bolton, Patrick F; Bölte, Sven; Bernier, Raphael; Baird, Gillian; Bailey, Anthony J; Anagnostou, Evdokia; Almeida, Joana; Wijsman, Ellen M; Vieland, Veronica J; Vicente, Astrid M; Schellenberg, Gerard D; Pericak-Vance, Margaret; Paterson, Andrew D; Parr, Jeremy R; Oliveira, Guiomar; Nurnberger, John I; Monaco, Anthony P; Maestrini, Elena; Klauck, Sabine M; Hakonarson, Hakon; Haines, Jonathan L; Geschwind, Daniel H; Freitag, Christine M; Folstein, Susan E; Ennis, Sean; Coon, Hilary; Battaglia, Agatino; Szatmari, Peter; Sutcliffe, James S; Hallmayer, Joachim; Gill, Michael; Cook, Edwin H; Buxbaum, Joseph D; Devlin, Bernie; Gallagher, Louise; Betancur, Catalina; Scherer, Stephen W

    2014-05-01

    Rare copy-number variation (CNV) is an important source of risk for autism spectrum disorders (ASDs). We analyzed 2,446 ASD-affected families and confirmed an excess of genic deletions and duplications in affected versus control groups (1.41-fold, p = 1.0 × 10(-5)) and an increase in affected subjects carrying exonic pathogenic CNVs overlapping known loci associated with dominant or X-linked ASD and intellectual disability (odds ratio = 12.62, p = 2.7 × 10(-15), ∼3% of ASD subjects). Pathogenic CNVs, often showing variable expressivity, included rare de novo and inherited events at 36 loci, implicating ASD-associated genes (CHD2, HDAC4, and GDI1) previously linked to other neurodevelopmental disorders, as well as other genes such as SETD5, MIR137, and HDAC9. Consistent with hypothesized gender-specific modulators, females with ASD were more likely to have highly penetrant CNVs (p = 0.017) and were also overrepresented among subjects with fragile X syndrome protein targets (p = 0.02). Genes affected by de novo CNVs and/or loss-of-function single-nucleotide variants converged on networks related to neuronal signaling and development, synapse function, and chromatin regulation.

  16. Association of Copy Number Variations in Autism Spectrum Disorders: A Systematic Review

    Directory of Open Access Journals (Sweden)

    Elif Funda Sener

    2014-01-01

    Full Text Available Autism spectrum disorders (ASDs are characterized by language impairments, social deficits, and repetitive behaviors. The onset of symptoms occurs by the age of 3 and shows a lifelong persistence. Genetics plays a major role in the etiology of ASD. Except genetics, several potential risk factors (environmental factors and epigenetics may contribute to ASD. Copy number variations (CNVs are the most widespread structural variations in the human genome. These variations can alter the genome structure either by deletion or by duplication. CNVs can be de novo or inherited. Chromosomal rearrangements have been detected in 5–10% of the patients with ASD and recently copy number changes ranging from a few kilobases (kb to several megabases (Mb in size have been reported. Recent data have also revealed that submicroscopic CNVs can have a role in ASD, and de novo CNVs seem to be a more common risk factor in sporadic compared with inherited forms of ASD. CNVs are being implicated as a contributor to the pathophysiology of complex neurodevelopmental disorders and they can affect a wide range of human phenotypes including mental retardation (MR, autism, neuropsychiatric disorders, and susceptibility to other complex traits such as HIV, Crohn’s disease, and psoriasis. This review emphasizes the major CNVs reported to date in ASD.

  17. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  18. Variation in the RAD51 gene and familial breast cancer

    Science.gov (United States)

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  19. Genetic risk for autism spectrum disorders and neuropsychiatric variation in the general population

    DEFF Research Database (Denmark)

    Robinson, Elise B; St Pourcain, Beate; Anttila, Verneri

    2016-01-01

    Almost all genetic risk factors for autism spectrum disorders (ASDs) can be found in the general population, but the effects of this risk are unclear in people not ascertained for neuropsychiatric symptoms. Using several large ASD consortium and population-based resources (total n > 38,000), we...... find genome-wide genetic links between ASDs and typical variation in social behavior and adaptive functioning. This finding is evidenced through both LD score correlation and de novo variant analysis, indicating that multiple types of genetic risk for ASDs influence a continuum of behavioral...... and developmental traits, the severe tail of which can result in diagnosis with an ASD or other neuropsychiatric disorder. A continuum model should inform the design and interpretation of studies of neuropsychiatric disease biology....

  20. Population-based study of genetic variation in individuals with autism spectrum disorders from Croatia

    Directory of Open Access Journals (Sweden)

    Gidaya Nicole

    2010-09-01

    Full Text Available Abstract Background Genome-wide studies on autism spectrum disorders (ASDs have mostly focused on large-scale population samples, but examination of rare variations in isolated populations may provide additional insights into the disease pathogenesis. Methods As a first step in the genetic analysis of ASD in Croatia, we characterized genetic variation in a sample of 103 subjects with ASD and 203 control individuals, who were genotyped using the Illumina HumanHap550 BeadChip. We analyzed the genetic diversity of the Croatian population and its relationship to other populations, the degree of relatedness via Runs of Homozygosity (ROHs, and the distribution of large (>500 Kb copy number variations. Results Combining the Croatian cohort with several previously published populations in the FastME analysis (an alternative to Neighbor Joining revealed that Croatian subjects cluster, as expected, with Southern Europeans; in addition, individuals from the same geographic region within Europe cluster together. Whereas Croatian subjects could be separated from a sample of healthy control subjects of European origin from North America, Croatian ASD cases and controls are well mixed. A comparison of runs of homozygosity indicated that the number and the median length of regions of homozygosity are higher for ASD subjects than for controls (p = 6 × 10-3. Furthermore, analysis of copy number variants found a higher frequency of large chromosomal rearrangements (>2 Mb in ASD cases (5/103 than in ethnically matched control subjects (1/197, p = 0.019. Conclusions Our findings illustrate the remarkable utility of high-density genotype data for subjects from a limited geographic area in dissecting genetic heterogeneity with respect to population and disease related variation.

  1. Ultraviolet and Optical Line Profile Variations in the Spectrum of ɛ Persei

    Science.gov (United States)

    Gies, D. R.; Kambe, E.; Josephs, T. S.; Bagnuolo, W. G., Jr.; Choi, Y. J.; Gudehus, D.; Guyton, K. M.; Hartkopf, W. I.; Hildebrand, J. L.; Kaye, A. B.; Mason, B. D.; Riddle, R. L.; Sowers, J. W.; Turner, N. H.; Wilson, J. W.; Xiong, Y.

    1999-11-01

    The rapid variable star, ɛ Per (B0.5 IV-III), displays the largest amplitude profile fluctuations known among the growing number of massive, spectrum-variable stars. Here we present an analysis of a continuous 5 day run of IUE UV spectroscopy, and we show for the first time that the systematic, blue-to-red moving patterns observed in high-quality optical spectra are also present in the UV photospheric lines. We present cross-correlation functions of the individual spectra with that of a narrow-lined standard that produce a high signal-to-noise ratio representation of the blue-to-red moving bump patterns found in individual lines. We then use time series analysis methods to determine the periodic components of the profile variations (after reregistering the spectra to correct for binary motion). There are at least six periods present (ranging from 8.46 to 2.27 hr), and most of these signals are also found in optical line variations observed in 1986 (although the relative amplitudes have changed significantly). Furthermore, analysis of a shorter time series of IUE spectra from 1984 shows that similar periods were present then. We also present Hα and He I λ6678 profiles obtained with the Georgia State University Multi-Telescope Telescope, which were made simultaneously with IUE, and we show that the profile variations are essentially identical in the UV and optical ranges. We rule out rotational modulation and circumstellar gas obscuration as possible causes, and we suggest instead that the variations are the result of photospheric nonradial pulsations of relatively low degree (l=3-5). There were significant changes (~10%) in the equivalent widths of the UV stellar wind lines during the IUE run, and we suggest that wind strengthening events are related to episodes of large-amplitude, constructive interference between the NRP modes. Thus, intermode beating may play an important role in promoting wind loss from massive stars.

  2. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Science.gov (United States)

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution.

  3. Genomic and gene variation in Mycoplasma hominis strains

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Andersen, H; Birkelund, Svend

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed...... no identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns....... These hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  4. Hypertension and genetic variation in endothelial-specific genes.

    Directory of Open Access Journals (Sweden)

    Erik Larsson

    Full Text Available Genome-wide association (GWA studies usually detect common genetic variants with low-to-medium effect sizes. Many contributing variants are not revealed, since they fail to reach significance after strong correction for multiple comparisons. The WTCCC study for hypertension, for example, failed to identify genome-wide significant associations. We hypothesized that genetic variation in genes expressed specifically in the endothelium may be important for hypertension development. Results from the WTCCC study were combined with previously published gene expression data from mice to specifically investigate SNPs located within endothelial-specific genes, bypassing the requirement for genome-wide significance. Six SNPs from the WTCCC study were selected for independent replication in 5205 hypertensive patients and 5320 population-based controls, and successively in a cohort of 16,537 individuals. A common variant (rs10860812 in the DRAM (damage-regulated autophagy modulator locus showed association with hypertension (P = 0.008 in the replication study. The minor allele (A had a protective effect (OR = 0.93; 95% CI 0.88-0.98 per A-allele, which replicates the association in the WTCCC GWA study. However, a second follow-up, in the larger cohort, failed to reveal an association with blood pressure. We further tested the endothelial-specific genes for co-localization with a panel of newly discovered SNPs from large meta-GWAS on hypertension or blood pressure. There was no significant overlap between those genes and hypertension or blood pressure loci. The result does not support the hypothesis that genetic variation in genes expressed in endothelium plays an important role for hypertension development. Moreover, the discordant association of rs10860812 with blood pressure in the case control study versus the larger Malmö Preventive Project-study highlights the importance of rigorous replication in multiple large independent studies.

  5. The spectrum of major seed storage genes and proteins in oats (Avena sativa).

    Science.gov (United States)

    Anderson, Olin D

    2014-01-01

    The oat seed storage proteins are mainly composed of two classes: the globulins and avenins. Among the major cereals, the globulins are the major seed protein class in rice and oats, and along with the higher protein content of oats is the basis for the relative higher nutrition content in oats compared to the other cereals. The second major class of oat seed proteins is the avenins; also classified as prolamins - seed proteins high in proline and glutamine amino acids. The prolamins are associated with celiac disease, an autoimmune disorder of the gastrointestinal tract. In spite of their importance, neither the oat globulins nor the avenins have been completely analyzed and described for any single germplasm. Using available EST resources for a single hexaploid oat cultivar, the spectrum of avenin and globulin sequences are described for the gene coding regions and the derived protein sequences. The nine unique avenin sequences are suggested to be divided into 3-4 distinct subclasses distributed in the hexaploid genome. The globulins from the same germplasm include 24 distinct sequences. Variation in globulin size results mainly from a glutamine-rich domain, similar to as in the avenins, and to variation in the C-terminal sequence domain. Two globulin genes have premature stop codons that shorten the resulting polypeptides by 9 and 17 amino acids, and eight of the globulin sequences form a branch of the globulins not previously reported. A more complete description of the major oat seed proteins should allow a more thorough analysis of their contributions to those oat seed characteristics related to nutritional value, evolutionary history, and celiac disease association.

  6. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  7. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  8. Diurnal variation of hepatic antioxidant gene expression in mice.

    Directory of Open Access Journals (Sweden)

    Yi-Qiao Xu

    Full Text Available BACKGROUND: This study was aimed to examine circadian variations of hepatic antioxidant components, including the Nrf2- pathway, the glutathione (GSH system, antioxidant enzymes and metallothionein in mouse liver. METHODS AND RESULTS: Adult mice were housed in light- and temperature-controlled facilities for 2 weeks, and livers were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis. Hepatic mRNA levels of Nrf2, Keap1, Nqo1 and Gclc were higher in the light-phase than the dark-phase, and were female-predominant. Hepatic GSH presented marked circadian fluctuations, along with glutathione S-transferases (GST-α1, GST-µ, GST-π and glutathione peroxidase (GPx1. The expressions of GPx1, GST-µ and GST-π mRNA were also higher in females. Antioxidant enzymes Cu/Zn superoxide dismutase (Sod1, catalase (CAT, cyclooxygenase-2 (Cox-2 and heme oxygenase-1 (Ho-1 showed circadian rhythms, with higher expressions of Cox-2 and CAT in females. Metallothionein, a small non-enzymatic antioxidant protein, showed dramatic circadian variation in males, but higher expression in females. The circadian variations of the clock gene Brain and Muscle Arnt-like Protein-1(Bmal1, albumin site D-binding protein (Dbp, nuclear receptor Rev-Erbα (Nr1d1, period protein (Per1 and Per2 and cryptochrome 1(Cry1 were in agreement with the literature. Furthermore, acetaminophen hepatotoxicity is more severe when administered in the afternoon when hepatic GSH was lowest. CONCLUSIONS: Circadian variations and gender differences in transcript levels of antioxidant genes exist in mouse liver, which could affect body responses to oxidative stress at different times of the day.

  9. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome.

    Science.gov (United States)

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal models suggest a role for oxytocin (OXT) and oxytocin receptor (OXTR) genes in social-emotional behaviors, and several studies indicate that the oxytocin/oxytocin receptor system is altered in individuals with ASC. Previous studies have reported associations between genetic variations in the OXTR gene and ASC. The present study tested for an association between nine single nucleotide polymorphisms (SNPs) in the OXTR gene and AS in 530 individuals of Caucasian origin, using SNP association test and haplotype analysis. There was a significant association between rs2268493 in OXTR and AS. Multiple haplotypes that include this SNP (rs2268493-rs2254298, rs2268490-rs2268493-rs2254298, rs2268493-rs2254298-rs53576, rs237885-rs2268490-rs2268493-rs2254298, rs2268490-rs2268493-rs2254298-rs53576) were also associated with AS. rs2268493 has been previously associated with ASC and putatively alters several transcription factor-binding sites and regulates chromatin states, either directly or through other variants in linkage disequilibrium (LD). This study reports a significant association of the sequence variant rs2268493 in the OXTR gene and associated haplotypes with AS.

  10. Ultraviolet and Optical Line Profile Variations in the Spectrum of {epsilon} Persei

    Energy Technology Data Exchange (ETDEWEB)

    Gies, D. R.; Kambe, E.; Josephs, T. S.; Bagnuolo, W. G. Jr.; Choi, Y. J.; Gudehus, D.; Guyton, K. M.; Hartkopf, W. I.; Hildebrand, J. L.; Kaye, A. B. (and others)

    1999-11-01

    The rapid variable star, {epsilon} Per (B0.5 IV-III), displays the largest amplitude profile fluctuations known among the growing number of massive, spectrum-variable stars. Here we present an analysis of a continuous 5 day run of IUE UV spectroscopy, and we show for the first time that the systematic, blue-to-red moving patterns observed in high-quality optical spectra are also present in the UV photospheric lines. We present cross-correlation functions of the individual spectra with that of a narrow-lined standard that produce a high signal-to-noise ratio representation of the blue-to-red moving bump patterns found in individual lines. We then use time series analysis methods to determine the periodic components of the profile variations (after reregistering the spectra to correct for binary motion). There are at least six periods present (ranging from 8.46 to 2.27 hr), and most of these signals are also found in optical line variations observed in 1986 (although the relative amplitudes have changed significantly). Furthermore, analysis of a shorter time series of IUE spectra from 1984 shows that similar periods were present then. We also present H{alpha} and He i {lambda}6678 profiles obtained with the Georgia State University Multi-Telescope Telescope, which were made simultaneously with IUE, and we show that the profile variations are essentially identical in the UV and optical ranges. We rule out rotational modulation and circumstellar gas obscuration as possible causes, and we suggest instead that the variations are the result of photospheric nonradial pulsations of relatively low degree (l=3-5). There were significant changes ({approx}10%) in the equivalent widths of the UV stellar wind lines during the IUE run, and we suggest that wind strengthening events are related to episodes of large-amplitude, constructive interference between the NRP modes. Thus, intermode beating may play an important role in promoting wind loss from massive stars. (c) (c) 1999

  11. Variation within the Huntington's disease gene influences normal brain structure.

    Directory of Open Access Journals (Sweden)

    Mark Mühlau

    Full Text Available Genetics of the variability of normal and diseased brain structure largely remains to be elucidated. Expansions of certain trinucleotide repeats cause neurodegenerative disorders of which Huntington's disease constitutes the most common example. Here, we test the hypothesis that variation within the IT15 gene on chromosome 4, whose expansion causes Huntington's disease, influences normal human brain structure. In 278 normal subjects, we determined CAG repeat length within the IT15 gene on chromosome 4 and analyzed high-resolution T1-weighted magnetic resonance images by the use of voxel-based morphometry. We found an increase of GM with increasing long CAG repeat and its interaction with age within the pallidum, which is involved in Huntington's disease. Our study demonstrates that a certain trinucleotide repeat influences normal brain structure in humans. This result may have important implications for the understanding of both the healthy and diseased brain.

  12. GeneAnalytics Pathway Analysis and Genetic Overlap among Autism Spectrum Disorder, Bipolar Disorder and Schizophrenia

    Directory of Open Access Journals (Sweden)

    Naveen S. Khanzada

    2017-02-01

    Full Text Available Bipolar disorder (BPD and schizophrenia (SCH show similar neuropsychiatric behavioral disturbances, including impaired social interaction and communication, seen in autism spectrum disorder (ASD with multiple overlapping genetic and environmental influences implicated in risk and course of illness. GeneAnalytics software was used for pathway analysis and genetic profiling to characterize common susceptibility genes obtained from published lists for ASD (792 genes, BPD (290 genes and SCH (560 genes. Rank scores were derived from the number and nature of overlapping genes, gene-disease association, tissue specificity and gene functions subdivided into categories (e.g., diseases, tissues or functional pathways. Twenty-three genes were common to all three disorders and mapped to nine biological Superpathways including Circadian entrainment (10 genes, score = 37.0, Amphetamine addiction (five genes, score = 24.2, and Sudden infant death syndrome (six genes, score = 24.1. Brain tissues included the medulla oblongata (11 genes, score = 2.1, thalamus (10 genes, score = 2.0 and hypothalamus (nine genes, score = 2.0 with six common genes (BDNF, DRD2, CHRNA7, HTR2A, SLC6A3, and TPH2. Overlapping genes impacted dopamine and serotonin homeostasis and signal transduction pathways, impacting mood, behavior and physical activity level. Converging effects on pathways governing circadian rhythms support a core etiological relationship between neuropsychiatric illnesses and sleep disruption with hypoxia and central brain stem dysfunction.

  13. Variation in Socio-Economic Burden for Caring of Children with Autism Spectrum Disorder in Oman: Caregiver Perspectives

    Science.gov (United States)

    Al-Farsi, Yahya M.; Waly, Mostafa I.; Al-Sharbati, Marwan M.; Al-Shafaee, Mohamed; Al-Farsi, Omar; Al-Fahdi, Samiya; Ouhtit, Allal; Al-Khaduri, Maha; Al-Adawi, Samir

    2013-01-01

    A cross-sectional study was conducted to investigate whether caregiver's variations in socioeconomic status (SES) has direct bearing on challenges of nurturing children with autism spectrum disorder (ASD) in Oman. A cadre of caregivers (n = 150) from two types of SES (low-income and middle-high income) were compared based on four domains: (1)…

  14. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  15. The spectrum of the torus profile to a geometric variational problem with long range interaction

    Science.gov (United States)

    Ren, Xiaofeng; Wei, Juncheng

    2017-08-01

    The profile problem for the Ohta-Kawasaki diblock copolymer theory is a geometric variational problem. The energy functional is defined on sets in R3 of prescribed volume and the energy of an admissible set is its perimeter plus a long range interaction term related to the Newtonian potential of the set. This problem admits a solution, called a torus profile, that is a set enclosed by an approximate torus of the major radius 1 and the minor radius q. The torus profile is both axially symmetric about the z axis and reflexively symmetric about the xy-plane. There is a way to set up the profile problem in a function space as a partial differential-integro equation. The linearized operator L of the problem at the torus profile is decomposed into a family of linear ordinary differential-integro operators Lm where the index m = 0 , 1 , 2 , … is called a mode. The spectrum of L is the union of the spectra of the Lm's. It is proved that for each m, when q is sufficiently small, Lm is positive definite. (0 is an eigenvalue for both L0 and L1, due to the translation and rotation invariance.) As q tends to 0, more and more Lm's become positive definite. However no matter how small q is, there is always a mode m of which Lm has a negative eigenvalue. This mode grows to infinity like q - 3 / 4 as q → 0.

  16. AGTR1 gene variation: association with depression and frontotemporal morphology.

    Science.gov (United States)

    Taylor, Warren D; Benjamin, Sophiya; McQuoid, Douglas R; Payne, Martha E; Krishnan, Ranga R; MacFall, James R; Ashley-Koch, Allison

    2012-05-31

    The renin-angiotensin system (RAS) is implicated in the response to physiological and psychosocial stressors, but its role in stress-related psychiatric disorders is poorly understood. We examined if variation in AGTR1, the gene coding for the type 1 angiotensin II receptor (AT(1)R), is associated with a diagnosis of depression and differences in white matter hyperintensities and frontotemporal brain volumes. Participants comprised 257 depressed and 116 nondepressed elderly Caucasian subjects who completed clinical assessments and provided blood samples for genotyping. We used a haplotype-tagging single nucleotide polymorphism (htSNP) analysis to test for variation in AGTR1. For measurement of hyperintense lesions, 1.5 Tesla magnetic resonance imaging (MRI) data were available on 33 subjects. For measurements of the hippocampus and dorsolateral prefrontal cortex (dlPFC), 3 Tesla MRI data were available on 70 subjects. Two htSNPs exhibited statistically significant frequency differences between diagnostic cohorts: rs10935724 and rs12721331. Although hyperintense lesion volume did not significantly differ by any htSNP, dlPFC and hippocampus volume differed significantly for several htSNPs. Intriguingly, for those htSNPs differing significantly for both dlPFC and hippocampus volume, the variant associated with smaller dlPFC volume was associated with larger hippocampal volume. This supports the idea that genetic variation in AGTR1 is associated with depression and differences in frontotemporal morphology. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Science.gov (United States)

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder.

  18. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Onouchi

    Full Text Available Kawasaki disease (KD; MIM#61175 is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+ release activated Ca(2+ (CRAC channel mediating store-operated Ca(2+ entry (SOCE on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596 was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls, P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method. Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012. These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+/NFAT pathway in the pathogenesis of this disorder.

  19. Variations in ORAI1 Gene Associated with Kawasaki Disease

    Science.gov (United States)

    Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca2+ release activated Ca2+ (CRAC) channel mediating store-operated Ca2+ entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca2+/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  20. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  1. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  2. High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Merlin G. Butler

    2015-03-01

    Full Text Available Recently, autism-related research has focused on the identification of various genes and disturbed pathways causing the genetically heterogeneous group of autism spectrum disorders (ASD. The list of autism-related genes has significantly increased due to better awareness with advances in genetic technology and expanding searchable genomic databases. We compiled a master list of known and clinically relevant autism spectrum disorder genes identified with supporting evidence from peer-reviewed medical literature sources by searching key words related to autism and genetics and from authoritative autism-related public access websites, such as the Simons Foundation Autism Research Institute autism genomic database dedicated to gene discovery and characterization. Our list consists of 792 genes arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms, thereby enabling clinical and laboratory geneticists and genetic counsellors to access convenient visual images of the location and distribution of ASD genes. Meaningful correlations of the observed phenotype in patients with suspected/confirmed ASD gene(s at the chromosome region or breakpoint band site can be made to inform diagnosis and gene-based personalized care and provide genetic counselling for families.

  3. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Directory of Open Access Journals (Sweden)

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  4. Genetic Variation in Melatonin Pathway Enzymes in Children with Autism Spectrum Disorder and Comorbid Sleep Onset Delay

    Science.gov (United States)

    Veatch, Olivia J.; Pendergast, Julie S.; Allen, Melissa J.; Leu, Roberta M.; Johnson, Carl Hirschie; Elsea, Sarah H.; Malow, Beth A.

    2015-01-01

    Sleep disruption is common in individuals with autism spectrum disorder (ASD). Genes whose products regulate endogenous melatonin modify sleep patterns and have been implicated in ASD. Genetic factors likely contribute to comorbid expression of sleep disorders in ASD. We studied a clinically unique ASD subgroup, consisting solely of children with…

  5. Variation in the Ace Gene in Elite Polish Football Players

    Directory of Open Access Journals (Sweden)

    Cięszczyk Paweł

    2016-12-01

    Full Text Available Purpose. A common polymorphism in the angiotensin converting enzyme I gene (the ACE I/D variant represents one of the first characterized and the most widely studied genetic variants in the context of elite athletes status and performance related traits. The aim of the study was to determine the genotype and allele distribution of the allele and genotype of the ACE gene in Polish male football players. Methods. The total of 106 Polish male professional football players were recruited. They were divided into groups according to the position in the field: forwards, defenders, midfielders, and goalkeepers. For controls, samples were prepared with 115 unrelated volunteers. DNA was extracted from the buccal cells donated by the subjects, and the PCR amplification of the polymorphic region of the ACE gene containing either the insertion (I or deletion (D fragment was performed. Results. The genotype distribution and allele frequencies among all football players did not differ significantly when compared with sedentary control individuals (p = 0.887, p = 0.999, respectively. Likewise, the analysis of forwards, defenders, midfielders, and goalkeepers revealed no significant differences in either ACE genotype or allele frequencies. Conclusions. We did not provide evidence for difference of variation of the ACE I/D polymorphism between Polish football players and controls, as we did not obtain any statistically significantly higher frequency of either of the analysed alleles (I and D or genotypes (DD, ID, and II in the studied subgroups. It may be suspected that harbouring of I/D allelic variants of the ACE gene neither decreases nor increases the probability of being a professional football player in Poland.

  6. Caenorhabditis elegans Genes Affecting Interindividual Variation in Life-span Biomarker Gene Expression.

    Science.gov (United States)

    Mendenhall, Alexander; Crane, Matthew M; Tedesco, Patricia M; Johnson, Thomas E; Brent, Roger

    2017-10-01

    Genetically identical organisms grown in homogenous environments differ in quantitative phenotypes. Differences in one such trait, expression of a single biomarker gene, can identify isogenic cells or organisms that later manifest different fates. For example, in isogenic populations of young adult Caenorhabditis elegans, differences in Green Fluorescent Protein (GFP) expressed from the hsp-16.2 promoter predict differences in life span. Thus, it is of interest to determine how interindividual differences in biomarker gene expression arise. Prior reports showed that the thermosensory neurons and insulin signaling systems controlled the magnitude of the heat shock response, including absolute expression of hsp-16.2. Here, we tested whether these regulatory signals might also influence variation in hsp-16.2 reporter expression. Genetic experiments showed that the action of AFD thermosensory neurons increases interindividual variation in biomarker expression. Further genetic experimentation showed the insulin signaling system acts to decrease interindividual variation in life-span biomarker expression; in other words, insulin signaling canalizes expression of the hsp-16.2-driven life-span biomarker. Our results show that specific signaling systems regulate not only expression level, but also the amount of interindividual expression variation for a life-span biomarker gene. They raise the possibility that manipulation of these systems might offer means to reduce heterogeneity in the aging process. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Genes controlling mimetic colour pattern variation in butterflies.

    Science.gov (United States)

    Nadeau, Nicola J

    2016-10-01

    Butterfly wing patterns are made up of arrays of coloured scales. There are two genera in which within-species variation in wing patterning is common and has been investigated at the molecular level, Heliconius and Papilio. Both of these species have mimetic relationships with other butterfly species that increase their protection from predators. Heliconius have a 'tool-kit' of five genetic loci that control colour pattern, three of which have been identified at the gene level, and which have been repeatedly used to modify colour pattern by different species in the genus. By contrast, the three Papilio species that have been investigated each have different genetic mechanisms controlling their polymorphic wing patterns.

  8. Complete genome sequences of Incl1 Plasmids carrying extended-spectrum B-Lactamase genes

    NARCIS (Netherlands)

    Brouwer, M.S.M.; Bossers, A.; Harders, F.; Essen-Zandbergen, van A.; Mevius, D.J.; Smith, H.E.

    2014-01-01

    Extended spectrum beta-lactamases (ESBLs) confer resistance to clinically relevant antibiotics. Often, the resistance genes are carried by conjugative plasmids which are responsible for dissemination. Five IncI1 plasmids carrying ESBLs from commensal and clinical Escherichia coli isolates were compl

  9. Dysferlin Gene Mutation Spectrum in a Large Cohort of Chinese Patients with Dysferlinopathy

    Directory of Open Access Journals (Sweden)

    Su-Qin Jin

    2016-01-01

    Conclusions: DYSF mutations in Chinese patients clustered in the N-terminal region of the gene. Exonic rearrangements were found in 23% of patients with only one pathogenic mutation identified by Sanger sequencing or NGS. The novel mutations found in this study greatly expanded the mutational spectrum of dysferlinopathy.

  10. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  11. Quantitative gene-gene and gene-environment mapping for leaf shape variation using tree-based models

    Science.gov (United States)

    Leaf shape traits have long been a focus of many disciplines, but searching for complex genetic and environmental interactive mechanisms regulating leaf shape variation has not yet been well developed. The question of the respective roles of gene and environment and how they interplay to modulate l...

  12. Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Megan C. McDonald

    2016-04-01

    Full Text Available Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene.

  13. Association of oxytocin receptor (OXTR) gene variants with multiple phenotype domains of autism spectrum disorder.

    Science.gov (United States)

    Campbell, Daniel B; Datta, Dibyadeep; Jones, Shaine T; Batey Lee, Evon; Sutcliffe, James S; Hammock, Elizabeth A D; Levitt, Pat

    2011-06-01

    Autism spectrum disorder (ASD) is characterized by core deficits in social behavior, communication, and behavioral flexibility. Several lines of evidence indicate that oxytocin, signaling through its receptor (OXTR), is important in a wide range of social behaviors. In attempts to determine whether genetic variations in the oxytocin signaling system contribute to ASD susceptibility, seven recent reports indicated association of common genetic polymorphisms in the OXTR gene with ASD. Each involved relatively small sample sizes (57 to 436 families) and, where it was examined, failed to identify association of OXTR polymorphisms with measures of social behavior in individuals with ASD. We report genetic association analysis of 25 markers spanning the OXTR locus in 1,238 pedigrees including 2,333 individuals with ASD. Association of three markers previously implicated in ASD susceptibility, rs2268493 (P = 0.043), rs1042778 (P = 0.037), and rs7632287 (P = 0.016), was observed. Further, these genetic markers were associated with multiple core ASD phenotypes, including social domain dysfunction, measured by standardized instruments used to diagnose and describe ASD. The data suggest association of OXTR genetic polymorphisms with ASD, although the results should be interpreted with caution because none of the significant associations would survive appropriate correction for multiple comparisons. However, the current findings of association in a large independent cohort are consistent with previous results, and the biological plausibility of participation of the oxytocin signaling system in modulating social disruptions characteristic of ASD, suggest that functional polymorphisms of OXTR may contribute to ASD risk in a subset of families.

  14. Copy number variations in alternative splicing gene networks impact lifespan.

    Directory of Open Access Journals (Sweden)

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  15. Evolution of variation in presence and absence of genes in bacterial pathways

    Directory of Open Access Journals (Sweden)

    Francis Andrew R

    2012-04-01

    Full Text Available Abstract Background Bacterial genomes exhibit a remarkable degree of variation in the presence and absence of genes, which probably extends to the level of individual pathways. This variation may be a consequence of the significant evolutionary role played by horizontal gene transfer, but might also be explained by the loss of genes through mutation. A challenge is to understand why there would be variation in gene presence within pathways if they confer a benefit only when complete. Results Here, we develop a mathematical model to study how variation in pathway content is produced by horizontal transfer, gene loss and partial exposure of a population to a novel environment. Conclusions We discuss the possibility that variation in gene presence acts as cryptic genetic variation on which selection acts when the appropriate environment occurs. We find that a high level of variation in gene presence can be readily explained by decay of the pathway through mutation when there is no longer exposure to the selective environment, or when selection becomes too weak to maintain the genes. In the context of pathway variation the role of horizontal gene transfer is probably the initial introduction of a complete novel pathway rather than in building up the variation in a genome without the pathway.

  16. Spectrum of mutations in sarcoglycan genes in the Mumbai region of western India: High prevalence of 525del T

    Directory of Open Access Journals (Sweden)

    Khadilkar Satish

    2009-01-01

    Full Text Available Background : While the clinical and immunocytochemical features of sarcoglycanopathies have been reported from India, genetic aspects have not been studied. There is large variation in the sarcoglycan mutations among the studied populations. Aim : To study the spectrum of mutations in sarcoglycan genes (SG. Materials and Methods : Patients fulfilling Bushby′s criteria for limb girdle muscular dystrophy were prospectively analyzed. Patients gave their medical history and underwent a clinical examination, serum creatine kinase estimation, electrophysiology, muscle biopsy with immunostaining for alpha, beta, gamma, and delta subunits and mutational analysis using denaturing high pressure liquid chromatography and direct sequencing. Results : Mutations in SG accounted for 26.4% of the cohort of limb girdle muscular dystrophy. The mean age of these 18 patients was 22.5 years. Generally, proximal weakness affected the flexor and adductor compartments of the lower and upper limbs. The clinical profile of various mutations was indistinguishable from each other. Gamma SG mutations were most common, seen in 8 patients, followed by delta SG mutation in 5 patients and alpha mutation in 4 patients, while only 1 patient had mutation in the beta sarcoglycan gene. The most prevalent mutation in the gamma SG gene was 525del T. This is of interest as the mutation has been known to exist only in specific populations. Conclusion : This study, the first mutational analysis of Indian patients with sarcoglycanopathies suggests gamma SG mutations were the most common and the most prevalent mutation in the gamma SG gene was 525del T.

  17. Time variation in the low frequency spectrum of Vela-like pulsar B1800-21

    CERN Document Server

    Basu, Rahul; Lewandowski, Wojciech; Kijak, Jarosław; Dembska, Marta

    2016-01-01

    We report the flux measurement of the Vela like pulsar B1800-21 at the low radio frequency regime over multiple epochs spanning several years. The spectrum shows a turnover around the GHz frequency range and represents a typical example of gigahertz-peaked spectrum (GPS) pulsar. Our observations revealed that the pulsar spectrum show a significant evolution during the observing period with the low frequency part of the spectrum becoming steeper, with a higher turnover frequency, for a period of several years before reverting back to the initial shape during the latest measurements. The spectral change over times spanning several years requires dense structures, with free electron densities around 1000--20000 cm$^{-3}$ and physical dimensions ~220 AU, in the interstellar medium (ISM) traversing across the pulsar line of sight. We look into the possible sites of such structures in the ISM and likely mechanisms particularly the thermal free-free absorption as possible explanations for the change.

  18. Serotonergic gene variation: implications for personality traits and psychopathology.

    Science.gov (United States)

    Lesch, K P

    1999-06-01

    Serotonin 5-hydroxytryptamine (5-HT) is an important regulator of morphogenetic activities during early central nervous system development, including cell proliferation, migration, and differentiation as well as synapto-genesis. Serotonergic raphe neurons diffusely project to a variety of brain regions (e.g. cortex, amygdala, hippocampus) and play known roles in integrating emotion, cognition, motor function as well as in food intake, sleep, pain, and sexual activity. The diversity of physiologic functions is due to the fact that 5-HT acts as a master control neurotransmitter within a highly complex system of neural communication mediated by multiple pre- and postsynaptic 5-HT receptors, thus orchestrating the activity and interaction of several other neurotransmitter systems. Since proteins involved in the regulation of central serotonergic activity (e.g. enzymes, receptors, transporter) play pivotal role in brain 5-HT homeostasis, polymorphisms in the regulatory regions of their genes resulting in variation of expression and function are likely to influence complex traits, such as temperament/personality and psychopathology.

  19. Spectrum of NSD1 gene mutations in southern Chinese patients with Sotos syndrome

    Institute of Scientific and Technical Information of China (English)

    Tony M.F. Tong; Edgar W.L. Hau; Ivan F.M. Lo; Daniel H.C. Chan; Stephen T.S. Lam

    2005-01-01

    Background Sotos syndrome is an overgrowth syndrome with characteristic facial gestalt and mental retardation of variable severity. Haploinsufficiency of the NSD1 gene has been implicated as the major cause of Sotos syndrome, with a predominance of microdeletions reported in Japanese patients. This study was conducted to investigate into the spectrum of NSD1 gene mutations in southern Chinese patients with Sotos syndrome. Methods Thirty-six Chinese patients with Sotos syndrome and two patients with Weaver syndrome were subject to molecular testing. Results NSD1 gene mutations were detected in 26 (72%) Sotos patients. Microdeletion was found in only 3 patients, while the other 23 had point mutations (6 frameshift, 8 nonsense, 2 spice site, and 7 missense). Of these, 19 mutations were never reported. NSD1 gene mutations were not found in the two patients with Weaver syndrome. Conclusions Most cases of Sotos syndrome are caused by NSD1 gene defects, but the spectrum of mutations is different from that of Japanese patients. Genotype-phenotype correlation showed that patients with microdeletions might be more prone to congenital heart disease but less likely to have somatic overgrowth. The two patients with Weaver syndrome were not found to have NSD1 gene mutations, but the number was too small for any conclusion to be drawn.

  20. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  1. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  2. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    Science.gov (United States)

    Scott, Cinda P.; Williams, Dean A.; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory environment (G10). The G10 individuals have significantly less genetic variation than individuals obtained in the field and had a significantly lower variation in mRNA expression across all genes in comparison to the other two groups (p ≤ 0.001). When examining the gene specific variation, twenty-two genes had variation in expression that was significantly different among groups with lower variation in G10 individuals than in acclimated individuals. Additionally, there were fewer genes with significant differences in expression among G10 individuals versus either acclimated or field individuals: 66 genes have statistically different levels of expression versus 107 or 97 for Acclimated or Field groups. Based on the permutation of the data, these differences in the number of genes with significant differences among individuals within a group are unlikely to occur by chance (p < 0.01). Surprisingly, variation in mRNA expression in field individuals is lower than in acclimated individuals. Relative to the variation among individual within a group, few genes have significant differences in expression among groups (seven, 2.3%) and none of these are different between acclimated and field individuals. The results support the concept that genetic variation affects variation in mRNA expression and also suggests that temporal environmental variation associated with estuarine environments does not increase the variation among individuals or add to the differences among groups. PMID

  3. GeneFisher-P: variations of GeneFisher as processes in Bio-jETI

    Science.gov (United States)

    Lamprecht, Anna-Lena; Margaria, Tiziana; Steffen, Bernhard; Sczyrba, Alexander; Hartmeier, Sven; Giegerich, Robert

    2008-01-01

    Background PCR primer design is an everyday, but not trivial task requiring state-of-the-art software. We describe the popular tool GeneFisher and explain its recent restructuring using workflow techniques. We apply a service-oriented approach to model and implement GeneFisher-P, a process-based version of the GeneFisher web application, as a part of the Bio-jETI platform for service modeling and execution. We show how to introduce a flexible process layer to meet the growing demand for improved user-friendliness and flexibility. Results Within Bio-jETI, we model the process using the jABC framework, a mature model-driven, service-oriented process definition platform. We encapsulate remote legacy tools and integrate web services using jETI, an extension of the jABC for seamless integration of remote resources as basic services, ready to be used in the process. Some of the basic services used by GeneFisher are in fact already provided as individual web services at BiBiServ and can be directly accessed. Others are legacy programs, and are made available to Bio-jETI via the jETI technology. The full power of service-based process orientation is required when more bioinformatics tools, available as web services or via jETI, lead to easy extensions or variations of the basic process. This concerns for instance variations of data retrieval or alignment tools as provided by the European Bioinformatics Institute (EBI). Conclusions The resulting service- and process-oriented GeneFisher-P demonstrates how basic services from heterogeneous sources can be easily orchestrated in the Bio-jETI platform and lead to a flexible family of specialized processes tailored to specific tasks. PMID:18460174

  4. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  5. New ALS-Related Genes Expand the Spectrum Paradigm of Amyotrophic Lateral Sclerosis.

    Science.gov (United States)

    Sabatelli, Mario; Marangi, Giuseppe; Conte, Amelia; Tasca, Giorgio; Zollino, Marcella; Lattante, Serena

    2016-03-01

    Amyotrophic Lateral Sclerosis (ALS) is characterized by the degeneration of upper and lower motor neurons. Clinical heterogeneity is a well-recognized feature of the disease as age of onset, site of onset and the duration of the disease can vary greatly among patients. A number of genes have been identified and associated to familial and sporadic forms of ALS but the majority of cases remains still unexplained. Recent breakthrough discoveries have demonstrated that clinical manifestations associated with ALS-related genes are not circumscribed to motor neurons involvement. In this view, ALS appears to be linked to different conditions over a continuum or spectrum in which overlapping phenotypes may be identified. In this review, we aim to examine the increasing number of spectra, including ALS/Frontotemporal Dementia and ALS/Myopathies spectra. Considering all these neurodegenerative disorders as different phenotypes of the same spectrum can help to identify common pathological pathways and consequently new therapeutic targets in these incurable diseases.

  6. [Analysis of DIAPH3 gene mutation in a boy with autism spectrum disorder].

    Science.gov (United States)

    Xie, Jiang; Li, Hua; Zhu, Hua; Huang, Li; Li, Hongxia; Zhang, Xiling; Zhou, Yongmei; Zhou, Qiang; Xu, Wenming

    2016-08-01

    To analyze the clinical manifestations and gene mutation of a 6 year old boy with autism spectrum disorders (ASD). Peripheral blood of the boy and his parents were subjected to genetic testing. The patient was diagnosed with typical autism. Exome sequencing has identified mutations of four candidate genes, namely TUT1, DIAPH3, REELIN and SETD2, which were confirmed with Sanger sequencing. Analysis of family members confirmed that the missense mutations of DIAPH3 and SETD2 genes were of de novo origin. Missense mutations of DIAPH3 and SETD2 genes may have contributed to the risk of ASD. Disrupted neurogenesis associated with such mutations may have been the underlying mechanism for ASD.

  7. Mutation analysis of the NSD1 gene in patients with autism spectrum disorders and macrocephaly

    Directory of Open Access Journals (Sweden)

    Delorme Richard

    2007-11-01

    Full Text Available Abstract Background Sotos syndrome is an overgrowth syndrome characterized by macrocephaly, advanced bone age, characteristic facial features, and learning disabilities, caused by mutations or deletions of the NSD1 gene, located at 5q35. Sotos syndrome has been described in a number of patients with autism spectrum disorders, suggesting that NSD1 could be involved in other cases of autism and macrocephaly. Methods We screened the NSD1 gene for mutations and deletions in 88 patients with autism spectrum disorders and macrocephaly (head circumference 2 standard deviations or more above the mean. Mutation analysis was performed by direct sequencing of all exons and flanking regions. Dosage analysis of NSD1 was carried out using multiplex ligation-dependent probe amplification. Results We identified three missense variants (R604L, S822C and E1499G in one patient each, but none is within a functional domain. In addition, segregation analysis showed that all variants were inherited from healthy parents and in two cases were also present in unaffected siblings, indicating that they are probably nonpathogenic. No partial or whole gene deletions/duplications were observed. Conclusion Our findings suggest that Sotos syndrome is a rare cause of autism spectrum disorders and that screening for NSD1 mutations and deletions in patients with autism and macrocephaly is not warranted in the absence of other features of Sotos syndrome.

  8. Looking on the bright side of serotonin transporter gene variation.

    Science.gov (United States)

    Homberg, Judith R; Lesch, Klaus-Peter

    2011-03-15

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for depression in interaction with psychosocial adversity across the life span. However, genetically driven deficient serotonin transporter (5-HTT) function would not have been maintained throughout evolution if it only exerted negative effects without conveying any gain of function. Here, we review recent findings that humans and nonhuman primates carrying the s variant of the 5-HTTLPR outperform subjects carrying the long allele in an array of cognitive tasks and show increased social conformity. In addition, studies in 5-HTT knockout rodents are included that provide complementary insights in the beneficial effects of the 5-HTTLPR s-allele. We postulate that hypervigilance, mediated by hyperactivity in corticolimbic structures, may be the common denominator in the anxiety-related traits and (social) cognitive superiority of s-allele carriers and that environmental conditions determine whether a response will turn out to be negative (emotional) or positive (cognitive, in conformity with the social group). Taken together, these findings urge for a conceptual change in the current deficit-oriented connotation of the 5-HTTLPR variants. In fact, these factors may counterbalance or completely offset the negative consequences of the anxiety-related traits. This notion may not only explain the modest effect size of the 5-HTTLPR and inconsistent reports but may also lead to a more refined appreciation of allelic variation in 5-HTT function. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  9. Natural variation in the Pto disease resistance gene within species of wild tomato (Lycopersicon). II. Population genetics of Pto.

    Science.gov (United States)

    Rose, Laura E; Michelmore, Richard W; Langley, Charles H

    2007-03-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the host species Lycopersicon esculentum, the cultivated tomato, and the closely related L. pimpinellifolium is triggered by the physical interaction between the protein products of the host resistance (R) gene Pto and the pathogen avirulence genes AvrPto and AvrPtoB. Sequence variation at the Pto locus was surveyed in natural populations of seven species of Lycopersicon to test hypotheses of host-parasite coevolution and functional adaptation of the Pto gene. Pto shows significantly higher nonsynonymous polymorphism than 14 other non-R-gene loci in the same samples of Lycopersicon species, while showing no difference in synonymous polymorphism, suggesting that the maintenance of amino acid polymorphism at this locus is mediated by pathogen selection. Also, a larger proportion of ancestral variation is maintained at Pto as compared to these non-R-gene loci. The frequency spectrum of amino acid polymorphisms known to negatively affect Pto function is skewed toward low frequency compared to amino acid polymorphisms that do not affect function or silent polymorphisms. Therefore, the evolution of Pto appears to be influenced by a mixture of both purifying and balancing selection.

