WorldWideScience

Sample records for gene variant slc30a8

  1. Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

    Directory of Open Access Journals (Sweden)

    Hemant Kulkarni

    2016-01-01

    Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

  2. Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

    OpenAIRE

    Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

    2014-01-01

    Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

  3. Relationship between ZnT8Ab, the SLC30A8 gene and disease progression in children with newly diagnosed type 1 diabetes

    DEFF Research Database (Denmark)

    Nielsen, L. B.; Vaziri-Sani, F.; Porksen, S.

    2011-01-01

    Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact......8 gene is associated with preserved beta-cell function in type 1 diabetes patients. The genetic determination of the rs13266634 variant on the ZnT8Ab specificity is sustained the first 12 months after the diagnosis of type 1 diabetes in a pediatric cohort....

  4. Relationship between ZnT8Ab, the SLC30A8 gene and disease progression in children with newly diagnosed type 1 diabetes

    DEFF Research Database (Denmark)

    Nielsen, Lotte B; Vaziri-Sani, Fariba; Pörksen, Sven

    2011-01-01

    Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact...

  5. Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

    Science.gov (United States)

    Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

    2014-04-01

    Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

  6. Zinc-Associated Variant in SLC30A8 Gene Interacts With Gestational Weight Gain on Postpartum Glycemic Changes: A Longitudinal Study in Women With Prior Gestational Diabetes Mellitus.

    Science.gov (United States)

    Wang, Tiange; Liu, Huikun; Wang, Leishen; Huang, Tao; Li, Weiqin; Zheng, Yan; Heianza, Yoriko; Sun, Dianjianyi; Leng, Junhong; Zhang, Shuang; Li, Nan; Hu, Gang; Qi, Lu

    2016-12-01

    Zinc transporter 8 genetic variant SLC30A8 has been associated with postpartum risk of type 2 diabetes among women with gestational diabetes mellitus (GDM). Gestational weight gain is one of the strongest risk factors for postpartum hyperglycemia. We assessed the interaction between type 2 diabetes-associated SLC30A8 rs13266634 and gestational weight gain on 1-5 years of postpartum glycemic changes in 1,071 women with prior GDM in a longitudinal study. Compared with gestation of 26-30 weeks, postpartum levels of fasting glucose, oral glucose tolerance test 2-h glucose, and hemoglobin A 1c (HbA 1c ) increased across rs13266634 TT, CT, and CC genotypes in women with excessive gestational weight gain, whereas opposite genetic associations were found in women with inadequate or adequate gestational weight gain. Postpartum changes in fasting glucose per additional copy of the C allele were -0.18, -0.04, and 0.12 mmol/L in women with inadequate, adequate, and excessive gestational weight gain, respectively (P for interaction = 0.002). We also found similar interactions for changes in 2-h glucose and HbA 1c (P for interaction = 0.003 and 0.005, respectively). Our data indicate that gestational weight gain may modify SLC30A8 variant on long-term glycemic changes, highlighting the importance of gestational weight control in the prevention of postpartum hyperglycemia in women with GDM. © 2016 by the American Diabetes Association.

  7. Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

    Science.gov (United States)

    DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

    2015-07-10

    Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  8. Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

  9. Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    M. Vignesh

    2016-11-01

    Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.

  10. A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

    Science.gov (United States)

    Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

    2017-01-01

    Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  11. Three-dimensional structure of β-cell-specific zinc transporter, ZnT-8, predicted from the type 2 diabetes-associated gene variant SLC30A8 R325W

    Directory of Open Access Journals (Sweden)

    Weijers Rob NM

    2010-06-01

    to the correct sites in the pancreatic islet cells and are consistent with the observation that the SLC30A8 gene variant R325W has a low predicted value for future type 2 diabetes at population-based level.

  12. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  13. Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.