  10. Functional impact of global rare copy number variation in autism spectrum disorders

    NARCIS (Netherlands)

    Pinto, Dalila; Pagnamenta, Alistair T.; Klei, Lambertus; Anney, Richard; Merico, Daniele; Regan, Regina; Conroy, Judith; Magalhaes, Tiago R.; Correia, Catarina; Abrahams, Brett S.; Almeida, Joana; Bacchelli, Elena; Bader, Gary D.; Bailey, Anthony J.; Baird, Gillian; Battaglia, Agatino; Berney, Tom; Bolshakova, Nadia; Boelte, Sven; Bolton, Patrick F.; Bourgeron, Thomas; Brennan, Sean; Brian, Jessica; Bryson, Susan E.; Carson, Andrew R.; Casallo, Guillermo; Casey, Jillian; Chung, Brian H. Y.; Cochrane, Lynne; Corsello, Christina; Crawford, Emily L.; Crossett, Andrew; Cytrynbaum, Cheryl; Dawson, Geraldine; de Jonge, Maretha; Delorme, Richard; Drmic, Irene; Duketis, Eftichia; Duque, Frederico; Estes, Annette; Farrar, Penny; Fernandez, Bridget A.; Folstein, Susan E.; Fombonne, Eric; Freitag, Christine M.; Gilbert, John; Gillberg, Christopher; Glessner, Joseph T.; Goldberg, Jeremy; Green, Andrew; Green, Jonathan; Guter, Stephen J.; Hakonarson, Hakon; Heron, Elizabeth A.; Hill, Matthew; Holt, Richard; Howe, Jennifer L.; Hughes, Gillian; Hus, Vanessa; Igliozzi, Roberta; Kim, Cecilia; Klauck, Sabine M.; Kolevzon, Alexander; Korvatska, Olena; Kustanovich, Vlad; Lajonchere, Clara M.; Lamb, Janine A.; Laskawiec, Magdalena; Leboyer, Marion; Le Couteur, Ann; Leventhal, Bennett L.; Lionel, Anath C.; Liu, Xiao-Qing; Lord, Catherine; Lotspeich, Linda; Lund, Sabata C.; Maestrini, Elena; Mahoney, William; Mantoulan, Carine; Marshall, Christian R.; McConachie, Helen; McDougle, Christopher J.; McGrath, Jane; McMahon, William M.; Merikangas, Alison; Migita, Ohsuke; Minshew, Nancy J.; Mirza, Ghazala K.; Munson, Jeff; Nelson, Stanley F.; Noakes, Carolyn; Noor, Abdul; Nygren, Gudrun; Oliveira, Guiomar; Papanikolaou, Katerina; Parr, Jeremy R.; Parrini, Barbara; Paton, Tara; Pickles, Andrew; Pilorge, Marion; Piven, Joseph; Ponting, Chris P.; Posey, David J.; Poustka, Annemarie; Poustka, Fritz; Prasad, Aparna; Ragoussis, Jiannis; Renshaw, Katy; Rickaby, Jessica; Roberts, Wendy; Roeder, Kathryn; Roge, Bernadette; Rutter, Michael L.; Bierut, Laura J.; Rice, John P.; Salt, Jeff; Sansom, Katherine; Sato, Daisuke; Segurado, Ricardo; Sequeira, Ana F.; Senman, Lili; Shah, Naisha; Sheffield, Val C.; Soorya, Latha; Sousa, Ines; Stein, Olaf; Sykes, Nuala; Stoppioni, Vera; Strawbridge, Christina; Tancredi, Raffaella; Tansey, Katherine; Thiruvahindrapduram, Bhooma; Thompson, Ann P.; Thomson, Susanne; Tryfon, Ana; Tsiantis, John; Van Engeland, Herman; Vincent, John B.; Volkmar, Fred; Wallace, Simon; Wang, Kai; Wang, Zhouzhi; Wassink, Thomas H.; Webber, Caleb; Weksberg, Rosanna; Wing, Kirsty; Wittemeyer, Kerstin; Wood, Shawn; Wu, Jing; Yaspan, Brian L.; Zurawiecki, Danielle; Zwaigenbaum, Lonnie; Buxbaum, Joseph D.; Cantor, Rita M.; Cook, Edwin H.; Coon, Hilary; Cuccaro, Michael L.; Devlin, Bernie; Ennis, Sean; Gallagher, Louise; Geschwind, Daniel H.; Gill, Michael; Haines, Jonathan L.; Hallmayer, Joachim; Miller, Judith; Monaco, Anthony P.; Nurnberger, John I.; Paterson, Andrew D.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Szatmari, Peter; Vicente, Astrid M.; Vieland, Veronica J.; Wijsman, Ellen M.; Scherer, Stephen W.; Sutcliffe, James S.; Betancur, Catalina

    2010-01-01

    The autism spectrum disorders (ASDs) are a group of conditions characterized by impairments in reciprocal social interaction and communication, and the presence of restricted and repetitive behaviours(1). Individuals with an ASD vary greatly in cognitive development, which can range from above avera

  11. [Research on transient temperature detection by spectrum function variation of speckle pattern interferometry].

    Science.gov (United States)

    Wu, Jin-Hui; Yang, Rui-Feng; Wang, Gao

    2012-07-01

    To improve the accuracy of the transient temperature detection system, transient temperature inversion processing algorithms was proposed based on spectrum analysis of speckle pattern interferometry. The interference fringes were formed by speckle interferometry in the system, and due to transient temperature changes that cause the material strain, the speckle interference pattern changes. The interference fringes on the measured surface were obtained by the area array CCD collection before and after deformation. The corresponding spectrum density function will change with the changes in the transient temperature, and the amplitude changes of center wavelength were inverted by the speckle pattern interferometry. Through detecting and calculating the ratio of the amplitude of the center wavelength, the transient temperature can be obtained by spectrum analysis. In the analysis and calculation for the function of transient temperature and material strain, material strain and interference fringes, the amplitude and phase function of the transient temperature change and interference fringes were derived, providing the necessary conditions for detecting spectral density function temperature. The experiment used 660 nm laser diode and SI6600 type area CCD detector. By extracting the offset of the center wavelength from the spectrum distribution function, the calculation and calibration data were compared to the data obtained with the traditional method of interference temperature detection, and the result showed that the detection accuracy can achieve 0.3%. Compared to traditional direct detection of interference fringes changes, the accuracy improved nearly three times by the method.

  12. Parental Sleep Concerns in Autism Spectrum Disorders: Variations from Childhood to Adolescence

    Science.gov (United States)

    Goldman, Suzanne E.; Richdale, Amanda L.; Clemons, Traci; Malow, Beth A.

    2012-01-01

    Sleep problems of adolescents and older children with Autism Spectrum Disorder (ASD) were compared to toddlers and young children in 1,859 children. Sleep was measured with the Children's Sleep Habits Questionnaire. Total sleep problems were significant across all age groups, however the factors contributing to these problems differed. Adolescents…

  13. Functional impact of global rare copy number variation in autism spectrum disorders

    NARCIS (Netherlands)

    Pinto, Dalila; Pagnamenta, Alistair T.; Klei, Lambertus; Anney, Richard; Merico, Daniele; Regan, Regina; Conroy, Judith; Magalhaes, Tiago R.; Correia, Catarina; Abrahams, Brett S.; Almeida, Joana; Bacchelli, Elena; Bader, Gary D.; Bailey, Anthony J.; Baird, Gillian; Battaglia, Agatino; Berney, Tom; Bolshakova, Nadia; Boelte, Sven; Bolton, Patrick F.; Bourgeron, Thomas; Brennan, Sean; Brian, Jessica; Bryson, Susan E.; Carson, Andrew R.; Casallo, Guillermo; Casey, Jillian; Chung, Brian H. Y.; Cochrane, Lynne; Corsello, Christina; Crawford, Emily L.; Crossett, Andrew; Cytrynbaum, Cheryl; Dawson, Geraldine; de Jonge, Maretha; Delorme, Richard; Drmic, Irene; Duketis, Eftichia; Duque, Frederico; Estes, Annette; Farrar, Penny; Fernandez, Bridget A.; Folstein, Susan E.; Fombonne, Eric; Freitag, Christine M.; Gilbert, John; Gillberg, Christopher; Glessner, Joseph T.; Goldberg, Jeremy; Green, Andrew; Green, Jonathan; Guter, Stephen J.; Hakonarson, Hakon; Heron, Elizabeth A.; Hill, Matthew; Holt, Richard; Howe, Jennifer L.; Hughes, Gillian; Hus, Vanessa; Igliozzi, Roberta; Kim, Cecilia; Klauck, Sabine M.; Kolevzon, Alexander; Korvatska, Olena; Kustanovich, Vlad; Lajonchere, Clara M.; Lamb, Janine A.; Laskawiec, Magdalena; Leboyer, Marion; Le Couteur, Ann; Leventhal, Bennett L.; Lionel, Anath C.; Liu, Xiao-Qing; Lord, Catherine; Lotspeich, Linda; Lund, Sabata C.; Maestrini, Elena; Mahoney, William; Mantoulan, Carine; Marshall, Christian R.; McConachie, Helen; McDougle, Christopher J.; McGrath, Jane; McMahon, William M.; Merikangas, Alison; Migita, Ohsuke; Minshew, Nancy J.; Mirza, Ghazala K.; Munson, Jeff; Nelson, Stanley F.; Noakes, Carolyn; Noor, Abdul; Nygren, Gudrun; Oliveira, Guiomar; Papanikolaou, Katerina; Parr, Jeremy R.; Parrini, Barbara; Paton, Tara; Pickles, Andrew; Pilorge, Marion; Piven, Joseph; Ponting, Chris P.; Posey, David J.; Poustka, Annemarie; Poustka, Fritz; Prasad, Aparna; Ragoussis, Jiannis; Renshaw, Katy; Rickaby, Jessica; Roberts, Wendy; Roeder, Kathryn; Roge, Bernadette; Rutter, Michael L.; Bierut, Laura J.; Rice, John P.; Salt, Jeff; Sansom, Katherine; Sato, Daisuke; Segurado, Ricardo; Sequeira, Ana F.; Senman, Lili; Shah, Naisha; Sheffield, Val C.; Soorya, Latha; Sousa, Ines; Stein, Olaf; Sykes, Nuala; Stoppioni, Vera; Strawbridge, Christina; Tancredi, Raffaella; Tansey, Katherine; Thiruvahindrapduram, Bhooma; Thompson, Ann P.; Thomson, Susanne; Tryfon, Ana; Tsiantis, John; Van Engeland, Herman; Vincent, John B.; Volkmar, Fred; Wallace, Simon; Wang, Kai; Wang, Zhouzhi; Wassink, Thomas H.; Webber, Caleb; Weksberg, Rosanna; Wing, Kirsty; Wittemeyer, Kerstin; Wood, Shawn; Wu, Jing; Yaspan, Brian L.; Zurawiecki, Danielle; Zwaigenbaum, Lonnie; Buxbaum, Joseph D.; Cantor, Rita M.; Cook, Edwin H.; Coon, Hilary; Cuccaro, Michael L.; Devlin, Bernie; Ennis, Sean; Gallagher, Louise; Geschwind, Daniel H.; Gill, Michael; Haines, Jonathan L.; Hallmayer, Joachim; Miller, Judith; Monaco, Anthony P.; Nurnberger, John I.; Paterson, Andrew D.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Szatmari, Peter; Vicente, Astrid M.; Vieland, Veronica J.; Wijsman, Ellen M.; Scherer, Stephen W.; Sutcliffe, James S.; Betancur, Catalina

    2010-01-01

    The autism spectrum disorders (ASDs) are a group of conditions characterized by impairments in reciprocal social interaction and communication, and the presence of restricted and repetitive behaviours(1). Individuals with an ASD vary greatly in cognitive development, which can range from above avera

  14. Tandem gene arrays in Trypanosoma brucei: Comparative phylogenomic analysis of duplicate sequence variation

    Directory of Open Access Journals (Sweden)

    Jackson Andrew P

    2007-04-01

    Full Text Available Abstract Background The genome sequence of the protistan parasite Trypanosoma brucei contains many tandem gene arrays. Gene duplicates are created through tandem duplication and are expressed through polycistronic transcription, suggesting that the primary purpose of long, tandem arrays is to increase gene dosage in an environment where individual gene promoters are absent. This report presents the first account of the tandem gene arrays in the T. brucei genome, employing several related genome sequences to establish how variation is created and removed. Results A systematic survey of tandem gene arrays showed that substantial sequence variation existed across the genome; variation from different regions of an array often produced inconsistent phylogenetic affinities. Phylogenetic relationships of gene duplicates were consistent with concerted evolution being a widespread homogenising force. However, tandem duplicates were not usually identical; therefore, any homogenising effect was coincident with divergence among duplicates. Allelic gene conversion was detected using various criteria and was apparently able to both remove and introduce sequence variation. Tandem arrays containing structural heterogeneity demonstrated how sequence homogenisation and differentiation can occur within a single locus. Conclusion The use of multiple genome sequences in a comparative analysis of tandem gene arrays identified substantial sequence variation among gene duplicates. The distribution of sequence variation is determined by a dynamic balance of conservative and innovative evolutionary forces. Gene trees from various species showed that intraspecific duplicates evolve in concert, perhaps through frequent gene conversion, although this does not prevent sequence divergence, especially where structural heterogeneity physically separates a duplicate from its neighbours. In describing dynamics of sequence variation that have consequences beyond gene dosage, this

  15. Comorbid Analysis of Genes Associated with Autism Spectrum Disorders Reveals Differential Evolutionary Constraints

    Science.gov (United States)

    David, Maude M.; Enard, David; Ozturk, Alp; Daniels, Jena; Jung, Jae-Yoon; Diaz-Beltran, Leticia; Wall, Dennis. P.

    2016-01-01

    The burden of comorbidity in Autism Spectrum Disorder (ASD) is substantial. The symptoms of autism overlap with many other human conditions, reflecting common molecular pathologies suggesting that cross-disorder analysis will help prioritize autism gene candidates. Genes in the intersection between autism and related conditions may represent nonspecific indicators of dysregulation while genes unique to autism may play a more causal role. Thorough literature review allowed us to extract 125 ICD-9 codes comorbid to ASD that we mapped to 30 specific human disorders. In the present work, we performed an automated extraction of genes associated with ASD and its comorbid disorders, and found 1031 genes involved in ASD, among which 262 are involved in ASD only, with the remaining 779 involved in ASD and at least one comorbid disorder. A pathway analysis revealed 13 pathways not involved in any other comorbid disorders and therefore unique to ASD, all associated with basal cellular functions. These pathways differ from the pathways associated with both ASD and its comorbid conditions, with the latter being more specific to neural function. To determine whether the sequence of these genes have been subjected to differential evolutionary constraints, we studied long term constraints by looking into Genomic Evolutionary Rate Profiling, and showed that genes involved in several comorbid disorders seem to have undergone more purifying selection than the genes involved in ASD only. This result was corroborated by a higher dN/dS ratio for genes unique to ASD as compare to those that are shared between ASD and its comorbid disorders. Short-term evolutionary constraints showed the same trend as the pN/pS ratio indicates that genes unique to ASD were under significantly less evolutionary constraint than the genes associated with all other disorders. PMID:27414027

  16. Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of Prostate Cancer

    Science.gov (United States)

    2015-10-01

    occupation, and smoking . 2. To examine the modifying effect of genetic variants in ITC-metabolizing genes on the associations between cruciferous...AWARD NUMBER: W81XWH-14-1-0453 TITLE: Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of...COVERED 15 Sep 2014 - 14 Sep 2015 4. TITLE AND SUBTITLE Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in

  17. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Directory of Open Access Journals (Sweden)

    Karen E Sears

    2015-08-01

    Full Text Available Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11 and late (expansion and elongation; E11-13 limb development in mouse. This resulted in an Early (ESN and Late (LSN Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species.

  18. High-Frequency EEG Variations in Children with Autism Spectrum Disorder during Human Faces Visualization

    Directory of Open Access Journals (Sweden)

    Celina A. Reis Paula

    2017-01-01

    Full Text Available Autism spectrum disorder (ASD is a neuropsychiatric disorder characterized by the impairment in the social reciprocity, interaction/language, and behavior, with stereotypes and signs of sensory function deficits. Electroencephalography (EEG is a well-established and noninvasive tool for neurophysiological characterization and monitoring of the brain electrical activity, able to identify abnormalities related to frequency range, connectivity, and lateralization of brain functions. This research aims to evidence quantitative differences in the frequency spectrum pattern between EEG signals of children with and without ASD during visualization of human faces in three different expressions: neutral, happy, and angry. Quantitative clinical evaluations, neuropsychological evaluation, and EEG of children with and without ASD were analyzed paired by age and gender. The results showed stronger activation in higher frequencies (above 30 Hz in frontal, central, parietal, and occipital regions in the ASD group. This pattern of activation may correlate with developmental characteristics in the children with ASD.

  19. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  20. Mutation analysis of the NRXN1 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Onay H

    2016-12-01

    Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

  1. Genetic risk for autism spectrum disorders and neuropsychiatric variation in the general population

    DEFF Research Database (Denmark)

    Robinson, Elise B; St Pourcain, Beate; Anttila, Verneri

    2016-01-01

    Almost all genetic risk factors for autism spectrum disorders (ASDs) can be found in the general population, but the effects of this risk are unclear in people not ascertained for neuropsychiatric symptoms. Using several large ASD consortium and population-based resources (total n > 38,000), we...... and developmental traits, the severe tail of which can result in diagnosis with an ASD or other neuropsychiatric disorder. A continuum model should inform the design and interpretation of studies of neuropsychiatric disease biology....

  2. Expanding the genotype-phenotype spectrum in hereditary colorectal cancer by gene panel testing

    DEFF Research Database (Denmark)

    Rohlin, Anna; Rambech, Eva; Kvist, Anders;

    2016-01-01

    sixteen pathogenic or likely pathogenic variants and 30 variants of unknown clinical significance. Four of the pathogenic or likely pathogenic variants were found in BMPR1A in patients with unexplained familial adenomatous polyposis or atypical adenomatous polyposis, which extends the genotype......-phenotype spectrum for this gene. Nine patients had more than one variant remaining after the filtration, including three with truncating mutations in BMPR1A, PMS2 and AXIN2. CNVs were found in three patients, in upstream regions of SMAD4, MSH3 and CTNNB1, and one additional individual harbored a 24.2 kb duplication......Hereditary syndromes causing colorectal cancer include both polyposis and non-polyposis syndromes. Overlapping phenotypes between the syndromes have been recognized and this make targeted molecular testing for single genes less favorable, instead there is a gaining interest for multi-gene panel...

  3. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo-

  4. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo- an

  5. Observed periodicities and the spectrum of field variations in Holocene magnetic records

    DEFF Research Database (Denmark)

    Panovska, S.; Finlay, Chris; Hirt, A.M.

    2013-01-01

    In order to understand mechanisms that maintain and drive the evolution of the Earth's magnetic field, a characterization of its behavior on time scales of centuries to millennia is required. We have conducted a search for periodicities in Holocene sediment magnetic records, by applying three......, globally observed, periods. Rather we find a continuous broadband spectrum, with a slope corresponding to a power law with exponent of -2.3 ± 0.6 for the period range between 300 and 4000 yr. This is consistent with the hypothesis that chaotic convection in the outer core drives the majority of secular...

  6. Analysis and functional characterization of sequence variations in ligand binding domain of thyroid hormone receptors in autism spectrum disorder (ASD) patients.

    Science.gov (United States)

    Kalikiri, Mahesh Kumar; Mamidala, Madhu Poornima; Rao, Ananth N; Rajesh, Vidya

    2017-08-30

    Autism spectrum disorder (ASD) is a neuro developmental disorder, reported to be on a rise in the past two decades. Thyroid hormone-T3 plays an important role in early embryonic and central nervous system development. T3 mediates its function by binding to thyroid hormone receptors, TRα and TRβ. Alterations in T3 levels and thyroid receptor mutations have been earlier implicated in neuropsychiatric disorders and have been linked to environmental toxins. Limited reports from earlier studies have shown the effectiveness of T3 treatment with promising results in children with ASD and that the thyroid hormone levels in these children was also normal. This necessitates the need to explore the genetic variations in the components of the thyroid hormone pathway in ASD children. To achieve this objective, we performed genetic analysis of ligand binding domain of THRA and THRB receptor genes in 30 ASD subjects and in age matched controls from India. Our study for the first time reports novel single nucleotide polymorphisms in the THRA and THRB receptor genes of ASD individuals. Autism Res 2017. ©2017 International Society for Autism Research, Wiley Periodicals, Inc. Thyroid hormone (T3) and thyroid receptors (TRα and TRβ) are the major components of the thyroid hormone pathway. The link between thyroid pathway and neuronal development is proven in clinical medicine. Since the thyroid hormone levels in Autistic children are normal, variations in their receptors needs to be explored. To achieve this objective, changes in THRA and THRB receptor genes was studied in 30 ASD and normal children from India. The impact of some of these mutations on receptor function was also studied. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  7. Natural variation in abiotic stress responsive gene expression and local adaptation to climate in Arabidopsis thaliana.

    Science.gov (United States)

    Lasky, Jesse R; Des Marais, David L; Lowry, David B; Povolotskaya, Inna; McKay, John K; Richards, James H; Keitt, Timothy H; Juenger, Thomas E

    2014-09-01

    Gene expression varies widely in natural populations, yet the proximate and ultimate causes of this variation are poorly known. Understanding how variation in gene expression affects abiotic stress tolerance, fitness, and adaptation is central to the field of evolutionary genetics. We tested the hypothesis that genes with natural genetic variation in their expression responses to abiotic stress are likely to be involved in local adaptation to climate in Arabidopsis thaliana. Specifically, we compared genes with consistent expression responses to environmental stress (expression stress responsive, "eSR") to genes with genetically variable responses to abiotic stress (expression genotype-by-environment interaction, "eGEI"). We found that on average genes that exhibited eGEI in response to drought or cold had greater polymorphism in promoter regions and stronger associations with climate than those of eSR genes or genomic controls. We also found that transcription factor binding sites known to respond to environmental stressors, especially abscisic acid responsive elements, showed significantly higher polymorphism in drought eGEI genes in comparison to eSR genes. By contrast, eSR genes tended to exhibit relatively greater pairwise haplotype sharing, lower promoter diversity, and fewer nonsynonymous polymorphisms, suggesting purifying selection or selective sweeps. Our results indicate that cis-regulatory evolution and genetic variation in stress responsive gene expression may be important mechanisms of local adaptation to climatic selective gradients.

  8. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  9. Mutation spectrum of the TYR and SLC45A2 genes in patients with oculocutaneous albinism.

    Science.gov (United States)

    Ko, Jung Min; Yang, Jung-Ah; Jeong, Seon-Yong; Kim, Hyon-Ju

    2012-04-01

    Oculocutaneous albinism (OCA) is a group of inherited disorders characterized by defective melanin biosynthesis. OCA1, the most common and severe form, is caused by mutations in the tyrosinase (TYR) gene. OCA4, caused by mutations in the SLC45A2 gene, has frequently been reported in the Japanese population. To determine the mutational spectrum in Korean OCA patients, 12 patients were recruited. The samples were first screened for TYR mutations, and negative samples were screened for SLC45A2 mutations. OCA1 was confirmed in 8 of 12 (66.7%) patients, and OCA4 was diagnosed in 1 (8.3%) patient. In the OCA1 patients, a total of 6 distinct TYR mutations were found in 15 of 16 (93.8%) alleles, all of which had been previously reported. Out of the 6 alleles, c.929insC was the most frequently detected (31.3%), and was mainly associated with OCA1A phenotypes. Other TYR mutations identified included c.1037-7T>A/c.1037-10delTT, p.D383N, p.R77Q and p.R299H. These largely overlapped with mutations found in Japanese and Chinese patients. The SLC45A2 gene analysis identified 1 novel mutation, p.D93N, in 1 patient. This study has provided information on the mutation spectrum in Korean OCA patients, and allows us to estimate the relative frequencies of OCA1 and OCA4 in Korea.

  10. Association Study between the CD157/BST1 Gene and Autism Spectrum Disorders in a Japanese Population

    Directory of Open Access Journals (Sweden)

    Shigeru Yokoyama

    2015-05-01

    Full Text Available CD157, also referred to as bone marrow stromal cell antigen-1 (BST-1, is a glycosylphosphatidylinositol-anchored molecule that promotes pre-B-cell growth. Previous studies have reported associations between single-nucleotide polymorphisms (SNPs of the CD157/BST1 gene with Parkinson’s disease. In an attempt to determine whether SNPs or haplotypes in the CD157/BST1 are associated with other brain disorders, we performed a case-control study including 147 autism spectrum disorder (ASD patients at Kanazawa University Hospital in Japan and 150 unselected Japanese volunteers by the sequence-specific primer-polymerase chain reaction method combined with fluorescence correlation spectroscopy. Of 93 SNPs examined, two SNPs showed significantly higher allele frequencies in cases with ASDs than in unaffected controls (rs4301112, OR = 6.4, 95% CI = 1.9 to 22, p = 0.0007; and rs28532698, OR = 6.2, 95% CI = 1.8 to 21, p = 0.0012; Fisher’s exact test; p < 0.002 was considered significant after multiple testing correction. In addition, CT genotype in rs10001565 was more frequently observed in the ASD group than in the control group (OR = 15, 95% CI = 2.0 to 117, p = 0.0007; Fisher’s exact test. The present data indicate that genetic variation of the CD157/BST1 gene might confer susceptibility to ASDs.

  11. Investigating the role of ALS genes CHCHD10 and TUBA4A in Belgian FTD-ALS spectrum patients.

    Science.gov (United States)

    Perrone, Federica; Nguyen, Hung Phuoc; Van Mossevelde, Sara; Moisse, Matthieu; Sieben, Anne; Santens, Patrick; De Bleecker, Jan; Vandenbulcke, Mathieu; Engelborghs, Sebastiaan; Baets, Jonathan; Cras, Patrick; Vandenberghe, Rik; De Jonghe, Peter; De Deyn, Peter P; Martin, Jean-Jacques; Van Damme, Philip; Van Broeckhoven, Christine; van der Zee, Julie

    2017-03-01

    Mutation screening and phenotypic profiling of 2 amyotrophic lateral sclerosis-(ALS) and frontotemporal dementia-(FTD) associated genes, CHCHD10 and TUBA4A, were performed in a Belgian cohort of 459 FTD, 28 FTD-ALS, and 429 ALS patients. In CHCHD10, we identified a novel nonsense mutation (p.Gln108*) in a patient with atypical clinical FTD and pathology-confirmed Parkinson's disease (1/459, 0.22%) leading to loss of transcript. We further observed 3 previously described missense variants (p.Pro34Ser, p.Pro80Leu, and p.Pro96Thr) that were also present in the matched control series. In TUBA4A, we detected a novel frameshift mutation (p.Arg64Glyfs*90) leading to a truncated protein in 1 FTD patient (1/459 of 0.22%) with family history of Parkinson's disease and cognitive impairment, and a novel missense mutation (p.Thr381Met) in 2 sibs with familial ALS and memory problems (1 index patient/429, 0.23%) in whom we previously identified a pathogenic Chromosome 9 open reading frame 72 repeat expansion mutation. The present study confirms the role of CHCHD10 and TUBA4A in the FTD-ALS spectrum, although genetic variations in these 2 genes are extremely rare in the Belgian population and often associated with symptomatology of related neurodegenerative diseases including Parkinson's disease and Alzheimer's disease.

  12. Association Study between the CD157/BST1 Gene and Autism Spectrum Disorders in a Japanese Population.

    Science.gov (United States)

    Yokoyama, Shigeru; Al Mahmuda, Naila; Munesue, Toshio; Hayashi, Kenshi; Yagi, Kunimasa; Yamagishi, Masakazu; Higashida, Haruhiro

    2015-05-20

    CD157, also referred to as bone marrow stromal cell antigen-1 (BST-1), is a glycosylphosphatidylinositol-anchored molecule that promotes pre-B-cell growth. Previous studies have reported associations between single-nucleotide polymorphisms (SNPs) of the CD157/BST1 gene with Parkinson's disease. In an attempt to determine whether SNPs or haplotypes in the CD157/BST1 are associated with other brain disorders, we performed a case-control study including 147 autism spectrum disorder (ASD) patients at Kanazawa University Hospital in Japan and 150 unselected Japanese volunteers by the sequence-specific primer-polymerase chain reaction method combined with fluorescence correlation spectroscopy. Of 93 SNPs examined, two SNPs showed significantly higher allele frequencies in cases with ASDs than in unaffected controls (rs4301112, OR = 6.4, 95% CI = 1.9 to 22, p = 0.0007; and rs28532698, OR = 6.2, 95% CI = 1.8 to 21, p = 0.0012; Fisher's exact test; p < 0.002 was considered significant after multiple testing correction). In addition, CT genotype in rs10001565 was more frequently observed in the ASD group than in the control group (OR = 15, 95% CI = 2.0 to 117, p = 0.0007; Fisher's exact test). The present data indicate that genetic variation of the CD157/BST1 gene might confer susceptibility to ASDs.

  13. Faraday rotation measure variations in the Cygnus region and the spectrum of interstellar plasma turbulence

    Science.gov (United States)

    Lazio, T. Joseph; Spangler, Steven R.; Cordes, James M.

    1990-01-01

    Linear polarization observations were made of eight double-lobed radio galaxies viewed through the galactic plane in the Cygnus region. These observations have been used to determine intra- and intersource rotation measure differences; in some cases, unambiguous rotation measures have been extracted. The rotation measures are dominated by foreground magnetoionic material. The differences in rotation measure between pairs of sources correlate with angular separation for separations from 10 arcsec to 1.5 deg. These rotation measure fluctuations are consistent with a model in which the electron density varies on roughly 0.1-200 pc scales. The amplitudes of these variations are, in turn, consistent with those electron density variations that cause diffractive interstellar scattering on scales less than 10 to the 11th cm.

  14. Language impairment and dyslexia genes influence language skills in children with autism spectrum disorders.

    Science.gov (United States)

    Eicher, John D; Gruen, Jeffrey R

    2015-04-01

    Language and communication development is a complex process influenced by numerous environmental and genetic factors. Many neurodevelopment disorders include deficits in language and communication skills in their diagnostic criteria, including autism spectrum disorders (ASD), language impairment (LI), and dyslexia. These disorders are polygenic and complex with a significant genetic component contributing to each. The similarity of language phenotypes and comorbidity of these disorders suggest that they may share genetic contributors. To test this, we examined the association of genes previously implicated in dyslexia, LI, and/or language-related traits with language skills in children with ASD. We used genetic and language data collected in the Autism Genome Research Exchange (AGRE) and Simons Simplex Collection (SSC) cohorts to perform a meta-analysis on performance on a receptive vocabulary task. There were associations with LI risk gene ATP2C2 and dyslexia risk gene MRPL19. Additionally, we found suggestive evidence of association with CMIP, GCFC2, KIAA0319L, the DYX2 locus (ACOT13, GPLD1, and FAM65B), and DRD2. Our results show that LI and dyslexia genes also contribute to language traits in children with ASD. These associations add to the growing literature of generalist genes that contribute to multiple related neurobehavioral traits. Future studies should examine whether other genetic contributors may be shared among these disorders and how risk variants interact with each other and the environment to modify clinical presentations. © 2014 International Society for Autism Research, Wiley Periodicals, Inc.

  15. Association between genetic variation in the oxytocin receptor gene and emotional withdrawal, but not between oxytocin pathway genes and diagnosis in psychotic disorders.

    Directory of Open Access Journals (Sweden)

    Marit eHaram

    2015-01-01

    Full Text Available Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behaviour. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, CD38 and four areas of social behaviour-related psychopathology as measured by Positive and Negative Syndrome Scale (PANSS. For this purpose, we used both a polygenic risk score (PGRS and single OXTR candidate SNPs previously reported in the literature (rs53576, rs237902, rs2254298. A total of 734 subjects with DSM-IV psychotic spectrum disorders and 420 healthy controls were included. Oxytocin pathway PGRSs were calculated based on the independent Psychiatric Genomics Consortium study sample. There was a significant association between symptom of Emotional Withdrawal and the previously reported OXTR risk allele A in rs53576. No significant associations between oxytocin pathway gene variants and a diagnosis of psychotic disorder were found. Our findings indicate that while oxytocin pathway genes do not appear to contribute to the susceptibility to psychotic disorders, variations in the OXTR gene might play a role in the development of impaired social behaviour.

  16. Intellectual Disability and Autism Spectrum Disorders: Causal Genes and Molecular Mechanisms

    Science.gov (United States)

    Srivastava, Anand K.; Schwartz, Charles E.

    2014-01-01

    Intellectual disability (ID) and Autism Spectrum disorder (ASD) are the most common developmental disorders present in humans. Combined, they affect between 3-5% of the population. Additionally, they can be found together in the same individual thereby complicating treatment. The causative factors (genes, epigenetic and environmental) are quite varied and likely interact so as to further complicate the assessment of an individual patient. Nonetheless, much valuable information has been gained by identifying candidate genes for ID or ASD. Understanding the etiology of either ID or ASD is of utmost importance for families. It allows a determination of the risk of recurrence, the possibility of other comorbidity medical problems, the molecular and cellular nature of the pathobiology and hopefully potential therapeutic approaches. PMID:24709068

  17. A survey of genomic studies supports association of circadian clock genes with bipolar disorder spectrum illnesses and lithium response.

    Directory of Open Access Journals (Sweden)

    Michael J McCarthy

    Full Text Available Circadian rhythm abnormalities in bipolar disorder (BD have led to a search for genetic abnormalities in circadian "clock genes" associated with BD. However, no significant clock gene findings have emerged from genome-wide association studies (GWAS. At least three factors could account for this discrepancy: complex traits are polygenic, the organization of the clock is more complex than previously recognized, and/or genetic risk for BD may be shared across multiple illnesses. To investigate these issues, we considered the clock gene network at three levels: essential "core" clock genes, upstream circadian clock modulators, and downstream clock controlled genes. Using relaxed thresholds for GWAS statistical significance, we determined the rates of clock vs. control genetic associations with BD, and four additional illnesses that share clinical features and/or genetic risk with BD (major depression, schizophrenia, attention deficit/hyperactivity. Then we compared the results to a set of lithium-responsive genes. Associations with BD-spectrum illnesses and lithium-responsiveness were both enriched among core clock genes but not among upstream clock modulators. Associations with BD-spectrum illnesses and lithium-responsiveness were also enriched among pervasively rhythmic clock-controlled genes but not among genes that were less pervasively rhythmic or non-rhythmic. Our analysis reveals previously unrecognized associations between clock genes and BD-spectrum illnesses, partly reconciling previously discordant results from past GWAS and candidate gene studies.

  18. Theoretical studies of gene substitution, geographic variation, and speciation

    Energy Technology Data Exchange (ETDEWEB)

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  19. The infrared spectrum of the hydrogen bifluoride anion: unprecedented variation with level of theory

    Science.gov (United States)

    Janssen, Curtis L.; Allen, Wesley D.; Bowman, Henry F. Schaefer Joel M., III

    1986-11-01

    High-quality ab initio theoretical methods have been employed to reinvestigate the infrared of the FHF - and FDF - molecular anions in light of the recent experimental v3 (σ u+) assignments of Kawaguchi and Hirota. SCF, CISD, and Davidson-corrected CISD (CIDVD) results were obtained for seven basis sets ranging in quality from double-zeta plus polarization (DZP) to triple-zeta plus triple polarization plus diffuse augmented by hydrogen d functions (TZ3P + R + d). Fundamental frequencies were determined using variational techniques and complete quartic force fields. As the level of theory is increased, unprecedented variations in v3(σ u+) are observed. At the TZ3P + R + d CIDVD level, v(σ g+) = 617, v2(π u) = 1363, and v3(σ u+) = 1427 cm -1 are predicted for FHF - and v1(σ g+) = 620, v2(π u) = 974, and v3(σ u+) = 983 cm -1 for FDF -. These theoretical v3 values are in significant disagreement with the 1848 cm -1 (FHF -) and 1397 cm -1 (FDF -) experimental v3 assignments.

  20. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  1. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    OpenAIRE

    Cinda P Scott; Williams, Dean A; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory...

  2. Association of aryl hydrocarbon receptor-related gene variants with the severity of autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Takashi X. Fujisawa

    2016-11-01

    Full Text Available Exposure to environmental chemicals, such as dioxin, is known to have adverse effects on the homeostasis of gonadal steroids, thereby potentially altering the sexual differentiation of the brain to express autistic traits. Dioxin-like chemicals act on the aryl hydrocarbon receptor (AhR, polymorphisms and mutations of AhR-related gene may exert pathological influences on sexual differentiation of the brain, causing autistic traits. To ascertain the relationship between AhR-related gene polymorphisms and autism susceptibility, we identified genotypes of them in patients and controls and determined whether there are different gene and genotype distributions between both groups. In addition, to clarify the relationships between the polymorphisms and the severity of autism, we compared the two genotypes of AhR-related genes (rs2066853, rs2228099 with the severity of autistic symptoms. Although no statistically significant difference was found between autism spectrum disorder (ASD patients and control individuals for the genotypic distribution of any of the polymorphisms studied herein, a significant difference in the total score of severity was observed in rs2228099 polymorphism, suggesting that the polymorphism modifies the severity of ASD symptoms but not ASD susceptibility. Moreover, we found that a significant difference in the social communication score of severity was observed. These results suggest that the rs2228099 polymorphism is possibly associated with the severity of social communication impairment among the diverse ASD symptoms.

  3. INVOLVEMENT OF SYNAPTIC GENES IN THE PATHOGENESIS OF AUTISM SPECTRUM DISORDERS: THE CASE OF SYNAPSINS

    Directory of Open Access Journals (Sweden)

    Silvia eGiovedi

    2014-09-01

    Full Text Available Autism spectrum disorders (ASDs are heterogeneous neurodevelopmental disorders characterized by deficits in social interaction and social communication, restricted interests and repetitive behaviors. Many synaptic protein genes are linked to the pathogenesis of ASDs, making them prototypical synaptopathies. An array of mutations in the synapsin (Syn genes in humans have been recently associated with ASD and epilepsy, diseases that display a frequent comorbidity. Synapsins are presynaptic proteins regulating synaptic vesicle traffic, neurotransmitter release and short-term synaptic plasticity. In doing so, Syn isoforms control the tone of activity of neural circuits and the balance between excitation and inhibition. As ASD pathogenesis is believed to result from dysfunctions in the balance between excitatory and inhibitory transmissions in neocortical areas, Syns are novel ASD candidate genes. Accordingly, deletion of single Syn genes in mice, in addition to epilepsy, causes core symptoms of ASD by affecting social behavior, social communication and repetitive behaviors. Thus, Syn knockout mice represent a good experimental model to define synaptic alterations involved in the pathogenesis of ASD and epilepsy.

  4. Predicting Autism Spectrum Disorder Using Blood-based Gene Expression Signatures and Machine Learning

    Science.gov (United States)

    Oh, Dong Hoon; Kim, Il Bin; Kim, Seok Hyeon; Ahn, Dong Hyun

    2017-01-01

    Objective The aim of this study was to identify a transcriptomic signature that could be used to classify subjects with autism spectrum disorder (ASD) compared to controls on the basis of blood gene expression profiles. The gene expression profiles could ultimately be used as diagnostic biomarkers for ASD. Methods We used the published microarray data (GSE26415) from the Gene Expression Omnibus database, which included 21 young adults with ASD and 21 age- and sex-matched unaffected controls. Nineteen differentially expressed probes were identified from a training dataset (n=26, 13 ASD cases and 13 controls) using the limma package in R language (adjusted p value <0.05) and were further analyzed in a test dataset (n=16, 8 ASD cases and 8 controls) using machine learning algorithms. Results Hierarchical cluster analysis showed that subjects with ASD were relatively well-discriminated from controls. Based on the support vector machine and K-nearest neighbors analysis, validation of 19-DE probes with a test dataset resulted in an overall class prediction accuracy of 93.8% as well as a sensitivity and specificity of 100% and 87.5%, respectively. Conclusion The results of our exploratory study suggest that the gene expression profiles identified from the peripheral blood samples of young adults with ASD can be used to identify a biological signature for ASD. Further study using a larger cohort and more homogeneous datasets is required to improve the diagnostic accuracy. PMID:28138110

  5. Muscular dystrophies and myopathies: the spectrum of mutated genes in the Czech Republic.

    Science.gov (United States)

    Stehlíková, K; Skálová, D; Zídková, J; Haberlová, J; Voháňka, S; Mazanec, R; Mrázová, L; Vondráček, P; Ošlejšková, H; Zámečník, J; Honzík, T; Zeman, J; Magner, M; Šišková, D; Langová, M; Gregor, V; Godava, M; Smolka, V; Fajkusová, L

    2017-03-01

    Inherited neuromuscular disorder (NMD) is a wide term covering different genetic disorders affecting muscles, nerves, and neuromuscular junctions. Genetic and clinical heterogeneity is the main drawback in a routine gene-by-gene diagnostics. We present Czech NMD patients with a genetic cause identified using targeted next-generation sequencing (NGS) and the spectrum of these causes. Overall 167 unrelated patients presenting NMD falling into categories of muscular dystrophies, congenital muscular dystrophies, congenital myopathies, distal myopathies, and other myopathies were tested by targeted NGS of 42 known NMD-related genes. Pathogenic or probably pathogenic sequence changes were identified in 79 patients (47.3%). In total, 37 novel and 51 known disease-causing variants were detected in 23 genes. In addition, variants of uncertain significance were suspected in 7 cases (4.2%), and in 81 cases (48.5%) sequence changes associated with NMD were not found. Our results strongly indicate that for molecular diagnostics of heterogeneous disorders such as NMDs, targeted panel testing has a high-clinical yield and should therefore be the preferred first-tier approach. Further, we show that in the genetic diagnostic practice of NMDs, it is necessary to take into account different types of inheritance including the occurrence of an autosomal recessive disorder in two generations of one family. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Duplication of the NPHP1 gene in patients with autism spectrum disorder and normal intellectual ability: a case series.

    Science.gov (United States)

    Yasuda, Yuka; Hashimoto, Ryota; Fukai, Ryoko; Okamoto, Nobuhiko; Hiraki, Yoko; Yamamori, Hidenaga; Fujimoto, Michiko; Ohi, Kazutaka; Taniike, Masako; Mohri, Ikuko; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Saitsu, Hirotomo; Matsumoto, Naomichi; Miyake, Noriko; Takeda, Masatoshi

    2014-01-01

    Autism spectrum disorder is a neurodevelopmental disorder characterized by impairments in social interactions, reduced verbal communication abilities, stereotyped repetitive behaviors, and restricted interests. It is a complex condition caused by genetic and environmental factors; the high heritability of this disorder supports the presence of a significant genetic contribution. Many studies have suggested that copy-number variants contribute to the etiology of autism spectrum disorder. Recently, copy-number variants of the nephronophthisis 1 gene have been reported in patients with autism spectrum disorder. To the best of our knowledge, only six autism spectrum disorder cases with duplications of the nephronophthisis 1 gene have been reported. These patients exhibited intellectual dysfunction, including verbal dysfunction in one patient, below-average verbal intellectual ability in one patient, and intellectual disability in four patients. In this study, we identified nephronophthisis 1 duplications in two unrelated Japanese patients with autism spectrum disorder using a high-resolution single-nucleotide polymorphism array. This report is the first to describe a nephronophthisis 1 duplication in an autism spectrum disorder patient with an average verbal intelligence quotient and an average performance intelligence quotient. However, the second autism spectrum disorder patient with a nephronophthisis 1 duplication had a below-average performance intelligence quotient. Neither patient exhibited physical dysfunction, motor developmental delay, or neurological abnormalities. This study supports the clinical observation of nephronophthisis 1 duplication in autism spectrum disorder cases and might contribute to our understanding of the clinical phenotype that arises from this duplication.

  7. Looking on the bright side of serotonin transporter gene variation.

    NARCIS (Netherlands)

    Homberg, J.R.; Lesch, K.P.

    2011-01-01

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for

  8. Integrated analyses of copy number variations and gene expression in lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Tzu-Pin Lu

    Full Text Available Numerous efforts have been made to elucidate the etiology and improve the treatment of lung cancer, but the overall five-year survival rate is still only 15%. Identification of prognostic biomarkers for lung cancer using gene expression microarrays poses a major challenge in that very few overlapping genes have been reported among different studies. To address this issue, we have performed concurrent genome-wide analyses of copy number variation and gene expression to identify genes reproducibly associated with tumorigenesis and survival in non-smoking female lung adenocarcinoma. The genomic landscape of frequent copy number variable regions (CNVRs in at least 30% of samples was revealed, and their aberration patterns were highly similar to several studies reported previously. Further statistical analysis for genes located in the CNVRs identified 475 genes differentially expressed between tumor and normal tissues (p<10(-5. We demonstrated the reproducibility of these genes in another lung cancer study (p = 0.0034, Fisher's exact test, and showed the concordance between copy number variations and gene expression changes by elevated Pearson correlation coefficients. Pathway analysis revealed two major dysregulated functions in lung tumorigenesis: survival regulation via AKT signaling and cytoskeleton reorganization. Further validation of these enriched pathways using three independent cohorts demonstrated effective prediction of survival. In conclusion, by integrating gene expression profiles and copy number variations, we identified genes/pathways that may serve as prognostic biomarkers for lung tumorigenesis.

  9. Common variation in fatty acid metabolic genes and risk of incident sudden cardiac arrest

    NARCIS (Netherlands)

    R.N. Lemaitre (Rozenn ); C.O. Johnson (Catherine); S. Hesselson (Stephanie); N. Sotoodhenia (Nona); B. McKnight (Barbara); C.M. Sitlani (Colleen); D. Rea (Dan); I.B. King (Irena); P.-Y. Kwok (Pui-Yan); A. Mak (Angel); G. Li (Guo); J. Brody (Jennifer); E.B. Larson (Eric); D. Mozaffarian (Dariush); B.M. Psaty (Bruce); A. Huertas-Vazquez (Adriana); J.-C. Tardif (Jean-Claude); C.M. Albert (Christine); L.-P. Lyytikäinen (Leo-Pekka); D.E. Arking (Dan); S. Kääb (Stefan); H.V. Huikuri (Heikki); B.P. Krijthe (Bouwe); M. Eijgelsheim (Mark); Y.A. Wang (Ying); K. Reinier (Kyndaron); T. Lehtimäki (Terho); S.L. Pulit (Sara); R. Brugada (Ramon); M. Müller-Nurasyid (Martina); C. Newton-Cheh (Christopher); P.J. Karhunen (Pekka); B.H.Ch. Stricker (Bruno); P. Goyette (Philippe); J.I. Rotter (Jerome); S.S. Chugh (Sumeet); A. Chakravarti (Aravinda); X. Jouven (Xavier); D.S. Siscovick (David)

    2014-01-01

    textabstractBackground There is limited information on genetic factors associated with sudden cardiac arrest (SCA). Objective To assess the association of common variation in genes in fatty acid pathways with SCA risk. Methods We selected 85 candidate genes and 1155 single nucleotide polymorphisms (

  10. Unraveling the regulatory mechanisms underlying tissue-dependent genetic variation of gene expression

    NARCIS (Netherlands)

    Fu, Jingyuan; Wolfs, Marcel G M; Deelen, Patrick; Westra, Harm Jan; Fehrmann, Rudolf S N; te Meerman, Gerhardus; Buurman, Wim A; Rensen, Sander S M; Groen, Hendricus; Weersma, Rinse K; van den Berg, Leonard H; Veldink, Jan; Ophoff, Roel A; Snieder, Harold; van Heel, David; Jansen, Ritsert C; Hofker, Marten H; Wijmenga, Cisca; Franke, Lude

    2012-01-01

    It is known that genetic variants can affect gene expression, but it is not yet completely clear through what mechanisms genetic variation mediate this expression. We therefore compared the cis-effect of single nucleotide polymorphisms (SNPs) on gene expression between blood samples from 1,240 human

  11. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    DEFF Research Database (Denmark)

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  12. Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment

    Science.gov (United States)

    Xu, Qin; Zhu, Caiyun; Fan, Yangyang; Song, Zhihong; Xing, Shilai; Liu, Wei; Yan, Juan; Sang, Tao

    2016-01-01

    Expression variation plays an important role in plant adaptation, but little is known about the factors impacting the expression variation when population adapts to changing environment. We used RNA-seq data from 80 individuals in 14 Miscanthus lutarioriparius populations, which were transplanted into a harsh environment from native habitat, to investigate the expression level, expression diversity and genetic diversity for genes expressed in both environments. The expression level of genes with lower expression level or without SNP tended to be more changeable in new environment, which suggested highly expressed genes experienced stronger purifying selection than those at lower level. Low proportion of genes with population effect confirmed the weak population structure and frequent gene flow in these populations. Meanwhile, the number of genes with environment effect was the most frequent compared with that with population effect. Our results showed that environment and genetic diversity were the main factors determining gene expression variation in population. This study could facilitate understanding the mechanisms of global gene expression variation when plant population adapts to changing environment. PMID:27150248

  13. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovari...

  14. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  15. NMDA receptor gene variations as modifiers in Huntington disease : a replication study

    NARCIS (Netherlands)

    Saft, Carsten; Epplen, Jörg T; Wieczorek, Stefan; Landwehrmeyer, G Bernhard; Roos, Raymund A C; de Yebenes, Justo Garcia; Dose, Matthias; Tabrizi, Sarah J; Craufurd, David; Arning, Larissa; Kremer, Berry

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN

  16. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  17. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    Science.gov (United States)

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  18. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  19. The Arabidopsis NPR1 gene confers broad-spectrum disease resistance in strawberry.

    Science.gov (United States)

    Silva, Katchen Julliany P; Brunings, Asha; Peres, Natalia A; Mou, Zhonglin; Folta, Kevin M

    2015-08-01

    Although strawberry is an economically important fruit crop worldwide, production of strawberry is limited by its susceptibility to a wide range of pathogens and the lack of major commercial cultivars with high levels of resistance to multiple pathogens. The objective of this study is to ectopically express the Arabidopsis thaliana NPR1 gene (AtNPR1) in the diploid strawberry Fragaria vesca L. and to test transgenic plants for disease resistance. AtNPR1 is a key positive regulator of the long-lasting broad-spectrum resistance known as systemic acquired resistance (SAR) and has been shown to confer resistance to a number of pathogens when overexpressed in Arabidopsis or ectopically expressed in several crop species. We show that ectopic expression of AtNPR1 in strawberry increases resistance to anthracnose, powdery mildew, and angular leaf spot, which are caused by different fungal or bacterial pathogens. The increased resistance is related to the relative expression levels of AtNPR1 in the transgenic plants. In contrast to Arabidopsis plants overexpressing AtNPR1, which grow normally and do not constitutively express defense genes, the strawberry transgenic plants are shorter than non-transformed controls, and most of them fail to produce runners and fruits. Consistently, most of the transgenic lines constitutively express the defense gene FvPR5, suggesting that the SAR activation mechanisms in strawberry and Arabidopsis are different. Nevertheless, our results indicate that overexpression of AtNPR1 holds the potential for generation of broad-spectrum disease resistance in strawberry.

  20. Interplanetary Magnetic Field Power Spectrum Variations in the Inner Heliosphere: A Wind and MESSENGER Study

    Science.gov (United States)

    Szabo, Adam; Koval, A.

    2011-01-01

    The newly reprocessed high time resolution (11/22 vectors/sec) Wind mission interplanetary magnetic field data and the similar observations made by the MESSENGER spacecraft in the inner heliosphere affords an opportunity to compare magnetic field power spectral density variations as a function of radial distance from the Sun under different solar wind conditions. In the reprocessed Wind Magnetic Field Investigation (MFI) data, the spin tone and its harmonics are greatly reduced that allows the meaningful fitting of power spectra to the approx.2 Hz limit above which digitization noise becomes apparent. The powe'r spectral density is computed and the spectral index is fitted for the MHD and ion inertial regime separately along with the break point between the two for various solar wind conditions. Wind and MESSENGER magnetic fluctuations are compared for times when the two spacecraft are close to radial and Parker field alignment. The functional dependence of the ion inertial spectral index and break point on solar wind plasma and magnetic field conditions will be discussed.

  1. Photoprotective and antioxidant responses to light spectrum and intensity variations in the coastal diatom Skeletonema marinoi.

    Science.gov (United States)

    Smerilli, Arianna; Orefice, Ida; Corato, Federico; Gavalás Olea, Antonio; Ruban, Alexander V; Brunet, Christophe

    2017-02-01

    Photosynthesis is known to produce reactive oxygen species together with the transformation of light into biochemical energy. To fill the gap of the knowledge on the protective antioxidant network of microalgae, a series of experiments to explore the role of spectral composition and intensity of light in the modulation of the photodefence mechanisms developed by the coastal diatom Skeletonema marinoi were performed. The modulation of the total phenolic content, ascorbic acid and the enzymes glutathione reductase, catalase, ascorbate peroxidase and superoxide dismutase together with xanthophyll cycle and non-photochemical quenching in response to variations in the light environment were analysed. Most of the enzymes' activity was promptly affected by the red light. Yet, the monochromatic high intensity blue light enhanced the synthesis of total phenolic content and ascorbic acid in parallel to the xanthophyll cycle activity. This study reveals the dual effects of spectral composition and intensity of light on the modulation of photoprotective mechanisms. Diatoms developed a complementary and/or alternative tuning processes to cope with the variable light environment they experience in the water column. They also provided valuable insights into light manipulation regimes for diatom cultivation that will help to maximize production of bioactive molecules. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. NUCLEOTIDE SEQUENCE VARIATION IN LEPTIN GENE OF MURRAH BUFFALO (BUBALUS BUBALIS

    Directory of Open Access Journals (Sweden)

    Sanjoy Datta

    2012-12-01

    Full Text Available Leptin is a 16 kD protein, synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility and immune functions. Present study was undertaken with the objectives of sequence characterization and studying the nucleotide variation in leptin gene in Murrah buffalo. The leptin gene consists of three exons and two introns which spans about 18.9kb, of which the first exon is not transcribed into protein. In buffaloes, the leptin gene is located on chromosome eight and maps to BBU 8q32. The leptin gene was amplified by PCR using oligonucleotide primers to obtain 289 bp fragment comprising of exon 2 and 405 bp fragment containing exon 3 of leptin gene. The amplicons were sequenced to identify variation at nucleotide level. Sequence comparison of buffalo with cattle reveals variation at five nucleotide sequences at positions 983, 1083, 1147, 1152, 1221 and all the SNPs are synonymous resulting no in change in amino acids. Three of these eight nucleotide variations have been reported for the first time in buffalo. The results indicate conservation of DNA sequence between cattle and buffalo. Nucleotide sequence variations observed at leptin gene between Bubalus bubalis and Bos taurus species revealed 97% nucleotide identity.

  3. Gene expression analysis in lymphoblasts derived from patients with autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Yasuda Yuka

    2011-05-01

    Full Text Available Abstract Background The autism spectrum disorders (ASDs are complex neurodevelopmental disorders that result in severe and pervasive impairment in the development of reciprocal social interaction and verbal and nonverbal communication skills. In addition, individuals with ASD have stereotypical behavior, interests and activities. Rare mutations of some genes, such as neuroligin (NLGN 3/4, neurexin (NRXN 1, SHANK3, MeCP2 and NHE9, have been reported to be associated with ASD. In the present study, we investigated whether alterations in mRNA expression levels of these genes could be found in lymphoblastoid cell lines derived from patients with ASD. Methods We measured mRNA expression levels of NLGN3/4, NRXN1, SHANK3, MeCP2, NHE9 and AKT1 in lymphoblastoid cells from 35 patients with ASD and 35 healthy controls, as well as from 45 patients with schizophrenia and 45 healthy controls, using real-time quantitative reverse transcriptase polymerase chain reaction assays. Results The mRNA expression levels of NLGN3 and SHANK3 normalized by β-actin or TBP were significantly decreased in the individuals with ASD compared to controls, whereas no difference was found in the mRNA expression level of MeCP2, NHE9 or AKT1. However, normalized NLGN3 and SHANK3 gene expression levels were not altered in patients with schizophrenia, and expression levels of NLGN4 and NRXN1 mRNA were not quantitatively measurable in lymphoblastoid cells. Conclusions Our results provide evidence that the NLGN3 and SHANK3 genes may be differentially expressed in lymphoblastoid cell lines from individuals with ASD compared to those from controls. These findings suggest the possibility that decreased mRNA expression levels of these genes might be involved in the pathophysiology of ASD in a substantial population of ASD patients.

  4. Linkage and candidate gene studies of autism spectrum disorders in European populations

    Science.gov (United States)

    Holt, Richard; Barnby, Gabrielle; Maestrini, Elena; Bacchelli, Elena; Brocklebank, Denise; Sousa, Inês; Mulder, Erik J; Kantojärvi, Katri; Järvelä, Irma; Klauck, Sabine M; Poustka, Fritz; Bailey, Anthony J; Monaco, Anthony P

    2010-01-01

    Over the past decade, research on the genetic variants underlying susceptibility to autism and autism spectrum disorders (ASDs) has focused on linkage and candidate gene studies. This research has implicated various chromosomal loci and genes. Candidate gene studies have proven to be particularly intractable, with many studies failing to replicate previously reported associations. In this paper, we investigate previously implicated genomic regions for a role in ASD susceptibility, using four cohorts of European ancestry. Initially, a 384 SNP Illumina GoldenGate array was used to examine linkage at six previously implicated loci. We identify linkage approaching genome-wide suggestive levels on chromosome 2 (rs2885116, MLOD=1.89). Association analysis showed significant associations in MKL2 with ASD (rs756472, P=4.31 × 10−5) and between SND1 and strict autism (rs1881084, P=7.76 × 10−5) in the Finnish and Northern Dutch populations, respectively. Subsequently, we used a second 384 SNP Illumina GoldenGate array to examine the association in seven candidate genes, and evidence for association was found in RELN (rs362780, P=0.00165). Further increasing the sample size strengthened the association with RELN (rs362780, P=0.001) and produced a second significant result in GRIK2 (rs2518261, P=0.008). Our results strengthen the case for a more detailed study of the role of RELN and GRIK2 in autism susceptibility, as well as identifying two new potential candidate genes, MKL2 and SND1. PMID:20442744

  5. Associations between Variation in X Chromosome Male Reproductive Genes and Sperm Competitive Ability in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Leah Greenspan

    2011-01-01

    Full Text Available Variation in reproductive success has long been thought to be mediated in part by genes encoding seminal proteins. Here we explore the effect on male reproductive phenotypes of X-linked polymorphisms, a chromosome that is depauperate in genes encoding seminal proteins. Using 57 X chromosome substitution lines, sperm competition was tested both when the males from the wild-extracted line were the first to mate (“defense” crosses, followed by a tester male, and when extracted-line males were the second to mate, after a tester male (“offfense” crosses. We scored the proportion of progeny sired by each male, the fecundity, the remating rate and refractoriness to remating, and tested the significance of variation among lines. Eleven candidate genes were chosen based on previous studies, and portions of these genes were sequenced in all 57 lines. A total of 131 polymorphisms were tested for associations with the reproductive phenotypes using linear models. Nine polymorphisms in 4 genes were found to show significant associations (at a 5% FDR. Overall, it appears that the X chromosomes harbor abundant variation in sperm competition, especially considering the paucity of seminal protein genes. This suggests that much of the male reproductive variation lies outside of genes that encode seminal proteins.

  6. A new approach to quantify the adaptive potential of gene expression variation in gymnosperms.

    Science.gov (United States)

    Renaut, Sébastien

    2013-05-01

    Variation in patterns of gene expression contributes to phenotypic diversity and can ultimately predict adaptive responses. However, in many cases, the consequences of regulatory mutations on patterns of gene expression and ultimately phenotypic differences remain elusive. A standard way to study the genetic architecture of expression variation in model systems has been to map gene expression variation to genetic loci (Fig. 1a). At the same time, in many nonmodel species, especially for long-lived organisms, controlled crosses are not feasible. If we are to expand our understanding of the role of regulatory mutations on phenotypes, we need to develop new methodologies to study species under ecologically relevant conditions. In this issue of Molecular Ecology, Verta et al. (2013) present a new approach to analyse gene expression variation and regulatory networks in gymnosperms (Fig. 1b). They capitalized on the fact that gymnosperm seeds contain an energy storage tissue (the megagametophyte) that is directly derived from a single haploid cell (the megaspore). The authors identified over 800 genes for which expression segregated in this maternally inherited haploid tissue. Based on the observed segregation patterns, these genes (Mendelian Expression Traits) are most probably controlled by biallelic variants at a single locus. Most of these genes also belonged to different regulatory networks, except for one large group of 180 genes under the control of a putative trans-acting factor. In addition, the approach developed here may also help to uncover the effect of rare recessive mutations, which usually remain hidden in a heterozygous state in diploid individuals. The appeal of the work by Verta et al. (2013) to study gene expression variation is in its simplicity, which circumvents several of the hurdles behind traditional expression quantitative trait locus (eQTL) studies, and could potentially be applied to a large number of species.

  7. Allelic variation in the NPY gene in 14 Indian populations.

    Science.gov (United States)

    Bhaskar, L V K S; Thangaraj, K; Shah, Anish M; Pardhasaradhi, G; Praveen Kumar, K; Reddy, A G; Papa Rao, A; Mulligan, C J; Singh, Lalji; Rao, V R

    2007-01-01

    NPY is a 36-aminoacid peptide expressed in several areas of the nervous system. Neuropeptide Y (NPY) receptors represent a widely diffused system that is involved in the regulation of multiple biological functions. The human NPY gene is located in chromosome 7. The functional significance of coding Leu7Pro polymorphism in the signal peptide of preproNPY is known. Six hundred and fifty four individuals of 14 ethnic Indian populations were screened for three mutations in the NPY gene, including Leu7Pro. We found that the Pro7 frequencies among the studied populations were much higher than in previous studies from other parts of the world. The highest allele frequency of Pro7 was detected in the Kota population in the Nilgiri Hill region of south India, and this may reflect a founder event in the past or genetic drift. All populations followed the Hardy-Weinberg equilibrium for the assayed markers. A total of five haplotypes were observed, only two of which were found to occur with a high frequency in all populations. No linkage disequilibrium (LD) was observed across the tested alleles in any population with the exception of Leu7Pro and Ser50Ser in the Badaga population (chi(2) = 13.969; p = 0.0001).

  8. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Valeria Paula Carreira

    Full Text Available Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may

  9. Chimpanzee sociability is associated with vasopressin (Avpr1a) but not oxytocin receptor gene (OXTR) variation.

    Science.gov (United States)

    Staes, Nicky; Koski, Sonja E; Helsen, Philippe; Fransen, Erik; Eens, Marcel; Stevens, Jeroen M G

    2015-09-01

    The importance of genes in regulating phenotypic variation of personality traits in humans and animals is becoming increasingly apparent in recent studies. Here we focus on variation in the vasopressin receptor gene 1a (Avpr1a) and oxytocin receptor gene (OXTR) and their effects on social personality traits in chimpanzees. We combine newly available genetic data on Avpr1a and OXTR allelic variation of 62 captive chimpanzees with individual variation in personality, based on behavioral assessments. Our study provides support for the positive association of the Avpr1a promoter region, in particular the presence of DupB, and sociability in chimpanzees. This complements findings of previous studies on adolescent chimpanzees and studies that assessed personality using questionnaire data. In contrast, no significant associations were found for the single nucleotide polymorphism (SNP) ss1388116472 of the OXTR and any of the personality components. Most importantly, our study provides additional evidence for the regulatory function of the 5' promoter region of Avpr1a on social behavior and its evolutionary stable effect across species, including rodents, chimpanzees and humans. Although it is generally accepted that complex social behavior is regulated by a combination of genes, the environment and their interaction, our findings highlight the importance of candidate genes with large effects on behavioral variation.

  10. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2012-06-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is transformed via the didactic transposition into school science textbooks. The results indicate that a common textbook discourse on genes and their function exist in textbooks from the different countries. The structure of science as represented by conceptual variation and the use of multiple models was present in all the textbooks. However, the existence of conceptual variation and multiple models is implicit in these textbooks, i.e., the phenomenon of conceptual variation and multiple models are not addressed explicitly, nor its consequences and, thus, it ends up introducing conceptual incoherence about the gene concept and its function within the textbooks. We conclude that within the found textbook-discourse ontological aspects of the academic disciplines of genetics and molecular biology were retained, but without their epistemological underpinnings; these are lost in the didactic transposition. These results are of interest since students might have problems reconstructing the correct scientific understanding from the transformed school science knowledge as depicted within the high school textbooks. Implications for textbook writing as well as teaching are discussed in the paper.

  11. Degranulation of rat cerebellum induces selective variations in gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Eliyahu, D.; Soreq, H.

    1982-02-01

    Selective variations in the composition of poly(A)-containing mRNA were found to be induced in the rat cerebellum by X-irradiation. mRNA populations prepared from normal and X-irradiated rat cerebella at different stages of their development displayed equal efficiencies when translated in vitro in reticulocyte lysates. Specific differences were revealed, however, when the labeled translation products of both mRNA preparations were subjected to two-dimensional gel electrophoresis followed by fluorography of the dried gels. Of more than 100 polypeptide products, several showed marked intensity differences, indicating changes in the abundance of their directing mRNA species. These differences appear both in developing and in mature cerebellar mRNA, and the extent of modification in mRNA is much higher than the consequent changes in the composition of proteins in the irradiated cerebellum. The degranulation-induced modifications in levels of specific cerebellar mRNA species can be used to identify proteins whose biosynthesis depends on the presence of interneurons.

  12. Gene Silencing and Antigenic Variation in Malaria Parasites

    Directory of Open Access Journals (Sweden)

    Kirk W. Deitsch

    2001-01-01

    Full Text Available Malaria remains one of the most important infectious diseases in the world today, infecting 300 to 500 million people yearly and resulting in 1 to 2 million deaths, primarily of young African children[1]. The most severe form of this disease is caused by infection with the mosquito borne protozoan parasite Plasmodium falciparum. This parasite lives by invading and multiplying within the red blood cells of its host, causing disease through anemia resulting from red cell destruction, and also through modifications made to the surface of infected red cells. These modifications make infected cells cytoadherent or “sticky”, allowing them to adhere to the walls of blood vessels, leading to obstruction of blood flow and such clinical manifestations as the often fatal syndrome of cerebral malaria[2]. In addition, parasites are capable of undergoing antigenic variation, a process of continually changing the identity of proteins on the surface of infected cells and thus avoiding the immune response mounted by the host[3]. This process promotes a long term, persistent infection that is difficult to clear.

  13. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  14. Gene diversity and genetic variation in lung flukes (genus Paragonimus).

    Science.gov (United States)

    Blair, David; Nawa, Yukifumi; Mitreva, Makedonka; Doanh, Pham Ngoc

    2016-01-01

    Paragonimiasis caused by lung flukes (genus Paragonimus) is a neglected disease occurring in Asia, Africa and the Americas. The genus is species-rich, ancient and widespread. Genetic diversity is likely to be considerable, but investigation of this remains confined to a few populations of a few species. In recent years, studies of genetic diversity have moved from isoenzyme analysis to molecular phylogenetic analysis based on selected DNA sequences. The former offered better resolution of questions relating to allelic diversity and gene flow, whereas the latter is more suitable for questions relating to molecular taxonomy and phylogeny. A picture is emerging of a highly diverse taxon of parasites, with the greatest diversity found in eastern and southern Asia where ongoing speciation might be indicated by the presence of several species complexes. Diversity of lung flukes in Africa and the Americas is very poorly sampled. Functional molecules that might be of value for immunodiagnosis, or as targets for medical intervention, are of great interest. Characterisation of these from Paragonimus species has been ongoing for a number of years. However, the imminent release of genomic and transcriptomic data for several species of Paragonimus will dramatically increase the rate of discovery of such molecules, and illuminate their diversity within and between species.

  15. [Association of schizophrenia with variations in genes encoding transcription factors].

    Science.gov (United States)

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  16. Genetic variation in V gene of class II Newcastle disease virus.

    Science.gov (United States)

    Hao, Huafang; Chen, Shengli; Liu, Peng; Ren, Shanhui; Gao, Xiaolong; Wang, Yanping; Wang, Xinglong; Zhang, Shuxia; Yang, Zengqi

    2016-01-01

    The genetic variation and molecular evolution of the V gene of the class II Newcastle disease virus (NDV) isolates with genotypes I-XVIII were determined using bioinformatics. Results indicated that low homology existed in different genotype viruses, whereas high homology often for the same genotypes, exception may be existed within genotypes I, V, VI, and XII. Sequence analysis showed that the genetic variation of V protein was consistent with virus genotype, and specific signatures on the V protein for nine genotypes were identified. Phylogenetic analysis demonstrated that the phylogenetic trees were highly consistent between the V and F genes, with slight discrepancies in the sub-genotypes. Evolutionary rate analyses based on V and F genes revealed the evolution rates varied in genotypes. These data indicate that the genetic variation of V protein is genotype-related and will help in elucidating the molecular evolution of NDV.

  17. Common variation of the CYP17 gene in Iraqi women with endometriosis disease.

    Science.gov (United States)

    Al-Rubae'i, Salwa H N; Naji, Tamara Sami; Turki, Kisma M

    2017-03-01

    Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17), a gene that codes for a key enzyme (cytochrome P450c17a1) in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23-46), the associations between selected single-nucleotide polymorphisms (SNPs) in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01)between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01) in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  18. Common variation of the CYP17 gene in Iraqi women with endometriosis disease

    Directory of Open Access Journals (Sweden)

    Salwa H.N. Al-Rubae'i

    2017-03-01

    Full Text Available Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17, a gene that codes for a key enzyme (cytochrome P450c17a1 in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23–46, the associations between selected single-nucleotide polymorphisms (SNPs in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01 in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  19. The oxytocin receptor gene (OXTR) is associated with autism spectrum disorder: a meta-analysis.

    Science.gov (United States)

    LoParo, D; Waldman, I D

    2015-05-01

    The oxytocin receptor gene (OXTR) has been studied as a risk factor for autism spectrum disorder (ASD) owing to converging evidence from multiple levels of analysis that oxytocin (OXT) has an important role in the regulation of affiliative behavior and social bonding in both nonhuman mammals and humans. Inconsistency in the effect sizes of the OXTR variants included in association studies render it unclear whether OXTR is truly associated with ASD, and, if so, which OXTR single-nucleotide polymorphisms (SNPs) are associated. Thus, a meta-analytic review of extant studies is needed to determine whether OXTR shows association with ASD, and to elucidate which specific SNPs have a significant effect on ASD. The current meta-analysis of 16 OXTR SNPs included 3941 individuals with ASD from 11 independent samples, although analyses of each individual SNP included a subset of this total. We found significant associations between ASD and the SNPs rs7632287, rs237887, rs2268491 and rs2254298. OXTR was also significantly associated with ASD in a gene-based test. The current meta-analysis is the largest and most comprehensive investigation of the association of OXTR with ASD and the findings suggest directions for future studies of the etiology of ASD.

  20. Reelin gene variants and risk of autism spectrum disorders: an integrated meta-analysis.

    Science.gov (United States)

    Wang, Zhenling; Hong, Yuan; Zou, Li; Zhong, Rong; Zhu, Beibei; Shen, Na; Chen, Wei; Lou, Jiao; Ke, Juntao; Zhang, Ti; Wang, Weipeng; Miao, Xiaoping

    2014-03-01

    Autism spectrum disorder (ASD) is a severe neurological disorder with a high degree of heritability. Reelin gene (RELN), which plays a crucial role in the migration and positioning of neurons during brain development, has been strongly posed as a candidate gene for ASD. Genetic variants in RELN have been investigated as risk factors of ASD in numerous epidemiologic studies but with inconclusive results. To clearly discern the effects of RELN variants on ASD, the authors conducted a meta-analysis integrating case-control and transmission disequilibrium test (TDT) studies published through 2001 to 2013. Odds ratios (ORs) with 95% confidence intervals were used to estimate the associations between three RELN variants (rs736707, rs362691, and GGC repeat variant) and ASD. In overall meta-analysis, the summary ORs for rs736707, rs362691, and GGC repeat variant were 1.11 [95% confidence interval (CI): 0.80-1.54], 0.69 (95% CI: 0.56-0.86), and 1.09 (95% CI: 0.97-1.23), respectively. Besides, positive result was also obtained in subgroup of broadly-defined ASD for rs362691 (OR = 0.67, 95% CI: 0.52-0.86). Our meta-analysis revealed that the RELN rs362691, rather than rs736707 or GGC repeat variant, might contribute significantly to ASD risk. © 2014 Wiley Periodicals, Inc.

  1. Investigation of variation in gene expression profiling of human blood by extended principle component analysis.

    Directory of Open Access Journals (Sweden)

    Qinghua Xu

    Full Text Available BACKGROUND: Human peripheral blood is a promising material for biomedical research. However, various kinds of biological and technological factors result in a large degree of variation in blood gene expression profiles. METHODOLOGY/PRINCIPAL FINDINGS: Human peripheral blood samples were drawn from healthy volunteers and analysed using the Human Genome U133Plus2 Microarray. We applied a novel approach using the Principle Component Analysis and Eigen-R(2 methods to dissect the overall variation of blood gene expression profiles with respect to the interested biological and technological factors. The results indicated that the predominating sources of the variation could be traced to the individual heterogeneity of the relative proportions of different blood cell types (leukocyte subsets and erythrocytes. The physiological factors like age, gender and BMI were demonstrated to be associated with 5.3% to 9.2% of the total variation in the blood gene expression profiles. We investigated the gene expression profiles of samples from the same donors but with different levels of RNA quality. Although the proportion of variation associated to the RNA Integrity Number was mild (2.1%, the significant impact of RNA quality on the expression of individual genes was observed. CONCLUSIONS: By characterizing the major sources of variation in blood gene expression profiles, such variability can be minimized by modifications to study designs. Increasing sample size, balancing confounding factors between study groups, using rigorous selection criteria for sample quality, and well controlled experimental processes will significantly improve the accuracy and reproducibility of blood transcriptome study.

  2. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.

    2002-01-01

    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  3. NMDA receptor gene variations as modifiers in Huntington disease: a replication study

    OpenAIRE

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN2A and GRIN2B in the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). The analyses did replicate the association reported between the GRIN2A rs2650427 variation and AO in the ...

  4. Dysferlin Gene Mutation Spectrum in a Large Cohort of Chinese Patients with Dysferlinopathy

    Science.gov (United States)

    Jin, Su-Qin; Yu, Meng; Zhang, Wei; Lyu, He; Yuan, Yun; Wang, Zhao-Xia

    2016-01-01

    Background: Dysferlinopathy is caused by mutations in the dysferlin (DYSF) gene. Here, we described the genetic features of a large cohort of Chinese patients with this disease. Methods: Eighty-nine index patients were included in the study. DYSF gene analysis was performed by Sanger sequencing in 41 patients and targeted next generation sequencing (NGS) in 48 patients. Multiplex ligation-dependent probe amplification (MLPA) was performed to detect exon duplication/deletion in patients with only one pathogenic mutation. Results: Among the 89 index patients, 79 patients were demonstrated to carry two disease-causing (73 cases) or possibly disease-causing mutations (6 cases), including 26 patients with homozygous mutations. We identified 105 different mutations, including 59 novel ones. Notably, in 13 patients in whom only one pathogenic mutation was initially found by Sanger sequencing or NGS, 3 were further identified to carry exon deletions by MLPA. The mutations identified in this study appeared to cluster in the N-terminal region. Mutation types included missense mutations (30.06%), nonsense mutations (17.18%), frameshift mutations (30.67%), in-frame deletions (2.45%), intronic mutations (17.79%), and exonic rearrangement (1.84%). No genotype-phenotype correlation was identified. Conclusions: DYSF mutations in Chinese patients clustered in the N-terminal region of the gene. Exonic rearrangements were found in 23% of patients with only one pathogenic mutation identified by Sanger sequencing or NGS. The novel mutations found in this study greatly expanded the mutational spectrum of dysferlinopathy. PMID:27647186

  5. Dysferlin Gene Mutation Spectrum in a Large Cohort of Chinese Patients with Dysferlinopathy

    Institute of Scientific and Technical Information of China (English)

    Su-Qin Jin; Meng Yu; Wei Zhang; He Lyu; Yun Yuan; Zhao-Xia Wang

    2016-01-01

    Background:Dysferlinopathy is caused by mutations in the dysferlin (DYSF) gene.Here,we described the genetic features of a large cohort of Chinese patients with this disease.Methods:Eighty-nine index patients were included in the study.DYSF gene analysis was performed by Sanger sequencing in 41 patients and targeted next generation sequencing (NGS) in 48 patients.Multiplex ligation-dependent probe amplification (MLPA) was performed to detect exon duplication/deletion in patients with only one pathogenic mutation.Results:Among the 89 index patients,79 patients were demonstrated to carry two disease-causing (73 cases) or possibly disease-causing mutations (6 cases),including 26 patients with homozygous mutations.We identified 105 different mutations,including 59 novel ones.Notably,in 13 patients in whom only one pathogenic mutation was initially found by Sanger sequencing or NGS,3 were further identified to carry exon deletions by MLPA.The mutations identified in this study appeared to cluster in the N-terminal region.Mutation types included missense mutations (30.06%),nonsense mutations (1 7.18%),frameshift mutations (30.67%),in-frame deletions (2.45%),intronic mutations (17.79%),and exonic rearrangement (1.84%).No genotype-phenotype correlation was identified.Conclusions:DYSF mutations in Chinese patients clustered in the N-terminal region of the gene.Exonic rearrangements were found in 23% of patients with only one pathogenic mutation identified by Sanger sequencing or NGS.The novel mutations found in this study greatly expanded the mutational spectrum of dysferlinopathy.

  6. Genetic variation in telomere maintenance genes in relation to ovarian cancer survival.

    Science.gov (United States)

    Harris, Holly R; Vivo, Immaculata De; Titus, Linda J; Vitonis, Allison F; Wong, Jason Y Y; Cramer, Daniel W; Terry, Kathryn L

    2012-01-01

    Telomeres are repetitive non-coding DNA sequences at the ends of chromosomes that provide protection against chromosomal instability. Telomere length and stability are influenced by proteins, including telomerase which is partially encoded by the TERT gene. Genetic variation in the TERT gene is associated with ovarian cancer risk, and predicts survival in lung cancer and glioma. We investigated whether genetic variation in five telomere maintenance genes was associated with survival among 1480 cases of invasive epithelial ovarian cancer in the population-based New England Case-Control Study. Cox proportional hazard models were used to calculate hazard ratios and 95% confidence intervals. Overall we observed no significant associations between SNPs in telomere maintenance genes and mortality using a significance threshold of p=0.001. However, we observed some suggestive associations in subgroup analyses. Future studies with larger populations may further our understanding of what role telomeres play in ovarian cancer survival.

  7. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Directory of Open Access Journals (Sweden)

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  8. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Science.gov (United States)

    Porto-Neto, Laercio R.; Fortes, Marina R. S.; McWilliam, Sean M.; Lehnert, Sigrid A.; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10−5). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  9. Variation.

    Science.gov (United States)

    Hamilton City Board of Education (Ontario).

    Suggestions for studying the topic of variation of individuals and objects (balls) to help develop elementary school students' measurement, comparison, classification, evaluation, and data collection and recording skills are made. General suggestions of variables that can be investigated are made for the study of human variation. Twelve specific…

  10. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  11. Exploiting natural variation in Saccharomyces cerevisiae to identify genes for increased ethanol resistance.

    Science.gov (United States)

    Lewis, Jeffrey A; Elkon, Isaac M; McGee, Mick A; Higbee, Alan J; Gasch, Audrey P

    2010-12-01

    Ethanol production from lignocellulosic biomass holds promise as an alternative fuel. However, industrial stresses, including ethanol stress, limit microbial fermentation and thus prevent cost competitiveness with fossil fuels. To identify novel engineering targets for increased ethanol tolerance, we took advantage of natural diversity in wild Saccharomyces cerevisiae strains. We previously showed that an S288c-derived lab strain cannot acquire higher ethanol tolerance after a mild ethanol pretreatment, which is distinct from other stresses. Here, we measured acquired ethanol tolerance in a large panel of wild strains and show that most strains can acquire higher tolerance after pretreatment. We exploited this major phenotypic difference to address the mechanism of acquired ethanol tolerance, by comparing the global gene expression response to 5% ethanol in S288c and two wild strains. Hundreds of genes showed variation in ethanol-dependent gene expression across strains. Computational analysis identified several transcription factor modules and known coregulated genes as differentially expressed, implicating genetic variation in the ethanol signaling pathway. We used this information to identify genes required for acquisition of ethanol tolerance in wild strains, including new genes and processes not previously linked to ethanol tolerance, and four genes that increase ethanol tolerance when overexpressed. Our approach shows that comparative genomics across natural isolates can quickly identify genes for industrial engineering while expanding our understanding of natural diversity.

  12. Detection, Validation, and Downstream Analysis of Allelic Variation in Gene Expression

    Science.gov (United States)

    Ciobanu, Daniel C.; Lu, Lu; Mozhui, Khyobeni; Wang, Xusheng; Jagalur, Manjunatha; Morris, John A.; Taylor, William L.; Dietz, Klaus; Simon, Perikles; Williams, Robert W.

    2010-01-01

    Common sequence variants within a gene often generate important differences in expression of corresponding mRNAs. This high level of local (allelic) control—or cis modulation—rivals that produced by gene targeting, but expression is titrated finely over a range of levels. We are interested in exploiting this allelic variation to study gene function and downstream consequences of differences in expression dosage. We have used several bioinformatics and molecular approaches to estimate error rates in the discovery of cis modulation and to analyze some of the biological and technical confounds that contribute to the variation in gene expression profiling. Our analysis of SNPs and alternative transcripts, combined with eQTL maps and selective gene resequencing, revealed that between 17 and 25% of apparent cis modulation is caused by SNPs that overlap probes rather than by genuine quantitative differences in mRNA levels. This estimate climbs to 40–50% when qualitative differences between isoform variants are included. We have developed an analytical approach to filter differences in expression and improve the yield of genuine cis-modulated transcripts to ∼80%. This improvement is important because the resulting variation can be successfully used to study downstream consequences of altered expression on higher-order phenotypes. Using a systems genetics approach we show that two validated cis-modulated genes, Stk25 and Rasd2, are likely to control expression of downstream targets and affect disease susceptibility. PMID:19884314

  13. Disseminated cysticercosis: clinical spectrum, Toll-like receptor-4 gene polymorphisms and role of albendazole

    Science.gov (United States)

    Qavi, Abdul; Garg, Ravindra Kumar; Malhotra, Hardeep Singh; Jain, Amita; Kumar, Neeraj; Malhotra, Kiran Preet; Srivastava, Pradeep Kumar; Verma, Rajesh; Sharma, Praveen Kumar

    2016-01-01

    Abstract In this study, we describe clinical and imaging spectrum, and the natural course of patients with disseminated cysticercosis. How albendazole affects the course of disease has also been evaluated. We assessed the Toll-like receptor-4 gene polymorphisms, to know the reason for the apparently higher prevalence of disseminated cysticercosis in India. Sixty consecutive patients with disseminated cysticercosis were enrolled. Sixty age-and-sex-matched healthy controls were also enrolled for the purpose of genetic study. Twenty patients, who gave consent, were treated with albendazole along with corticosteroids. Forty patients did not give consent for antiparasitic therapy. Assessment for Toll-like receptor-4 gene polymorphisms (Asp299Gly and Thr399Ile genes) was done. Patients were followed for 6 months. We also performed a literature search of cases published in English language using PubMed electronic database and analyzed 56 cases thus available. There was an increased risk (6.63 fold and 4.61 fold) of disseminated cysticercosis in the presence of Asp299Gly and Thr399Ile polymorphisms in Toll-like receptor-4, respectively. The allelic frequency of Gly (11% vs. 3%, P = 0.024, odds ratio [OR] = 3.52) and Ile alleles (11% vs. 2%, P = 0.009, OR = 4.738) in disseminated cysticercosis was high. Albendazole resulted in complete disappearance of all cerebral lesions in 35% (7/20) patients and reduction in lesion load in remaining 65% (13/20) patients. No significant change in number of cysticercal lesion was noted in patients who did not receive albendazole. No major adverse reaction following antiparasitic treatment was noted. Three deaths were recorded in patients who did not receive antiparasitic treatment. Of the 56 cases reported in PubMed, 33 patients received antiparasitic treatment with follow-up data available for 31 patients. Most (24) of these patients received albendazole. A significant clinical and/or imaging improvements, on follow up, were observed in

  14. Structural variation of the ribosomal gene cluster within the class Insecta

    Energy Technology Data Exchange (ETDEWEB)

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V. [Vavilov Institute of General Genetics, Moscow (Russian Federation)] [and others

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  15. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Directory of Open Access Journals (Sweden)

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  16. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  17. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    DEFF Research Database (Denmark)

    Song, H.; Hogdall, E.; Ramus, S.J.

    2008-01-01

    PURPOSE: Somatic alterations have been shown to correlate with ovarian cancer prognosis and survival, but less is known about the effects on survival of common inherited genetic variation. Of particular interest are genes involved in cell cycle pathways, which regulate cell division and could pla...

  18. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Directory of Open Access Journals (Sweden)

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  19. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Science.gov (United States)

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  20. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  1. Gene expression profiles deciphering leaf senescence variation between early- and late-senescence cotton lines.

    Directory of Open Access Journals (Sweden)

    Xiangqiang Kong

    Full Text Available Leaf senescence varies greatly among genotypes of cotton (Gossypium hirsutium L, possibly due to the different expression of senescence-related genes. To determine genes involved in leaf senescence, we performed genome-wide transcriptional profiling of the main-stem leaves of an early- (K1 and a late-senescence (K2 cotton line at 110 day after planting (DAP using the Solexa technology. The profiling analysis indicated that 1132 genes were up-regulated and 455 genes down-regulated in K1 compared with K2 at 110 DAP. The Solexa data were highly consistent with, and thus were validated by those from real-time quantitative PCR (RT-PCR. Most of the genes related to photosynthesis, anabolism of carbohydrates and other biomolecules were down-regulated, but those for catabolism of proteins, nucleic acids, lipids and nutrient recycling were mostly up-regulated in K1 compared with K2. Fifty-one differently expressed hormone-related genes were identified, of which 5 ethylene, 3 brassinosteroid (BR, 5 JA, 18 auxin, 8 GA and 1 ABA related genes were up-regulated in K1 compared with K2, indicating that these hormone-related genes might play crucial roles in early senescence of K1 leaves. Many differently expressed transcription factor (TF genes were identified and 11 NAC and 8 WRKY TF genes were up-regulated in K1 compared with K2, suggesting that TF genes, especially NAC and WRKY genes were involved in early senescence of K1 leaves. Genotypic variation in leaf senescence was attributed to differently expressed genes, particularly hormone-related and TF genes.

  2. The role of β3 integrin gene variants in Autism Spectrum Disorders--diagnosis and symptomatology.

    Science.gov (United States)

    Schuch, Jaqueline Bohrer; Muller, Diana; Endres, Renata Giuliani; Bosa, Cleonice Alves; Longo, Dânae; Schuler-Faccini, Lavinia; Ranzan, Josiane; Becker, Michele Michelin; dos Santos Riesgo, Rudimar; Roman, Tatiana

    2014-12-10

    Autism Spectrum Disorders (ASDs) represent a group of very complex early-onset neurodevelopmental diseases. In this study, we analyzed 5 SNPs (rs2317385, rs5918, rs15908, rs12603582, rs3809865) at the β3 integrin locus (ITGB3), which has been suggested as a possible susceptibility gene, both as single markers and as part of haplotypes in 209 ASD children and their biological parents. We tested for association with the following: a) DSM-IV ASD diagnosis; b) clinical symptoms common in ASD patients (repetitive behaviors, echolalia, seizures and epilepsy, mood instability, aggression, psychomotor agitation, sleep disorders); and c) dimensional scores obtained with the Autism Screening Questionnaire and the Childhood Autism Rating Scale. These hypotheses were investigated using family-based tests, logistic regression models and analysis of covariance. The family-based tests showed an association with the H5 haplotype (composed by GTCGA alleles, the order of SNPs as above), which was transmitted less often than expected by chance (P=0.006; Pcorr=0.036). The analyses of the clinical symptoms showed a trend for an association with rs12603582 (P=0.008; Pcorr=0.064) and positive results for the haplotype composed of rs15908 and rs12603582 (Pglcorr=0.048; Pindcorr=0.015), both in symptoms of echolalia. Other nominal associations with different variants were found and involved epilepsy/seizures, aggression symptoms and higher ASQ scores. Although our positive results are not definitive, they suggest small effect associations of the ITGB3 gene with both ASD diagnosis and symptoms of echolalia. Other studies are nonetheless needed to fully understand the involvement of this locus on the etiology of ASDs and its different clinical aspects.

  3. Variation in gene expression patterns in effusions and primary tumors from serous ovarian cancer patients

    Directory of Open Access Journals (Sweden)

    Tropè Claes G

    2005-07-01

    Full Text Available Abstract Background While numerous studies have characterized primary ovarian tumors, little information is available regarding expression patterns of metastatic sites of this cancer. To define sets of genes that distinguish primary and metastatic ovarian tumors, we used cDNA microarrays to characterize global gene expression patterns in 38 effusions (28 peritoneal, 10 pleural and 8 corresponding primary ovarian tumors, and searched for associations between expression patterns and clinical parameters. Results We observed multidimensional variation in expression patterns among the cancers. Coordinate variation in expression of genes from two chromosomal regions, 8q and 19q, was seen in subsets of the cancers indicating possible amplifications in these regions. A set of 112 unique genes of known function was differentially expressed between primary tumors and effusions using supervised analysis. Relatively few differences were seen between effusions isolated from the pleural and peritoneal cavities or between effusions from patients diagnosed with stage III and stage IV cancers. A set of 84 unique genes was identified that distinguished high from lower grade ovarian cancers. The results were corroborated using immunocytochemistry, mRNA in situ hybridization, and immunoblotting. Conclusion The extensive variation in expression patterns observed underscores the molecular heterogeneity of ovarian cancer, but suggests a similar molecular profile for ovarian carcinoma cells in serosal cavities.

  4. Clinical spectrum of obesity and mutations in the melanocortin 4 receptor gene.

    Science.gov (United States)

    Farooqi, I Sadaf; Keogh, Julia M; Yeo, Giles S H; Lank, Emma J; Cheetham, Tim; O'Rahilly, Stephen

    2003-03-20

    Melanocortin 4 receptor (MC4R) deficiency is the commonest monogenic form of obesity. However, the clinical spectrum and mode of inheritance have not been defined, pathophysiological mechanisms leading to obesity are poorly understood, and there is little information regarding genotype-phenotype correlations. We determined the nucleotide sequence of the MC4R gene in 500 probands with severe childhood obesity. Family studies were undertaken to examine cosegregation of identified mutations with obesity. Subjects with MC4R deficiency underwent metabolic and endocrine evaluation; the results were correlated with the signaling properties of mutant receptors. Twenty-nine probands (5.8 percent) had mutations in MC4R; 23 were heterozygous, and 6 were homozygous. Mutation carriers had severe obesity, increased lean mass, increased linear growth, hyperphagia, and severe hyperinsulinemia; homozygotes were more severely affected than heterozygotes. Subjects with mutations retaining residual signaling capacity had a less severe phenotype. Mutations in MC4R result in a distinct obesity syndrome that is inherited in a codominant manner. Mutations leading to complete loss of function are associated with a more severe phenotype. The correlation between the signaling properties of these mutant receptors and energy intake emphasizes the key role of this receptor in the control of eating behavior in humans. Copyright 2003 Massachusetts Medical Society

  5. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  6. Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer.