    Science.gov (United States)

    Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel

    2013-12-05

    Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  15. SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

    Science.gov (United States)

    Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

    2015-12-03

    SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  16. SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

    Directory of Open Access Journals (Sweden)

    Hassan Brim

    Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

  17. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  18. Autosomal-Recessive Intellectual Disability with Cerebellar Atrophy Syndrome Caused by Mutation of the Manganese and Zinc Transporter Gene SLC39A8

    Science.gov (United States)

    Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami

    2015-01-01

    Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978

  19. Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.

    Science.gov (United States)

    Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K

    2018-04-11

    To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  20. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  1. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  2. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  3. A customized pigmentation SNP array identifies a novel SNP associated with melanoma predisposition in the SLC45A2 gene.

    Directory of Open Access Journals (Sweden)

    Maider Ibarrola-Villava

    Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.

  4. SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

    Science.gov (United States)

    Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

    2017-07-03

    Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. The common SLC30A8 Arg325Trp variant is associated with reduced first-phase insulin release in 846 non-diabetic offspring of type 2 diabetes patients--the EUGENE2 study

    DEFF Research Database (Denmark)

    Boesgaard, T W; Zilinskaite, J; Vänttinen, M

    2008-01-01

    AIMS/HYPOTHESIS: A recent genome-wide association study identified the SLC30A8 rs13266634 polymorphism encoding an Arg325Trp polymorphism in the zinc transporter protein member 8 (ZnT-8) to be associated with type 2 diabetes. Here, we investigate whether the polymorphism is related to altered ins...

  6. Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

    Science.gov (United States)

    Archer, N S; Nassif, N T; O'Brien, B A

    2015-06-01

    A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

  7. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  8. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  9. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  10. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  11. Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

    Science.gov (United States)

    Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

    2015-01-01

    Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

  12. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI

  13. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  14. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Science.gov (United States)

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  16. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  17. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  18. MC1R gene variants involvement in human OCA phenotype

    OpenAIRE

    Saleha Shamim; Khan Taj Ali; Zafar Shaista

    2016-01-01

    Oculocutaneous albinism (OCA) is a genetic disorder of melanin synthesis that results in hypopigmentation in hair, skin and eyes. OCA has been reported in individuals from all ethnic backgrounds but it is more common among those with Europeans ancestry. OCA is heterogeneous group of disorders and seven types of OCA are caused by mutations in TYR (OCA1), OCA2 (OCA2), TYRP1 (OCA3), SLC45A2 (OCA4), SLC24A5 (OCA6) and C10oRF11 (OCA7) genes. However, MC1R gene variants have been reported that modi...

  19. Treatment of intractable epilepsy in a female with SLC6A8 deficiency

    NARCIS (Netherlands)

    Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.

    2010-01-01

    A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine

  20. Variability of Creatine Metabolism Genes in Children with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Jessie M. Cameron

    2017-07-01

    Full Text Available Creatine deficiency syndrome (CDS comprises three separate enzyme deficiencies with overlapping clinical presentations: arginine:glycine amidinotransferase (GATM gene, glycine amidinotransferase, guanidinoacetate methyltransferase (GAMT gene, and creatine transporter deficiency (SLC6A8 gene, solute carrier family 6 member 8. CDS presents with developmental delays/regression, intellectual disability, speech and language impairment, autistic behaviour, epileptic seizures, treatment-refractory epilepsy, and extrapyramidal movement disorders; symptoms that are also evident in children with autism. The objective of the study was to test the hypothesis that genetic variability in creatine metabolism genes is associated with autism. We sequenced GATM, GAMT and SLC6A8 genes in 166 patients with autism (coding sequence, introns and adjacent untranslated regions. A total of 29, 16 and 25 variants were identified in each gene, respectively. Four variants were novel in GATM, and 5 in SLC6A8 (not present in the 1000 Genomes, Exome Sequencing Project (ESP or Exome Aggregation Consortium (ExAC databases. A single variant in each gene was identified as non-synonymous, and computationally predicted to be potentially damaging. Nine variants in GATM were shown to have a lower minor allele frequency (MAF in the autism population than in the 1000 Genomes database, specifically in the East Asian population (Fisher’s exact test. Two variants also had lower MAFs in the European population. In summary, there were no apparent associations of variants in GAMT and SLC6A8 genes with autism. The data implying there could be a lower association of some specific GATM gene variants with autism is an observation that would need to be corroborated in a larger group of autism patients, and with sub-populations of Asian ethnicities. Overall, our findings suggest that the genetic variability of creatine synthesis/transport is unlikely to play a part in the pathogenesis of autism