    Science.gov (United States)

    Pearlman, Rachel; Frankel, Wendy L; Swanson, Benjamin; Zhao, Weiqiang; Yilmaz, Ahmet; Miller, Kristin; Bacher, Jason; Bigley, Christopher; Nelsen, Lori; Goodfellow, Paul J; Goldberg, Richard M; Paskett, Electra; Shields, Peter G; Freudenheim, Jo L; Stanich, Peter P; Lattimer, Ilene; Arnold, Mark; Liyanarachchi, Sandya; Kalady, Matthew; Heald, Brandie; Greenwood, Carla; Paquette, Ian; Prues, Marla; Draper, David J; Lindeman, Carolyn; Kuebler, J Philip; Reynolds, Kelly; Brell, Joanna M; Shaper, Amy A; Mahesh, Sameer; Buie, Nicole; Weeman, Kisa; Shine, Kristin; Haut, Mitchell; Edwards, Joan; Bastola, Shyamal; Wickham, Karen; Khanduja, Karamjit S; Zacks, Rosemary; Pritchard, Colin C; Shirts, Brian H; Jacobson, Angela; Allen, Brian; de la Chapelle, Albert; Hampel, Heather

    2017-04-01

    Hereditary cancer syndromes infer high cancer risks and require intensive cancer surveillance, yet the prevalence and spectrum of these conditions among unselected patients with early-onset colorectal cancer (CRC) is largely undetermined. To determine the frequency and spectrum of cancer susceptibility gene mutations among patients with early-onset CRC. Overall, 450 patients diagnosed with colorectal cancer younger than 50 years were prospectively accrued from 51 hospitals into the Ohio Colorectal Cancer Prevention Initiative from January 1, 2013, to June 20, 2016. Mismatch repair (MMR) deficiency was determined by microsatellite instability and/or immunohistochemistry. Germline DNA was tested for mutations in 25 cancer susceptibility genes using next-generation sequencing. Mutation prevalence and spectrum in patients with early-onset CRC was determined. Clinical characteristics were assessed by mutation status. In total 450 patients younger than 50 years were included in the study, and 75 gene mutations were found in 72 patients (16%). Forty-eight patients (10.7%) had MMR-deficient tumors, and 40 patients (83.3%) had at least 1 gene mutation: 37 had Lynch syndrome (13, MLH1 [including one with constitutional MLH1 methylation]; 16, MSH2; 1, MSH2/monoallelic MUTYH; 2, MSH6; 5, PMS2); 1 patient had the APC c.3920T>A, p.I1307K mutation and a PMS2 variant; 9 patients (18.8%) had double somatic MMR mutations (including 2 with germline biallelic MUTYH mutations); and 1 patient had somatic MLH1 methylation. Four hundred two patients (89.3%) had MMR-proficient tumors, and 32 patients (8%) had at least 1 gene mutation: 9 had mutations in high-penetrance CRC genes (5, APC; 1, APC/PMS2; 2, biallelic MUTYH; 1, SMAD4); 13 patients had mutations in high- or moderate-penetrance genes not traditionally associated with CRC (3, ATM; 1, ATM/CHEK2; 2, BRCA1; 4, BRCA2; 1, CDKN2A; 2, PALB2); 10 patients had mutations in low-penetrance CRC genes (3, APC c.3920T>A, p.I1307K; 7

  7. Poly(T) variation within mitochondrial protein-coding genes in Globodera (Nematoda: Heteroderidae).

    Science.gov (United States)

    Riepsamen, Angelique H; Blok, Vivian C; Phillips, Mark; Gibson, Tracey; Dowton, Mark

    2008-03-01

    We sequenced a mitochondrial subgenome from the nematode Globodera rostochiensis, in two overlapping pieces. The subgenome was 9210 bp and contained four protein-coding genes (ND4, COIII, ND3, Cytb) and two tRNA genes (tRNA(Thr), tRNA(Gln)). Genome organization was similar to that of Globodera pallida, which is multipartite. Together with the small number of genes on this subgenome, this suggests that the mitochondrial genome of G. rostochiensis is also multipartite. In the initial clones sequenced, COIII and ND3 were full-length, while ND4 and Cytb were interrupted by premature stop codons and contained point indels that disrupted the reading frame. However, sequencing of multiple clones, from DNA extracted both from multiple individuals and from single cysts, revealed a predominant source of variation-in the length of polythymidine tracts. Comparison of our genomic sequences with ESTs similarly revealed variation in the length of polythymidine tracts. We subsequently sequenced both genomic DNA and mRNA from populations of G. pallida. In each case, variation in the length of polythymidine tracts was observed. The levels of expression of mitochondrial genes in G. pallida were representative of the subgenomes present: little evidence of differential expression was observed. These observations are consistent with the operation of posttranscriptional editing in Globodera mitochondria, although this is difficult to show conclusively in the presence of intraindividual gene sequence variation. Further, alternative explanations cannot be discounted; these include the operation of slippage during translation or that genomic copies of most genes are pseudogenes with a small proportion of full-length sequences able to maintain mitochondrial function.

  8. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  9. Patterns of variation among distinct alleles of the Flag silk gene from Nephila clavipes.

    Science.gov (United States)

    Higgins, Linden E; White, Sheryl; Nuñez-Farfán, Juan; Vargas, Jesus

    2007-02-20

    Spider silk proteins and their genes are very attractive to researchers in a wide range of disciplines because they permit linking many levels of organization. However, hypotheses of silk gene evolution have been built primarily upon single sequences of each gene each species, and little is known about allelic variation within a species. Silk genes are known for their repeat structure with high levels of homogenization of nucleotide and amino acid sequence among repeated units. One common explanation for this homogeneity is gene convergence. To test this model, we sequenced multiple alleles of one intron-exon segment from the Flag gene from four populations of the spider Nephila clavipes and compared the new sequences to a published sequence. Our analysis revealed very high levels of heterozygosity in this gene, with no pattern of population differentiation. There was no evidence of gene convergence within any of these alleles, with high levels of nucleotide and amino acid substitution among the repeating motifs. Our data suggest that minimally, there is relaxed selection on mutations in this gene and that there may actually be positive selection for heterozygosity.

  10. Markers for sebaceoma show a spectrum of cell cycle regulators, tumor suppressor genes, and oncogenes

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2015-01-01

    Full Text Available Background: Sebaceoma is a tumor for which the causative oncogenes are not well-understood. Sebaceomas demonstrate some histopathologic features similar to basal cell carcinoma (BCC, such as palisading borders and basaloid cells with additional features, including foamy cytoplasm and indented nuclei. Aims: We examine multiple cell-cycle, oncogene, and tumor suppressor gene markers in sebaceomas, to try to find some suitable biological markers for this tumor, and compare with other published studies. Materials and Methods: We investigated a panel of immunohistochemical (IHC stains that are important for cellular signaling, including a cell cycle regulator, tumor suppressor gene, oncogene, hormone receptor, and genomic stability markers in our cohort of sebaceomas. We collected 30 sebaceomas from three separate USA dermatopathology laboratories. The following IHC panel: Epithelial membrane antigen (EMA/CD227, cytokeratin AE1/AE3, cyclin D1, human breast cancer 1 protein (BRCA-1, C-erb-2, Bcl-2, human androgen receptor (AR, cyclin-dependent kinase inhibitor 1B (p27 kip1 , p53, topoisomerase II alpha, proliferating cell nuclear antigen, and Ki-67 were tested in our cases. Results: EMA/CD227 was positive in the well-differentiated sebaceomas (13/30. Cyclin-dependent kinase inhibitor 1B was positive in tumors with intermediate differentiation (22/30. The less well-differentiated tumors failed to stain with EMA and AR. Most of the tumors with well-differentiated palisaded areas demonstrated positive staining for topoisomerase II alpha, p27 kip1 , and p53, with positive staining in tumoral basaloid areas (22/30. Numerous tumors were focally positive with multiple markers, indicating a significant degree of variability in the complete group. Conclusions: Oncogenes, tumor suppressor genes, cell cycle regulators, and hormone receptors are variably expressed in sebaceomas. Our results suggest that in these tumors, selected marker staining seems to correlate

  11. Gene expression and variation in social aggression by queens of the harvester ant Pogonomyrmex californicus.

    Science.gov (United States)

    Helmkampf, Martin; Mikheyev, Alexander S; Kang, Yun; Fewell, Jennifer; Gadau, Jürgen

    2016-08-01

    A key requirement for social cooperation is the mitigation and/or social regulation of aggression towards other group members. Populations of the harvester ant Pogonomyrmex californicus show the alternate social phenotypes of queens founding nests alone (haplometrosis) or in groups of unrelated yet cooperative individuals (pleometrosis). Pleometrotic queens display an associated reduction in aggression. To understand the proximate drivers behind this variation, we placed foundresses of the two populations into social environments with queens from the same or the alternate population, and measured their behaviour and head gene expression profiles. A proportion of queens from both populations behaved aggressively, but haplometrotic queens were significantly more likely to perform aggressive acts, and conflict escalated more frequently in pairs of haplometrotic queens. Whole-head RNA sequencing revealed variation in gene expression patterns, with the two populations showing moderate differentiation in overall transcriptional profile, suggesting that genetic differences underlie the two founding strategies. The largest detected difference, however, was associated with aggression, regardless of queen founding type. Several modules of coregulated genes, involved in metabolism, immune system and neuronal function, were found to be upregulated in highly aggressive queens. Conversely, nonaggressive queens exhibited a striking pattern of upregulation in chemosensory genes. Our results highlight that the social phenotypes of cooperative vs. solitary nest founding tap into a set of gene regulatory networks that seem to govern aggression level. We also present a number of highly connected hub genes associated with aggression, providing opportunity to further study the genetic underpinnings of social conflict and tolerance.

  12. Identifying the genetic variation of gene expression using gene sets: application of novel gene Set eQTL approach to PharmGKB and KEGG.

    Directory of Open Access Journals (Sweden)

    Ryan Abo

    Full Text Available Genetic variation underlying the regulation of mRNA gene expression in humans may provide key insights into the molecular mechanisms of human traits and complex diseases. Current statistical methods to map genetic variation associated with mRNA gene expression have typically applied standard linkage and/or association methods; however, when genome-wide SNP and mRNA expression data are available performing all pair wise comparisons is computationally burdensome and may not provide optimal power to detect associations. Consideration of different approaches to account for the high dimensionality and multiple testing issues may provide increased efficiency and statistical power. Here we present a novel approach to model and test the association between genetic variation and mRNA gene expression levels in the context of gene sets (GSs and pathways, referred to as gene set - expression quantitative trait loci analysis (GS-eQTL. The method uses GSs to initially group SNPs and mRNA expression, followed by the application of principal components analysis (PCA to collapse the variation and reduce the dimensionality within the GSs. We applied GS-eQTL to assess the association between SNP and mRNA expression level data collected from a cell-based model system using PharmGKB and KEGG defined GSs. We observed a large number of significant GS-eQTL associations, in which the most significant associations arose between genetic variation and mRNA expression from the same GS. However, a number of associations involving genetic variation and mRNA expression from different GSs were also identified. Our proposed GS-eQTL method effectively addresses the multiple testing limitations in eQTL studies and provides biological context for SNP-expression associations.

  13. Natural variation for gene expression responses to abiotic stress in maize.

    Science.gov (United States)

    Waters, Amanda J; Makarevitch, Irina; Noshay, Jaclyn; Burghardt, Liana T; Hirsch, Candice N; Hirsch, Cory D; Springer, Nathan M

    2017-02-01

    Plants respond to abiotic stress through a variety of physiological, biochemical, and transcriptional mechanisms. Many genes exhibit altered levels of expression in response to abiotic stress, which requires concerted action of both cis- and trans-regulatory features. In order to study the variability in transcriptome response to abiotic stress, RNA sequencing was performed using 14-day-old maize seedlings of inbreds B73, Mo17, Oh43, PH207 and B37 under control, cold and heat conditions. Large numbers of genes that responded differentially to stress between parental inbred lines were identified. RNA sequencing was also performed on similar tissues of the F1 hybrids produced by crossing B73 and each of the three other inbred lines. By evaluating allele-specific transcript abundance in the F1 hybrids, we were able to measure the abundance of cis- and trans-regulatory variation between genotypes for both steady-state and stress-responsive expression differences. Although examples of trans-regulatory variation were observed, cis-regulatory variation was more common for both steady-state and stress-responsive expression differences. The genes with cis-allelic variation for response to cold or heat stress provided an opportunity to study the basis for regulatory diversity.

  14. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    Science.gov (United States)

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, ppopulation. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  15. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  16. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  17. Mitochondrial tRNALeu/Lys and ATPase 6/8 gene variations in spinocerebellar ataxias.

    Science.gov (United States)

    Safaei, Sepideh; Houshmand, Massoud; Banoei, Mohammad Mehdi; Panahi, Mehdi Shafa Shariat; Nafisi, Shahriar; Parivar, Kazem; Rostami, Maryam; Shariati, Parvin

    2009-01-01

    The spinocerebellar ataxias (SCA) comprise a heterogeneous group of severe late-onset neurodegenerative diseases that are promoted by the expansion of a tandem-arrayed DNA sequence that modifies the primary structure of the protein. Genomic DNA of 20 patients affected with SCAs was extracted from peripheral blood and screened for deletions in mitochondrial DNA (mtDNA). Sequencing of tRNA(Leu), tRNA(Lys), cytochrome oxidase II, ATPase 6/8 and NADH dehydrogenase I (NDI) genes belonging to mtDNA from patients with SCAs was also carried out to detect the presence of variations. We identified cytosine-adenine-guanine (CAG) trinucleotide repeat expansions in 20 patients. Seven of these patients had at least one nucleotide change in mtDNA. In such cases, 5 nucleotide variations resulted in amino acid changes with two novel variations T8256G and G9010A. SCA patients showed high levels of mtDNA variations in lymphocytes. It can be proposed that the SCA gene proteins (Ataxins) are involved in the complicated intracellular mechanisms that affect cellular organelles and their components, such as the mitochondrial genome. The instability of CAG repeats in polyglutamine diseases such as SCAs and Huntington's disease might be a causative factor in mtDNA variation or possible damage. Copyright 2008 S. Karger AG, Basel.

  18. Conceptual Variation in the Depiction of Gene Function in Upper Secondary School Textbooks

    Science.gov (United States)

    Gericke, Niklas Markus; Hagberg, Mariana

    2010-10-01

    This paper explores conceptual variation in the depiction of gene function in upper secondary school textbooks. Historically, concepts in genetics have developed in various scientific frameworks, which has led to a level of incommensurability as concepts have changed over time within their respective frameworks. Since students may have difficulties in understanding concepts where there is implicit variation in descriptions of the same phenomena, we have developed a concept mapping instrument and applied it to study the gene function concepts in biology and chemistry textbooks that are widely used in Sweden, and others used in a selection of English speaking countries. The data were then further examined using content analysis. In the present paper we describe the conceptual variation of gene function as it is presented in the textbooks, and analyze the ways in which students’ understanding may be influenced. We conclude that it may be difficult for students to gain a modern, process-oriented understanding of gene function if textbooks are used as foundations for the planning and execution of lessons.

  19. Copy Number Variation of UGT 2B Genes in Indian Families Using Whole Genome Scans

    Directory of Open Access Journals (Sweden)

    Avinash M. Veerappa

    2016-01-01

    Full Text Available Background and Objectives. Uridine diphospho-glucuronosyltransferase 2B (UGT2B is a family of genes involved in metabolizing steroid hormones and several other xenobiotics. These UGT2B genes are highly polymorphic in nature and have distinct polymorphisms associated with specific regions around the globe. Copy number variations (CNVs status of UGT2B17 in Indian population is not known and their disease associations have been inconclusive. It was therefore of interest to investigate the CNV profile of UGT2B genes. Methods. We investigated the presence of CNVs in UGT2B genes in 31 members from eight Indian families using Affymetrix Genome-Wide Human SNP Array 6.0 chip. Results. Our data revealed >50% of the study members carried CNVs in UGT2B genes, of which 76% showed deletion polymorphism. CNVs were observed more in UGT2B17 (76.4% than in UGT2B15 (17.6%. Molecular network and pathway analysis found enrichment related to steroid metabolic process, carboxylesterase activity, and sequence specific DNA binding. Interpretation and Conclusion. We report the presence of UGT2B gene deletion and duplication polymorphisms in Indian families. Network analysis indicates the substitutive role of other possible genes in the UGT activity. The CNVs of UGT2B genes are very common in individuals indicating that the effect is neutral in causing any suspected diseases.

  20. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  1. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga

    2009-01-01

    -binding protein), which is induced by glucose, and SREBP-1 (sterol response element-binding protein-1), which is stimulated by insulin through the PI3K/Akt signal transduction pathway. We investigated whether the genetic variability of the genes encoding for ChREBP, SREBP and FAS (respectively, MLXIPL, SREBF1...... and FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall...

  2. Morphometric Analysis of Recognized Genes for Autism Spectrum Disorders and Obesity in Relationship to the Distribution of Protein-Coding Genes on Human Chromosomes

    Directory of Open Access Journals (Sweden)

    Austen B. McGuire

    2016-05-01

    Full Text Available Mammalian chromosomes are comprised of complex chromatin architecture with the specific assembly and configuration of each chromosome influencing gene expression and function in yet undefined ways by varying degrees of heterochromatinization that result in Giemsa (G negative euchromatic (light bands and G-positive heterochromatic (dark bands. We carried out morphometric measurements of high-resolution chromosome ideograms for the first time to characterize the total euchromatic and heterochromatic chromosome band length, distribution and localization of 20,145 known protein-coding genes, 790 recognized autism spectrum disorder (ASD genes and 365 obesity genes. The individual lengths of G-negative euchromatin and G-positive heterochromatin chromosome bands were measured in millimeters and recorded from scaled and stacked digital images of 850-band high-resolution ideograms supplied by the International Society of Chromosome Nomenclature (ISCN 2013. Our overall measurements followed established banding patterns based on chromosome size. G-negative euchromatic band regions contained 60% of protein-coding genes while the remaining 40% were distributed across the four heterochromatic dark band sub-types. ASD genes were disproportionately overrepresented in the darker heterochromatic sub-bands, while the obesity gene distribution pattern did not significantly differ from protein-coding genes. Our study supports recent trends implicating genes located in heterochromatin regions playing a role in biological processes including neurodevelopment and function, specifically genes associated with ASD.

  3. Morphometric Analysis of Recognized Genes for Autism Spectrum Disorders and Obesity in Relationship to the Distribution of Protein-Coding Genes on Human Chromosomes.

    Science.gov (United States)

    McGuire, Austen B; Rafi, Syed K; Manzardo, Ann M; Butler, Merlin G

    2016-05-05

    Mammalian chromosomes are comprised of complex chromatin architecture with the specific assembly and configuration of each chromosome influencing gene expression and function in yet undefined ways by varying degrees of heterochromatinization that result in Giemsa (G) negative euchromatic (light) bands and G-positive heterochromatic (dark) bands. We carried out morphometric measurements of high-resolution chromosome ideograms for the first time to characterize the total euchromatic and heterochromatic chromosome band length, distribution and localization of 20,145 known protein-coding genes, 790 recognized autism spectrum disorder (ASD) genes and 365 obesity genes. The individual lengths of G-negative euchromatin and G-positive heterochromatin chromosome bands were measured in millimeters and recorded from scaled and stacked digital images of 850-band high-resolution ideograms supplied by the International Society of Chromosome Nomenclature (ISCN) 2013. Our overall measurements followed established banding patterns based on chromosome size. G-negative euchromatic band regions contained 60% of protein-coding genes while the remaining 40% were distributed across the four heterochromatic dark band sub-types. ASD genes were disproportionately overrepresented in the darker heterochromatic sub-bands, while the obesity gene distribution pattern did not significantly differ from protein-coding genes. Our study supports recent trends implicating genes located in heterochromatin regions playing a role in biological processes including neurodevelopment and function, specifically genes associated with ASD.

  4. Whole exome sequencing in extended families with autism spectrum disorder implicates four candidate genes.

    Science.gov (United States)

    Chapman, Nicola H; Nato, Alejandro Q; Bernier, Raphael; Ankenman, Katy; Sohi, Harkirat; Munson, Jeff; Patowary, Ashok; Archer, Marilyn; Blue, Elizabeth M; Webb, Sara Jane; Coon, Hilary; Raskind, Wendy H; Brkanac, Zoran; Wijsman, Ellen M

    2015-10-01

    Autism spectrum disorders (ASDs) are a group of neurodevelopmental disorders, characterized by impairment in communication and social interactions, and by repetitive behaviors. ASDs are highly heritable, and estimates of the number of risk loci range from hundreds to >1000. We considered 7 extended families (size 12-47 individuals), each with ≥3 individuals affected by ASD. All individuals were genotyped with dense SNP panels. A small subset of each family was typed with whole exome sequence (WES). We used a 3-step approach for variant identification. First, we used family-specific parametric linkage analysis of the SNP data to identify regions of interest. Second, we filtered variants in these regions based on frequency and function, obtaining exactly 200 candidates. Third, we compared two approaches to narrowing this list further. We used information from the SNP data to impute exome variant dosages into those without WES. We regressed affected status on variant allele dosage, using pedigree-based kinship matrices to account for relationships. The p value for the test of the null hypothesis that variant allele dosage is unrelated to phenotype was used to indicate strength of evidence supporting the variant. A cutoff of p = 0.05 gave 28 variants. As an alternative third filter, we required Mendelian inheritance in those with WES, resulting in 70 variants. The imputation- and association-based approach was effective. We identified four strong candidate genes for ASD (SEZ6L, HISPPD1, FEZF1, SAMD11), all of which have been previously implicated in other studies, or have a strong biological argument for their relevance.

  5. An investigation of ribosomal protein L10 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Rastam Maria

    2009-01-01

    Full Text Available Abstract Background Autism spectrum disorders (ASD are severe neurodevelopmental disorders with the male:female ratio of 4:1, implying the contribution of X chromosome genetic factors to the susceptibility of ASD. The ribosomal protein L10 (RPL10 gene, located on chromosome Xq28, codes for a key protein in assembling large ribosomal subunit and protein synthesis. Two non-synonymous mutations of RPL10, L206M and H213Q, were identified in four boys with ASD. Moreover, functional studies of mutant RPL10 in yeast exhibited aberrant ribosomal profiles. These results provided a novel aspect of disease mechanisms for autism – aberrant processes of ribosome biosynthesis and translation. To confirm these initial findings, we re-sequenced RPL10 exons and quantified mRNA transcript level of RPL10 in our samples. Methods 141 individuals with ASD were recruited in this study. All RPL10 exons and flanking junctions were sequenced. Furthermore, mRNA transcript level of RPL10 was quantified in B lymphoblastoid cell lines (BLCL of 48 patients and 27 controls using the method of SYBR Green quantitative PCR. Two sets of primer pairs were used to quantify the mRNA expression level of RPL10: RPL10-A and RPL10-B. Results No non-synonymous mutations were detected in our cohort. Male controls showed similar transcript level of RPL10 compared with female controls (RPL10-A, U = 81, P = 0.7; RPL10-B, U = 61.5, P = 0.2. We did not observe any significant difference in RPL10 transcript levels between cases and controls (RPL10-A, U = 531, P = 0.2; RPL10-B, U = 607.5, P = 0.7. Conclusion Our results suggest that RPL10 has no major effect on the susceptibility to ASD.

  6. Chloroplast gene arrangement variation within a closely related group of green algae (Trebouxiophyceae, Chlorophyta).

    Science.gov (United States)

    Letsch, Molly R; Lewis, Louise A

    2012-09-01

    The 22 published chloroplast genomes of green algae, representing sparse taxonomic sampling of diverse lineages that span over one billion years of evolution, each possess a unique gene arrangement. In contrast, many of the >190 published embryophyte (land plant) chloroplast genomes have relatively conserved architectures. To determine the phylogenetic depth at which chloroplast gene rearrangements occur in green algae, a 1.5-4 kb segment of the chloroplast genome was compared across nine species in three closely related genera of Trebouxiophyceae (Chlorophyta). In total, four distinct gene arrangements were obtained for the three genera Elliptochloris, Hemichloris, and Coccomyxa. In Elliptochloris, three distinct chloroplast gene arrangements were detected, one of which is shared with members of its sister genus Hemichloris. Both species of Coccomyxa examined share the fourth arrangement of this genome region, one characterized by very long spacers. Next, the order of genes found in this segment of the chloroplast genome was compared across green algae and land plants. As taxonomic ranks are not equivalent among different groups of organisms, the maximum molecular divergence among taxa sharing a common gene arrangement in this genome segment was compared. Well-supported clades possessing a single gene order had similar phylogenetic depth in green algae and embryophytes. When the dominant gene order of this chloroplast segment in embryophytes was assumed to be ancestral for land plants, the maximum molecular divergence was found to be over two times greater in embryophytes than in trebouxiophyte green algae. This study greatly expands information about chloroplast genome variation in green algae, is the first to demonstrate such variation among congeneric green algae, and further illustrates the fluidity of green algal chloroplast genome architecture in comparison to that of many embryophytes.

  7. Threshold-dominated regulation hides genetic variation in gene expression networks

    Directory of Open Access Journals (Sweden)

    Plahte Erik

    2007-12-01

    Full Text Available Abstract Background In dynamical models with feedback and sigmoidal response functions, some or all variables have thresholds around which they regulate themselves or other variables. A mathematical analysis has shown that when the dose-response functions approach binary or on/off responses, any variable with an equilibrium value close to one of its thresholds is very robust to parameter perturbations of a homeostatic state. We denote this threshold robustness. To check the empirical relevance of this phenomenon with response function steepnesses ranging from a near on/off response down to Michaelis-Menten conditions, we have performed a simulation study to investigate the degree of threshold robustness in models for a three-gene system with one downstream gene, using several logical input gates, but excluding models with positive feedback to avoid multistationarity. Varying parameter values representing functional genetic variation, we have analysed the coefficient of variation (CV of the gene product concentrations in the stable state for the regulating genes in absolute terms and compared to the CV for the unregulating downstream gene. The sigmoidal or binary dose-response functions in these models can be considered as phenomenological models of the aggregated effects on protein or mRNA expression rates of all cellular reactions involved in gene expression. Results For all the models, threshold robustness increases with increasing response steepness. The CVs of the regulating genes are significantly smaller than for the unregulating gene, in particular for steep responses. The effect becomes less prominent as steepnesses approach Michaelis-Menten conditions. If the parameter perturbation shifts the equilibrium value too far away from threshold, the gene product is no longer an effective regulator and robustness is lost. Threshold robustness arises when a variable is an active regulator around its threshold, and this function is maintained by

  8. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  9. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Directory of Open Access Journals (Sweden)

    Slavé Petrovski

    2015-09-01

    Full Text Available Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS, termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1 genes that are known to cause disease through haploinsufficiency, 2 genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3 genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4 genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding

  10. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Science.gov (United States)

    Petrovski, Slavé; Gussow, Ayal B; Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H; Allen, Andrew S; Goldstein, David B

    2015-09-01

    Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, nc

  11. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  12. Regulation of flowering in rice: two florigen genes, a complex gene network, and natural variation.

    Science.gov (United States)

    Tsuji, Hiroyuki; Taoka, Ken-ichiro; Shimamoto, Ko

    2011-02-01

    Photoperiodic control of flowering time consists of a complicated network that converges into the generation of a mobile flowering signal called florigen. Recent advances identifying the protein FT/Hd3a as the molecular nature responsible for florigen activity have focused current research on florigen genes as the important output of this complex signaling network. Rice is a model system for short-day plants and recent progress in elucidating the flowering network from rice and Arabidopsis, a long-day plant, provides an evolutionarily comparative view of the photoperiodic flowering pathway. This review summarizes photoperiodic flowering control in rice, including the interaction of complex layers of gene networks contributed from evolutionarily unique factors and the regulatory adaptation of conserved factors.

  13. Genetic variations of glycinin subunit genes among cultivated and wild type soybean species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Glycinin is a predominant storage protein in most soybean accessions. It is a hexamer constituted by five major subunits, which can be classified into two groups. Group Ⅰ contains Gl, G2 and G3, and Group Ⅱ contains G4 and G5. The genes encoding these subunits have been designated from Gyl to Gy5, respectively. In the present study, Gyl genomic fragments were cloned from wild accessions of subgenera Glycine glycine, Glycine soja and a cultivar of Glycine max. Their sequences and the deduced amino acid sequences were compared. The residues critical for assembling of G1 subunits from the wild perennial accession were conservative. The Gy4 fragments were cloned from two wild perennial accessions and compared with that from subgenus Soja. The intron 3 of Gy4 had abundant variations between the subgenera G. Soja and G. Glycine as well as within the subgenus G. Glycine. Abundant variations existed in the disordered regions 3 and 4 of G4 subunits from two wild perennial accessions. The genomic organization of glycinin genes was analyzed in 19 accessions from subgenera Soja and Glycine. The hybridization patterns were identical among the accessions of subgenus Soja. On the contrary, abundant polymorphisms existed between the accessions from subgenus Glycine. These results indicated that glycinin genes have high degree of conservation within subgenus Soja but more variations within subgenus Glycine.

  14. Effects of abhydrolase domain containing 5 gene (ABHD5) expression and variations on chicken fat metabolism.

    Science.gov (United States)

    Ouyang, Hongjia; Liu, Qing; Xu, Jiguo; Zeng, Fang; Pang, Xiaolin; Jebessa, Endashaw; Liang, Shaodong; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    Abhydrolase domain containing 5 gene (ABHD5), also known as comparative gene identification 58 (CGI-58), is a member of the α/β-hydrolase family as a protein cofactor of ATGL stimulating its triacylglycerol hydrolase activity. In this study, we aim to characterize the expression and variations of ABHD5 and to study their functions in chicken fat metabolism. We compared the ABHD5 expression level in various tissues and under different nutrition conditions, identified the variations of ABHD5, and associated them with production traits in an F2 resource population of chickens. Overexpression analysis with two different genotypes and siRNA interfering analysis of ABHD5 were performed in chicken preadipocytes. Chicken ABDH5 was expressed widely and most predominantly in adipose tissue. Five SNPs of the ABHD5 gene were identified and genotyped in the F2 resource population. The c.490C > T SNP was associated with subcutaneous fat thickness (P  C SNP was also associated with chicken body weight (P chicken preadipocytes, overexpression of wild type ABDH5 did not affect the mRNA level of ATGL (adipose triglyceride lipase) but markedly decreased (P chickens with a high fat diet. These results suggest that expression and variations of ABHD5 may affect fat metabolism through regulating the activity of ATGL in chickens.

  15. Contribution of haplotypes across the fibrinogen gene cluster to variation in risk of myocardial infarction.

    Science.gov (United States)

    Mannila, Maria Nastase; Eriksson, Per; Lundman, Pia; Samnegård, Ann; Boquist, Susanna; Ericsson, Carl-Göran; Tornvall, Per; Hamsten, Anders; Silveira, Angela

    2005-03-01

    Fibrinogen has consistently been recognized as an independent predictor of myocardial infarction (MI). Multiple mechanisms link fibrinogen to MI; therefore disentangling the factors underlying variation in plasma fibrinogen concentration is essential. Candidate regions in the fibrinogen gamma (FGG), alpha (FGA) and beta (FGB) genes were screened for single nucleotide polymorphisms (SNPs). Several novel SNPs were detected in the FGG and FGA genes in addition to the previously known SNPs in the fibrinogen genes. Tight linkage disequilibrium extending over various physical distances was observed between most SNPs. Consequently, eight SNPs were chosen and determined in 377 postinfarction patients and 387 healthy individuals. None of the SNPs were associated with plasma fibrinogen concentration or MI. Haplotype analyses revealed a consistent pattern of haplotypes associated with variation in risk of MI. Of the four haplotypes inferred using the FGA -58G>A and FGG 1299 +79T>C SNPs, the most frequent haplotype, FGG-FGA*1 (prevalence 46.6%), was associated with increased risk of MI (OR 1.51; 95%CI 1.18, 1.93), whereas the least frequent haplotype, FGG-FGA*4 (11.8%), was associated with lower risk of MI (OR 0.79 95%CI 0.64, 0.98). In conclusion, fibrinogen haplotypes, but not SNPs in isolation, are associated with variation in risk of MI.

  16. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Directory of Open Access Journals (Sweden)

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  17. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  18. Association of variation in Fc gamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples

    NARCIS (Netherlands)

    McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.

    2010-01-01

    Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of polymorphonucl

  19. Development of EMS-induced mutation population for amylose and resistant starch variation in bread wheat (Triticum aestivum) and identification of candidate genes responsible for amylose variation.

    Science.gov (United States)

    Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy

    2016-10-06

    Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and

  20. Sweet taste receptor gene variation and aspartame taste in primates and other species.

    Science.gov (United States)

    Li, Xia; Bachmanov, Alexander A; Maehashi, Kenji; Li, Weihua; Lim, Raymond; Brand, Joseph G; Beauchamp, Gary K; Reed, Danielle R; Thai, Chloe; Floriano, Wely B

    2011-06-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, T1R2 and T1R3, we sequenced these genes in 9 aspartame taster and nontaster primate species. We then compared these sequences with sequences of their orthologs in 4 other nontasters species. We identified 9 variant sites in the gene encoding T1R2 and 32 variant sites in the gene encoding T1R3 that distinguish aspartame tasters and nontasters. Molecular docking of aspartame to computer-generated models of the T1R2 + T1R3 receptor dimer suggests that species variation at a secondary, allosteric binding site in the T1R2 protein is the most likely origin of differences in perception of the sweetness of aspartame. These results identified a previously unknown site of aspartame interaction with the sweet receptor and suggest that the ability to taste aspartame might have developed during evolution to exploit a specialized food niche.

  1. A novel approach of homozygous haplotype sharing identifies candidate genes in autism spectrum disorder

    NARCIS (Netherlands)

    Casey, Jillian P.; Magalhaes, Tiago; Conroy, Judith M.; Regan, Regina; Shah, Naisha; Anney, Richard; Shields, Denis C.; Abrahams, Brett S.; Almeida, Joana; Bacchelli, Elena; Bailey, Anthony J.; Baird, Gillian; Battaglia, Agatino; Berney, Tom; Bolshakova, Nadia; Bolton, Patrick F.; Bourgeron, Thomas; Brennan, Sean; Cali, Phil; Correia, Catarina; Corsello, Christina; Coutanche, Marc; Dawson, Geraldine; de Jonge, Maretha; Delorme, Richard; Duketis, Eftichia; Duque, Frederico; Estes, Annette; Farrar, Penny; Fernandez, Bridget A.; Folstein, Susan E.; Foley, Suzanne; Fombonne, Eric; Freitag, Christine M.; Gilbert, John; Gillberg, Christopher; Glessner, Joseph T.; Green, Jonathan; Guter, Stephen J.; Hakonarson, Hakon; Holt, Richard; Hughes, Gillian; Hus, Vanessa; Igliozzi, Roberta; Kim, Cecilia; Klauck, Sabine M.; Kolevzon, Alexander; Lamb, Janine A.; Leboyer, Marion; Le Couteur, Ann; Leventhal, Bennett L.; Lord, Catherine; Lund, Sabata C.; Maestrini, Elena; Mantoulan, Carine; Marshall, Christian R.; McConachie, Helen; McDougle, Christopher J.; McGrath, Jane; McMahon, William M.; Merikangas, Alison; Miller, Judith; Minopoli, Fiorella; Mirza, Ghazala K.; Munson, Jeff; Nelson, Stanley F.; Nygren, Gudrun; Oliveira, Guiomar; Pagnamenta, Alistair T.; Papanikolaou, Katerina; Parr, Jeremy R.; Parrini, Barbara; Pickles, Andrew; Pinto, Dalila; Piven, Joseph; Posey, David J.; Poustka, Annemarie; Poustka, Fritz; Ragoussis, Jiannis; Roge, Bernadette; Rutter, Michael L.; Sequeira, Ana F.; Soorya, Latha; Sousa, Ines; Sykes, Nuala; Stoppioni, Vera; Tancredi, Raffaella; Tauber, Maite; Thompson, Ann P.; Thomson, Susanne; Tsiantis, John; Van Engeland, Herman; Vincent, John B.; Volkmar, Fred; Vorstman, Jacob A. S.; Wallace, Simon; Wang, Kai; Wassink, Thomas H.; White, Kathy; Wing, Kirsty; Wittemeyer, Kerstin; Yaspan, Brian L.; Zwaigenbaum, Lonnie; Betancur, Catalina; Buxbaum, Joseph D.; Cantor, Rita M.; Cook, Edwin H.; Coon, Hilary; Cuccaro, Michael L.; Geschwind, Daniel H.; Haines, Jonathan L.; Hallmayer, Joachim; Monaco, Anthony P.; Nurnberger, John I.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Scherer, Stephen W.; Sutcliffe, James S.; Szatmari, Peter; Vieland, Veronica J.; Wijsman, Ellen M.; Green, Andrew; Gill, Michael; Gallagher, Louise; Vicente, Astrid; Ennis, Sean

    2012-01-01

    Autism spectrum disorder (ASD) is a highly heritable disorder of complex and heterogeneous aetiology. It is primarily characterized by altered cognitive ability including impaired language and communication skills and fundamental deficits in social reciprocity. Despite some notable successes in neur

  2. Evidence that genetic variation in the oxytocin receptor (OXTR) gene influences social cognition in ADHD.

    Science.gov (United States)

    Park, J; Willmott, M; Vetuz, G; Toye, C; Kirley, A; Hawi, Z; Brookes, K J; Gill, M; Kent, L

    2010-05-30

    Some children with ADHD also have social and communication difficulties similar to those seen in children with autistic spectrum disorders and this may be due to shared genetic liability. As the oxytocin receptor (OXTR) gene has been implicated in social cognition and autistic spectrum disorders, this study investigated whether OXTR polymorphisms previously implicated in autism were associated with ADHD and whether they influenced OXTR mRNA expression in 27 normal human amygdala brain samples. The family-based association sample consisted of 450 DSM-IV diagnosed ADHD probands and their parents. Although there was no association with the ADHD phenotype, an association with social cognitive impairments in a subset of the ADHD probands (N=112) was found for SNP rs53576 (F=5.24, p=0.007) with post-hoc tests demonstrating that the AA genotype was associated with better social ability compared to the AG genotype. Additionally, significant association was also found for rs13316193 (F=3.09, p=0.05) with post-hoc tests demonstrating that the CC genotype was significantly associated with poorer social ability than the TT genotype. No significant association between genotype and OXTR mRNA expression was found. This study supports previous evidence that the OXTR gene is implicated in social cognition.

  3. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....... and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according...

  4. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    Science.gov (United States)

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

  5. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Science.gov (United States)

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species.

  6. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    Science.gov (United States)

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama

    2014-01-01

    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  7. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  8. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  9. Copy number variation of age-related macular degeneration relevant genes in the Korean population.

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    Full Text Available PURPOSE: Studies that analyzed single nucleotide polymorphisms (SNP in various genes have shown that genetic factors are strongly associated with age-related macular degeneration (AMD susceptibility. Copy number variation (CNV may be an additional type of genetic variation that contributes to AMD pathogenesis. This study investigated CNV in 4 AMD-relevant genes in Korean AMD patients and control subjects. METHODS: Four CNV candidate regions located in AMD-relevant genes (VEGFA, ARMS2/HTRA1, CFH and VLDLR, were selected based on the outcomes of our previous study which elucidated common CNVs in the Asian populations. Real-time PCR based TaqMan Copy Number Assays were performed on CNV candidates in 273 AMD patients and 257 control subjects. RESULTS: The predicted copy number (PCN, 0, 1, 2 or 3+ of each region was called using the CopyCaller program. All candidate genes except ARMS2/HTRA1 showed CNV in at least one individual, in which losses of VEGFA and VLDLR represent novel findings in the Asian population. When the frequencies of PCN were compared, only the gain in VLDLR showed significant differences between AMD patients and control subjects (p = 0.025. Comparisons of the raw copy values (RCV revealed that 3 of 4 candidate genes showed significant differences (2.03 vs. 1.92 for VEGFA, p<0.01; 2.01 vs. 1.97 for CFH, p<0.01; 1.97 vs. 2.01, p<0.01 for ARMS2/HTRA1. CONCLUSION: CNVs located in AMD-relevant genes may be associated with AMD susceptibility. Further investigations encompassing larger patient cohorts are needed to elucidate the role of CNV in AMD pathogenesis.

  10. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Science.gov (United States)

    Purrington, Kristen S.; Slettedahl, Seth; Bolla, Manjeet K.; Michailidou, Kyriaki; Czene, Kamila; Nevanlinna, Heli; Bojesen, Stig E.; Andrulis, Irene L.; Cox, Angela; Hall, Per; Carpenter, Jane; Yannoukakos, Drakoulis; Haiman, Christopher A.; Fasching, Peter A.; Mannermaa, Arto; Winqvist, Robert; Brenner, Hermann; Lindblom, Annika; Chenevix-Trench, Georgia; Benitez, Javier; Swerdlow, Anthony; Kristensen, Vessela; Guénel, Pascal; Meindl, Alfons; Darabi, Hatef; Eriksson, Mikael; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Wang, Xianshu; Olswold, Curtis; Olson, Janet E.; Mulligan, Anna Marie; Knight, Julia A.; Tchatchou, Sandrine; Reed, Malcolm W.R.; Cross, Simon S.; Liu, Jianjun; Li, Jingmei; Humphreys, Keith; Clarke, Christine; Scott, Rodney; Fostira, Florentia; Fountzilas, George; Konstantopoulou, Irene; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Ekici, Arif B.; Hartmann, Arndt; Beckmann, Matthias W.; Hartikainen, Jaana M.; Kosma, Veli-Matti; Kataja, Vesa; Jukkola-Vuorinen, Arja; Pylkäs, Katri; Kauppila, Saila; Dieffenbach, Aida Karina; Stegmaier, Christa; Arndt, Volker; Margolin, Sara; Balleine, Rosemary; Arias Perez, Jose Ignacio; Pilar Zamora, M.; Menéndez, Primitiva; Ashworth, Alan; Jones, Michael; Orr, Nick; Arveux, Patrick; Kerbrat, Pierre; Truong, Thérèse; Bugert, Peter; Toland, Amanda E.; Ambrosone, Christine B.; Labrèche, France; Goldberg, Mark S.; Dumont, Martine; Ziogas, Argyrios; Lee, Eunjung; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Long, Jirong; Shrubsole, Martha; Deming-Halverson, Sandra; Ficarazzi, Filomena; Barile, Monica; Peterlongo, Paolo; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Brüning, Thomas; Ko, Yon-Dschun; Van Deurzen, Carolien H.M.; Martens, John W.M.; Kriege, Mieke; Figueroa, Jonine D.; Chanock, Stephen J.; Lissowska, Jolanta; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Schneeweiss, Andreas; Tapper, William J.; Gerty, Susan M.; Durcan, Lorraine; Mclean, Catriona; Milne, Roger L.; Baglietto, Laura; dos Santos Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Van'T Veer, Laura J.; Cornelissen, Sten; Försti, Asta; Torres, Diana; Rüdiger, Thomas; Rudolph, Anja; Flesch-Janys, Dieter; Nickels, Stefan; Weltens, Caroline; Floris, Giuseppe; Moisse, Matthieu; Dennis, Joe; Wang, Qin; Dunning, Alison M.; Shah, Mitul; Brown, Judith; Simard, Jacques; Anton-Culver, Hoda; Neuhausen, Susan L.; Hopper, John L.; Bogdanova, Natalia; Dörk, Thilo; Zheng, Wei; Radice, Paolo; Jakubowska, Anna; Lubinski, Jan; Devillee, Peter; Brauch, Hiltrud; Hooning, Maartje; García-Closas, Montserrat; Sawyer, Elinor; Burwinkel, Barbara; Marmee, Frederick; Eccles, Diana M.; Giles, Graham G.; Peto, Julian; Schmidt, Marjanka; Broeks, Annegien; Hamann, Ute; Chang-Claude, Jenny; Lambrechts, Diether; Pharoah, Paul D.P.; Easton, Douglas; Pankratz, V. Shane; Slager, Susan; Vachon, Celine M.; Couch, Fergus J.

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymorphisms (SNPs) from 194 mitotic genes and breast cancer risk, overall and by histologic grade, in the Breast Cancer Association Consortium (BCAC) iCOGS study (n = 39 067 cases; n = 42 106 controls). SNPs in TACC2 [rs17550038: odds ratio (OR) = 1.24, 95% confidence interval (CI) 1.16–1.33, P = 4.2 × 10−10) and EIF3H (rs799890: OR = 1.07, 95% CI 1.04–1.11, P = 8.7 × 10−6) were significantly associated with risk of low-grade breast cancer. The TACC2 signal was retained (rs17550038: OR = 1.15, 95% CI 1.07–1.23, P = 7.9 × 10−5) after adjustment for breast cancer risk SNPs in the nearby FGFR2 gene, suggesting that TACC2 is a novel, independent genome-wide significant genetic risk locus for low-grade breast cancer. While no SNPs were individually associated with high-grade disease, a pathway-level gene set analysis showed that variation across the 194 mitotic genes was associated with high-grade breast cancer risk (P = 2.1 × 10−3). These observations will provide insight into the contribution of mitotic defects to histological grade and the etiology of breast cancer. PMID:24927736

  11. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  12. Differential susceptibility to plasticity: a 'missing link' between gene-culture co-evolution and neuropsychiatric spectrum disorders?