  1. Variability of Creatine Metabolism Genes in Children with Autism Spectrum Disorder.

    Science.gov (United States)

    Cameron, Jessie M; Levandovskiy, Valeriy; Roberts, Wendy; Anagnostou, Evdokia; Scherer, Stephen; Loh, Alvin; Schulze, Andreas

    2017-07-31

    Creatine deficiency syndrome (CDS) comprises three separate enzyme deficiencies with overlapping clinical presentations: arginine:glycine amidinotransferase ( GATM gene, glycine amidinotransferase), guanidinoacetate methyltransferase ( GAMT gene), and creatine transporter deficiency ( SLC6A8 gene, solute carrier family 6 member 8). CDS presents with developmental delays/regression, intellectual disability, speech and language impairment, autistic behaviour, epileptic seizures, treatment-refractory epilepsy, and extrapyramidal movement disorders; symptoms that are also evident in children with autism. The objective of the study was to test the hypothesis that genetic variability in creatine metabolism genes is associated with autism. We sequenced GATM , GAMT and SLC6A8 genes in 166 patients with autism (coding sequence, introns and adjacent untranslated regions). A total of 29, 16 and 25 variants were identified in each gene, respectively. Four variants were novel in GATM , and 5 in SLC6A8 (not present in the 1000 Genomes, Exome Sequencing Project (ESP) or Exome Aggregation Consortium (ExAC) databases). A single variant in each gene was identified as non-synonymous, and computationally predicted to be potentially damaging. Nine variants in GATM were shown to have a lower minor allele frequency (MAF) in the autism population than in the 1000 Genomes database, specifically in the East Asian population (Fisher's exact test). Two variants also had lower MAFs in the European population. In summary, there were no apparent associations of variants in GAMT and SLC6A8 genes with autism. The data implying there could be a lower association of some specific GATM gene variants with autism is an observation that would need to be corroborated in a larger group of autism patients, and with sub-populations of Asian ethnicities. Overall, our findings suggest that the genetic variability of creatine synthesis/transport is unlikely to play a part in the pathogenesis of autism spectrum

  2. Evidencia de asociación entre el gen SLC6A4 y efectos epistáticos con variantes en HTR2A en la etiología del autismo en la población antioqueña

    Directory of Open Access Journals (Sweden)

    Ana Victoria Valencia

    2012-12-01

    Full Text Available Introducción. El espectro autista constituye un grupo de trastornos graves del neurodesarrollo, conun fuerte componente genético. Se ha sugerido un papel importante del sistema serotoninérgico en el desarrollo de este grupo de trastornos, con base en los estudios de respuesta a medicamentos y la hiperserotoninemia, característica común en el autismo. Se han implicado múltiples moléculas en el metabolismo y la neurotransmisión de la serotonina; sin embargo, los resultados de los estudios hantenido poca congruencia entre diferentes poblaciones. Objetivos. Evaluar la relación entre el autismo y el polimorfismo de nucleótido simple (SingleNucleotide Polymorphism, SNP en los genes SLC6A4, HTR2A e ITGB3, en una muestra de la población antioqueña. Materiales y métodos. Se genotipificaron 42 núcleos familiares con autismo para 10 variantes enlos genes SLC6A4, ITGB3 y HTR2A. Se evaluó la asociación utilizando la prueba de desequilibrio enla transmisión. Se exploró el impacto de la interacción entre estos genes y el autismo, utilizando la reducción multidimensional. Resultados. Se encontró asociación de las variantes rs4583306 (OR=2,6, p=0,004 y rs2066713(OR=2,2 p=0,03, en el gen SLC6A4, y asociación de combinaciones genotípicas entre los genes SLC6A4 y HTR2A y el riesgo de autismo (p=0,0001. Conclusiones. Se encontró asociación significativa con variantes en el gen transportador de serotoninacon el autismo, al igual que interacción entre variantes en los genes HTR2A con SLC6A4. Estos resultados concuerdan con los de estudios previos en otras poblaciones y son pruebas a favor delpapel del sistema serotoninérgico en la etiología del espectro autista.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.593