    Directory of Open Access Journals (Sweden)

    Wurzman Rachel

    2012-04-01

    Full Text Available Abstract Brüne's proposal that erstwhile 'vulnerability' genes need to be reconsidered as 'plasticity' genes, given the potential for certain environments to yield increased positive function in the same domain as potential dysfunction, has implications for psychiatric nosology as well as a more dynamic understanding of the relationship between genes and culture. In addition to validating neuropsychiatric spectrum disorder nosologies by calling for similar methodological shifts in gene-environment-interaction studies, Brüne's position elevates the importance of environmental contexts - inclusive of socio-cultural variables - as mechanisms that contribute to clinical presentation. We assert that when models of susceptibility to plasticity and neuropsychiatric spectrum disorders are concomitantly considered, a new line of inquiry emerges into the co-evolution and co-determination of socio-cultural contexts and endophenotypes. This presents potentially unique opportunities, benefits, challenges, and responsibilities for research and practice in psychiatry. Please see related manuscript: http://www.biomedcentral.com/1741-7015/10/38

  13. Extended-spectrum β-lactamases, carbapenemases and the mcr-1 gene: is there a historical link?

    Science.gov (United States)

    Rhouma, Mohamed; Letellier, Ann

    2017-03-01

    The plasmid mediated mcr-1 gene encoding for Enterobacteriaceae colistin resistance has been recently identified across five continents. The objective of the present study was to trace historical events concerning the discovery and emergence of the mcr-1 gene along with ESBL and carbapenemase genes since several studies have reported identifying mcr-1 genes among Extended-Spectrum β-Lactamases (ESBL) and/or carbapenemase producing Escherichia coli. A retrospective study reported the identification of the mcr-1 gene in E. coli strains isolated in the 1980s, and this seems to correspond to the first identification of ESBL enzymes. The first discovery of the New Delhi metallo-beta-lactamase-1 (NDM-1) in 2009 was associated with a significant increase in mcr-1 gene prevalence in E. coli strains obtained from food producing animals. We noticed that a historical link has existed between mcr-1, ESBL and carbapenemase genes since the 1980s, and we believe that the re-evaluation of colistin use in livestock needs an overall approach that includes not only colistin use reduction but also the reduction of all antibiotic use. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  14. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Directory of Open Access Journals (Sweden)

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  15. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Science.gov (United States)

    Anderson, Mark T; Seifert, H Steven

    2013-01-01

    Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae when investigating

  16. Plant functional types are more efficient than climate in predicting spectrums of trait variation in evergreen angiosperm trees of tropical Australia and China

    Science.gov (United States)

    Togashi, H. F.; Prentice, I. C. C.; Atkin, O. K.; Bloomfield, K. J.; Bradford, M.; Weerasinghe, L. K.; Harrison, S. P.; Evans, B. J.; Liddell, M. J.; Wang, H.; Cao, K. F.; Fan, Z.

    2015-12-01

    The representation of Plant Functional Types (PFTs) in current generation of Dynamic Global Vegetation Models (DGVMs) is excessively simplistically. Key ecophysiological properties, such as photosynthesis biochemistry, are most times merely averaged and trade-off with other plant traits is often neglected. Validation of a PFT framework based in photosynthetic process is crucial to improve reliability of DGVMs. We present 431 leaf-biochemical and wood level measurements in evergreen angiosperm trees of tropical forests in Australia and China that were divided in four spectrums of plant trait variation: metabolic, structural, hydraulic and height dimensions. Plant traits divided in each of these dimensions adopt survival strategies reflected more clearly by trade-off within each spectrum, and in some extent across spectrums. Co-ordination theory (that Rubisco- and electron-transport limited rates of photosynthesis are co-limiting) and least-coast theory (that intercellular to ambient CO2 concentration minimizes the combined costs per unit carbon assimilation, regulating maximum height and wood density) expectations matched PFT (which takes in account canopy position and light access, and life spam) variation. Our findings suggest that climate (air moisture, air temperature, light) has lower power representing these dimensions, in comparison to the PFT framework.

  17. Antigen-presenting genes and genomic copy number variations in the Tasmanian devil MHC

    Directory of Open Access Journals (Sweden)

    Cheng Yuanyuan

    2012-03-01

    Full Text Available Abstract Background The Tasmanian devil (Sarcophilus harrisii is currently under threat of extinction due to an unusual fatal contagious cancer called Devil Facial Tumour Disease (DFTD. DFTD is caused by a clonal tumour cell line that is transmitted between unrelated individuals as an allograft without triggering immune rejection due to low levels of Major Histocompatibility Complex (MHC diversity in Tasmanian devils. Results Here we report the characterization of the genomic regions encompassing MHC Class I and Class II genes in the Tasmanian devil. Four genomic regions approximately 960 kb in length were assembled and annotated using BAC contigs and physically mapped to devil Chromosome 4q. 34 genes and pseudogenes were identified, including five Class I and four Class II loci. Interestingly, when two haplotypes from two individuals were compared, three genomic copy number variants with sizes ranging from 1.6 to 17 kb were observed within the classical Class I gene region. One deletion is particularly important as it turns a Class Ia gene into a pseudogene in one of the haplotypes. This deletion explains the previously observed variation in the Class I allelic number between individuals. The frequency of this deletion is highest in the northwestern devil population and lowest in southeastern areas. Conclusions The third sequenced marsupial MHC provides insights into the evolution of this dynamic genomic region among the diverse marsupial species. The two sequenced devil MHC haplotypes revealed three copy number variations that are likely to significantly affect immune response and suggest that future work should focus on the role of copy number variations in disease susceptibility in this species.

  18. Case report: an unexpected link between partial deletion of the SHANK3 gene and Heller's dementia infantilis, a rare subtype of autism spectrum disorder

    National Research Council Canada - National Science Library

    Philippe, Anne; Craus, Yann; Rio, Marlène; Bahi-Buisson, Nadia; Boddaert, Nathalie; Malan, Valérie; Bonnefont, Jean-Paul; Robel, Laurence

    2015-01-01

    Deletions and mutations involving the SHANK3 gene lead to a nonspecific clinical presentation with moderate to profound intellectual disability, severely delayed or absent speech, and autism spectrum disorders (ASD...

  19. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Directory of Open Access Journals (Sweden)

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  20. [Genetic variation analysis of canine parvovirus VP2 gene in China].

    Science.gov (United States)

    Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

    2009-11-01

    To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

  1. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Science.gov (United States)

    Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D

    2016-01-01

    Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  2. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  3. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Science.gov (United States)

    Li, Zhenkun; Huo, Xueyun; Zhang, Shuangyue; Lu, Jing; Li, Changlong; Guo, Meng; Fu, Rui; He, Zhengming; Du, Xiaoyan; Chen, Zhenwen

    2015-01-01

    Deformities in the Circle of Willis (CoW) can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH). After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR) on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2) associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  4. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Directory of Open Access Journals (Sweden)

    Zhenkun Li

    Full Text Available Deformities in the Circle of Willis (CoW can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH. After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2 associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  5. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  6. Systematic variation in gene expression patterns in human cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ross, Douglas T.; Scherf, Uwe; Eisen, Michael B.; Perou, Charles M.; Rees, Christian; Spellman, Paul; Iyer, Vishwanath; Jeffrey, Stefanie S.; Van de Rijn, Matt; Waltham, Mark; Pergamenschikov, Alexander; Lee, Jeffrey C.F.; Lashkari, Deval; Shalon, Dari; Myers, Timothy G.; Weinstein, John N.; Botstein, David; Brown, Patrick O.

    2000-01-01

    We used cDNA micro arrays to explore the variation in expression of approximately 8,000 unique genes among the 60 cell lines used in the National Cancer Institute s screen for anti-cancer drugs. Classification of the cell lines based solely on the observed patterns of gene expression revealed a correspondence to the ostensible origins of the tumors from which the cell lines were derived. The consistent relationship between the gene expression patterns and the tissue of origin allowed us to recognize outliers whose previous classification appeared incorrect. Specific features of the gene expression patterns appeared to be related to physiological properties of the cell lines, such as their doubling time in culture, drug metabolism or the interferon response. Comparison of gene expression patterns in the cell lines to those observed in normal breast tissue or in breast tumor specimens revealed features of the expression patterns in the tumors that had recognizable counterparts in specific cell lines, reflecting the tumor, stromal and inflammatory components of the tumor tissue. These results provided a novel molecular characterization of this important group of human cell lines and their relationships to tumors in vivo.

  7. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  8. Analysis of Resistant Spectrum to Rice Blast in Transgenic Rice Lines Introduced Lysozyme Gene from T4 Phage

    Institute of Scientific and Technical Information of China (English)

    XU Ming-hui; LI Cheng-yun; LI Jin-bin; TAN Xue-lin; TIAN Wen-zhong; TANG Zuo-shun

    2003-01-01

    The receptor cultivar Nan29 and thirty-six T5 rice lines derived from ten T0 generation transgen-ic plants harboring lysozyme gene were challenged in the greenhouse by inoculating 63 isolates belonging to 48races of Magnaporthe grisea from Yunnan Province. The transgenic rice lines exhibited resistance to morethan 72% of isolates inoculated in this experiment, and 38.1% (24 isolates) of them could infect the receptorcultivar Nan29. The results indicated that the transgenic rice lines possessed wide-spectrum resistance againstvarious rice blast races and the resistant spectrum of rice lines were different although some lines derived fromsame T0 plant. The transgenic rice lines exhibited also high resistance to leaf and neck blast in the disease fieldevaluation, but not all of resistant lines against leaf blast were resistant to neck blast.

  9. Genetic variation in telomere maintenance genes, telomere length, and lung cancer susceptibility.

    Science.gov (United States)

    Hosgood, H Dean; Cawthon, Richard; He, Xingzhou; Chanock, Stephen; Lan, Qing

    2009-11-01

    Telomeres are responsible for the protection of the chromosome ends and shortened telomere length has been associated with risk of multiple cancers. Genetic variation in telomere-related genes may alter cancer risk associated with telomere length. Using lung cancer cases (n=120) and population-based controls (n=110) from Xuanwei, China, we analyzed telomere length separately and in conjunction with single nucleotide polymorphisms in the telomere maintenance genes POT1, TERT, and TERF2, which we have previously reported were associated with risk of lung cancer in this study. POT1 rs10244817, TERT rs2075786, and TERF2 rs251796 were significantly associated with lung cancer (p(trend)telomere length was not significantly associated with risk of lung cancer (OR=1.58; 95% CI=0.79-3.18) when compared to the longest tertile of telomere length. When stratified by genotype, there was a suggestion of a dose-response relationship between tertiles of telomere length and risk of lung cancer among the POT1 rs10244817 common variant carriers (OR (95% CI)=1.33 (0.47-3.75), 3.30 (1.14-9.56), respectively) but not among variant genotype carriers (p(interaction)=0.05). Our findings provide evidence that telomere length and genetic variation in telomere maintenance genes may be associated with risk of lung cancer susceptibility and warrant replication in larger studies.

  10. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Science.gov (United States)

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; Hasler, Brant P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2013-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30–54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p seasonal patterns of recurrence or exacerbation. PMID:22881342

  11. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  12. Genetic variations of the dihydrofolate reductase gene of Plasmodium vivax in Mandalay Division, Myanmar.

    Science.gov (United States)

    Na, Byoung-Kuk; Lee, Hyeong-Woo; Moon, Sung-Ung; In, Tae-Suk; Lin, Khin; Maung, Maung; Chung, Gyung-Tae; Lee, Jong-Koo; Kim, Tong-Soo; Kong, Yoon

    2005-07-01

    Dihydrofolate reductase (DHFR; EC1.5.1.3) is a known target enzyme for antifolate agents, which are used as alternative chemotherapeutics for chloroquine-resistant malaria. Mutations in the dhfr gene of Plasmodium vivax are thought to be associated with resistance to the antifolate drugs. In this study, we have analyzed genetic variations in the dhfr genes of clinical isolates of P. vivax (n=21) in Myanmar, to monitor antifolate resistance in this country. Sequence variations within the entire dhfr gene were highly restricted to codons from 57 to 117, and the GGDN tandem repeat region. Double (S58R and S117N/T) or quadruple mutations (F57L/I, S58R, T61M, and S117N/T), which may be closely related to the drug resistance, were recognized in most of the isolates (20/21 cases). Our results suggest that antifolate-resistant P. vivax is becoming widespread in Myanmar, as it also is in the neighboring countries in Southeast Asia. It appears that the drug resistance situation may be worsening in the country.

  13. Clinically relevant genetic variants of drug-metabolizing enzyme and transporter genes detected in Thai children and adolescents with autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Medhasi S

    2016-04-01

    Full Text Available Sadeep Medhasi,1–3 Ekawat Pasomsub,4 Natchaya Vanwong,1,2 Nattawat Ngamsamut,5 Apichaya Puangpetch,1,2 Montri Chamnanphon,1,2 Yaowaluck Hongkaew,1,2 Penkhae Limsila,5 Darawan Pinthong,3 Chonlaphat Sukasem1,2 1Division of Pharmacogenomics and Personalized Medicine, Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand; 2Laboratory for Pharmacogenomics, Somdech Phra Debaratana Medical Center, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand; 3Department of Pharmacology, Faculty of Science, Mahidol University, Bangkok, Thailand; 4Division of Virology, Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand; 5Yuwaprasart Waithayopathum Child and Adolescent Psychiatric Hospital, Department of Mental Health Services, Ministry of Public Health, Samut Prakarn, Thailand Abstract: Single-nucleotide polymorphisms (SNPs among drug-metabolizing enzymes and transporters (DMETs influence the pharmacokinetic profile of drugs and exhibit intra- and interethnic variations in drug response in terms of efficacy and safety profile. The main objective of this study was to assess the frequency of allelic variants of drug absorption, distribution, metabolism, and elimination-related genes in Thai children and adolescents with autism spectrum disorder. Blood samples were drawn from 119 patients, and DNA was extracted. Genotyping was performed using the DMET Plus microarray platform. The allele frequencies of the DMET markers were generated using the DMET Console software. Thereafter, the genetic variations of significant DMET genes were assessed. The frequencies of SNPs across the genes coding for DMETs were determined. After filtering the SNPs, 489 of the 1,931 SNPs passed quality control. Many clinically relevant SNPs, including CYP2C19*2, CYP2D6*10, CYP3A5*3, and SLCO1B1*5, were found to have frequencies similar to those in the Chinese

  14. The roles of CC2D1A and HTR1A gene expressions in autism spectrum disorders.

    Science.gov (United States)

    Sener, Elif Funda; Cıkılı Uytun, Merve; Korkmaz Bayramov, Keziban; Zararsiz, Gokmen; Oztop, Didem Behice; Canatan, Halit; Ozkul, Yusuf

    2016-06-01

    Classical autism belongs to a group of heterogeneous disorders known as autism spectrum disorders (ASD). Autism is defined as a neurodevelopmental disorder, characterized by repetitive stereotypic behaviors or restricted interests, social withdrawal, and communication deficits. Numerous susceptibility genes and chromosomal abnormalities have been reported in association with autism but the etiology of this disorder is unknown in many cases. CC2D1A gene has been linked to mental retardation (MR) in a family with a large deletion before. Intellectual disability (ID) is a common feature of autistic cases. Therefore we aimed to investigate the expressions of CC2D1A and HTR1A genes with the diagnosis of autism in Turkey. Forty-four autistic patients (35 boys, 9 girls) and 27 controls were enrolled and obtained whole blood samples to isolate RNA samples from each participant. CC2D1A and HTR1A gene expressions were assessed by quantitative Real-Time PCR (qRT-PCR) in Genome and Stem Cell Center, Erciyes University. Both expressions of CC2D1A and HTR1A genes studied on ASD cases and controls were significantly different (p < 0.001). The expression of HTR1A was undetectable in the ASD samples. Comparison of ID and CC2D1A gene expression was also found statistically significant (p = 0.028). CC2D1A gene expression may be used as a candidate gene for ASD cases with ID. Further studies are needed to investigate the potential roles of these CC2D1A and HTR1A genes in their related pathways in ASD.

  15. Genetic variation of Taenia pisiformis collected from Sichuan, China, based on the mitochondrial cytochrome B gene.

    Science.gov (United States)

    Yang, Deying; Ren, Yongjun; Fu, Yan; Xie, Yue; Nie, Huaming; Nong, Xiang; Gu, Xiaobin; Wang, Shuxian; Peng, Xuerong; Yang, Guangyou

    2013-08-01

    Taenia pisiformis is one of the most important parasites of canines and rabbits. T. pisiformis cysticercus (the larval stage) causes severe damage to rabbit breeding, which results in huge economic losses. In this study, the genetic variation of T. pisiformis was determined in Sichuan Province, China. Fragments of the mitochondrial cytochrome b (cytb) (922 bp) gene were amplified in 53 isolates from 8 regions of T. pisiformis. Overall, 12 haplotypes were found in these 53 cytb sequences. Molecular genetic variations showed 98.4% genetic variation derived from intra-region. FST and Nm values suggested that 53 isolates were not genetically differentiated and had low levels of genetic diversity. Neutrality indices of the cytb sequences showed the evolution of T. pisiformis followed a neutral mode. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. These findings indicate that 53 isolates of T. pisiformis keep a low genetic variation, which provide useful knowledge for monitoring changes in parasite populations for future control strategies.

  16. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation.

    Science.gov (United States)

    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw

    2016-12-31

    Host-pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Common genetic variations in the CYP2R1 and GC genes are determinants of vitamin D status in Danes

    DEFF Research Database (Denmark)

    Nissen, Ioanna

    ), after 6 months intake of vitamin D3-fortified bread and milk (paper II) and in 92 participants in the VitDgen study after artificial UVB irradiation during winter (paper III). Common genetic variations in the CYP2R1 and GC genes were found to be important determinants of vitamin D status in three out...... by genetic variation in vitamin D modulating genes. Twin and family-based studies indicate that genetic variation may have an appreciable influence on vitamin D status. Moreover, several candidate gene studies including two genome-wide association studies (GWAS) have found single nucleotide polymorphisms...... (SNPs) in CYP2R1, CYP24A1, CYP27B1, C10orf88, DHCR7/NADSYN1, GC and VDR genes to be associated with vitamin D status. The main hypothesis of this work was that genetically determined variation in vitamin D metabolism would influence the effect of vitamin D sources (vitamin D...

  18. Inheritance studies of apple scab resistance and identification of Rvi14, a new major gene that acts together with other broad-spectrum QTL.

    Science.gov (United States)

    Soufflet-Freslon, V; Gianfranceschi, L; Patocchi, A; Durel, C-E

    2008-08-01

    Scab, caused by the fungal pathogen Venturia inaequalis, is the most common disease of cultivated apple (Malus xdomestica). The fungal races 6 and 7 have now overcome the major resistance gene Vf, which is widely used in apple breeding programmes. New breeding strategies to achieve durable resistance are thus necessary. The aim of this study was to determine the genetic basis of quantitative resistance of the apple cultivar 'Dülmener Rosenapfel', known to be scab resistant under different environmental conditions. An F1 progeny derived from the cross between the susceptible cultivar 'Gala' and 'Dülmener Rosenapfel' was tested in a greenhouse with a multi-isolate inoculum of V. inaequalis. Rvi14, a new major gene that conditions a chlorotic-type reaction, was mapped on linkage group (LG) 6 in a genomic region not known to be involved in disease resistance. A further three quantitative trait loci (QTL) for resistance were identified. One co-localized with Rvi14 on LG6, whereas the remaining two were detected on LG11 and LG17, in genomic regions already reported to carry broad-spectrum QTL in other genetic backgrounds. Since a selective genotyping approach was used to detect QTL, an expectation-maximization (EM) computation was used to estimate the corrected QTL contributions to phenotypic variation and was validated by entire progeny genotyping.

  19. FTO gene variation and measures of body mass in an African population

    Directory of Open Access Journals (Sweden)

    Hattersley Andrew T

    2009-03-01

    Full Text Available Abstract Background Variation in the fat mass and obesity associated (FTO gene has been reproducibly associated with body mass index (BMI and obesity in populations of White European origin. Data from Asians and African-Americans is less conclusive. Methods We assessed the effect of 16 FTO polymorphisms on body mass in a large population of predominantly lean Gambians (Nmax 2208 participating in a long-term surveillance program providing contemporary and early-life anthropometric measurements. Results Sixteen FTO tagSNPs screened here, including several associated with BMI in Europeans, were not associated with birth weight (BWT, early weight gain in 1–2 year olds, BMI in adults (≥ 18 y, or weight-for-height (WFH z-score across all ages. No association was seen between genotype and WFH z-score or other measures of body mass. The confidence limits indicate that the effect size for WFH z-score never exceeded 0.17 units per allele copy for any SNP (excluding the three SNPs with allele Conclusion To our knowledge this is the first study of FTO gene variation in a well-characterised African population. Our results suggest that FTO gene variation does not influence measures of body mass in Gambians living a traditional lifestyle, or has a smaller effect than that detected in Europeans. These findings are not directly comparable to results from previous studies in African-Americans due to differences in study design and analysis. It is also possible that any effect of FTO genotype on body mass is of limited relevance in a lean population where little excess food is available, compared to similar ethnic populations where food supply is plentiful.

  20. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

    NARCIS (Netherlands)

    Yuen, Ryan K C; Merico, Daniele; Bookman, Matt; Howe, Jennifer L.; Thiruvahindrapuram, Bhooma; Patel, Rohan V.; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A.; Walker, Susan; Marshall, Christian R.; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D'Abate, Lia; Chan, Ada J S; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L.; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J.; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R.; Nalpathamkalam, Thomas; Sung, Wilson W L; Tsoi, Fiona J.; Wei, John; Xu, Lizhen; Tasse, Anne Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie Mackinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M.; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H.; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A.; Parr, Jeremy R.; Spence, Sarah J.; Vorstman, Jacob|info:eu-repo/dai/nl/304817023; Frey, Brendan J.; Robinson, James T.; Strug, Lisa J.; Fernandez, Bridget A.; Elsabbagh, Mayada; Carter, Melissa T.; Hallmayer, Joachim; Knoppers, Bartha M.; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H.; Glazer, David; Pletcher, Mathew T.; Scherer, Stephen W.

    2017-01-01

    We are performing whole-genome sequencing of families with autism spectrum disorder (ASD) to build a resource (MSSNG) for subcategorizing the phenotypes and underlying genetic factors involved. Here we report sequencing of 5,205 samples from families with ASD, accompanied by clinical information,

  1. From Structural Variation of Gene Molecules to Chromatin Dynamics and Transcriptional Bursting

    Directory of Open Access Journals (Sweden)

    Hinrich Boeger

    2015-06-01

    Full Text Available Transcriptional activation of eukaryotic genes is accompanied, in general, by a change in the sensitivity of promoter chromatin to endonucleases. The structural basis of this alteration has remained elusive for decades; but the change has been viewed as a transformation of one structure into another, from “closed” to “open” chromatin. In contradistinction to this static and deterministic view of the problem, a dynamical and probabilistic theory of promoter chromatin has emerged as its solution. This theory, which we review here, explains observed variation in promoter chromatin structure at the level of single gene molecules and provides a molecular basis for random bursting in transcription—the conjecture that promoters stochastically transition between transcriptionally conducive and inconducive states. The mechanism of transcriptional regulation may be understood only in probabilistic terms.

  2. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  3. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2016-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  4. Variation in the sequence and modification state of the human insulin gene flanking regions.

    Science.gov (United States)

    Ullrich, A; Dull, T J; Gray, A; Philips, J A; Peter, S

    1982-04-10

    The nucleotide sequence of a highly repetitive sequence region upstream from the human insulin gene is reported. The length of this region varies between alleles in the population, and appears to be stably transmitted to the next generation in a Mendelian fashion. There is no significant correlation between the length of this sequence and two types of diabetes mellitus. We observe variation in the cleavability of a BglI recognition site downstream from the human insulin gene, which is probably due to variable nucleotide modification. This presumed modification state appears not to be inherited, and varies between tissues within an individual and between individuals for a given tissue. Both alleles in a given tissue DNA sample are modified to the same extent.

  5. Determining the Lyapunov Spectrum of Continuous-Time 1D and 2D Multiscroll Chaotic Oscillators via the Solution of m-PWL Variational Equations

    Directory of Open Access Journals (Sweden)

    Jesus Manuel Munoz-Pacheco

    2013-01-01

    Full Text Available An algorithm to compute the Lyapunov exponents of piecewise linear function-based multidirectional multiscroll chaotic oscillators is reported. Based on the m regions in the piecewise linear functions, the suggested algorithm determines the individual expansion rate of Lyapunov exponents from m-piecewise linear variational equations and their associated m-Jacobian matrices whose entries remain constant during all computation cycles. Additionally, by considering OpAmp-based chaotic oscillators, we study the impact of two analog design procedures on the magnitude of Lyapunov exponents. We focus on analyzing variations of both frequency bandwidth and voltage/current dynamic range of the chaotic signals at electronic system level. As a function of the design parameters, a renormalization factor is proposed to estimate correctly the Lyapunov spectrum. Numerical simulation results in a double-scroll type chaotic oscillator and complex chaotic oscillators generating multidirectional multiscroll chaotic attractors on phase space confirm the usefulness of the reported algorithm.

  6. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory.

  7. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Science.gov (United States)

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. Published by Oxford University Press on behalf of Kazusa DNA Research Institute 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  8. Drd4 gene polymorphisms are associated with personality variation in a passerine bird.

    Science.gov (United States)

    Fidler, Andrew E; van Oers, Kees; Drent, Piet J; Kuhn, Sylvia; Mueller, Jakob C; Kempenaers, Bart

    2007-07-22

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, genotype-environment interactions and confounding environmental factors all act to obscure genotype-personality relationships. Such problems can be addressed by measuring personality under standardized conditions and by selection experiments, with both approaches only feasible with non-human animals. Looking for similar Drd4 genotype-personality associations in a free-living bird, the great tit (Parus major), we detected 73 polymorphisms (66 SNPs, 7 indels) in the P. major Drd4 orthologue. Two of the P. major Drd4 gene polymorphisms were investigated for evidence of association with novelty-seeking behaviour: a coding region synonymous single nucleotide polymorphism (SNP830) and a 15bp indel (ID15) located 5' to the putative transcription initiation site. Frequencies of the three Drd4 SNP830 genotypes, but not the ID15 genotypes, differed significantly between two P. major lines selected over four generations for divergent levels of 'early exploratory behaviour' (EEB). Strong corroborating evidence for the significance of this finding comes from the analysis of free-living, unselected birds where we found a significant association between SNP830 genotypes and differing mean EEB levels. These findings suggest that an association between Drd4 gene polymorphisms and animal personality variation predates the divergence of the avian and mammalian lineages. Furthermore, this work heralds the possibility of following microevolutionary changes in frequencies of behaviourally relevant Drd4 polymorphisms within populations where natural selection acts differentially on different personality types.

  9. Genetic Variation in Osteopontin Gene Is Associated with Susceptibility to Sarcoidosis in Slovenian Population

    Directory of Open Access Journals (Sweden)

    A. Maver

    2009-01-01

    Full Text Available Sarcoidosis is a systemic inflammatory disease characterised by appearance of granulomas. Precise etiology has not been elucidated. Osteopontin (Opn is a Th1 cytokine whose levels have been found increased in granulomas and serum samples from patients with sarcoidosis. We investigated whether genetic variation in Osteopontin gene (OPN gene contributes to susceptibility to sarcoidosis. Haplotype-block structure in the OPN gene region was investigated using data from HapMap project. Three representative SNPs have been selected from each block of SNPs in linkage disequilibrium (rs11730582-C/T, rs11728697-C/T and rs4754-C/T. Genotyping was performed using TaqMan SNP Genotyping Assays on a sample of 165 patients and 284 controls. Statistical analyses of association were performed using Chi-Square test and algorithms implemented in the haplo.stats and PHASE packages. Genotyping analysis revealed a significant difference in genotype frequencies at rs4754 polymorphism in groups of patients and controls under recessive genetic model (p=0.036, OR=1.99, 95%CI=1.04-3.82, CC homozygotes being significantly over-represented in the patients group. However these results failed to reach significance after correction for multiple testing (p=0.25. The frequencies of predicted haplotypes differed between patient and control groups, frequency of TTT haplotype was found to be significantly decreased in the group of patients with sarcoidosis (p=0.014, OR=0.40, 95%CI=0.20-0.79. Our results suggest that variation in the OPN gene might be significantly associated with sarcoidosis and that the TTT haplotype in OPN may act as a protective factor in sarcoidosis.

  10. Investigation of Gene Regulatory Networks Associated with Autism Spectrum Disorder Based on MiRNA Expression in China.

    Directory of Open Access Journals (Sweden)

    Fengzhen Huang

    Full Text Available Autism spectrum disorder (ASD comprise a group of neurodevelopmental disorders characterized by deficits in social and communication capacities and repetitive behaviors. Increasing neuroscientific evidence indicates that the neuropathology of ASD is widespread and involves epigenetic regulation in the brain. Differentially expressed miRNAs in the peripheral blood from autism patients were identified by high-throughput miRNA microarray analyses. Five of these miRNAs were confirmed through quantitative reverse transcription-polymerase chain reaction (qRT-PCR analysis. A search for candidate target genes of the five confirmed miRNAs was performed through a Kyoto encyclopedia of genes and genomes (KEGG biological pathways and Gene Ontology enrichment analysis of gene function to identify gene regulatory networks. To the best of our knowledge, this study provides the first global miRNA expression profile of ASD in China. The differentially expressed miR-34b may potentially explain the higher percentage of male ASD patients, and the aberrantly expressed miR-103a-3p may contribute to the abnormal ubiquitin-mediated proteolysis observed in ASD.

  11. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. ...... imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). CONCLUSION: These results, generated on a large cohort of women, revealed associations between inherited cellular transport gene variants and risk of EOC histologic subtypes.......BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes....... As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. METHODS: In total, DNA samples were obtained from 14,525 case subjects with invasive EOC...

  12. Molecular cloning and daily variations of the Period gene in a reef fish Siganus guttatus.

    Science.gov (United States)

    Park, Ji-Gweon; Park, Yong-Ju; Sugama, Nozomi; Kim, Se-Jae; Takemura, Akihiro

    2007-04-01

    As the first step in understanding the molecular oscillation of the circa rhythms in the golden rabbitfish Siganus guttatus--a reef fish with a definite lunar-related rhythmicity--we cloned and sequenced a Period gene (rfPer). The rfPer gene contained an open reading frame that encodes a protein consisting of 1,452 amino acids; this protein is highly homologous to PER proteins of vertebrates including zebrafish. Phylogenetic analyses indicated that the rfPER protein is related to the zebrafish PER1 and PER4. The expression of rfPer mRNA in the whole brain, retina, and liver under light/dark (LD) conditions increased at 06:00 h and decreased at 18:00 h, suggesting that its robust circadian rhythm occurs in neural and peripheral tissues. When daily variation in the expression in rfPer mRNA in the whole brain and cultured pineal gland were examined under LD conditions, similar expression patterns of the gene were observed with an increase around dawn. Under constant light condition, the increased expression of rfPer mRNA in the whole brain disappeared around dawn. The present results demonstrate that rfPer is related to zPer4 and possibly zPer1. The present study is the first report on the Period gene from a marine fish.

  13. A spectrum of genes expressed during early stages of rice panicle and flower development

    Indian Academy of Sciences (India)

    Kumuda M. Kushalappa; Autar K. Mattoo; Usha Vijayraghavan

    2000-08-01

    To unravel gene expression patterns during rice inflorescence development, particularly at early stages of panicle and floral organ specification, we have characterized random cloned cDNAs from developmental-stage-specific libraries. cDNA libraries were constructed from rice panicles at the stage of branching and flower primordia specification or from panicles undergoing floral organogenesis. Partial sequence analysis and expression patterns of some of these random cDNA clones from these two rice panicle libraries are presented. Sequence comparisons with known DNA sequences in databases reveal that approximately sixtyeight per cent of these expressed rice genes show varying degrees of similarity to genes in other species with assigned functions. In contrast, thirtytwo per cent represent uncharacterized genes. cDNAs reported here code for potential rice homologues of housekeeping molecules, regulators of gene expression, and signal transduction molecules. They comprise both single-copy and multicopy genes, and genes expressed differentially, both spatially and temporally, during rice plant development. New rice cDNAs requiring specific mention are those with similarity to COP1, a regulator of photomorphogenesis in Arabidopsis; sequence-specific DNA binding plant proteins like AP2-domain-containing factors; genes that specify positional information in shoot meristems like leucine-rich-repeat-containing receptor kinases; regulators of chromatin structure like Polycomb domain protein; and also proteins induced by abiotic stresses.

  14. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    LENUS (Irish Health Repository)

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  15. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Indian Academy of Sciences (India)

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  16. The impact of osteopontin gene variations on multiple sclerosis development and progression.

    Science.gov (United States)

    Comi, Cristoforo; Cappellano, Giuseppe; Chiocchetti, Annalisa; Orilieri, Elisabetta; Buttini, Sara; Ghezzi, Laura; Galimberti, Daniela; Guerini, Franca; Barizzone, Nadia; Perla, Franco; Leone, Maurizio; D'Alfonso, Sandra; Caputo, Domenico; Scarpini, Elio; Cantello, Roberto; Dianzani, Umberto

    2012-01-01

    Osteopontin is a proinflammatory molecule, modulating TH1 and TH17 responses. Several reports suggest its involvement in multiple sclerosis (MS) pathogenesis. We previously reported that OPN gene variations at the 3' end are a predisposing factor for MS development and evolution. In this paper, we extended our analysis to a gene variation at the 5' end on the -156G > GG single nucleotide polymorphism (SNP) and replicated our previous findings at the 3' end on the +1239A > C SNP. We found that only +1239A > C SNP displayed a statistically significant association with MS development, but both +1239A > C and -156G > GG had an influence on MS progression, since patients homozygous for both +1239A and -156GG alleles displayed slower progression of disability and slower switch to secondary progression than those carrying +1239C and/or -156G and those homozygous for +1239A only. Moreover, patients homozygous for +1239A also displayed a significantly lower relapse rate than those carrying +1239C, which is in line with the established role of OPN in MS relapses.

  17. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Directory of Open Access Journals (Sweden)

    Helle Ruff Laursen

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  18. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  19. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A

  20. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the

  1. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A a

  2. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    2012-01-01

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the pre

  3. Identification of Klebsiella pneumoniae strains harboring inactive extended-spectrum beta-lactamase antibiotic-resistance genes

    Institute of Scientific and Technical Information of China (English)

    Xu Li; Zhai Yao; Lyu Yuan; Wang Qi; An Shuchang; Chen Jichao; Chen Yusheng

    2014-01-01

    Background The extended-spectrum beta-lactamase (ESBL)-producing Klebsiella pneumoniae has increasingly become a major contributor to nosocomial infections and can exhibit multiple antibiotic resistance.Previous studies have focused on the resistance genes in ESBL-producing strains,and the resistance-associated genetic environment of non-ESBL-producing strains has been ignored until now.Here,we investigated the occurrence and characteristics of non-ESBL-producing K.pneumoniae,which potentially carries unexpressed resistance genes.Methods K.pneumoniae strains were collected from five medical institutions in China from February 2010 to August 2013.The VITEK-2 ESBL detection system was used as a primary screen to identify the ESBL-producing phenotype,and the three primary types of ESBL-associated genes (CTX,SHV,and TEM) were detected by polymerase chain reaction (PCR) to confirm the strains presenting with a non-ESBL-producing phenotype.mRNA expression in the non-ESBL-producing strains was further screened by reverse-transcription PCR (RT-PCR) to validate their transcriptional efficiency.Results Out of 224 clinically isolated antibiotic-sensitive K.pneumoniae strains with a non-ESBL-producing phenotype,5 (2.2%) were identified to carry inactivated ESBL blaSHV genes with intact upstream promoter regions and resistance gene sequences.Interestingly,three of the five antibiotic-sensitive K.pneumoniae strains containing ESBL blaSHV genes still exhibited mRNA transcription of blasHv,while the other two exhibited no mRNA transcription.Conclusion These findings suggest that inactivated ESBL genes exist in non-ESBL-producing antibiotic-sensitive K.pneumoniae strains,which have the potential to transform the strain into an ESBL phenotype if an inappropriate application or overdose of antibiotics is implemented during clinical management.

  4. Polymorphic genes of major effect: consequences for variation, selection and evolution in Arabidopsis thaliana.

    Science.gov (United States)

    Stinchcombe, John R; Weinig, Cynthia; Heath, Katy D; Brock, Marcus T; Schmitt, Johanna

    2009-07-01

    The importance of genes of major effect for evolutionary trajectories within and among natural populations has long been the subject of intense debate. For example, if allelic variation at a major-effect locus fundamentally alters the structure of quantitative trait variation, then fixation of a single locus can have rapid and profound effects on the rate or direction of subsequent evolutionary change. Using an Arabidopsis thaliana RIL mapping population, we compare G-matrix structure between lines possessing different alleles at ERECTA, a locus known to affect ecologically relevant variation in plant architecture. We find that the allele present at ERECTA significantly alters G-matrix structure-in particular the genetic correlations between branch number and flowering time traits-and may also modulate the strength of natural selection on these traits. Despite these differences, however, when we extend our analysis to determine how evolution might differ depending on the ERECTA allele, we find that predicted responses to selection are similar. To compare responses to selection between allele classes, we developed a resampling strategy that incorporates uncertainty in estimates of selection that can also be used for statistical comparisons of G matrices.

  5. Persistent fifth arch anomalies - broadening the spectrum to include a variation of double aortic arch vascular ring

    Energy Technology Data Exchange (ETDEWEB)

    Newman, Beverley; Chan, Frandics [Stanford Children' s Hospital and Stanford University, Department of Radiology, Stanford, CA (United States); Hanneman, Kate [University of Toronto, Department of Medical Imaging, Toronto, ON (Canada)

    2016-12-15

    Fifth arch anomalies are rare and complex and frequently misdiagnosed or mistaken for other entities. We report a double arch vascular ring that is thought to consist of right fourth arch and left fifth arch components, a previously undescribed persistent fifth arch variant. The currently recognized spectrum and classification of fifth arch vascular anomalies are expanded along with illustrative images to justify the proposed changes. Reviewing and expanding the classification of fifth arch anomalies to include a double arch ring variant will promote recognition, correct diagnosis and appropriate management of these anomalies. (orig.)

  6. The spectrum of pulmonary sarcoidosis: Variations of high-resolution CT findings and clues for specific diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Nishino, Mizuki; Lee, Karen S. [Department of Radiology, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215 (United States); Itoh, Harumi [Department of Radiology, University of Fukui, Faculty of Medical Sciences, Matsuoka-cho, Yoshida-gun, Fukui (Japan); Hatabu, Hiroto [Department of Radiology, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215 (United States)], E-mail: hhatabu@bidmc.harvard.edu

    2010-01-15

    Sarcoidosis is a systemic disease of unknown cause, characterized by widespread non-caseating granulomas. There is a wide spectrum of radiologic manifestations in pulmonary sarcoidosis, providing challenges to radiologists. However, recognition of the key features of sarcoidosis with knowledge of its pathologic background can often allow for specific diagnosis. In this review, we describe the variety of high-resolution CT findings in pulmonary sarcoidosis along with its pathologic features as the basis for radiographic manifestations, and discuss the key features on high-resolution CT for the specific diagnosis of pulmonary sarcoidosis.

  7. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    Science.gov (United States)

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample.

  8. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  9. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt

    2011-01-01

    Recently, two large, and independent genome wide association studies of late-onset Alzheimer's disease (AD) established association with the same rs11136000 variation in the clusterin (CLU) gene. In addition, one variation, rs3851179, in the phosphatidylinositol binding clathrin assembly protein...... (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...

  10. Variation in the Coat Protein Gene of Papaya ringspot Virus Isolates from Multiple Locations of China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The potyvirus Papaya ringspot virus (PRSV) is an important pathogen of papaya that causes severe losses in economic crops for papaya production globally. The coat protein (CP) genes of five PRSV isolates originating from different locations in China were cloned and sequenced. The CP-coding region varied in size from 864-873 nucleotides, encoding proteins of 288-291 amino acids. The five Chinese isolates of PRSV have been characterized as papaya-infecting (PRSV-P). The CP sequences of the Chinese isolates were compared with those of previously published PRSV isolates originating from different countries at amino acid levels. A number of KE repeat boxes in the N terminus of the PRSV-CP were found in all Chinese isolates. The phylogenetic branching pattern revealed that there was certain extended grouping between geographic locations, and the Asian type probably represents the oldest population of PRSV. The information of CP genes will be useful in designing and developing durable virus resistant-PRSV transgenic papaya in China. Meanwhile broad-spectrum-virus resistant, strongly resistant-PRSV and good safe papaya lines are required.

  11. Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation.

    Science.gov (United States)

    Zhao, Yan; Huang, Jin; Wang, Zhizheng; Jing, Shengli; Wang, Yang; Ouyang, Yidan; Cai, Baodong; Xin, Xiu-Fang; Liu, Xin; Zhang, Chunxiao; Pan, Yufang; Ma, Rui; Li, Qiaofeng; Jiang, Weihua; Zeng, Ya; Shangguan, Xinxin; Wang, Huiying; Du, Bo; Zhu, Lili; Xu, Xun; Feng, Yu-Qi; He, Sheng Yang; Chen, Rongzhi; Zhang, Qifa; He, Guangcun

    2016-10-24

    Brown planthopper (BPH), Nilaparvata lugens Stål, is one of the most devastating insect pests of rice (Oryza sativa L.). Currently, 30 BPH-resistance genes have been genetically defined, most of which are clustered on specific chromosome regions. Here, we describe molecular cloning and characterization of a BPH-resistance gene, BPH9, mapped on the long arm of rice chromosome 12 (12L). BPH9 encodes a rare type of nucleotide-binding and leucine-rich repeat (NLR)-containing protein that localizes to the endomembrane system and causes a cell death phenotype. BPH9 activates salicylic acid- and jasmonic acid-signaling pathways in rice plants and confers both antixenosis and antibiosis to BPH. We further demonstrated that the eight BPH-resistance genes that are clustered on chromosome 12L, including the widely used BPH1, are allelic with each other. To honor the priority in the literature, we thus designated this locus as BPH1/9 These eight genes can be classified into four allelotypes, BPH1/9-1, -2, -7, and -9 These allelotypes confer varying levels of resistance to different biotypes of BPH. The coding region of BPH1/9 shows a high level of diversity in rice germplasm. Homologous fragments of the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains exist, which might have served as a repository for generating allele diversity. Our findings reveal a rice plant strategy for modifying the genetic information to gain the upper hand in the struggle against insect herbivores. Further exploration of natural allelic variation and artificial shuffling within this gene may allow breeding to be tailored to control emerging biotypes of BPH.

  12. Genetic variation in exon 5 of troponin - I gene in hypertrophic cardiomyopathy cases

    Directory of Open Access Journals (Sweden)

    Annapurna S

    2007-01-01

    Full Text Available Background: Cardiomyopathies are a heterogeneous group of heart muscle disorders and are classified as 1 Hypertrophic Cardiomyopathy (HCM 2 Dilated cardiomyopathy (DCM 3 Restrictive cardiomyopathy (RCM and 4 Arrhythmogenic right ventricular dysplasia (ARVD as per WHO classification, of which HCM and DCM are common. HCM is a complex but relatively common form of inherited heart muscle disease with prevalence of 1 in 500 individuals and is commonly associated with sarcomeric gene mutations. Cardiac muscle troponin I (TNNI-3 is one such sarcomeric protein and is a subunit of the thin filament-associated troponin-tropomyosin complex involved in calcium regulation of skeletal and cardiac muscle contraction. Mutations in this gene were found to be associated with a history of sudden cardiac death in HCM patients. Aim: Therefore the present study aims to identify for mutations associated with troponin I gene in a set of HCM patients from Indian population. Materials and Methods: Mutational analyses of 92 HCM cases were carried out following PCR based SSCP analysis. Results: The study revealed band pattern variation in 3 cases from a group of 92 HCM patients. This band pattern variation, on sequencing revealed base changes, one at nt 2560 with G>T transversion in exon-5 region with a wobble and others at nt 2479 and nt 2478 with G>C and C>G transversions in the intronic region upstream of the exon 5 on sequencing. Further analysis showed that one of the probands showed apical form of hypertrophy, two others showing asymmetric septal hypertrophy. Two of these probands showed family history of the condition. Conclusions: Hence, the study supports earlier reports of involvement of TNNI-3 in the causation of apical and asymmetrical forms of hypertrophy.

  13. Genomic imprinting variations in the mouse type 3 deiodinase gene between tissues and brain regions.

    Science.gov (United States)

    Martinez, M Elena; Charalambous, Marika; Saferali, Aabida; Fiering, Steven; Naumova, Anna K; St Germain, Donald; Ferguson-Smith, Anne C; Hernandez, Arturo

    2014-11-01

    The Dio3 gene, which encodes for the type 3 deiodinase (D3), controls thyroid hormone (TH) availability. The lack of D3 in mice results in tissue overexposure to TH and a broad neuroendocrine phenotype. Dio3 is an imprinted gene, preferentially expressed from the paternally inherited allele in the mouse fetus. However, heterozygous mice with paternal inheritance of the inactivating Dio3 mutation exhibit an attenuated phenotype when compared with that of Dio3 null mice. To investigate this milder phenotype, the allelic expression of Dio3 was evaluated in different mouse tissues. Preferential allelic expression of Dio3 from the paternal allele was observed in fetal tissues and neonatal brain regions, whereas the biallelic Dio3 expression occurred in the developing eye, testes, and cerebellum and in the postnatal brain neocortex, which expresses a larger Dio3 mRNA transcript. The newborn hypothalamus manifests the highest degree of Dio3 expression from the paternal allele, compared with other brain regions, and preferential allelic expression of Dio3 in the brain relaxed in late neonatal life. A methylation analysis of two regulatory regions of the Dio3 imprinted domain revealed modest but significant differences between tissues, but these did not consistently correlate with the observed patterns of Dio3 allelic expression. Deletion of the Dio3 gene and promoter did not result in significant changes in the tissue-specific patterns of Dio3 allelic expression. These results suggest the existence of unidentified epigenetic determinants of tissue-specific Dio3 imprinting. The resulting variation in the Dio3 allelic expression between tissues likely explains the phenotypic variation that results from paternal Dio3 haploinsufficiency.

  14. Integrase-mediated recombination of the veb1 gene cassette encoding an extended-spectrum β-lactamase.

    Directory of Open Access Journals (Sweden)

    Daniel Aubert

    Full Text Available The veb1 gene cassette encodes the extended spectrum β-lactamase, VEB-1 that is increasingly isolated from worldwide Gram-negative rods. Veb1 is commonly inserted into the variable region of different class 1 integrons in which it is always associated with a downstream-located aadB gene cassette encoding an aminoglycoside adenylyltransferase. In Pseudomonas aeruginosa, the majority of veb1-containing integrons also carry an insertion sequence, IS1999 that is inserted upstream of the veb1 gene cassette and disrupts the integron specific recombination site, attI1. Investigation of the recombination properties of the sites surrounding veb1 revealed that insertion of IS1999 reduces significantly the recombination frequency of attI1 and that veb1 attC is not efficient for recombination in contrast to aadB attC. Subsequent sequence optimisation of veb1 attC by mutagenesis, into a more consensual attC site resembling aadB attC, successfully improved recombination efficiency. Overall, this work gives some insights into the organisation of veb1-containing integrons. We propose that IS1999 and the nature of veb1 attC stabilize the veb1 gene cassette environment likely by impairing recombination events upstream or downstream of veb1, respectively.

  15. Copy number variations of the ATP-binding cassette transporter ABCC6 gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Kringen Marianne K

    2012-08-01

    Full Text Available Abstract Background The ATP-binding cassette transporter ABCC6 gene is located on chromosome 16 between its two pseudogenes (ABCC6P1 and ABCC6P2. Previously, we have shown that ABCC6P1 is transcribed and affects ABCC6 at the transcriptional level. In this study we aimed to determine copy number variations of ABCC6, ABCC6P1 and ABCC6P2 in different populations. Moreover, we sought to study the transcription pattern of ABCC6 and ABCC6 pseudogenes in 39 different human tissues. Findings Genomic DNA from healthy individuals from five populations, Chinese (n = 24, Middle East (n = 20, Mexicans (n = 24, Caucasians (n = 50 and Africans (n = 24, were examined for copy number variations of ABCC6 and its pseudogenes by pyrosequencing and quantitative PCR. Copy number variation of ABCC6 was very rare (2/142; 1.4%. However, one or three copies of ABCC6P1 were relatively common (3% and 8%, respectively. Only one person had a single copy of ABCC6P2 while none had three copies. In Chinese, deletions or duplications of ABCC6P1 were more frequent than in any other population (9/24; 37.5%. The transcription pattern of ABCC6P2 was highly similar to ABCC6 and ABCC6P1, with highest transcription in liver and kidney. Interestingly, the total transcription level of pseudogenes, ABCC6P1 + ABCC6P2, was higher than ABCC6 in most tissues, including liver and kidney. Conclusions Copy number variations of the ABCC6 pseudogenes are quite common, especially in populations of Chinese ancestry. The expression pattern of ABCC6P2 in 39 human tissues was highly similar to that of ABCC6 and ABCC6P1 suggesting similar regulatory mechanisms for ABCC6 and its pseudogenes.

  16. Evidence for the involvement of genetic variation in the oxytocin receptor gene (OXTR) in the etiology of autistic disorders on high-functioning level.

    Science.gov (United States)

    Wermter, Anne-Kathrin; Kamp-Becker, Inge; Hesse, Philipp; Schulte-Körne, Gerd; Strauch, Konstantin; Remschmidt, Helmut

    2010-03-05

    An increasing number of animal studies advert to a substantial role of the neuropeptide oxytocin in the regulation of social attachment and affiliation. Furthermore, animal studies showed anxiety and stress-reduced effects of oxytocin. First human studies confirm these findings in animal studies and implicate a crucial role of oxytocin in human social attachment behavior and in social interactions. Thus, the oxytocin system might be involved in the impairment of social interaction and attachment in autism spectrum disorders (ASD). The human oxytocin receptor gene (OXTR) represents a plausible candidate gene for the etiology of ASD. To analyze whether genetic variants in the OXTR gene are associated with ASD we performed family-based single-marker and haplotype association analyses with 22 single nucleotide polymorphisms (SNPs) in the OXTR and its 5' region in 100 families with autistic disorders on high-functioning level (Asperger syndrome (AS), high-functioning autism (HFA), and atypical autism (AA)). Single-marker and haplotype association analyses revealed nominally significant associations of one single SNP and one haplotype with autism, respectively. Furthermore, employing a "reverse phenotyping" approach, patients carrying the haplotype associated with autism showed nominally significant impairments in comparison to noncarriers of the haplotype in items of the Autism Diagnostic Interview-Revised algorithm describing aspects of social interaction and communication. In conclusion, our results implicate that genetic variation in the OXTR gene might be relevant in the etiology of autism on high-functioning level.

  17. Genes and quantitative genetic variation involved with senescence in cells, organs and the whole plant

    Directory of Open Access Journals (Sweden)

    Benoit ePujol

    2015-02-01

    Full Text Available Senescence, the deterioration of morphological, physiological and reproductive functions with age that ends with the death of the organism, was widely studied in plants. Genes were identified that are linked to the deterioration of cells, organs and the whole plant. It is however unclear whether those genes are the source of age dependent deterioration or get activated to regulate such deterioration. Furthermore, it is also unclear whether such genes are active as a direct consequence of age or because they are specifically involved in some developmental stages. At the individual level, it is the relationship between quantitative genetic variation and age that can be used to detect the genetic signature of senescence. Surprisingly, the latter approach was only scarcely applied to plants. This may be the consequence of the demanding requirements for such approaches and/or the fact that most research interest was directed towards plants that avoid senescence. Here, I review those aspects in turn and call for an integrative genetic theory of senescence in plants. Such conceptual development would have implications for the management of plant genetic resources and generate progress on fundamental questions raised by ageing research.

  18. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    Institute of Scientific and Technical Information of China (English)

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  19. The dopamine transporter gene, a spectrum of most common risky behaviors, and the legal status of the behaviors.

    Directory of Open Access Journals (Sweden)

    Guang Guo

    Full Text Available This study tests the specific hypothesis that the 9R/9R genotype in the VNTR of the dopamine transporter gene (DAT1 exerts a general protective effect against a spectrum of risky behaviors in comparison to the 10R/9R and 10R/10R genotypes, drawing on three-time repeated measures of risky behaviors in adolescence and young adulthood on about 822 non-Hispanic white males from the Add Health study. Our data have established two empirical findings. The first is a protective main effect in the DAT1 gene against risky behaviors. The second finding is that the protective effect varies over age, with the effect prominent at ages when a behavior is illegal and the effect largely vanished at ages when the behavior becomes legal or more socially tolerated. Both the protective main effect and the gene-lifecourse interaction effect are replicated across a spectrum of most common risky behaviors: delinquency, variety of sexual partners, binge drinking, drinking quantity, smoking quantity, smoking frequency, marijuana use, cocaine use, other illegal drug use, and seatbelt non-wearing. We also compared individuals with the protective genotype and individuals without it in terms of age, physical maturity, verbal IQ, GPA, received popularity, sent popularity, church attendance, two biological parents, and parental education. These comparisons indicate that the protective effect of DAT1*9R/9R cannot be explained away by these background characteristics. Our work demonstrates how legal/social contexts can enhance or reduce a genetic effect on risky behaviors.

  20. Molecular variation at a candidate gene implicated in the regulation of fire ant social behavior.

    Directory of Open Access Journals (Sweden)

    Dietrich Gotzek

    Full Text Available The fire ant Solenopsis invicta and its close relatives display an important social polymorphism involving differences in colony queen number. Colonies are headed by either a single reproductive queen (monogyne form or multiple queens (polygyne form. This variation in social organization is associated with variation at the gene Gp-9, with monogyne colonies harboring only B-like allelic variants and polygyne colonies always containing b-like variants as well. We describe naturally occurring variation at Gp-9 in fire ants based on 185 full-length sequences, 136 of which were obtained from S. invicta collected over much of its native range. While there is little overall differentiation between most of the numerous alleles observed, a surprising amount is found in the coding regions of the gene, with such substitutions usually causing amino acid replacements. This elevated coding-region variation may result from a lack of negative selection acting to constrain amino acid replacements over much of the protein, different mutation rates or biases in coding and non-coding sequences, negative selection acting with greater strength on non-coding than coding regions, and/or positive selection acting on the protein. Formal selection analyses provide evidence that the latter force played an important role in the basal b-like lineages coincident with the emergence of polygyny. While our data set reveals considerable paraphyly and polyphyly of S. invicta sequences with respect to those of other fire ant species, the b-like alleles of the socially polymorphic species are monophyletic. An expanded analysis of colonies containing alleles of this clade confirmed the invariant link between their presence and expression of polygyny. Finally, our discovery of several unique alleles bearing various combinations of b-like and B-like codons allows us to conclude that no single b-like residue is completely predictive of polygyne behavior and, thus, potentially causally

  1. Spectrum of EGFR gene copy number changes and KRAS gene mutation status in Korean triple negative breast cancer patients.

    Directory of Open Access Journals (Sweden)

    Yoonjung Kim

    Full Text Available Anti-epidermal growth factor receptor (EGFR therapy has been tried in triple negative breast cancer (TNBC patients without evaluation of molecular and clinical predictors in several randomized clinical studies. Only fewer than 20% of metastatic TNBCs showed response to anti-EGFR therapy. In order to increase the overall response rate, first step would be to classify TNBC into good or poor responders according to oncogenic mutation profiles. This study provides the molecular characteristics of TNBCs including EGFR gene copy number changes and mutation status of EGFR and KRAS gene in Korean TNBC patients. Mutation analysis for EGFR, KRAS, BRAF and TP53 from a total of 105 TNBC tissue samples was performed by direct sequencing, peptide nucleic acid-mediated PCR clamping method and real-time PCR. Copy number changes of EGFR gene were evaluated using multiplex ligation-dependent probe amplification. Out of all 105 TNBCs, 15.2% (16/105 showed EGFR copy number changes. Among them, increased or decreased EGFR copy number was detected in 13 (5 single copy gain, 2 amplification and 4 high-copy number amplification and 3 cases (3 hemizygous deletion, respectively. The mutation frequencies of KRAS, EGFR and TP53 gene were 1.9% (G12V and G12D, 1.0% (exon 19 del and 31.4%, respectively. There was no BRAF V600E mutation found. Future studies are needed to evaluate the clinical outcomes of TNBC patients who undergo anti-EGFR therapy according to the genetic status of EGFR.

  2. Telomere length and variation in telomere biology genes in individuals with osteosarcoma.

    Science.gov (United States)

    Mirabello, Lisa; Richards, Elliott G; Duong, Linh M; Yu, Kai; Wang, Zhaoming; Cawthon, Richard; Berndt, Sonja I; Burdett, Laurie; Chowdhury, Salma; Teshome, Kedest; Douglass, Chester; Savage, Sharon A

    2011-01-01

    Osteosarcoma, the most common primary bone tumor, occurs most frequently in adolescents. Chromosomal aneuploidy is common in osteosarcoma cells, suggesting underlying chromosomal instability. Telomeres, located at chromosome ends, are essential for genomic stability; several studies have suggested that germline telomere length (TL) is associated with cancer risk. We hypothesized that TL and/or common genetic variation in telomere biology genes may be associated with risk of osteosarcoma. We investigated TL in peripheral blood DNA and 713 single nucleotide polymorphisms (SNPs) from 39 telomere biology genes in 98 osteosarcoma cases and 69 orthopedic controls. For the genotyping component, we added 1363 controls from the Prostate, Lung, Colorectal, and Ovarian Cancer ScreeningTrial. Short TL was not associated with osteosarcoma risk overall (OR 1.39, P=0.67), although there was a statistically significant association in females (OR 4.35, 95% Cl 1.20-15.74, P=0.03). Genotype analyses identified seven SNPs in TERF1 significantly associated with osteosarcoma risk after Bonferroni correction by gene. These SNPs were highly linked and associated with a reduced risk of osteosarcoma (OR 0.48-0.53, P=0.0001-0.0006). We also investigated associations between TL and telomere gene SNPs in osteosarcoma cases and orthopedic controls. Several SNPs were associated with TL prior to Bonferroni correction; one SNP in NOLA2 and one in MEN1 were marginally non-significant after correction (P(adj)=0.057 and 0.066, respectively). This pilot-study suggests that females with short telomeres may be at increased risk of osteosarcoma, and that SNPs in TERF1 are inversely associated with osteosarcoma risk.

  3. Genetic variation in the epidermal transglutaminase genes is not associated with atopic dermatitis.

    Directory of Open Access Journals (Sweden)

    Agne Liedén

    Full Text Available BACKGROUND: Atopic dermatitis (AD is a common chronic inflammatory skin disorder where epidermal barrier dysfunction is a major factor in the pathogenesis. The identification of AD susceptibility genes related to barrier dysfunction is therefore of importance. The epidermal transglutaminases (TGM1, TGM3 and TGM5 encodes essential cross-linking enzymes in the epidermis. OBJECTIVE: To determine whether genetic variability in the epidermal transglutaminases contributes to AD susceptibility. METHODS: Forty-seven single nucleotide polymorphisms (SNPs in the TGM1, TGM3 and TGM5 gene region were tested for genetic association with AD, independently and in relation to FLG genotype, using a pedigree disequilibrium test (PDT in a Swedish material consisting of 1753 individuals from 539 families. In addition, a German case-control material, consisting of 533 AD cases and 1996 controls, was used for in silico analysis of the epidermal TGM regions. Gene expression of the TGM1, TGM3 and TGM5 gene was investigated by relative quantification with Real Time PCR (qRT-PCR. Immunohistochemical (IHC analysis was performed to detect TG1, TG3 and TG5 protein expression in the skin of patients and healthy controls. RESULTS: PDT analysis identified a significant association between the TGM1 SNP rs941505 and AD with allergen-specific IgE in the Swedish AD family material. However, the association was not replicated in the German case-control material. No significant association was detected for analyzed SNPs in relation to FLG genotype. TG1, TG3 and TG5 protein expression was detected in AD skin and a significantly increased TGM3 mRNA expression was observed in lesional skin by qRT-PCR. CONCLUSION: Although TGM1 and TGM3 may be differentially expressed in AD skin, the results from the genetic analysis suggest that genetic variation in the epidermal transglutaminases is not an important factor in AD susceptibility.

  4. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Directory of Open Access Journals (Sweden)

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  5. Variation in fibrinogen FGG and FGA genes and risk of stroke: the Rotterdam Study.

    Science.gov (United States)

    Cheung, Elim Y L; Bos, Michiel J; Leebeek, Frank W G; Koudstaal, Peter J; Hofman, Albert; de Maat, Moniek P M; Breteler, Monique M B

    2008-08-01

    Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

  6. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Directory of Open Access Journals (Sweden)

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  7. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  8. Circadian variations of clock gene Per2 and cell cycle genes in different stages of carcinogenesis in golden hamster buccal mucosa.

    Science.gov (United States)

    Tan, Xue-Mei; Ye, Hua; Yang, Kai; Chen, Dan; Wang, Qing-Qing; Tang, Hong; Zhao, Ning-Bo

    2015-05-07

    Previous studies have suggested that the expression of clock genes have circadian rhythms, and many cell cycle genes are regulated by clock genes. The disruption of circadian rhythms appears to be associated with the acceleration of cancer development. To investigate the circadian patterns of the clock gene Per2 and of cell cycle genes p53, Cyclin D1, CDK1 and Cyclin B1 in different stages of carcinogenesis, the daily mRNA profiles of these genes were detected by real-time RT-PCR in dimethylbenzanthracene-induced cancer, in precancerous lesions and in normal tissues. Per2, p53, Cyclin D1 and CDK1 showed circadian rhythms in the 3 different stages of carcinogenesis, whereas the circadian rhythm of Cyclin B1 was absent in the precancerous lesions. The mesors and amplitudes of Per2 and p53 were decreased (P circadian pattern variations of these genes in different stages of carcinogenesis.

  9. Association between common variation in 120 candidate genes and breast cancer risk.

    Directory of Open Access Journals (Sweden)

    Paul D P Pharoah

    2007-03-01

    Full Text Available Association studies in candidate genes have been widely used to search for common low penetrance susceptibility alleles, but few definite associations have been established. We have conducted association studies in breast cancer using an empirical single nucleotide polymorphism (SNP tagging approach to capture common genetic variation in genes that are candidates for breast cancer based on their known function. We genotyped 710 SNPs in 120 candidate genes in up to 4,400 breast cancer cases and 4,400 controls using a staged design. Correction for population stratification was done using the genomic control method, on the basis of data from 280 genomic control SNPs. Evidence for association with each SNP was assessed using a Cochran-Armitage trend test (p-trend and a two-degrees of freedom chi(2 test for heterogeneity (p-het. The most significant single SNP (p-trend = 8 x 10(-5 was not significant at a nominal 5% level after adjusting for population stratification and multiple testing. To evaluate the overall evidence for an excess of positive associations over the proportion expected by chance, we applied two global tests: the admixture maximum likelihood (AML test and the rank truncated product (RTP test corrected for population stratification. The admixture maximum likelihood experiment-wise test for association was significant for both the heterogeneity test (p = 0.0031 and the trend test (p = 0.017, but no association was observed using the rank truncated product method for either the heterogeneity test or the trend test (p = 0.12 and p = 0.24, respectively. Genes in the cell-cycle control pathway and genes involved in steroid hormone metabolism and signalling were the main contributors to the association. These results suggest that a proportion of SNPs in these candidate genes are associated with breast cancer risk, but that the effects of individual SNPs is likely to be small. Large sample sizes from multicentre collaboration will be needed

  10. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas

    2008-01-01

    . Furthermore, human AFAR1 catalyses the rate limiting step in the synthesis of the neuromodulator gamma-hydroxybutyrate (GHB) and was found elevated in neurodegenerative diseases such as Alzheimer's and dementia with Lewy bodies (DLB). The human AFAR gene family maps to a genomic region in 1p36 of frequent...... samples, we identified nine different amino acid changes; two were in AFAR1 and seven in AFAR2. In AFAR1, we found genetic variation in the proposed substrate-binding amino acid 113, encoding Ala(113) or Thr(113). An AFAR2 variant had a Glu(55) substituted by Lys(55) at a position that is conserved among...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  11. Plasma Fetuin-A concentration, genetic variation in the AHSG gene and risk of colorectal cancer

    DEFF Research Database (Denmark)

    Nimptsch, Katharina; Aleksandrova, Krasimira; Boeing, Heiner

    2015-01-01

    .93-1.22) in women, 1.13 (1.00-1.27) for colon cancer and 1.12 (0.94-1.32) for rectal cancer. To improve causal inference in a Mendelian Randomization approach, five tagging single nucleotide polymorphisms of the AHSG gene were genotyped in a subset of 456 case-control pairs. The AHSG allele-score explained 21......% of the interindividual variation in plasma fetuin-A concentrations. In instrumental variable analysis, genetically raised fetuin-A was not associated with colorectal cancer risk (relative risk per 40 µg/mL genetically determined higher fetuin-A was 0.98, 95% confidence interval: 0.73-1.33). The findings of our study...

  12. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    DEFF Research Database (Denmark)

    Meidtner, Karina; Fisher, Eva; Angquist, Lars

    2014-01-01

    ) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were followed up...... for 6.9 ± 2.5 years. Association of 69 tagSNPs with baseline BMI and annual changes in weight as well as waist circumference were investigated using linear regression analysis. Interactions with sex, GI and intake of carbohydrates, fat as well as saturated, monounsaturated and polyunsaturated fatty...... acids were examined by including multiplicative SNP-covariate terms into the regression model. Neither baseline BMI nor annual weight or waist circumference changes were significantly associated with variation in the selected genes in the entire study population after correction for multiple testing...

  13. Genetic Variations in Inflammatory Response Genes and Their Association with the Risk of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Xin Cui

    2015-01-01

    Full Text Available Prostate cancer is a common cancer in men. Genetic variations in inflammatory response genes can potentially influence the risk of prostate cancer. We aimed to examine the association between PPARG Pro12Ala, NFKB1 -94 ins/del, NFKBIA -826C/T, COX-1 (50C>T, and COX-2 (-1195G>A polymorphisms on prostate cancer risk. The genotypes of the polymorphisms were ascertained in 543 prostate cancer patients and 753 controls through PCR-RFLP and the risk association was evaluated statistically using logistic regression analysis. The NFKB1 -94 polymorphism was shown to decrease prostate cancer risk in both heterozygous and homozygous comparison models (odds ratios of 0.74 (95% CI = 0.58–0.96 (P=0.02 and 0.57 (95% CI = 0.42–0.78 (PA polymorphisms may be, respectively, associated with decreased and increased prostate cancer risk in the Chinese population.

  14. The architecture of gene regulatory variation across multiple human tissues: the MuTHER study.

    Directory of Open Access Journals (Sweden)

    Alexandra C Nica

    Full Text Available While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL, skin, and fat. The samples (156 LCL, 160 skin, 166 fat were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes. In addition, we apply factor analysis (FA to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes. The unique study design (Matched Co-Twin Analysis--MCTA permits immediate replication of eQTLs using co-twins (93%-98% and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%-20% have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits.

  15. The Architecture of Gene Regulatory Variation across Multiple Human Tissues: The MuTHER Study

    Science.gov (United States)

    Nica, Alexandra C.; Parts, Leopold; Glass, Daniel; Nisbet, James; Barrett, Amy; Sekowska, Magdalena; Travers, Mary; Potter, Simon; Grundberg, Elin; Small, Kerrin; Hedman, Åsa K.; Bataille, Veronique; Tzenova Bell, Jordana; Surdulescu, Gabriela; Dimas, Antigone S.; Ingle, Catherine; Nestle, Frank O.; di Meglio, Paola; Min, Josine L.; Wilk, Alicja; Hammond, Christopher J.; Hassanali, Neelam; Yang, Tsun-Po; Montgomery, Stephen B.; O'Rahilly, Steve; Lindgren, Cecilia M.; Zondervan, Krina T.; Soranzo, Nicole; Barroso, Inês; Durbin, Richard; Ahmadi, Kourosh; Deloukas, Panos; McCarthy, Mark I.; Dermitzakis, Emmanouil T.; Spector, Timothy D.

    2011-01-01

    While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL), skin, and fat. The samples (156 LCL, 160 skin, 166 fat) were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes). In addition, we apply factor analysis (FA) to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes). The unique study design (Matched Co-Twin Analysis—MCTA) permits immediate replication of eQTLs using co-twins (93%–98%) and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%–20%) have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits. PMID:21304890

  16. Spectrum of mutations in the renin-angiotensin system genes in autosomal recessive renal tubular dysgenesis

    DEFF Research Database (Denmark)

    Gribouval, Olivier; Morinière, Vincent; Pawtowski, Audrey

    2012-01-01

    , pulmonary hypoplasia, and refractory arterial hypotension. The disease is linked to mutations in the genes encoding several components of the renin-angiotensin system (RAS): AGT (angiotensinogen), REN (renin), ACE (angiotensin-converting enzyme), and AGTR1 (angiotensin II receptor type 1). Here, we review...

  17. Further Evidence of Mutational Heterogeneity of the XPC Gene in Tunisian Families: A Spectrum of Private and Ethnic Specific Mutations

    Directory of Open Access Journals (Sweden)

    Mariem Ben Rekaya

    2013-01-01

    Full Text Available Xeroderma Pigmentosum (XP is a rare recessive autosomal cancer prone disease, characterized by UV hypersensitivity and early appearance of cutaneous and ocular malignancies. We investigated four unrelated patients suspected to be XP-C. To confirm linkage to XPC gene, genotyping and direct sequencing of XPC gene were performed. Pathogenic effect of novel mutations was confirmed by reverse Transciptase PCR. Mutation screening revealed the presence of two novel mutations g.18246G>A and g.18810G>T in the XPC gene (NG_011763.1. The first is present in one patient XP50NEF, but the second is present in three unrelated patients (XP16KEB, XP28SFA, and XP45GB. These 3 patients are from three different cities of Southern Tunisia and bear the same haplotype, suggesting a founder effect. Reverse Transciptase PCR revealed the absence of the XPC mRNA. In Tunisia, as observed in an other severe genodermatosis, the mutational spectrum of XP-C group seems to be homogeneous with some clusters of heterogeneity that should be taken into account to improve molecular diagnosis of this disease.

  18. Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE

    Science.gov (United States)

    Nava, C; Lamari, F; Héron, D; Mignot, C; Rastetter, A; Keren, B; Cohen, D; Faudet, A; Bouteiller, D; Gilleron, M; Jacquette, A; Whalen, S; Afenjar, A; Périsse, D; Laurent, C; Dupuits, C; Gautier, C; Gérard, M; Huguet, G; Caillet, S; Leheup, B; Leboyer, M; Gillberg, C; Delorme, R; Bourgeron, T; Brice, A; Depienne, C

    2012-01-01

    The striking excess of affected males in autism spectrum disorders (ASD) suggests that genes located on chromosome X contribute to the etiology of these disorders. To identify new X-linked genes associated with ASD, we analyzed the entire chromosome X exome by next-generation sequencing in 12 unrelated families with two affected males. Thirty-six possibly deleterious variants in 33 candidate genes were found, including PHF8 and HUWE1, previously implicated in intellectual disability (ID). A nonsense mutation in TMLHE, which encodes the ɛ-N-trimethyllysine hydroxylase catalyzing the first step of carnitine biosynthesis, was identified in two brothers with autism and ID. By screening the TMLHE coding sequence in 501 male patients with ASD, we identified two additional missense substitutions not found in controls and not reported in databases. Functional analyses confirmed that the mutations were associated with a loss-of-function and led to an increase in trimethyllysine, the precursor of carnitine biosynthesis, in the plasma of patients. This study supports the hypothesis that rare variants on the X chromosome are involved in the etiology of ASD and contribute to the sex-ratio disequilibrium. PMID:23092983

  19. Marker-assisted introgression of broad-spectrum blast resistance genes into the cultivated MR219 rice variety.

    Science.gov (United States)

    Miah, Gous; Rafii, Mohd Y; Ismail, Mohd R; Puteh, Adam B; Rahim, Harun A; Latif, Mohammad A

    2017-07-01

    The rice cultivar MR219 is famous for its better yield and long and fine grain quality; however, it is susceptible to blast disease. The main objective of this study was to introgress blast resistance genes into MR219 through marker-assisted selection (MAS). The rice cultivar MR219 was used as the recurrent parent, and Pongsu Seribu 1 was used as the donor. Marker-assisted foreground selection was performed using RM6836 and RM8225 to identify plants possessing blast resistance genes. Seventy microsatellite markers were used to estimate recurrent parent genome (RPG) recovery. Our analysis led to the development of 13 improved blast resistant lines with Piz, Pi2 and Pi9 broad-spectrum blast resistance genes and an MR219 genetic background. The RPG recovery of the selected improved lines was up to 97.70% with an average value of 95.98%. Selected improved lines showed a resistance response against the most virulent blast pathogen pathotype, P7.2. The selected improved lines did not express any negative effect on agronomic traits in comparison with MR219. The research findings of this study will be a conducive approach for the application of different molecular techniques that may result in accelerating the development of new disease-resistant rice varieties, which in turn will match rising demand and food security worldwide. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE.

    Science.gov (United States)

    Nava, C; Lamari, F; Héron, D; Mignot, C; Rastetter, A; Keren, B; Cohen, D; Faudet, A; Bouteiller, D; Gilleron, M; Jacquette, A; Whalen, S; Afenjar, A; Périsse, D; Laurent, C; Dupuits, C; Gautier, C; Gérard, M; Huguet, G; Caillet, S; Leheup, B; Leboyer, M; Gillberg, C; Delorme, R; Bourgeron, T; Brice, A; Depienne, C

    2012-10-23

    The striking excess of affected males in autism spectrum disorders (ASD) suggests that genes located on chromosome X contribute to the etiology of these disorders. To identify new X-linked genes associated with ASD, we analyzed the entire chromosome X exome by next-generation sequencing in 12 unrelated families with two affected males. Thirty-six possibly deleterious variants in 33 candidate genes were found, including PHF8 and HUWE1, previously implicated in intellectual disability (ID). A nonsense mutation in TMLHE, which encodes the ɛ-N-trimethyllysine hydroxylase catalyzing the first step of carnitine biosynthesis, was identified in two brothers with autism and ID. By screening the TMLHE coding sequence in 501 male patients with ASD, we identified two additional missense substitutions not found in controls and not reported in databases. Functional analyses confirmed that the mutations were associated with a loss-of-function and led to an increase in trimethyllysine, the precursor of carnitine biosynthesis, in the plasma of patients. This study supports the hypothesis that rare variants on the X chromosome are involved in the etiology of ASD and contribute to the sex-ratio disequilibrium.

  1. Variation in oxytocin receptor gene (OXTR) polymorphisms is associated with emotional and behavioral reactions to betrayal.

    Science.gov (United States)

    Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L

    2014-06-01

    Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction.

  2. Variation at genes influencing facial morphology are not associated with developmental imprecision in human faces.

    Directory of Open Access Journals (Sweden)

    Sonja Windhager

    Full Text Available Facial asymmetries are commonly used as a proxy for human developmental imprecision resulting from inbreeding, and thus reduced genetic heterozygosity. Several environmental factors influence human facial asymmetry (e.g., health care, parasites, but the generalizability of findings on genetic stressors has been limited in humans by sample characteristics (island populations, endogamy and indirect genetic assessment (inference from pedigrees. In a sample of 3215 adult humans from the Rotterdam Study, we therefore studied the relationship of facial asymmetry, estimated from nine mid-facial landmarks, with genetic variation at 102 single nucleotide polymorphism (SNP loci recently associated with facial shape variation. We further tested whether the degree of individual heterozygosity is negatively correlated with facial asymmetry. An ANOVA tree regression did not identify any SNP relating to either fluctuating asymmetry or total asymmetry. In a general linear model, only age and sex--but neither heterozygosity nor any SNP previously reported to covary with facial shape--was significantly related to total or fluctuating asymmetry of the midface. Our study does not corroborate the common assumption in evolutionary and behavioral biology that morphological asymmetries reflect heterozygosity. Our results, however, may be affected by a relatively small degree of inbreeding, a relatively stable environment, and an advanced age in the Rotterdam sample. Further large-scale genetic studies, including gene expression studies, are necessary to validate the genetic and developmental origin of morphological asymmetries.

  3. Post-polyploidisation morphotype diversification associates with gene copy number variation

    Science.gov (United States)

    Schiessl, Sarah; Huettel, Bruno; Kuehn, Diana; Reinhardt, Richard; Snowdon, Rod

    2017-01-01

    Genetic models for polyploid crop adaptation provide important information relevant for future breeding prospects. A well-suited model is Brassica napus, a recent allopolyploid closely related to Arabidopsis thaliana. Flowering time is a major adaptation trait determining life cycle synchronization with the environment. Here we unravel natural genetic variation in B. napus flowering time regulators and investigate associations with evolutionary diversification into different life cycle morphotypes. Deep sequencing of 35 flowering regulators was performed in 280 diverse B. napus genotypes. High sequencing depth enabled high-quality calling of single-nucleotide polymorphisms (SNPs), insertion-deletions (InDels) and copy number variants (CNVs). By combining these data with genotyping data from the Brassica 60 K Illumina® Infinium SNP array, we performed a genome-wide marker distribution analysis across the 4 ecogeographical morphotypes. Twelve haplotypes, including Bna.FLC.A10, Bna.VIN3.A02 and the Bna.FT promoter on C02_random, were diagnostic for the diversification of winter and spring types. The subspecies split between oilseed/kale (B. napus ssp. napus) and swedes/rutabagas (B. napus ssp. napobrassica) was defined by 13 haplotypes, including genomic rearrangements encompassing copies of Bna.FLC, Bna.PHYA and Bna.GA3ox1. De novo variation in copies of important flowering-time genes in B. napus arose during allopolyploidisation, enabling sub-functionalisation that allowed different morphotypes to appropriately fine-tune their lifecycle. PMID:28165502

  4. Intra-retinal variation of opsin gene expression in the guppy (Poecilia reticulata).

    Science.gov (United States)

    Rennison, Diana J; Owens, Gregory L; Allison, W Ted; Taylor, John S

    2011-10-01

    Although behavioural experiments demonstrate that colouration influences mate choice in many species, a complete understanding of this form of signalling requires information about colour vision in the species under investigation. The guppy (Poecilia reticulata) has become a model species for the study of colour-based sexual selection. To investigate the role of opsin gene duplication and divergence in the evolution of colour-based mate choice, we used in situ hybridization to determine where the guppy's nine cone opsins are expressed in the retina. Long wavelength-sensitive (LWS) opsins were more abundant in the dorsal retina than in the ventral retina. One of the middle wavelength-sensitive opsins (RH2-1) exhibited the opposite pattern, while the other middle wavelength-sensitive opsin (RH2-2) and the short wavelength-sensitive opsins (SWS1, SWS2A and SWS2B) were expressed throughout the retina. We also found variation in LWS opsin expression among individuals. These observations suggest that regions of the guppy retina are specialized with respect to wavelength discrimination and/or sensitivity. Intra-retinal variability in opsin expression, which has been observed in several fish species, might be an adaptation to variation in the strength and spectral composition of light entering the eye from above and below. The discovery that opsin expression varies in the guppy retina may motivate new behavioural experiments designed to study its role in mate choice.

  5. Time variations of an absorption feature in the spectrum of the gamma-ray burst on 1980 April 19

    Science.gov (United States)

    Dennis, B. R.; Frost, K. J.; Kiplinger, A. L.; Orwig, L. E.; Desai, U.; Cline, T. L.

    1982-01-01

    The photon number spectrum integrated over the impulsive part of the event is shown to fit a thermal bremsstrahlung function with a temperature of 330 + or - 70 keV at energies between 151 and 487 keV. At lower energies, the data points lie considerably below this function, indicating a broad absorption feature extending down to values less than or equal to 28 keV, the lowest energy measured. The upper energy of this absorption feature varies from 100 to 150 keV on a time scale less than or equal to 0.5 s. This event is interpreted as a typical gamma ray burst, even though it is still considered remotely possible that it is of solar origin. The spectral features, together with their variability, are interpreted in terms of electron interactions at the cyclotron resonance frequency in magnetic fields of 10 to the 12th - 10 to the 13th gauss close to the surface of a neutron star.

  6. Parenting stress and salivary cortisol in parents of children with autism spectrum disorder: Longitudinal variations in the context of a service dog's presence in the family.

    Science.gov (United States)

    Fecteau, Stéphanie-M; Boivin, Louise; Trudel, Marcel; Corbett, Blythe A; Harrell, Frank E; Viau, Robert; Champagne, Noël; Picard, Frédéric

    2017-02-01

    A significant portion of parents of children with autism spectrum disorder report high levels of stress related to parenting responsibilities, which have been linked to abnormal cortisol patterns. This study seeks to better understand the parents' adaptation to caregiving demands and use of a service dog, by taking into account longitudinal variations in salivary cortisol and perception of parental stress. Salivary cortisol was collected one day per week for 15 weeks by 98 primary caregivers of children with ASD. Overall, parents perceived high levels of stress at baseline. Mean morning cortisol increase was below expected levels for healthy adults, and perception of stress predicted morning cortisol activity. Hypocorticolism related to chronic stress may be present in parents of children with ASD. Longitudinal analysis revealed that the presence of a service dog in the family had an effect on parenting stress, wakening and morning cortisol levels.

  7. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  8. Common Genetic Variants Found in HLA and KIR Immune Genes in Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Anthony R Torres

    2016-10-01

    Full Text Available The common variant - common disease hypothesis was proposed to explain diseases with strong inheritance. This model suggests that a genetic disease is the result of the combination of several common genetic variants. Common genetic variants are described as a 5% frequency differential between diseased versus matched control populations. This theory was recently supported by an epidemiology paper stating that about 50% of genetic risk for autism resides in common variants. However, rare variants, rather than common variants, have been found in numerous genome wide genetic studies and many have concluded that the common variant—common disease hypothesis is incorrect. One interpretation is that rare variants are major contributors to genetic diseases and autism involves the interaction of many rare variants, especially in the brain. It is obvious there is much yet to be learned about autism genetics.Evidence has been mounting over the years indicating immune involvement in autism, particularly the HLA genes on chromosome 6 and KIR genes on chromosome 19. These two large multigene complexes have important immune functions and have been shown to interact to eliminate unwanted virally infected and malignant cells. HLA proteins have important functions in antigen presentation in adaptive immunity and specific epitopes on HLA class I proteins act as cognate ligands for KIR receptors in innate immunity. Data suggests that HLA alleles and KIR activating genes/haplotypes are common variants in different autism populations. For example, class I allele (HLA-A2 and HLA-G 14bp-indel frequencies are significantly increased by more than 5% over control populations (Table2. The HLA-DR4 Class II and shared epitope frequencies are significantly above the control populations (Table 2. Three activating KIR genes: 3DS1, 2DS1 and 2DS2 have increased frequencies of 15%, 22% and 14% in autism populations, respectively. There is a 6% increase in total activating KIR

  9. Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.

    Science.gov (United States)

    Denora, Paola S; Schlesinger, David; Casali, Carlo; Kok, Fernando; Tessa, Alessandra; Boukhris, Amir; Azzedine, Hamid; Dotti, Maria Teresa; Bruno, Claudio; Truchetto, Jeremy; Biancheri, Roberta; Fedirko, Estelle; Di Rocco, Maja; Bueno, Clarissa; Malandrini, Alessandro; Battini, Roberta; Sickl, Elisabeth; de Leva, Maria Fulvia; Boespflug-Tanguy, Odile; Silvestri, Gabriella; Simonati, Alessandro; Said, Edith; Ferbert, Andreas; Criscuolo, Chiara; Heinimann, Karl; Modoni, Anna; Weber, Peter; Palmeri, Silvia; Plasilova, Martina; Pauri, Flavia; Cassandrini, Denise; Battisti, Carla; Pini, Antonella; Tosetti, Michela; Hauser, Erwin; Masciullo, Marcella; Di Fabio, Roberto; Piccolo, Francesca; Denis, Elodie; Cioni, Giovanni; Massa, Roberto; Della Giustina, Elvio; Calabrese, Olga; Melone, Marina A B; De Michele, Giuseppe; Federico, Antonio; Bertini, Enrico; Durr, Alexandra; Brockmann, Knut; van der Knaap, Marjo S; Zatz, Mayana; Filla, Alessandro; Brice, Alexis; Stevanin, Giovanni; Santorelli, Filippo M

    2009-03-01

    Autosomal recessive spastic paraplegia with thinning of corpus callosum (ARHSP-TCC) is a complex form of HSP initially described in Japan but subsequently reported to have a worldwide distribution with a particular high frequency in multiple families from the Mediterranean basin. We recently showed that ARHSP-TCC is commonly associated with mutations in SPG11/KIAA1840 on chromosome 15q. We have now screened a collection of new patients mainly originating from Italy and Brazil, in order to further ascertain the spectrum of mutations in SPG11, enlarge the ethnic origin of SPG11 patients, determine the relative frequency at the level of single Countries (i.e., Italy), and establish whether there is one or more common mutation. In 25 index cases we identified 32 mutations; 22 are novel, including 9 nonsense, 3 small deletions, 4 insertions, 1 in/del, 1 small duplication, 1 missense, 2 splice-site, and for the first time a large genomic rearrangement. This brings the total number of SPG11 mutated patients in the SPATAX collection to 111 cases in 44 families and in 17 isolated cases, from 16 Countries, all assessed using homogeneous clinical criteria. While expanding the spectrum of mutations in SPG11, this larger series also corroborated the notion that even within apparently homogeneous population a molecular diagnosis cannot be achieved without full gene sequencing.

  10. The association between ace gene variation and aerobic capacity in winter endurance disciplines.

    Science.gov (United States)

    Orysiak, J; Zmijewski, P; Klusiewicz, A; Kaliszewski, P; Malczewska-Lenczowska, J; Gajewski, J; Pokrywka, A

    2013-12-01

    The aim of the study was to examine the possible relationship between I/D polymorphism of ACE gene and selected indices of aerobic capacity among male and female athletes practising winter endurance sports. Sixty-six well-trained athletes (female n = 26, male n = 40), aged 18.4 ± 2.8 years, representing winter endurance sports (cross-country skiing, n = 48; biathlon, n = 8; Nordic combined, n = 10) participated in the study. Genotyping for ACE I/D polymorphism was performed using polymerase chain reaction. Maximal oxygen consumption (VO2max), maximal running velocity (Vmax) and running velocity at anaerobic threshold (VAT4) were determined in an incremental test to volitional exhaustion on a motorized treadmill. The ACE genotype had no significant effect on absolute VO2max, relative VO2max (divided by body mass or fat free body mass), VAT4 or Vmax. No interaction effect of gender x ACE genotype was found for each of the examined aerobic capacity indices. ACE gene variation was not found to be a determinant of aerobic capacity in either female or male Polish, well-trained endurance athletes participating in winter sports.

  11. Variation in the Oxytocin Receptor Gene Is Associated with Face Recognition and its Neural Correlates

    Science.gov (United States)

    Westberg, Lars; Henningsson, Susanne; Zettergren, Anna; Svärd, Joakim; Hovey, Daniel; Lin, Tian; Ebner, Natalie C.; Fischer, Håkan

    2016-01-01

    The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala—a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR) has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging (fMRI) during incidental encoding of faces. The OXTR 3′ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors. PMID:27713694

  12. Variation in the Oxytocin Receptor Gene is associated with Face Recognition and its neural correlates

    Directory of Open Access Journals (Sweden)

    Lars Westberg

    2016-09-01

    Full Text Available The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala – a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging during incidental encoding of faces. The OXTR 3’ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors.

  13. Chromosomal localisation and genetic variation of the SLC11A1 gene in goats (Capra hircus).

    Science.gov (United States)

    Vacca, G M; Pazzola, M; Pisano, C; Carcangiu, V; Diaz, M L; Nieddu, M; Robledo, R; Mezzanotte, R; Dettori, M L

    2011-10-01

    The solute carrier family 11 member A1 (SLC11A1) gene is associated with resistance to infectious diseases. Chromosomal localisation, genomic regions corresponding to functional domains and the genetic variability of microsatellites in the 3' untranslated region (3'-UTR) of this gene were investigated in 427 goats (Capra hircus) of six breeds. Using dual colour fluorescence in situ hybridisation, SLC11A1 was localised to goat chromosome 2. Single strand conformation polymorphism was used to screen for polymorphisms in SLC11A1 exons 2, 10 and 15. There was no variation among goat breeds in the sarcoma homology 3 (SH3) binding motif, the protein kinase C phosphorylation site or the two N-linked glycosylation sites. Exon 15 exhibited variability due to the presence of two polymorphic microsatellites. Genotyping of the upstream guanine-thymine repeat (GTn) at 3'-UTR revealed eight alleles (GT11, GT12, GT14-GT19) in goats, whereas GT13 (present in cattle) was absent. Most goats carried the GT16 allele and no allele was found to be exclusive to only one breed. The coefficient of genetic differentiation value (G(ST)) was 0.084. This microsatellite appears to be an informative DNA marker for genetic linkage analysis in goats.

  14. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    Science.gov (United States)

    Klann, Marleen; Stollewerk, Angelika

    2017-02-24

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  15. Clinical associations of host genetic variations in the genes of cytokines in critically ill patients.

    Science.gov (United States)

    Belopolskaya, O B; Smelaya, T V; Moroz, V V; Golubev, A M; Salnikova, L E

    2015-06-01

    Host genetic variations may influence a changing profile of biochemical markers and outcome in patients with trauma/injury. The objective of this study was to assess clinical associations of single nucleotide polymorphisms (SNPs) in the genes of cytokines in critically ill patients. A total of 430 patients were genotyped for SNPs in the genes of pro- (IL1B, IL6, IL8) and anti-inflammatory (IL4, IL10, IL13) cytokines. The main end-points were sepsis, mortality and adult respiratory distress syndrome (ARDS). We evaluated the dynamic levels of bilirubin, blood urea nitrogen, creatine kinase, creatinine and lactate dehydrogenase in five points of measurements (between 1 and 14 days after admission) and correlated them with SNPs. High-producing alleles of proinflammatory cytokines protected patients against sepsis (IL1B -511A and IL8 -251A) and mortality (IL1B -511A). High-producing alleles of anti-inflammatory cytokines IL4 -589T and IL13 431A (144Gln) were less frequent in ARDS patients. The carriers of IL6 -174C/C genotypes were prone to the increased levels of biochemical markers and acute kidney and liver insufficiency. Genotype-dependent differences in the levels of biochemical indicators gradually increased to a maximal value on the 14th day after admission. These findings suggest that genetic variability in pro- and anti-inflammatory cytokines may contribute to different clinical phenotypes in patients at high risk of critical illness.

  16. Genetic variations in the KIR gene family may contribute to susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Zuo, Hai-Ning; Wang, Zhi-Long; Cui, Dao-Ran; Xin, Da-Jiang

    2014-08-01

    The present meta-analysis of relevant case-control studies was conducted to investigate the possible relationships between genetic variations in the killer cell immunoglobulin-like receptor (KIR) gene clusters of the human KIR gene family and susceptibility to ankylosing spondylitis (AS). The following electronic databases were searched for relevant articles without language restrictions: the Web of Science, the Cochrane Library Database, PubMed, EMBASE, CINAHL, the Chinese Biomedical Database (CBM) and Chinese National Knowledge Infrastructure (CNKI) databases, covering all papers published until 2013. STATA statistical software was adopted in this meta-analysis as well. We also calculated the crude odds ratios (OR) and its 95% confidence intervals (95 % CI). Seven case-control studies with 1,004 patients diagnosed with AS and 2,138 healthy cases were implicated in our meta-analysis, and 15 genes in the KIR gene family were also evaluated. The results of our meta-analysis show statistical significance between the genetic variations in the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes and an increased susceptibility to AS (KIR2DL1: OR 7.82, 95% CI 3.87-15.81, P0.05). The current meta-analysis provides reliable evidence that genetic variations in the KIR gene family may contribute to susceptibility to AS, especially for the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes.

  17. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  18. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  19. Spectrum of mutations of the LPL gene identified in Italy in patients with severe hypertriglyceridemia.

    Science.gov (United States)

    Rabacchi, Claudio; Pisciotta, Livia; Cefalù, Angelo B; Noto, Davide; Fresa, Raffaele; Tarugi, Patrizia; Averna, Maurizio; Bertolini, Stefano; Calandra, Sebastiano

    2015-07-01

    Monogenic hypertriglyceridemia (HTG) may result from mutations in some genes which impair the intravascular lipolysis of triglyceride (TG)-rich lipoproteins mediated by the enzyme Lipoprotein lipase (LPL). Mutations in the LPL gene are the most frequent cause of monogenic HTG (familial chylomicronemia) with recessive transmission. The LPL gene was resequenced in 149 patients with severe HTG (TG > 10 mmol/L) and 106 patients with moderate HTG (TG > 4.5 and <10 mmol/L) referred to tertiary Lipid Clinics in Italy. In the group of severe HTG, 26 patients (17.4%) were homozygotes, 9 patients (6%) were compound heterozygotes and 15 patients (10%) were simple heterozygotes for rare LPL gene variants. Single or multiple episodes of pancreatitis were recorded in 24 (48%) of these patients. There was no difference in plasma TG concentration between patients with or without a positive history of pancreatitis. Among moderate HTG patients, six patients (5.6%) were heterozygotes for rare LPL variants; two of them had suffered from pancreatitis. Overall 36 rare LPL variants were found, 15 of which not reported previously. Systematic analysis of close relatives of mutation carriers led to the identification of 44 simple heterozygotes (plasma TG 3.2 ± 4.1 mmol/L), none of whom had a positive history of pancreatitis. The prevalence of rare LPL variants in patients with severe or moderate HTG, referred to tertiary lipid clinics, was 50/149 (33.5%) and 6/106 (5.6%), respectively. Systematic analysis of relatives of mutation carriers is an efficient way to identify heterozygotes who may develop severe HTG. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Genetic variation of the Fc gamma receptor 3B gene and association with rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Rute B Marques

    Full Text Available BACKGROUND: Fc gamma receptors (FcγRs play a crucial role in immunity by linking IgG antibody-mediated responses with cellular effector and regulatory functions. Genetic variants in these receptors have been previously identified as risk factors for several chronic inflammatory conditions. The present study aimed to investigate the presence of copy number variations (CNVs in the FCGR3B gene and its potential association with the autoimmune disease rheumatoid arthritis (RA. METHODOLOGY/PRINCIPAL FINDINGS: CNV of the FCGR3B gene was studied using Multiplex Ligation Dependent Probe Amplification (MLPA in 518 Dutch RA patients and 304 healthy controls. Surprisingly, three independent MLPA probes targeting the FCGR3B promoter measured different CNV frequencies, with probe#1 and #2 measuring 0 to 5 gene copies and probe#3 showing little evidence of CNV. Quantitative-PCR correlated with the copy number results from MLPA probe#2, which detected low copy number (1 copy in 6.7% and high copy number (≥3 copies in 9.4% of the control population. No significant difference was observed between RA patients and the healthy controls, neither in the low copy nor the high copy number groups (p-values = 0.36 and 0.71, respectively. Sequencing of the FCGR3B promoter region revealed an insertion/deletion (indel that explained the disparate CNV results of MLPA probe#1. Finally, a non-significant trend was found between the novel -256A>TG indel and RA (40.7% in healthy controls versus 35.9% in RA patients; P = 0.08. CONCLUSIONS/SIGNIFICANCE: The current study highlights the complexity and poor characterization of the FCGR3B gene sequence, indicating that the design and interpretation of genotyping assays based on specific probe sequences must be performed with caution. Nonetheless, we confirmed the presence of CNV and identified novel polymorphisms in the FCGR3B gene in the Dutch population. Although no association was found between RA and FCGR3B CNV, the

  1. Genetic and epigenetic variation in the DNMT3B and MTHFR genes and colorectal adenoma risk.

    Science.gov (United States)

    Ho, Vikki; Ashbury, Janet E; Taylor, Sherryl; Vanner, Stephen; King, Will D

    2016-05-01

    Polymorphisms in DNMT3B and MTHFR have been implicated in cancer etiology; however, it is increasingly clear that gene-specific DNA methylation also affects gene expression. A cross-sectional study (N = 272) investigated the main and joint effects of polymorphisms and DNA methylation in DNMT3B and MTHFR on colorectal adenoma risk. Polymorphisms examined included DNMT3B c.-6-1045G > T, and MTHFR c.665C > T and c.1286A > C. DNA methylation of 66 and 28 CpG sites in DNMT3B and MTHFR, respectively, was quantified in blood leukocytes using Sequenom EpiTYPER®. DNA methylation was conceptualized using two approaches: (1) average methylation and (2) unsupervised principal component analysis to identify variables that represented methylation around the transcription start site and the gene coding area of both genes. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) associated with the main and joint effects of polymorphisms and DNA methylation. DNA methyltransferase 3B (DNMT3B) TT versus GG/GT genotypes was associated with increased colorectal adenoma risk (OR = 2.12; 95% CI: 1.03-4.34). In addition, increasing DNA methylation in the gene-coding area of DNMT3B was associated with higher risk of colorectal adenomas (OR = 1.34; 95% CI: 1.01-1.79 per SD). In joint effect analyses, synergistic effects were observed among those with both the DNMT3B TT genotype and higher DNMT3B methylation levels compared to those with GT/GG genotypes and lower methylation levels (OR = 4.19; 95% CI: 1.45-12.13 for average methylation; OR = 4.26; 95%CI: 1.31-13.87 for methylation in the transcription start site). This research provides novel evidence that genetic and epigenetic variations contribute to colorectal adenoma risk, precursor to the majority of colorectal cancer (CRC).

  2. Genome-wide association implicates numerous genes underlying ecological trait variation in natural populations of Populus trichocarpa.

    Science.gov (United States)

    McKown, Athena D; Klápště, Jaroslav; Guy, Robert D; Geraldes, Armando; Porth, Ilga; Hannemann, Jan; Friedmann, Michael; Muchero, Wellington; Tuskan, Gerald A; Ehlting, Jürgen; Cronk, Quentin C B; El-Kassaby, Yousry A; Mansfield, Shawn D; Douglas, Carl J

    2014-07-01

    In order to uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa) from much of its range in western North America. Extensive data from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34 K Populus single nucleotide polymorphism (SNP) array) of all accessions were used for gene discovery in a genome-wide association study (GWAS). We performed GWAS with 40 biomass, ecophysiology and phenology traits and 29,355 filtered SNPs representing 3518 genes. The association analyses were carried out using a Unified Mixed Model accounting for population structure effects among accessions. We uncovered 410 significant SNPs using a Bonferroni-corrected threshold (P<1.7×10(-6)). Markers were found across 19 chromosomes, explained 1-13% of trait variation, and implicated 275 unique genes in trait associations. Phenology had the largest number of associated genes (240 genes), followed by biomass (53 genes) and ecophysiology traits (25 genes). The GWAS results propose numerous loci for further investigation. Many traits had significant associations with multiple genes, underscoring their genetic complexity. Genes were also identified with multiple trait associations within and/or across trait categories. In some cases, traits were genetically correlated while in others they were not.

  3. Diversity of Streptococcus thermophilus in bacteriocin production; inhibitory spectrum and occurrence of thermophilin genes.

    Science.gov (United States)

    Rossi, Franca; Marzotto, Marta; Cremonese, Silvia; Rizzotti, Lucia; Torriani, Sandra

    2013-08-01

    The bacteriocin-producing Streptococcus thermophilus strains that can dominate in natural dairy ecosystems, may also enhance safety in products obtained from natural cultures. In this study, we sought to identify bacteriocin production and bacteriocin genes in 75 strains of dairy and plant origin. The strains were tested for antimicrobial activity against pathogens or pathogen models, spoiling bacteria, and lactic acid bacteria associated with dairy products. All strains moderately inhibited Staphylococcus aureus P310, none inhibited Listeria innocua LMG 11387(T) or Clostridium tyrobutyricum LMG 1285(T). In addition, 14 were active against one or more indicators in addition to S. aureus P310. Inhibition of other starter bacteria was more common than the inhibition of unwanted microorganisms. The involvement of a proteinaceous compound was ascertained in all cases. Results suggested that the selection of bacteriocinogenic S. thermophilus strains for use in biopreservation must take into account the effects exerted on other lactic acid bacteria. PCR detection of thermophilin genes proved unreliable in predicting antimicrobial activity. For S. thermophilus PRI36 and PRI45, with relevant inhibitory features, the identity of the bacteriocin genes present in the thermophilin 9 cluster was defined, thus revealing novel variants for this genome region.

  4. Melanopsin gene variations interact with season to predict sleep onset and chronotype.

    Science.gov (United States)

    Roecklein, Kathryn A; Wong, Patricia M; Franzen, Peter L; Hasler, Brant P; Wood-Vasey, W Michael; Nimgaonkar, Vishwajit L; Miller, Megan A; Kepreos, Kyle M; Ferrell, Robert E; Manuck, Stephen B

    2012-10-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30-54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p sleep onset among those with the TT genotype was later in the day when individuals were assessed on longer days and earlier in the day on shorter days, whereas individuals in the other genotype groups (i.e., CC and CT) did not show this interaction effect. P10L genotype also interacted in an analogous way with daylength to predict self-reported morningness (interaction p sleep onset and chronotype as a function of daylength, whereas other genotypes at P10L do not seem to have effects that vary by daylength. A better understanding of how melanopsin confers heightened responsivity to daylength may improve our understanding of a broad range of

  5. Genetic variations of the porcine PRKAG3 gene in Chinese indigenous pig breeds

    Directory of Open Access Journals (Sweden)

    Zhou Li-Hua

    2004-07-01

    Full Text Available Abstract Four missense substitutions (T30N, G52S, V199I and R200Q in the porcine PRKAG3 gene were considered as the likely candidate loci affecting meat quality. In this study, the R200Q substitution was investigated in a sample of 62 individuals from Hampshire, Chinese Min and Erhualian pigs, and the genetic variations of T30N, G52S and V199I substitutions were detected in 1505 individuals from 21 Chinese indigenous breeds, 5 Western commercial pig breeds, and the wild pig. Allele 200R was fixed in Chinese Min and Erhualian pigs. Haplotypes II-QQ and IV-QQ were not observed in the Hampshire population, supporting the hypothesis that allele 200Q is tightly linked with allele 199V. Significant differences in allele frequencies of the three substitutions (T30N, G52S and V199I between Chinese indigenous pigs and Western commercial pigs were observed. Obvious high frequencies of the "favorable" alleles 30T and 52G in terms of meat quality were detected in Chinese indigenous pigs, which are well known for high meat quality. However, the frequency of the "favorable" allele 199I, which was reported to have a greater effect on meat quality in comparison with 30T and 52G, was very low in all of the Chinese indigenous pigs except for the Min pig. The reasons accounting for this discrepancy remain to be addressed. The presence of the three substitutions in purebred Chinese Tibetan pigs indicates that the three substitutions were ancestral mutations. A novel A/G substitution at position 51 in exon 1 was identified. The results suggest that further studies are required to investigate the associations of these substitutions in the PRKAG3 gene with meat quality of Chinese indigenous pigs, and to uncover other polymorphisms in the PRKAG3 gene with potential effects on meat quality in Chinese indigenous pigs.

  6. The influence of genetic variations in HHEX gene on insulin metabolism in the German MESYBEPO cohort.

    Science.gov (United States)

    Pivovarova, Olga; Nikiforova, Victoria J; Pfeiffer, Andreas F H; Rudovich, Natalia

    2009-02-01

    In the present study, we aimed to validate the type 2 diabetes (T2DM) susceptibility alleles identified in the first genome-wide association study in the hematopoietically expressed homeobox protein (HHEX) gene region (rs1111875 and rs7923837). Furthermore, we investigated quantitative metabolic risk phenotypes of these two variants for association with three key components of the insulin metabolism: insulin secretion, insulin sensitivity and insulin degradation. Two HHEX polymorphisms were genotyped in 1026 subjects from the German MESYBEPO cohort. Complete OGTT data were available for a subset of 420 with normal glucose tolerance (NGT), 282 with impaired glucose tolerance/impaired fasting glucose (IGT/IFG) and 146 diabetic subjects. We validated association of both HHEX polymorphisms with T2DM. In the non-diabetic subcohort including NGT and IFG/IGT subjects, the risk alleles of rs7923837 and rs1111875 were significantly associated with decreased first and second phases of insulin secretion and lower insulinogenic index after oral glucose loading. In healthy, normal glucose-tolerant subjects, the same association of HHEX SNP rs1111875 with OGTT-derived phases of insulin secretion were detectable, however, rs7923837 was only weakly associated with reduced insulinogenic index. For both polymorphisms, no significant correlations with insulin sensitivity were obtained. Reduced insulin clearance was also observed in heterozygous carriers of rs1111875. We validated the association of polymorphisms of the HHEX gene with T2DM in the MESYBEPO cohort. Importantly, variations within the HHEX gene conferred the impaired insulin secretion and changes of insulin degradation but no alteration in insulin sensitivity in carriers of risk alleles. Copyright (c) 2008 John Wiley & Sons, Ltd.

  7. Variations of the angiotensin II type 1 receptor gene are associated with extreme human longevity.

    Science.gov (United States)

    Benigni, Ariela; Orisio, Silvia; Noris, Marina; Iatropoulos, Paraskevas; Castaldi, Davide; Kamide, Kei; Rakugi, Hiromi; Arai, Yasumichi; Todeschini, Marta; Ogliari, Giulia; Imai, Enyu; Gondo, Yasuyuki; Hirose, Nobuyoshi; Mari, Daniela; Remuzzi, Giuseppe

    2013-06-01

    Longevity phenotype in humans results from the influence of environmental and genetic factors. Few gene polymorphisms have been identified so far with a modest effect on lifespan leaving room for the search of other players in the longevity game. It has been recently demonstrated that targeted disruption of the mouse homolog of the human angiotensin II type 1 receptor (AT1R) gene (AGTR1) translates into marked prolongation of animal lifespan (Benigni et al., J Clin Invest 119(3):524-530, 2009). Based on the above study in mice, here we sought to search for AGTR1 variations associated to reduced AT1 receptor protein levels and to prolonged lifespan in humans. AGTR1 was sequenced in 173 Italian centenarians and 376 younger controls. A novel non-synonymous mutation was detected in a centenarian. Two polymorphisms in AGTR1 promoter, rs422858 and rs275653, in complete linkage disequilibrium, were significantly associated with the ability to attain extreme old age. We then replicated the study of rs275653 in a large independent cohort of Japanese origin (598 centenarians and semi-supercentenarians, 422 younger controls) and indeed confirmed its association with exceptional old age. In combined analyses, rs275653 was associated to extreme longevity either at recessive model (P = 0.007, odds ratio (OR) 3.57) or at genotype level (P = 0.015). Significance was maintained after correcting for confounding factors. Fluorescence activated cell sorting analysis revealed that subjects homozygous for the minor allele of rs275653 had less AT1R-positive peripheral blood polymorphonuclear cells. Moreover, rs275653 was associated to lower blood pressure in centenarians. These findings highlight the role of AGTR1 as a possible candidate among longevity-enabling genes.

  8. The Effects of the Terrain Variation and Changed Parameters of the Moving Window on the LIDAR DEM Spectrum

    Science.gov (United States)

    Vrečko, A.; Kovacs, G.; Podobnikar, T.; Székely, B.

    2012-04-01

    LIDAR (Light Detection And Ranging) data has become a highly used data source for modelling the terrain surface in recent years. In comparison to other surveying techniques, LIDAR measurements provide much denser (and affordable) sampling of the terrain in an automated manner. Higher density of data points results also in the better spatial resolution of DEMs (Digital Elevation Model) generated from these data. Fourier transform (FT) is a technique for transforming the terrain information from the spatial into the frequency domain. Higher spatial resolution of the DEM enables more local approach for analyzing the terrain surface with the FT, since even for a smaller area many (enough) sampling points are given. In this study 2D discrete Fast Fourier Transform (as implemented in MatLab) is applied to LIDAR DEM with a cell size of 0.5 m and therefore with a spatial resolution - in Fourier terminology - of 1.0 m. The chosen study area has different terrain characteristics, such as: different orientation of the lineaments, different aspects, different roughness. Our approach is to analyze the spectrum of the series of subareas ("moving window") of the DEM. This enables studying the response to the changes of different variables in the frequency domain. The changing variables were: (1) the size of the transformed area, (2) the offset between different positions of moving window, and (3) the orientation of the landforms with the respect to the moving window. Changes in all the variables influence the spectral information. We focus more on the results of changing the offset between moving windows, since these analysis are less explored. These offset changes reflect as the changes in the frequency domain due to a new relief structures included in the moving window. Additionally, the possibilities for visualization of spectral information were explored. The purpose was to find an appropriate way to visualize a series of FT, which would raise the understanding of the

  9. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Directory of Open Access Journals (Sweden)

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  10. Expanding the Spectrum of Genes Involved in Huntington Disease Using a Combined Clinical and Genetic Approach.

    Science.gov (United States)

    Mariani, Louise-Laure; Tesson, Christelle; Charles, Perrine; Cazeneuve, Cécile; Hahn, Valérie; Youssov, Katia; Freeman, Leorah; Grabli, David; Roze, Emmanuel; Noël, Sandrine; Peuvion, Jean-Noel; Bachoud-Levi, Anne-Catherine; Brice, Alexis; Stevanin, Giovanni; Durr, Alexandra

    2016-09-01

    Huntington disease (HD), a prototypic monogenic disease, is caused by an expanded CAG repeat in the HTT gene exceeding 35 units. However, not all patients with an HD phenotype carry the pathological expansion in HTT, and the positive diagnosis rate is poor. To examine patients with HD phenotypes to determine the frequency of HD phenocopies with typical features of HD but without pathological CAG repeat expansions in HTT in an attempt to improve the positive diagnosis rate. Between January 1, 2004, and April 18, 2011, a total of 226 consecutive index patients with an HD phenotype were referred to specialized clinics of the French National Huntington Disease Reference Centre for Rare Diseases. They underwent detailed clinical examination and follow-up, as well as neuropsychological, biological, imaging, and genetic examinations. Nucleotide expansions in JPH3, ATN1, TBP, and C9ORF72 and mutations in PRNP, as well as acquired conditions commonly causing HD phenocopies, were first screened. The diagnostic rate of HD phenocopies and frequency of other etiologies using deep clinical phenotyping and next generation sequencing. Our goal was to improve the genetic diagnosis of HD phenocopies and to identify new HD related genes. One hundred ninety-eight patients carried a pathological CAG repeat expansion in HTT, whereas 28 patients (12 women and 16 men) did not. Huntington disease phenocopies accounted for 12.4%, and their mean (SD) age at onset was similar to those of the HD-HTT group (47.3 [12.7] years vs 50.3 [16.4] years, P = .29). We first identified 3 patients with abnormal CTG expansions in JPH3, a fourth patient with an antiphospholipid syndrome, and a fifth patient with B12 avitaminosis. A custom-made 63-gene panel was generated based on clinical evolution and exome sequencing. It contained genes responsible for HD phenocopies and other neurodegenerative conditions, as well as candidate genes from exome sequencing in 3 index cases with imaging features of brain

  11. Natural variation in the Pto pathogen resistance gene within species of wild tomato (Lycopersicon). I. Functional analysis of Pto alleles.

    Science.gov (United States)

    Rose, Laura E; Langley, Charles H; Bernal, Adriana J; Michelmore, Richard W

    2005-09-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene.

  12. Mutation Spectrum in the CACNA1A Gene in 49 Patients with Episodic Ataxia.

    Science.gov (United States)

    Sintas, Cèlia; Carreño, Oriel; Fernàndez-Castillo, Noèlia; Corominas, Roser; Vila-Pueyo, Marta; Toma, Claudio; Cuenca-León, Ester; Barroeta, Isabel; Roig, Carles; Volpini, Víctor; Macaya, Alfons; Cormand, Bru

    2017-05-31

    Episodic ataxia is an autosomal dominant ion channel disorder characterized by episodes of imbalance and incoordination. The disease is genetically heterogeneous and is classified as episodic ataxia type 2 (EA2) when it is caused by a mutation in the CACNA1A gene, encoding the α1A subunit of the P/Q-type voltage-gated calcium channel Cav2.1. The vast majority of EA2 disease-causing variants are loss-of-function (LoF) point changes leading to decreased channel currents. CACNA1A exonic deletions have also been reported in EA2 using quantitative approaches. We performed a mutational screening of the CACNA1A gene, including the promoter and 3'UTR regions, in 49 unrelated patients diagnosed with episodic ataxia. When pathogenic variants were not found by sequencing, we performed a copy number variant (CNV) analysis to screen for duplications or deletions. Overall, sequencing screening allowed identification of six different point variants (three nonsense and three missense changes) and two coding indels, one of them found in two unrelated patients. Additionally, CNV analysis identified a deletion in a patient spanning exon 35 as a result of a recombination event between flanking intronic Alu sequences. This study allowed identification of potentially pathogenic alterations in our sample, five of them novel, which cover 20% of the patients (10/49). Our data suggest that most of these variants are disease-causing, although functional studies are required.

  13. Patterns of human genetic variation inferred from comparative analysis of allelic mutations in blood group antigen genes.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Blumenfeld, Olga O

    2011-03-01

    Comparative analysis of allelic variation of a gene sheds light on the pattern and process of its diversification at the population level. Gene families for which a large number of allelic forms have been verified by sequencing provide a useful resource for such studies. In this regard, human blood group-encoding genes are unique in that differences of cell surface traits among individuals and populations can be readily detected by serological screening, and correlation between the variant cell surface phenotype and the genotype is, in most cases, unequivocal. Here, we perform a comprehensive analysis of allelic forms, compiled in the Blood Group Antigen Gene Mutation database, of ABO, RHD/CE, GYPA/B/E and FUT1/2 gene families that encode the ABO, RH, MNS, and H/h blood group system antigens, respectively. These genes are excellent illustrative examples showing distinct mutational patterns among the alleles, and leading to speculation on how their origin may have been driven by recurrent but different molecular mechanisms. We illustrate how alignment of alleles of a gene may provide an additional insight into the DNA variation process and its pathways, and how this approach may serve to catalog alleles of a gene, simplifying the task and content of mutation databases.

  14. Association between a variation in the phosphodiesterase 4D gene and bone mineral density

    Directory of Open Access Journals (Sweden)

    Sambrook Philip N

    2005-03-01

    Full Text Available Abstract Background Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown. Methods We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (2, n = 319 and high (> 1.11 g/cm2, n = 321 BMD at the lumbar spine. Significant findings were verified in two additional sample collections. Results Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4D gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (2 and 138 females with high (>1.04 g/cm2 lumbar spine BMD. Odds ratios were 1.5 (P = 0.035 in the original sample and 2.1 (P = 0.018 in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09. We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD. Conclusion This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in

  15. Genetic variation of the IL-28B promoter affecting gene expression.

    Directory of Open Access Journals (Sweden)

    Masaya Sugiyama

    Full Text Available The current standard of care for the treatment of chronic hepatitis C is pegylated interferon-α (PEG-IFNα and ribavirin (RBV. The treatment achieves a sustained viral clearance in only approximately 50% of patients. Recent whole genome association studies revealed that single nucleotide polymorphisms (SNPs around IL-28B have been associated with response to the standard therapy and could predict treatment responses at approximately 80%. However, it is not clear which SNP is most informative because the genomic region containing significant SNPs shows strong linkage disequilibrium. We focused on SNPs in close proximity to the IL-28B gene to evaluate the function of each and identify the SNP affecting the IL-28B expression level most. The structures of IL-28A/B from 5' to 3'-UTR were determined by complete cDNA cloning. Both IL-28A and 28B genes consisted of 6 exons, differing from the CCDS data of NCBI. Two intron SNPs and a nonsynonymous SNP did not affect IL-28B gene function and expression levels but a SNP located in the proximal promoter region influenced gene expression. A (TA dinucleotide repeat, rs72258881, located in the promoter region was discovered by our functional studies of the proximal SNPs upstream of IL-28B; the transcriptional activity of the promoter increased gradually in a (TA(n length-dependent manner following IFN-α and lipopolysaccharide stimulation. Healthy Japanese donors exhibited a broad range of (TA dinucleotide repeat numbers from 10 to 18 and the most prevalent genotype was 12/12 (75%, differing from the database (13/13. However, genetic variation of IL-28A corresponding to that of IL-28B was not detected in these Japanese donors. These findings suggest that the dinucleotide repeat could be associated with the transcriptional activity of IL-28B as well as being a marker to improve the prediction of the response to interferon-based hepatitis C virus treatment.

  16. Identification of genes related to the phenotypic variations of a synthesized Paulownia (Paulownia tomentosa×Paulownia fortunei) autotetraploid.

    Science.gov (United States)

    Li, Yongsheng; Fan, Guoqiang; Dong, Yanpeng; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Xu, Enkai; Niu, Suyan

    2014-12-15

    Paulownia is a fast-growing deciduous tree native to China. It has great economic importance for the pulp and paper industries, as well as ecological prominence in forest ecosystems. Paulownia is of much interest to plant breeder keen to explore new plant varieties by selecting on the basis of phenotype. A newly synthesized autotetraploid Paulownia exhibited advanced characteristics, such as greater yield, and higher resistance than the diploid tree. However, tissue-specific transcriptome and genomic data in public databases are not sufficient to understand the molecular mechanisms associated with genome duplication. To evaluate the effects of genome duplication on the phenotypic variations in Paulownia tomentosa×Paulownia fortunei, the transcriptomes of the autotetraploid and diploid Paulownia were compared. Using Illumina sequencing technology, a total of 82,934 All-unigenes with a mean length of 1109 bp were assembled. The data revealed numerous differences in gene expression between the two transcriptomes, including 718 up-regulated and 667 down-regulated differentially expressed genes between the two Paulownia trees. An analysis of the pathway and gene annotations revealed that genes involved in nucleotide sugar metabolism in plant cell walls were down-regulated, and genes involved in the light signal pathway and the biosynthesis of structural polymers were up-regulated in autotetraploid Paulownia. The differentially expressed genes may contribute to the observed phenotypic variations between diploid and autotetraploid Paulownia. These results provide a significant resource for understanding the variations in Paulownia polyploidization and will benefit future breeding work.

  17. Adenosine A(2A) receptor gene (ADORA2A) variants may increase autistic symptoms and anxiety in autism spectrum disorder.

    Science.gov (United States)

    Freitag, Christine M; Agelopoulos, Konstantin; Huy, Ellen; Rothermundt, Matthias; Krakowitzky, Petra; Meyer, Jobst; Deckert, Jürgen; von Gontard, Alexander; Hohoff, Christa

    2010-01-01

    Autism spectrum disorders (ASDs) are heterogeneous disorders presenting with increased rates of anxiety. The adenosine A(2A) receptor gene (ADORA2A) is associated with panic disorder and is located on chromosome 22q11.23. Its gene product, the adenosine A(2A) receptor, is strongly expressed in the caudate nucleus, which also is involved in ASD. As autistic symptoms are increased in individuals with 22q11.2 deletion syndrome, and large 22q11.2 deletions and duplications have been observed in ASD individuals, in this study, 98 individuals with ASD and 234 control individuals were genotyped for eight single-nucleotide polymorphisms in ADORA2A. Nominal association with the disorder was observed for rs2236624-CC, and phenotypic variability in ASD symptoms was influenced by rs3761422, rs5751876 and rs35320474. In addition, association of ADORA2A variants with anxiety was replicated for individuals with ASD. Findings point toward a possible mediating role of ADORA2A variants on phenotypic expression in ASD that need to be replicated in a larger sample.

  18. Neuronal connectivity as a convergent target of gene × environment interactions that confer risk for Autism Spectrum Disorders.

    Science.gov (United States)

    Stamou, Marianna; Streifel, Karin M; Goines, Paula E; Lein, Pamela J

    2013-01-01

    Evidence implicates environmental factors in the pathogenesis of Autism Spectrum Disorders (ASD). However, the identity of specific environmental chemicals that influence ASD risk, severity or treatment outcome remains elusive. The impact of any given environmental exposure likely varies across a population according to individual genetic substrates, and this increases the difficulty of identifying clear associations between exposure and ASD diagnoses. Heritable genetic vulnerabilities may amplify adverse effects triggered by environmental exposures if genetic and environmental factors converge to dysregulate the same signaling systems at critical times of development. Thus, one strategy for identifying environmental risk factors for ASD is to screen for environmental factors that modulate the same signaling pathways as ASD susceptibility genes. Recent advances in defining the molecular and cellular pathology of ASD point to altered patterns of neuronal connectivity in the developing brain as the neurobiological basis of these disorders. Studies of syndromic ASD and rare highly penetrant mutations or CNVs in ASD suggest that ASD risk genes converge on several major signaling pathways linked to altered neuronal connectivity in the developing brain. This review briefly summarizes the evidence implicating dysfunctional signaling via Ca(2+)-dependent mechanisms, extracellular signal-regulated kinases (ERK)/phosphatidylinositol-3-kinases (PI3K) and neuroligin-neurexin-SHANK as convergent molecular mechanisms in ASD, and then discusses examples of environmental chemicals for which there is emerging evidence of their potential to interfere with normal neuronal connectivity via perturbation of these signaling pathways.

  19. Association of the oxytocin receptor (OXTR) gene polymorphisms with autism spectrum disorder (ASD) in the Japanese population.

    Science.gov (United States)

    Liu, Xiaoxi; Kawamura, Yoshiya; Shimada, Takafumi; Otowa, Takeshi; Koishi, Shinko; Sugiyama, Toshiro; Nishida, Hisami; Hashimoto, Ohiko; Nakagami, Ryoichi; Tochigi, Mamoru; Umekage, Tadashi; Kano, Yukiko; Miyagawa, Taku; Kato, Nobumasa; Tokunaga, Katsushi; Sasaki, Tsukasa

    2010-03-01

    The oxytocin receptor (OXTR) gene, which is located on chromosome 3p25.3, has been implicated as a candidate gene for susceptibility of autism spectrum disorder (ASD). Positive associations between OXTR and ASD have been reported in earlier studies. However, the results were inconsistent and demand further studies. In this study, we investigated the associations between OXTR and ASD in a Japanese population by analyzing 11 single-nucleotide polymorphisms (SNPs) using both family-based association test (FBAT) and population-based case-control test. No significant signal was detected in the FBAT test. However, significant differences were observed in allelic frequencies of four SNPs, including rs2254298 between patients and controls. The risk allele of rs2254298 was 'A', which was consistent with the previous study in Chinese, and not with the observations in Caucasian. The difference in the risk allele of this SNP in previous studies might be attributable to an ethnic difference in the linkage disequilibrium structure between the Asians and Caucasians. In addition, haplotype analysis exhibits a significant association between a five-SNP haplotype and ASD, including rs22542898. In conclusion, our study might support that OXTR has a significant role in conferring the risk of ASD in the Japanese population.

  20. A different spectrum of DMD gene mutations in local Chinese patients with Duchenne/Becker muscular dystrophy

    Institute of Scientific and Technical Information of China (English)

    Ivan Fai-man Lo; Kent Keung-san Lai; Tony Ming-for Tong; Stephen Tak-sum Lam

    2006-01-01

    Background Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are X-linked recessive, allelic disorders. This study was conducted to look into the spectrum of DMD gene mutations in Hong Kong Chinese patients with Duchenne or Becket muscular dystrophy (DMD/BMD), and to study genotype-phenotype correlation.Methods A retrospective review of 67 patients.Results Twenty-three (34.3%) patients had exon deletions; whereas 5 (7.5%) patients had exon duplications.Twenty-three (34.3%) patients had small mutations, including 17-point mutations and 6 small insertions or deletions. No correlation was found between the type of mutation and the muscle phenotype or mental retardation.Significantly fewer maternal carriers were found in patients with exon deletions, and a positive family history was more common in those with small mutations. DMD phenotype was significantly less common in patients with exon deletions/duplications at the 5' hotspot, whereas all 4 small mutations associated with mental retardation were located in the 3' end of the gene.Conclusions The percentage of DMD exon deletions in local Chinese patients was significantly lower than the commonly quoted 60%. This indicated an ethnic or regional difference in predisposition to DMD exon deletions.

  1. Secretory breast carcinomas with ETV6-NTRK3 fusion gene belong to the basal-like carcinoma spectrum.

    Science.gov (United States)

    Laé, Marick; Fréneaux, Paul; Sastre-Garau, Xavier; Chouchane, Olfa; Sigal-Zafrani, Brigitte; Vincent-Salomon, Anne

    2009-02-01

    Secretory breast carcinomas (carcinoma. A series of six secretory breast carcinomas were identified in our files. The ETV6 rearrangement was confirmed in all cases by fluorescence in situ hybridization. Immunophenotype was assessed with anti-ER, PR, ERBB2, KIT, EGFR, E-cadherin, vimentin, PS100, smooth muscle actin, basal (CK5/6 and 14), luminal cytokeratins (CK8/18) and p63 antibodies. In situ and invasive components shared the same immunoprofile and were ER, PR, ERBB2 negative with expression of basal cytokeratins. ETV6 gene alterations were present in both in situ and invasive components, highlighting their genetic similarities. The immunoprofile data (triple-negative with expression of basal markers) showed that secretory breast carcinomas with ETV6-NTRK3 fusion gene belong to the phenotypic basal-like spectrum of breast carcinomas. These results support the hypothesis that secretory breast carcinomas have immunohistochemical and genetic features that distinguish them from other basal-like tumors of the breast.

  2. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    Institute of Scientific and Technical Information of China (English)

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  3. Comparison of Affymetrix Gene Array with the Exon Array shows potential application for detection of transcript isoform variation

    Directory of Open Access Journals (Sweden)

    Coulombe-Huntington Jasmin

    2009-11-01

    Full Text Available Abstract Background The emergence of isoform-sensitive microarrays has helped fuel in-depth studies of the human transcriptome. The Affymetrix GeneChip Human Exon 1.0 ST Array (Exon Array has been previously shown to be effective in profiling gene expression at the isoform level. More recently, the Affymetrix GeneChip Human Gene 1.0 ST Array (Gene Array has been released for measuring gene expression and interestingly contains a large subset of probes from the Exon Array. Here, we explore the potential of using Gene Array probes to assess expression variation at the sub-transcript level. Utilizing datasets of the high quality Microarray Quality Control (MAQC RNA samples previously assayed on the Exon Array and Gene Array, we compare the expression measurements of the two platforms to determine the performance of the Gene Array in detecting isoform variations. Results Overall, we show that the Gene Array is comparable to the Exon Array in making gene expression calls. Moreover, to examine expression of different isoforms, we modify the Gene Array probe set definition file to enable summarization of probe intensity values at the exon level and show that the expression profiles between the two platforms are also highly correlated. Next, expression calls of previously known differentially spliced genes were compared and also show concordant results. Splicing index analysis, representing estimates of exon inclusion levels, shows a lower but good correlation between platforms. As the Gene Array contains a significant subset of probes from the Exon Array, we note that, in comparison, the Gene Array overlaps with fewer but still a high proportion of splicing events annotated in the Known Alt Events UCSC track, with abundant coverage of cassette exons. We discuss the ability of the Gene Array to detect alternative splicing and isoform variation and address its limitations. Conclusion The Gene Array is an effective expression profiling tool at gene and

  4. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  5. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    Institute of Scientific and Technical Information of China (English)

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  6. Role of Metabolic Genes in Blood Aluminum Concentrations of Jamaican Children with and without Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Mohammad H. Rahbar

    2016-11-01

    Full Text Available Aluminum is a neurotoxic metal with known health effects in animals and humans. Glutathione-S-transferase (GST genes and enzymes play a major role in detoxification of several heavy metals. Besides a direct relationship with oxidative stress; aluminum decreases GST enzyme activities. Using data from 116 Jamaican children; age 2–8 years; with Autism Spectrum Disorder (ASD and 116 sex- and age-matched typically developing (TD children; we investigated the association of polymorphisms in three GST genes (GSTP1; GSTM1; and GSTT1 with mean blood aluminum concentrations in children with and without ASD. Using log-transformed blood aluminum concentration as the dependent variable in a linear regression model; we assessed the additive and interactive effects of ASD status and polymorphisms in the three aforementioned GST genes in relation to blood aluminum concentrations. Although none of the additive effects were statistically significant (all p > 0.16; we observed a marginally significant interaction between GSTP1 Ile105Val (rs1695 and ASD status (p = 0.07; even after controlling for parental education level and consumption of avocado; root vegetables; and tuna (canned fish. Our findings indicate a significantly lower (p < 0.03 adjusted geometric mean blood aluminum concentration for TD children who had the Val/Val genotype (14.57 µg/L; compared with those with Ile/Ile or Ile/Val genotypes who had an adjusted geometric mean of 23.75 µg/L. However; this difference was not statistically significant among the ASD cases (p = 0.76. Our findings indicate that ASD status may be a potential effect modifier when assessing the association between GSTP1 rs1695 and blood aluminum concentrations among Jamaican children. These findings require replication in other populations.

  7. QTL replication and targeted association highlight the nerve growth factor gene for nonverbal communication deficits in autism spectrum disorders.

    Science.gov (United States)

    Lu, A T-H; Yoon, J; Geschwind, D H; Cantor, R M

    2013-02-01

    Autism Spectrum Disorder (ASD) has a heterogeneous etiology that is genetically complex. It is defined by deficits in communication and social skills and the presence of restricted and repetitive behaviors. Genetic analyses of heritable quantitative traits that correlate with ASD may reduce heterogeneity. With this in mind, deficits in nonverbal communication (NVC) were quantified based on items from the Autism Diagnostic Interview Revised. Our previous analysis of 228 families from the Autism Genetics Research Exchange (AGRE) repository reported 5 potential quantitative trait loci (QTL). Here we report an NVC QTL replication study in an independent sample of 213 AGRE families. One QTL was replicated (PNVC with a P-value of 0.001. Three associated haplotype blocks were intronic to the Nerve Growth Factor (NGF) gene (P=0.001, 0.001, 0.002), and one was intronic to KCND3 (P=0.001). Individual haplotypes within the associated blocks drove the associations (0.003, 0.0004 and 0.0002) for NGF and 0.0001 for KCND3. Using the same methods, these genes were tested for association with NVC in an independent sample of 1517 families from an Autism Genome Project (AGP). NVC was associated with a haplotype in an adjacent NGF block (P=0.0005) and one 46 kb away from the associated block in KCND3 (0.008). These analyses illustrate the value of QTL and targeted association studies for genetically complex disorders such as ASD. NGF is a promising risk gene for NVC deficits.

  8. Role of Metabolic Genes in Blood Aluminum Concentrations of Jamaican Children with and without Autism Spectrum Disorder.

    Science.gov (United States)

    Rahbar, Mohammad H; Samms-Vaughan, Maureen; Pitcher, Meagan R; Bressler, Jan; Hessabi, Manouchehr; Loveland, Katherine A; Christian, MacKinsey A; Grove, Megan L; Shakespeare-Pellington, Sydonnie; Beecher, Compton; McLaughlin, Wayne; Boerwinkle, Eric

    2016-11-08

    Aluminum is a neurotoxic metal with known health effects in animals and humans. Glutathione-S-transferase (GST) genes and enzymes play a major role in detoxification of several heavy metals. Besides a direct relationship with oxidative stress; aluminum decreases GST enzyme activities. Using data from 116 Jamaican children; age 2-8 years; with Autism Spectrum Disorder (ASD) and 116 sex- and age-matched typically developing (TD) children; we investigated the association of polymorphisms in three GST genes (GSTP1; GSTM1; and GSTT1) with mean blood aluminum concentrations in children with and without ASD. Using log-transformed blood aluminum concentration as the dependent variable in a linear regression model; we assessed the additive and interactive effects of ASD status and polymorphisms in the three aforementioned GST genes in relation to blood aluminum concentrations. Although none of the additive effects were statistically significant (all p > 0.16); we observed a marginally significant interaction between GSTP1 Ile105Val (rs1695) and ASD status (p = 0.07); even after controlling for parental education level and consumption of avocado; root vegetables; and tuna (canned fish). Our findings indicate a significantly lower (p < 0.03) adjusted geometric mean blood aluminum concentration for TD children who had the Val/Val genotype (14.57 µg/L); compared with those with Ile/Ile or Ile/Val genotypes who had an adjusted geometric mean of 23.75 µg/L. However; this difference was not statistically significant among the ASD cases (p = 0.76). Our findings indicate that ASD status may be a potential effect modifier when assessing the association between GSTP1 rs1695 and blood aluminum concentrations among Jamaican children. These findings require replication in other populations.

  9. Clinical features and MUT gene mutation spectrum in Chinese patients with isolated methylmalonic acidemia: identification of ten novel allelic variants.

    Science.gov (United States)

    Han, Lian-Shu; Huang, Zhuo; Han, Feng; Ye, Jun; Qiu, Wen-Juan; Zhang, Hui-Wen; Wang, Yu; Gong, Zhu-Wen; Gu, Xue-Fan

    2015-11-01

    This study aims to study MUT gene mutation spectrum in Chinese patients with isolated methylmalonic academia (MMA) and their clinical features for the potential genotype-phenotype correlation. Forty-three patients were diagnosed with isolated MMA by elevated blood propionylcarnitine, propionylcarnitine to acetylcarnitine ratio, and urine methylmalonate without hyperhomocysteinemia. The MUT gene was amplified by polymerase chain reaction and directly sequenced. Those patients with at least one variant allele were included. The novel missense mutations were assessed by bioinformatic analysis and screened against alleles sequenced from 50 control participants. Among the 43 patients, 38 had typical clinical presentations, and the majority (30/38) experienced earlyonset MMA. Eight patients died and seven were lost to follow-up. Twenty patients had poor outcomes and eight showed normal development. The 43 identified MUT gene mutations had at least one variant allele, whereas 35 had two mutant alleles. Of the 33 mutations reported before, eight recurrent mutations were identified in 32 patients, and c.729_730insTT (p.D244Lfs*39) was the most common (12/78) in the mutant alleles. Of the 10 novel mutations, six were missense mutations and four were premature termination codon mutations. The six novel missense mutations seemed to be pathogenic. A total of 10 novel MUT mutations were detected in the Chinese population. c.729_730insTT (p.D244Lfs*39) was the most frequent mutation. A genotype-phenotype correlation could not be found, but the genotypic characterization indicated the need of genetic counseling for MMA patients and early prenatal diagnoses for high-risk families.

  10. Case Study of Somaclonal Variation in Resistance Genes Mlo and Pme3 in Flaxseed (Linum usitatissimum L.) Induced by Nanoparticles

    Science.gov (United States)

    Kokina, Inese; Jermaļonoka, Marija; Bankovska, Linda; Gerbreders, Vjačeslavs; Ogurcovs, Andrejs; Jahundoviča, Inese

    2017-01-01

    Nanoparticles influence on genome is investigated worldwide. The appearance of somaclonal variation is a cause of great concern for any micropropagation system. Somaclonal variation describes the tissue-culture-induced phenotypic and genotypic variations. This paper shows the results of somaclonal variation in two resistance genes pectin methylesterase and Mlo-like protein in all tissue culture development stages, as donor plant, calluses, and regenerants of Linum usitatissimum induced by gold and silver nanoparticles. In this paper, it was essential to obtain DNA material from all tissue culture development stages from one donor plant to record changes in each nucleotide sequence. Gene region specific primers were developed for resistance genes such as Mlo and Pme3 to define the genetic variability in tissue culture of L. usitatissimum. In recent years, utilization of gold and silver nanoparticles in tissue culture is increased and the mechanisms of changes in genome induced by nanoparticles still remain unclear. Obtained data show the somaclonal variation increase in calluses obtained from one donor plant and grown on medium supplemented by gold nanoparticles (Mlo 14.68 ± 0.98; Pme3 2.07 ± 0.87) or silver nanoparticles (Mlo 12.01 ± 0.43; Pme3 10.04 ± 0.46) and decrease in regenerants. Morphological parameters of calluses showed a number of differences between each investigated culture group. PMID:28326314

  11. Common Variation in the NOS1AP Gene Is Associated With Drug-Induced QT Prolongation and Ventricular Arrhythmia

    NARCIS (Netherlands)

    Jamshidi, Yalda; Nolte, Ilja M.; Dalageorgou, Chrysoula; Zheng, Dongling; Johnson, Toby; Bastiaenen, Rachel; Ruddy, Suzanne; Talbott, Daniel; Norris, Kris J.; Snieder, Harold; George, Alfred L.; Marshall, Vanessa; Shakir, Saad; Kannankeril, Prince J.; Munroe, Patricia B.; Camm, A. John; Jeffery, Steve; Roden, Dan M.; Behr, Elijah R.

    2012-01-01

    Objectives This study sought to determine whether variations in NOS1AP affect drug-induced long QT syndrome (LQTS). Background Use of antiarrhythmic drugs is limited by the high incidence of serious adverse events including QT prolongation and torsades de pointes. NOS1AP gene variants play a role in

  12. Genetic Variation and the Risk of Haloperidol-Related Parkinsonism in Elderly Patients A Candidate Gene Approach

    NARCIS (Netherlands)

    Knol, Wilma; van Marum, Rob J.; Jansen, Paul A. F.; Strengman, Eric; Al Hadithy, Asmar F. Y.; Wilffert, Bob; Schobben, Alfred F. A. M.; Ophoff, Roel A.; Egberts, Toine C. G.

    2013-01-01

    Factors that influence the variation in occurrence of antipsychotic-related parkinsonism in elderly have not been well elucidated. The aim of this study was to investigate whether previous identified and studied genetic polymorphisms at DRD2, ANKK1, DRD3, HTR2A, HTR2C, RGS2, COMT, and BDNF genes are

  13. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, L S; Wod, M; Grarup, Niels;

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...... diabetes susceptibility or influences diabetes-related metabolic traits....

  14. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas;

    2012-01-01

    3918342 and rs1421292, were significantly associated with CSF HVA concentrations. Rs3918342 was found to be nominally associated with CSF 5-HIAA concentrations. None of the polymorphisms were significantly associated with MHPG concentrations. Our results indicate that DAOA gene variation affects dopamine...

  15. Common genetic variation in the Estrogen Receptor Beta (ESR2) gene and osteoarthritis: Results of a meta-analysis

    NARCIS (Netherlands)

    J.M. Kerkhof (Hanneke); I. Meulenbelt (Ingrid); A. Gonzalez (Antonio); D.J. Hart (Deborah); A. Hofman (Albert); M. Kloppenburg (Margreet); N.E. Lane; J. Loughlin (John); M.C. Nevitt (Michael); H.A.P. Pols (Huib); F. Rivadeneira Ramirez (Fernando); E. Slagboom (Eline); T.D. Spector (Tim); L. Stolk (Lisette); A. Tsezou (Aspasia); A.G. Uitterlinden (André); A.M. Valdes (Ana Maria); J.B.J. van Meurs (Joyce); A.J. Carr (Andrew Jonathan)

    2010-01-01

    textabstractBackground: The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis.Methods: In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs) were genotyped and tested for association with hip

  16. Variations in potassium channel genes are associated with breast pain in women prior to breast cancer surgery.

    Science.gov (United States)

    Langford, Dale J; West, Claudia; Elboim, Charles; Cooper, Bruce A; Abrams, Gary; Paul, Steven M; Schmidt, Brian L; Levine, Jon D; Merriman, John D; Dhruva, Anand; Neuhaus, John; Leutwyler, Heather; Baggott, Christina; Sullivan, Carmen Ward; Aouizerat, Bradley E; Miaskowski, Christine

    2014-01-01

    Preoperative breast pain in women with breast cancer may result from a number of causes. Previous work from our team found that breast pain occurred in 28.2% of women (n = 398) who were about to undergo breast cancer surgery. The occurrence of preoperative breast pain was associated with a number of demographic and clinical characteristics, as well as variation in two cytokine genes. Given that ion channels regulate excitability of sensory neurons, we hypothesized that variations in potassium channel genes would be associated with preoperative breast pain in these patients. Therefore, in this study, we evaluated for associations between single-nucleotide polymorphisms and inferred haplotypes among 10 potassium channel genes and the occurrence of preoperative breast pain in patients scheduled to undergo breast cancer surgery. Multivariable logistic regression analyses were used to identify those genetic variations that were associated with the occurrence of preoperative breast pain while controlling for age and genomic estimates of and self-reported race/ethnicity. Variations in four potassium channel genes: (1) potassium voltage-gated channel, delayed rectifier, subfamily S, member 1 (KCNS1); (2) potassium inwardly rectifying channel, subfamily J, member 3 (KCNJ3); (3) KCNJ6; and (4) potassium channel, subfamily K, member 9 (KCNK9) were associated with the occurrence of breast pain. Findings from this study warrant replication in an independent sample of women who report breast pain following one or more breast biopsies.

  17. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  18. Gene variations of nitric oxide synthase regulate the effects of a saturated fat rich meal on endothelial function

    Science.gov (United States)

    Objective: Endothelial nitric oxide synthase gene variations have been linked to a higher risk for cardiovascular diseases by unknown mechanisms. Our aim was to determine if two SNPs located in NOS3 (E298D and i19342) interfere with microvascular endothelial function (MEF) and/or oxidative stress du...

  19. Commensal Enterobacteriaceae as reservoirs of extended-spectrum beta-lactamases, integrons and sul genes in Portugal

    Directory of Open Access Journals (Sweden)

    Elisabete eMachado

    2013-04-01

    Full Text Available Bacteria colonizing the human intestine have a relevant role in the spread of antimicrobial resistance. We investigated the faecal carriage of extended-spectrum beta-lactamase (ESBL-producing Enterobacteriaceae in healthy humans from Portugal and analysed the distribution of sul genes and class 1 and 2 integrons. Faecal samples (n=113 were recovered from healthy persons (North/Centre of Portugal, 2001-04 and plated on MacConkey agar with and without ceftazidime (1mg/L or cefotaxime (1mg/L. Isolates representing different morphotypes/plate and antibiotic susceptibility patterns (n=201 were selected. Isolates resistant to sulfonamides and/or streptomycin, gentamicin and trimethoprim were screened (PCR, sequencing for sul genes (sul1, sul2, sul3 and class 1 and 2 integrons. Presence of ESBLs was inferred using the DDST and further confirmed by PCR and sequencing. ESBL producers were selected for clonal analysis, plasmid characterization and conjugation assays by standard methods. ESBL-producing isolates were found in 1.8% (2/113 of samples, corresponding to Escherichia coli of phylogroups A (n=1 and B1 (n=1 carrying transferable blaCTX-M-14 and the new blaTEM-153, respectively. A 80kb IncK-blaCTX-M-14 was found, being highly related to that widely spread among CTX-M-14 producers of humans and animals from Portugal and other European countries. sul genes were found in 88% (22/25;sul2-60%, sul1-48%, sul3-4% of the sulfonamide resistant isolates. Class 1 integrons were more frequently found than class 2 (7% vs 3%. Interestingly, gene cassette arrangements within these platforms were identical to those commonly observed among Enterobacteriaceae from Portuguese food-producing animals, although aadA13 is here firstly described in Morganella morganii. These results reinforce the relevance of human commensal flora as reservoir of clinically relevant antibiotic resistance genes including blaESBLs, and highly transferable genetic platforms as IncK epidemic

  20. The impact of heat shock protein 70 gene variations on clinical presentation and outcome in schizophrenic inpatients.

    Science.gov (United States)

    Pae, Chi-Un; Drago, Antonio; Kim, Jung-Jin; Mandelli, Laura; De Ronchi, Diana; Serretti, Alessandro

    2009-01-01

    We previously investigated a group of single-nucleotide polymorphisms of a set of genes coding for heat shock proteins (HSPA1A, HSPA1B and HSPA1L) and found a significant association between one HSPA1B variation and schizophrenia (SZ). We now report an association between a set of variations (rs2227956, rs2075799, rs1043618, rs562047 and rs539689) within the same genes and a larger sample of schizophrenic inpatients. A single variation, rs539689 (HSPA1B), was found to be marginally associated with Positive and Negative Syndrome Scale (PANSS) positive scores at discharge, and haplotype analysis revealed a significant association between improvement in PANSS scores with both A-C-G-G and A-C-G-G haplotypes. These findings further support a role of heat shock proteins in the pathophysiology of SZ.

  1. Broad spectrum late blight resistance in potato differential set plants MaR8 and MaR9 is conferred by multiple stacked R genes

    NARCIS (Netherlands)

    Kim, H.I.; Lee, H.; Jo, K.R.; Mortazavian, S.M.M.; Huigen, D.J.; Evenhuis, A.; Kessel, G.J.T.; Visser, R.G.F.; Vossen, J.H.; Jacobsen, E.

    2012-01-01

    Phytophthora infestans is the causal agent of late blight in potato. The Mexican species Solanum demissum is well known as a good resistance source. Among the 11 R gene differentials, which were introgressed from S. demissum, especially R8 and R9 differentials showed broad spectrum resistance both u

  2. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    Science.gov (United States)

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  3. Emergence of FGFR family gene fusions as therapeutic targets in a wide spectrum of solid tumours.

    Science.gov (United States)

    Parker, Brittany C; Engels, Manon; Annala, Matti; Zhang, Wei

    2014-01-01

    The emergence of fibroblast growth factor receptor (FGFR) family fusions across diverse cancers has brought attention to FGFR-derived cancer therapies. The discovery of the first recurrent FGFR fusion in glioblastoma was followed by discoveries of FGFR fusions in bladder, lung, breast, thyroid, oral, and prostate cancers. Drug targeting of FGFR fusions has shown promising results and should soon be translating into clinical trials. FGFR fusions form as a result of various mechanisms – predominantly deletion for FGFR1, translocation for FGFR2, and tandem duplication for FGFR3. The ability to exploit the unique targetability of FGFR fusions proves that FGFR-derived therapies could have a promising future in cancer therapeutics. Drug targeting of fusion genes has proven to be an extremely effective therapeutic approach for cancers such as the recurrent BCR–ABL1 fusion in chronic myeloid leukaemia. The recent discovery of recurrent FGFR family fusions in several cancer types has brought to attention the unique therapeutic potential for FGFR-positive patients. Understanding the diverse mechanisms of FGFR fusion formation and their oncogenic potential will shed light on the impact of FGFR-derived therapy in the future.

  4. Assessment of PD-1 gene variation in patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Shadmehri AA

    2010-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with presumed autoimmune origin. T cells are considered to play a pivotal role in orchestrating the self-reactive immune responses in multiple sclerosis (MS. This study was performed to investigate the role of polymorphisms of the programmed cell death 1 (PD-1 gene on susceptibility to ankylosing spondylitis. This gene codes an immunoreceptor named PD-1, which has a cytoplasmic domain containing two tyrosine residues located within immunoreceptor tyrosine-based inhibitory and switch motifs (ITIM and ITSM, suggesting that PD-1 is predominantly inhibitory which responsible for the negative regulation in T cell activation and peripheral tolerance. We investigated whether PD-1 gene polymorphism is a genetic modifier for risk and progression of MS."n"n Methods: Blood samples from 150 Iranian Relapsing-Remitting MS patients (mean age, 34.98 years and 202 healthy controls (mean age, 30 years were enrolled in this study. The PD-1.3 (7146 G/A Intron 4 and PD-1.9 (7625 C/T Exon 5 polymorphisms were detected by Polymerase Chain Reaction and Restriction Enzyme digestion or Restriction Fragment Length Polymorphism (PCR

  5. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  6. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Directory of Open Access Journals (Sweden)

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  7. Inherited Variation in Vitamin D Genes and Type 1 Diabetes Predisposition

    Science.gov (United States)

    Penna-Martinez, Marissa; Badenhoop, Klaus

    2017-01-01

    The etiology and pathophysiology of type 1 diabetes remain largely elusive with no established concepts for a causal therapy. Efforts to clarify genetic susceptibility and screening for environmental factors have identified the vitamin D system as a contributory pathway that is potentially correctable. This review aims at compiling all genetic studies addressing the vitamin D system in type 1 diabetes. Herein, association studies with case control cohorts are presented as well as family investigations with transmission tests, meta-analyses and intervention trials. Additionally, rare examples of inborn errors of vitamin D metabolism manifesting with type 1 diabetes and their immune status are discussed. We find a majority of association studies confirming a predisposing role for vitamin D receptor (VDR) polymorphisms and those of the vitamin D metabolism, particularly the CYP27B1 gene encoding the main enzyme for vitamin D activation. Associations, however, are tenuous in relation to the ethnic background of the studied populations. Intervention trials identify the specific requirements of adequate vitamin D doses to achieve vitamin D sufficiency. Preliminary evidence suggests that doses may need to be individualized in order to achieve target effects due to pharmacogenomic variation. PMID:28425954

  8. Common Variation in the LRRK2 Gene is a Risk Factor for Parkinson’s Disease

    Science.gov (United States)

    Mata, Ignacio F.; Checkoway, Harvey; Hutter, Carolyn M.; Samii, Ali; Roberts, John W.; Kim, Hojoong M.; Agarwal, Pinky; Alvarez, Victoria; Ribacoba, Renee; Pastor, Pau; Lorenzo-Betancor, Oswaldo; Infante, Jon; Sierra, María; Gómez-Garre, Pilar; Mir, Pablo; Ritz, Beate; Rhodes, Shannon L; Colcher, Amy; Van Deerlin, Vivianna; Chung, Kathryn A.; Quinn, Joseph F.; Yearout, Dora; Martinez, Erica; Farin, Federico M.; Wan, Jia Y.; Edwards, Karen L.; Zabetian, Cyrus P.

    2012-01-01

    Background Common variants in the LRRK2 gene influence risk of Parkinson’s disease (PD) in Asians, but whether the same is true in European-derived populations is less clear. Methods We genotyped 66 LRRK2 tagging single nucleotide polymorphisms (SNPs) in 575 PD patients and 689 controls from the Northwestern U.S. (Tier 1). PD-associated SNPs (p<0.05) were then genotyped in an independent sample of 3617 cases and 2512 controls from the U.S. and Spain (Tier 2). Logistic regression was used to model additive SNP genotype effects adjusted for age and sex among white individuals. Results Two regions showed independent association with PD in Tier 1, and SNPs in both regions were successfully replicated in Tier 2 (rs10878226, combined odds ratio [OR], 1.20; 95% confidence interval [CI], 1.08-1.33; p=6.3×10−4; rs11176013, OR, 0.89; CI, 0.83-0.95; p=4.6×10−4). Conclusions Our data suggest that common variation within LRRK2 conveys susceptibility for PD in individuals of European ancestry. PMID:23115130

  9. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Institute of Scientific and Technical Information of China (English)

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  10. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Science.gov (United States)

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments.

  11. Clinical spectrum of mutations in SCN1A gene: severe myoclonic epilepsy in infancy and related epilepsies.

    Science.gov (United States)

    Fujiwara, Tateki

    2006-08-01

    Severe myoclonic epilepsy in infancy (SMEI) manifests very frequent generalized tonic-clonic seizures (GTC), accompanied by myoclonic seizures, absences and partial seizures [Dravet, C., 1978. Les épilepsie grave de l'enfant. Vie Méd. 8, 543-548; Dravet, C., Roger, J., Bureau, M., Dalla Bernardina, B., 1982. Myoclonic epilepsies in childhood. In: Akimoto, H., Kazamatsuri, H., Seino, M., Ward, A. (Eds.), Advances in Epileptology. Raven Press, New York, pp. 135-140; Dravet, C., Bureau, M., Oguni, H., Fukuyama, Y., Cokar, O., 2002. Severe myoclonic epilepsy of infancy (Dravet syndrome). In: Roger, J., Bureau, M., Dravet, C., Genton, P., Tassinari, C.A., Wolf, P. (Eds.), Epileptic Syndromes in Infancy, Childhood and Adolescence, third ed. John Libbey, London, pp. 81-103]. However, there is a group of severe epilepsy that has many characteristics common to SMEI except for myoclonic seizures. We reported this group of epilepsy as intractable childhood epilepsy with GTC (ICEGTC) [Watanabe, M., Fujiwara, T., Yagi, K., Seino, M., Higashi, T., 1989b. Intractable childhood epilepsy with generalized tonic-clonic seizures. J. Jpn. Epil. Soc. 7, 96-105 (in Japanese); Fujiwara, T., Watanabe, M., Takahashi, Y., Higashi, T., Yagi, K., Seino, M., 1992. Long-term course of childhood epilepsy with intractable grand mal seizures. Jpn. J. Psychiatr. Neurol. 46, 297-302]. Recently, mutations of the neuronal voltage-gated sodium channel alphasubunit type 1 gene (SCN1A) have been found in SMEI [Claes, L., Del-Favero, J., Ceulemans, B., Lagae, L., Van Broeckhoven, C., De Jonghe, P., 2001, De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy. Am. J. Hum. Genet. 68, 327-1332]. Mutations in SCN1A are found in both SMEI and ICEGTC at high rates of 70-81%. The loci of the mutations seen in ICEGTC are quite similar to those found in SMEI, suggesting a genotypic continuity between these entities. The clinical spectrum of epilepsies harboring SCN1A

  12. Tissue Specificity and Sex-Specific Regulatory Variation Permit the Evolution of Sex-Biased Gene Expression.

    Science.gov (United States)

    Dean, Rebecca; Mank, Judith E

    2016-09-01

    Genetic correlations between males and females are often thought to constrain the evolution of sexual dimorphism. However, sexually dimorphic traits and the underlying sexually dimorphic gene expression patterns are often rapidly evolving. We explore this apparent paradox by measuring the genetic correlation in gene expression between males and females (Cmf) across broad evolutionary timescales, using two RNA-sequencing data sets spanning multiple populations and multiple species. We find that unbiased genes have higher Cmf than sex-biased genes, consistent with intersexual genetic correlations constraining the evolution of sexual dimorphism. However, we found that highly sex-biased genes (both male and female biased) also had higher tissue specificity, and unbiased genes had greater expression breadth, suggesting that pleiotropy may constrain the breakdown of intersexual genetic correlations. Finally, we show that genes with high Cmf showed some degree of sex-specific changes in gene expression in males and females. Together, our results suggest that genetic correlations between males and females may be less important in constraining the evolution of sex-biased gene expression than pleiotropy. Sex-specific regulatory variation and tissue specificity may resolve the paradox of widespread sex bias within a largely shared genome.

  13. High Prevalence of Extended-Spectrum β-Lactamase, Plasmid-Mediated AmpC, and Carbapenemase Genes in Pet Food

    Science.gov (United States)

    Seiffert, Salome N.; Carattoli, Alessandra; Tinguely, Regula; Lupo, Agnese; Perreten, Vincent

    2014-01-01

    We evaluated the pet food contained in 30 packages as a potential origin of extended-spectrum cephalosporin-resistant Gram-negative organisms and β-lactamase genes (bla). Live bacteria were not detected by selective culture. However, PCR investigations on food DNA extracts indicated that samples harbored the blaCTX-M-15 (53.3%), blaCMY-4 (20%), and blaVEB-4-like (6.7%) genes. Particularly worrisome was the presence of blaOXA-48-like carbapenemases (13.3%). The original pet food ingredients and/or the production processes were highly contaminated with bacteria carrying clinically relevant acquired bla genes. PMID:25092703

  14. Association of the Extended-Spectrum β-Lactamase Gene blaTLA-1 with a Novel ISCR Element, ISCR20▿

    Science.gov (United States)

    Berçot, Beatrice; Poirel, Laurent; Silva-Sanchez, Jesus; Nordmann, Patrice

    2010-01-01

    The blaTLA-1 gene encoding an extended-spectrum β-lactamase was identified in 11 enterobacterial isolates from Mexico City, Mexico. This gene was located on different plasmids and plasmid types with different sizes and incompatibility groups. It was associated with a novel insertion sequence, ISCR20, encoding a putative transposase that shared only 20% amino acid identity with the most closely related transposase of ISCR1. The ISCR20 element provided specific promoter sequences for expression of the blaTLA-1 gene. PMID:20585120

  15. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Directory of Open Access Journals (Sweden)

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  16. A molecular footprint of limb loss: sequence variation of the autopodial identity gene Hoxa-13.

    Science.gov (United States)

    Kohlsdorf, Tiana; Cummings, Michael P; Lynch, Vincent J; Stopper, Geffrey F; Takahashi, Kazuhiko; Wagner, Günter P

    2008-12-01

    The homeobox gene Hoxa-13 codes for a transcription factor involved in multiple functions, including body axis and hand/foot development in tetrapods. In this study we investigate whether the loss of one function (e.g., limb loss in snakes) left a molecular footprint in exon 1 of Hoxa-13 that could be associated with the release of functional constraints caused by limb loss. Fragments of the Hoxa-13 exon 1 were sequenced from 13 species and analyzed, with additional published sequences of the same region, using relative rates and likelihood-ratio tests. Five amino acid sites in exon 1 of Hoxa-13 were detected as evolving under positive selection in the stem lineage of snakes. To further investigate whether there is an association between limb loss and sequence variation in Hoxa-13, we used the random forest method on an alignment that included shark, basal fish lineages, and "eu-tetrapods" such as mammals, turtle, alligator, and birds. The random forest method approaches the problem as one of classification, where we seek to predict the presence or absence of autopodium based on amino acid variation in Hoxa-13 sequences. Different alignments tested were associated with similar error rates (18.42%). The random forest method suggested that phenotypic states (autopodium present and absent) can often be correctly predicted based on Hoxa-13 sequences. Basal, nontetrapod gnat-hostomes that never had an autopodium were consistently classified as limbless together with the snakes, while eu-tetrapods without any history of limb loss in their phylogeny were also consistently classified as having a limb. Misclassifications affected mostly lizards, which, as a group, have a history of limb loss and limb re-evolution, and the urodele and caecilian in our sample. We conclude that a molecular footprint can be detected in Hoxa-13 that is associated with the lack of an autopodium; groups with classification ambiguity (lizards) are characterized by a history of repeated limb loss

  17. Genetic Variation in the HSD17B1 Gene and Risk of Prostate Cancer

    Science.gov (United States)

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Marchand, Loic Le; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-01-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17β-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Δ5-androsterone-3β,17β-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup analyses

  18. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  19. Positive effects of methylphenidate on hyperactivity are moderated by monoaminergic gene variants in children with autism spectrum disorders.

    Science.gov (United States)

    McCracken, J T; Badashova, K K; Posey, D J; Aman, M G; Scahill, L; Tierney, E; Arnold, L E; Vitiello, B; Whelan, F; Chuang, S Z; Davies, M; Shah, B; McDougle, C J; Nurmi, E L

    2014-06-01

    Methylphenidate (MPH) reduces hyperactive-impulsive symptoms common in children with autism spectrum disorders (ASDs), however, response and tolerability varies widely. We hypothesized monoaminergic gene variants may moderate MPH effects in ASD, as in typically developing children with attention-deficit/hyperactivity disorder. Genotype data were available for 64 children with ASD and hyperactivity who were exposed to MPH during a 1-week safety/tolerability lead-in phase and 58 who went on to be randomized to placebo and three doses of MPH during a 4-week blinded, crossover study. Outcome measures included the Clinical Global Impression-Improvement (CGI-I) scale and the Aberrant Behavior Checklist (ABC-hyperactivity index). A total of 14 subjects discontinued the study because of MPH side effects. Subjects were genotyped for variants in DRD1-DRD5, ADRA2A, SLC6A3, SLC6A4, MAOA and MAOB, and COMT. Forty-nine percent of the sample met positive responder criteria. In this modest but relatively homogeneous sample, significant differences by DRD1 (P=0.006), ADRA2A (P<0.02), COMT (P<0.04), DRD3 (P<0.05), DRD4 (P<0.05), SLC6A3 (P<0.05) and SLC6A4 (P<0.05) genotypes were found for responders versus non-responders. Variants in DRD2 (P<0.001) and DRD3 (P<0.04) were associated with tolerability in the 14 subjects who discontinued the trial. For this first MPH pharmacogenetic study in children with ASD, multiple monoaminergic gene variants may help explain individual differences in MPH's efficacy and tolerability.

  20. Association Analysis of Noncoding Variants in Neuroligins 3 and 4X Genes with Autism Spectrum Disorder in an Italian Cohort

    Directory of Open Access Journals (Sweden)

    Martina Landini

    2016-10-01

    Full Text Available Since involved in synaptic transmission and located on X-chromosome, neuroligins 3 and 4X have been studied as good positional and functional candidate genes for autism spectrum disorder pathogenesis, although contradictory results have been reported. Here, we performed a case-control study to assess the association between noncoding genetic variants in NLGN3 and NLGN4X genes and autism, in an Italian cohort of 202 autistic children analyzed by high-resolution melting. The results were first compared with data from 379 European healthy controls (1000 Genomes Project and then with those from 1061 Italian controls genotyped by Illumina single nucleotide polymorphism (SNP array 1M-duo. Statistical evaluations were performed using Plink v1.07, with the Omnibus multiple loci approach. According to both the European and the Italian control groups, a 6-marker haplotype on NLGN4X (rs6638575(G, rs3810688(T, rs3810687(G, rs3810686(C, rs5916269(G, rs1882260(T was associated with autism (odd ratio = 3.58, p-value = 2.58 × 10−6 for the European controls; odds ratio = 2.42, p-value = 6.33 × 10−3 for the Italian controls. Furthermore, several haplotype blocks at 5-, 4-, 3-, and 2-, including the first 5, 4, 3, and 2 SNPs, respectively, showed a similar association with autism. We provide evidence that noncoding polymorphisms on NLGN4X may be associated to autism, suggesting the key role of NLGN4X in autism pathophysiology and in its male prevalence.

  1. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Directory of Open Access Journals (Sweden)

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  2. Colony-level behavioral variation correlates with differences in expression of the foraging gene in red imported fire ants.

    Science.gov (United States)

    Bockoven, Alison A; Coates, Craig J; Eubanks, Micky D

    2017-09-13

    Among social insects, colony-level variation is likely to be widespread and have significant ecological consequences. Very few studies, however, have documented how genetic factors relate to behavior at the colony level. Differences in expression of the foraging gene have been associated with differences in foraging and activity of a wide variety of organisms. We quantified expression of the red imported fire ant foraging gene (sifor) in workers from 21 colonies collected across the natural range of Texas fire ant populations, but maintained under standardized, environmentally controlled conditions. Colonies varied significantly in their behavior. The most active colonies had up to 10 times more active foragers than the least active colony and more than 16 times as many workers outside the nest. Expression differences among colonies correlated with this colony-level behavioral variation. Colonies with higher sifor expression in foragers had, on average, significantly higher foraging activity, exploratory activity, and recruitment to nectar than colonies with lower expression. Expression of sifor was also strongly correlated with worker task (foraging versus working in the interior of the nest). These results provide insight into the genetic and physiological processes underlying collective differences in social behavior. Quantifying variation in expression of the foraging gene may provide an important tool for understanding and predicting the ecological consequences of colony-level behavioral variation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Variations and classification of toxic epitopes related to celiac disease among α-gliadin genes from four Aegilops genomes.

    Science.gov (United States)

    Li, Jie; Wang, Shunli; Li, Shanshan; Ge, Pei; Li, Xiaohui; Ma, Wujun; Zeller, F J; Hsam, Sai L K; Yan, Yueming

    2012-07-01

    The α-gliadins are associated with human celiac disease. A total of 23 noninterrupted full open reading frame α-gliadin genes and 19 pseudogenes were cloned and sequenced from C, M, N, and U genomes of four diploid Aegilops species. Sequence comparison of α-gliadin genes from Aegilops and Triticum species demonstrated an existence of extensive allelic variations in Gli-2 loci of the four Aegilops genomes. Specific structural features were found including the compositions and variations of two polyglutamine domains (QI and QII) and four T cell stimulatory toxic epitopes. The mean numbers of glutamine residues in the QI domain in C and N genomes and the QII domain in C, N, and U genomes were much higher than those in Triticum genomes, and the QI domain in C and N genomes and the QII domain in C, M, N, and U genomes displayed greater length variations. Interestingly, the types and numbers of four T cell stimulatory toxic epitopes in α-gliadins from the four Aegilops genomes were significantly less than those from Triticum A, B, D, and their progenitor genomes. Relationships between the structural variations of the two polyglutamine domains and the distributions of four T cell stimulatory toxic epitopes were found, resulting in the α-gliadin genes from the Aegilops and Triticum genomes to be classified into three groups.

  4. Accurately assessing the risk of schizophrenia conferred by rare copy-number variation affecting genes with brain function.

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M; McCarroll, Steven A; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J

    2010-09-09

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied "pathway" analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package.

  5. Accurately Assessing the Risk of Schizophrenia Conferred by Rare Copy-Number Variation Affecting Genes with Brain Function

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M.; McCarroll, Steven A.; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J.

    2010-01-01

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied “pathway” analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package

  6. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for v

  7. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for

  8. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob;

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups fo...

  9. Coexistence of trichome variation in a natural plant population: a combined study using ecological and candidate gene approaches.

    Directory of Open Access Journals (Sweden)

    Tetsuhiro Kawagoe

    Full Text Available The coexistence of distinct phenotypes within populations has long been investigated in evolutionary ecology. Recent studies have identified the genetic basis of distinct phenotypes, but it is poorly understood how the variation in candidate loci is maintained in natural environments. In this study, we examined fitness consequences and genetic basis of variation in trichome production in a natural population of Arabidopsis halleri subsp. gemmifera. Half of the individuals in the study population produced trichomes while the other half were glabrous, and the leaf beetle Phaedon brassicae imposed intensive damage to both phenotypes. The fitness of hairy and glabrous plants showed no significant differences in the field during two years. A similar result was obtained when sibling hairy and glabrous plants were transplanted at the same field site, whereas a fitness cost of trichome production was detected under a weak herbivory condition. Thus, equivalent fitness of hairy and glabrous plants under natural herbivory allows their coexistence in the contemporary population. The pattern of polymorphism of the candidate trichome gene GLABROUS1 (GL1 showed no evidence of long-term maintenance of trichome variation within the population. Although balancing selection under fluctuating biotic environments is often proposed to explain the maintenance of defense variation, the lack of clear evidence of balancing selection in the study population suggests that other factors such as gene flow and neutral process may have played relatively large roles in shaping trichome variation at least for the single population level.

  10. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  11. Natural variations in expression of regulatory and detoxification related genes under limiting phosphate and arsenate stress in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Tapsi eShukla

    2015-10-01

    Full Text Available Abiotic stress including nutrient deficiency and heavy metal toxicity severely affects plant growth, development, and productivity. Genetic variations within and in between species are one of the important factors in establishing interactions and responses of plants with the environment. In the recent past, natural variations in Arabidopsis thaliana have been used to understand plant development and response towards different stresses at genetic level. Phosphorus (Pi deficiency negatively affects plant growth and metabolism and modulates expression of the genes involved in Pi homeostasis. Arsenate, As(V, a chemical analogue of Pi, is taken up by the plants via phosphate transport system. Studies suggest that during Pi deficiency, enhanced As(V uptake leads to increased toxicity in plants. Here, the natural variations in Arabidopsis have been utilized to study the As(V stress response under limiting Pi condition. The primary root length was compared to identify differential response of three Arabidopsis accessions (Col-0, Sij-1 and Slavi-1 under limiting Pi and As(V stress. To study the molecular mechanisms responsible for the differential response, comprehensive expression profiling of the genes involved in uptake, detoxification and regulatory mechanisms was carried out. Analysis suggests genetic variation-dependent regulatory mechanisms may affect differential response of Arabidopsis natural variants towards As(V stress under limiting Pi condition. Therefore, it is hypothesized that detailed analysis of the natural variations under multiple stress conditions might help in the better understanding of the biological processes involved in stress tolerance and adaptation.

  12. Variation in Maturity-Onset Diabetes of the Young Genes Influence Response to Interventions for Diabetes Prevention.

    Science.gov (United States)

    Billings, Liana K; Jablonski, Kathleen A; Warner, A Sofia; Cheng, Yu-Chien; McAteer, Jarred B; Tipton, Laura; Shuldiner, Alan R; Ehrmann, David A; Manning, Alisa K; Dabelea, Dana; Franks, Paul W; Kahn, Steven E; Pollin, Toni I; Knowler, William C; Altshuler, David; Florez, Jose C

    2017-08-01

    Variation in genes that cause maturity-onset diabetes of the young (MODY) has been associated with diabetes incidence and glycemic traits. This study aimed to determine whether genetic variation in MODY genes leads to differential responses to insulin-sensitizing interventions. This was a secondary analysis of a multicenter, randomized clinical trial, the Diabetes Prevention Program (DPP), involving 27 US academic institutions. We genotyped 22 missense and 221 common variants in the MODY-causing genes in the participants in the DPP. The study included 2806 genotyped DPP participants randomized to receive intensive lifestyle intervention (n = 935), metformin (n = 927), or placebo (n = 944). Association of MODY genetic variants with diabetes incidence at a median of 3 years and measures of 1-year β-cell function, insulinogenic index, and oral disposition index. Analyses were stratified by treatment group for significant single-nucleotide polymorphism × treatment interaction (Pint < 0.05). Sequence kernel association tests examined the association between an aggregate of rare missense variants and insulinogenic traits. After 1 year, the minor allele of rs3212185 (HNF4A) was associated with improved β-cell function in the metformin and lifestyle groups but not the placebo group; the minor allele of rs6719578 (NEUROD1) was associated with an increase in insulin secretion in the metformin group but not in the placebo and lifestyle groups. These results provide evidence that genetic variation among MODY genes may influence response to insulin-sensitizing interventions.

  13. Variation in the X-linked EFHC2 gene is associated with social cognitive abilities in males.

    Science.gov (United States)

    Startin, Carla M; Fiorentini, Chiara; de Haan, Michelle; Skuse, David H

    2015-01-01

    Females outperform males on many social cognitive tasks. X-linked genes may contribute to this sex difference. Males possess one X chromosome, while females possess two X chromosomes. Functional variations in X-linked genes are therefore likely to impact more on males than females. Previous studies of X-monosomic women with Turner syndrome suggest a genetic association with facial fear recognition abilities at Xp11.3, specifically at a single nucleotide polymorphism (SNP rs7055196) within the EFHC2 gene. Based on a strong hypothesis, we investigated an association between variation at SNP rs7055196 and facial fear recognition and theory of mind abilities in males. As predicted, males possessing the G allele had significantly poorer facial fear detection accuracy and theory of mind abilities than males possessing the A allele (with SNP variant accounting for up to 4.6% of variance). Variation in the X-linked EFHC2 gene at SNP rs7055196 is therefore associated with social cognitive abilities in males.

  14. BGMUT: NCBI dbRBC database of allelic variations of genes encoding antigens of blood group systems.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Helmberg, Wolfgang; Blumenfeld, Olga O

    2012-01-01

    Analogous to human leukocyte antigens, blood group antigens are surface markers on the erythrocyte cell membrane whose structures differ among individuals and which can be serologically identified. The Blood Group Antigen Gene Mutation Database (BGMUT) is an online repository of allelic variations in genes that determine the antigens of various human blood group systems. The database is manually curated with allelic information collated from scientific literature and from direct submissions from research laboratories. Currently, the database documents sequence variations of a total of 1251 alleles of all 40 gene loci that together are known to affect antigens of 30 human blood group systems. When available, information on the geographic or ethnic prevalence of an allele is also provided. The BGMUT website also has general information on the human blood group systems and the genes responsible for them. BGMUT is a part of the dbRBC resource of the National Center for Biotechnology Information, USA, and is available online at http://www.ncbi.nlm.nih.gov/projects/gv/rbc/xslcgi.fcgi?cmd=bgmut. The database should be of use to members of the transfusion medicine community, those interested in studies of genetic variation and related topics such as human migrations, and students as well as members of the general public.

  15. Population-based resequencing of APOA1 in 10,330 individuals: spectrum of genetic variation, phenotype, and comparison with extreme phenotype approach.

    Science.gov (United States)

    Haase, Christiane L; Frikke-Schmidt, Ruth; Nordestgaard, Børge G; Tybjærg-Hansen, Anne

    2012-01-01

    Rare genetic variants, identified by in-detail resequencing of loci, may contribute to complex traits. We used the apolipoprotein A-I gene (APOA1), a major high-density lipoprotein (HDL) gene, and population-based resequencing to determine the spectrum of genetic variants, the phenotypic characteristics of these variants, and how these results compared with results based on resequencing only the extremes of the apolipoprotein A-I (apoA-I) distribution. First, we resequenced APOA1 in 10,330 population-based participants in the Copenhagen City Heart Study. The spectrum and distribution of genetic variants was determined as a function of the number of individuals resequenced. Second, apoA-I and HDL cholesterol phenotypes were determined for nonsynonymous (NS) and synonymous (S) variants and were validated in the Copenhagen General Population Study (n = 45,239). Third, observed phenotypes were compared with those predicted using an extreme phenotype approach based on the apoA-I distribution. Our results are as follows: First, population-based resequencing of APOA1 identified 40 variants of which only 7 (18%) had minor allele frequencies >1%, and most were exceedingly rare. Second, 0.27% of individuals in the general population were heterozygous for NS variants which were associated with substantial reductions in apoA-I (up to 39 mg/dL) and/or HDL cholesterol (up to 0.9 mmol/L) and, surprisingly, 0.41% were heterozygous for variants predisposing to amyloidosis. NS variants associated with a hazard ratio of 1.72 (1.09-2.70) for myocardial infarction (MI), largely driven by A164S, a variant not associated with apoA-I or HDL cholesterol levels. Third, using the extreme apoA-I phenotype approach, NS variants correctly predicted the apoA-I phenotype observed in the population-based resequencing. However, using the extreme approach, between 79% (screening 0-1(st) percentile) and 21% (screening 0-20(th) percentile) of all variants were not identified; among these were variants

  16. Genetic variation within the interleukin-1 gene cluster and ischemic stroke.

    Science.gov (United States)

    Olsson, Sandra; Holmegaard, Lukas; Jood, Katarina; Sjögren, Marketa; Engström, Gunnar; Lövkvist, Håkan; Blomstrand, Christian; Norrving, Bo; Melander, Olle; Lindgren, Arne; Jern, Christina

    2012-09-01

    Evidence is emerging that inflammation plays a key role in the pathophysiology of ischemic stroke (IS). The aim of this study was to investigate whether genetic variation in the interleukin-1α, interleukin-1β, and interleukin-1 receptor antagonist genes (IL1A, IL1B, and IL1RN) is associated with IS and/or any etiologic subtype of IS. Twelve tagSNPs were analyzed in the Sahlgrenska Academy Study on Ischemic Stroke (SAHLSIS), which comprises 844 patients with IS and 668 control subjects. IS subtypes were defined according to the Trial of Org 10172 in Acute Stroke Treatment criteria in SAHLSIS. The Lund Stroke Register and the Malmö Diet and Cancer study were used as a replication sample for overall IS (in total 3145 patients and 1793 control subjects). The single nucleotide polymorphism rs380092 in IL1RN showed an association with overall IS in SAHLSIS (OR, 1.21; 95% CI, 1.02-1.43; P=0.03), which was replicated in the Lund Stroke Register and the Malmö Diet and Cancer study sample. An association was also detected in all samples combined (OR, 1.12; 95% CI, 1.04-1.21; P=0.03). Three single nucleotide polymorphisms in IL1RN (including rs380092) were nominally associated with the subtype of cryptogenic stroke in SAHLSIS, but the statistical significance did not remain after correction for multiple testing. Furthermore, increased plasma levels of interleukin-1 receptor antagonist were observed in the subtype of cryptogenic stroke compared with controls. This comprehensive study, based on a tagSNP approach and replication, presents support for the role of IL1RN in overall IS.

  17. Mutations in MAPT gene cause chromosome instability and introduce copy number variations widely in the genome.

    Science.gov (United States)

    Rossi, Giacomina; Conconi, Donatella; Panzeri, Elena; Redaelli, Serena; Piccoli, Elena; Paoletta, Laura; Dalprà, Leda; Tagliavini, Fabrizio

    2013-01-01

    In addition to the main function of promoting polymerization and stabilization of microtubules, other roles are being attributed to tau, now considered a multifunctional protein. In particular, previous studies suggest that tau is involved in chromosome stability and genome protection. We performed cytogenetic analysis, including molecular karyotyping, on lymphocytes and fibroblasts from patients affected by frontotemporal lobar degeneration carrying different mutations in the microtubule-associated protein tau gene, to investigate the effects of these mutations on genome stability. Furthermore, we analyzed the response of mutated lymphoblastoid cell lines to genotoxic agents to evaluate the participation of tau to DNA repair systems. We found a significantly higher level of chromosome aberrations in mutated than in control cells. Mutated lymphocytes showed higher percentages of stable lesions, clonal and total aneuploidy (medians: 2 versus 0, p $\\ll$ 0.01; 1.5 versus 0, p $\\ll$ 0.01; 16.5 versus 0, p $\\ll$ 0.01, respectively). Fibroblasts of patients showed higher percentages of stable lesions, structural aberrations and total aneuploidy (medians: 0 versus 0, p = 0.03; 5.8 versus 0, p = 0.02; 26.5 versus 12.6, p $\\ll$ 0.01, respectively). In addition, the in depth analysis of DNA copy number variations showed a higher tendency to non-allelic homologous recombination in mutated cells. Finally, while our analysis did not support an involvement of tau in DNA repair systems, it revealed its role in stabilization of chromatin. In summary, our findings indicate a role of tau in genome and chromosome stability that can be ascribed to its function as a microtubule-associated protein as well as a protein protecting chromatin integrity through interaction with DNA.

  18. Genetic variation of maturity groups and four E genes in the Chinese soybean mini core collection

    Science.gov (United States)

    Huang, Xinyang; Zhou, Jing; Zeng, Haiyan; Sun, Shi; Jia, Hongchang; Li, Wenbin; Zhou, Xinan; Li, Suzhen; Chen, Pengyin; Wu, Cunxiang; Guo, Yong; Han, Tianfu; Qiu, Lijuan

    2017-01-01

    The mini core collection (MCC) has been established by streamlining core collection (CC) chosen from China National Genebank including 23,587 soybean (Glycine max) accessions by morphological traits and simple sequence repeat (SSR) markers. Few studies have been focused on the maturity that has been considered as one of the most critical traits for the determination of the adaptation-growing region of the soybean. In the current study, two hundred and ninty-nine accessions of MCC planted for two years at four locations namely in Heihe, Harbin, Jining and Wuhan cities in China were used to assess the variation of maturity in MCC and identify the integrated effect of 4 E loci on flowering and maturity time in soybean. Forty-two North American varieties served as references of maturity groups (MG). Each accession in MCC was classified by comparing with the MG references in the days from VE (emergence) and physiological maturity (R7). The results showed that MCC covered a large range of MGs from MG000 to MGIX/X. Original locations and sowing types were revealed as the major affecting factors for maturity groups of the MCC accessions. The ratio of the reproductive period to the vegetative period (R/V) varied among MCC accessions. Genotyping of 4 maturity genes (i.e. E1, E2, E3 and E4) in 228 accessions indicated that recessive alleles e1, e2, e3 and e4 promoted earlier flowering and shortened the maturity time with different effects, while the dominate alleles were always detected in accessions with longer maturity. The allelic combinations determined the diversification of soybean maturity groups and adaptation to different regions. Our results indicated that the maturity of Chinese soybean MCC showed genetic diversities in phenotype and genotype, which provided information for further MG classification, geographic adaptation analysis of Chinese soybean cultivars, as well as developing new soybean varieties with adaptation to specific regions. PMID:28207889

  19. Differential stress responses among newly received calves: variations in reductant capacity and Hsp gene expression.

    Science.gov (United States)

    Eitam, Harel; Vaya, Jacob; Brosh, Arieh; Orlov, Ala; Khatib, Soliman; Izhaki, Ido; Shabtay, Ariel

    2010-11-01

    Bovine respiratory disease complex (BRD), a major economic concern to the beef cattle industry all over the world, is triggered by physical, biological and psychological stresses. It is becoming noticeable that the key to reducing BRD appears to be centered at reducing the response to stress. The aims of the present study were to detect individual variations in the stress response of newly received young calves through their leukocyte heat shock protein (Hsp) response, selected neutrophil-related gene expression and oxidative stress, and relate them to pulmonary adhesions at slaughter, an indicative sign of clinical and subclinical episodes of BRD at an early age. Differential expression patterns of Hsp60 and Hsp70A1A were revealed in newly received calves 1 h, 5 h and 1 day after arrival, distinguishing between stress-responsive and non-stress-responsive individuals. Plasma cortisol was also indicative of stress-responsive and non-stress-responsive individuals, 1 h and 5 h after arrival. At the longer term, β-glycan levels were highest 7 days after arrival and significantly correlated with an adhesion-free phenotype at slaughter. Oxidative stress responses, measured through the oxidation products of the exogenous linoleoyl tyrosine (LT) marker, revealed that hydroperoxidation and epoxidation of membranes may readily occur. Based on the LT oxidation products and levels of β-glycan, we present a discriminant analysis model, according to which vulnerable individuals may be predicted at near 100% probability 7 days after arrival. Since clinical signs of BRD may often go undetected in feedlot calves, such a model, after its examination in large-scale experiments, may be a reliable tool for an early prediction of subclinical signs of BRD.

  20. Transcription factor ATF-3 regulates allele variation phenotypes of the human SLC11A1 gene.

    Science.gov (United States)

    Taka, Styliani; Gazouli, Maria; Politis, Panagotis K; Pappa, Kalliopi I; Anagnou, Nicholas P

    2013-03-01

    Genetic polymorphisms in the human solute carrier family 11 member 1 (SLC11A1) gene predispose to susceptibility to infectious/inflammatory diseases and cancer. Human susceptibility to these diseases exhibits allelic association with a polymorphic regulatory Z-DNA-forming microsatellite of a (GT/AC)n repeat. The carriage of different alleles may influence chromatin remodeling and accessibility by transcription factors. Of particular importance is the binding site for the Activating Protein 1 (AP-1) elements, (ATF-3 and c-Jun), adjacent to the 5' sequence of the Z-DNA-forming polymorphism. The aim of the study was to characterize the transcriptional mechanisms controlling different alleles of SLC11A1 expression by ATF-3 and c-Jun. Allele 2, [T(GT)5AC(GT)5AC(GT)10GGCAGA(G)6], and Allele 3, [T(GT)5AC(GT)5AC(GT)9GGCAGA(G)6], were subcloned into the PGL2Basic vector. Transient transfections of THP-1 cells with the constructs, in the presence or absence of pATF-3 were preformed. Luciferase expression was determined. To document the recruitment of ATF-3 and c-Jun, to the polymorphic promoter alleles in vivo, we performed ChIP assays with transient transfected THP-1 cells treated with or without lipopolyssacharides. Our data documented that ATF-3 suppresses the transcriptional activation of Allele-3, and this suppression is enhanced in the presence of lipopolyssacharides. Our findings suggest that ATF-3 and c-Jun may influence heritable variation in SLC11A1-dependent innate resistance to infection and inflammation both within and between populations.

  1. Molecular variation and evolution of the tyrosine kinase domains of insulin receptor IRa and IRb genes in Cyprinidae.

    Science.gov (United States)

    Kong, XiangHui; Wang, XuZhen; He, ShunPing

    2011-07-01

    The insulin receptor (IR) gene plays an important role in regulating cell growth, differentiation and development. In the present study, DNA sequences of insulin receptor genes, IRa and IRb, were amplified and sequenced from 37 representative species of the Cyprinidae and from five outgroup species from non-cyprinid Cypriniformes. Based on coding sequences (CDS) of tyrosine kinase regions of IRa and IRb, molecular evolution and phylogenetic relationships were analyzed to better understand the characteristics of IR gene divergence in the family Cyprinidae. IRa and IRb were clustered into one lineage in the gene tree of the IR gene family, reconstructed using the unweighted pair group method with arithmetic mean (UPGMA). IRa and IRb have evolved into distinct genes after IR gene duplication in Cyprinidae. For each gene, molecular evolution analyses showed that there was no significant difference among different groups in the reconstructed maximum parsimony (MP) tree of Cyprinidae; IRa and IRb have been subjected to similar evolutionary pressure among different lineages. Although the amino acid sequences of IRa and IRb tyrosine kinase regions were highly conserved, our analyses showed that there were clear sequence variations between the tyrosine kinase regions of IRa and IRb proteins. This indicates that IRa and IRb proteins might play different roles in the insulin signaling pathway.

  2. Genome-wide identification of transcriptional targets of RORA reveals direct regulation of multiple genes associated with autism spectrum disorder.

    Science.gov (United States)

    Sarachana, Tewarit; Hu, Valerie W