  3. No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

    Science.gov (United States)

    González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

    2015-01-01

    Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

  4. Resequencing three candidate genes discovers seven potentially deleterious variants susceptibility to major depressive disorder and suicide attempts in Chinese.

    Science.gov (United States)

    Rao, Shitao; Leung, Cherry She Ting; Lam, Macro Hb; Wing, Yun Kwok; Waye, Mary Miu Yee; Tsui, Stephen Kwok Wing

    2017-03-01

    To date almost 200 genes were found to be associated with major depressive disorder (MDD) or suicide attempts (SA), but very few genes were reported for their molecular mechanisms. This study aimed to find out whether there were common or rare variants in three candidate genes altering the risk for MDD and SA in Chinese. Three candidate genes (HOMER1, SLC6A4 and TEF) were chosen for resequencing analysis and association studies as they were reported to be involved in the etiology of MDD and SA. Following that, bioinformatics analyses were applied on those variants of interest. After resequencing analysis and alignment for the amplicons, a total of 34 common or rare variants were found in the randomly selected 36 Hong Kong Chinese patients with both MDD and SA. Among those, seven variants show potentially deleterious features. Rs60029191 and a rare variant located in regulatory region of the HOMER1 gene may affect the promoter activities through interacting with predicted transcription factors. Two missense mutations existed in the SLC6A4 coding regions were firstly reported in Hong Kong Chinese MDD and SA patients, and both of them could affect the transport efficiency of SLC6A4 to serotonin. Moreover, a common variant rs6354 located in the untranslated region of this gene may affect the expression level or exonic splicing of serotonin transporter. In addition, both of a most studied polymorphism rs738499 and a low-frequency variant in the promoter region of the TEF gene were found to be located in potential transcription factor binding sites, which may let the two variants be able to influence the promoter activities of the gene. This study elucidated the potentially molecular mechanisms of the three candidate genes altering the risk for MDD and SA. These findings implied that not only common variants but rare variants could make contributions to the genetic susceptibility to MDD and SA in Chinese. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. The Effect of Turmeric (Curcuma longa Extract on the Functionality of the Solute Carrier Protein 22 A4 (SLC22A4 and Interleukin-10 (IL-10 Variants Associated with Inflammatory Bowel Disease

    Directory of Open Access Journals (Sweden)

    Mark J. McCann

    2014-10-01

    Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

  6. The effect of turmeric (Curcuma longa) extract on the functionality of the solute carrier protein 22 A4 (SLC22A4) and interleukin-10 (IL-10) variants associated with inflammatory bowel disease.

    Science.gov (United States)

    McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C

    2014-10-13

    Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

  7. SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

    Science.gov (United States)

    Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

    2016-11-01

    Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  9. SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

    Directory of Open Access Journals (Sweden)

    Hassen Hadj-Kacem

    2010-01-01

    Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

  10. Multivariate analysis of dopaminergic gene variants as risk factors of heroin dependence.

    Directory of Open Access Journals (Sweden)

    Andrea Vereczkei

    Full Text Available BACKGROUND: Heroin dependence is a debilitating psychiatric disorder with complex inheritance. Since the dopaminergic system has a key role in rewarding mechanism of the brain, which is directly or indirectly targeted by most drugs of abuse, we focus on the effects and interactions among dopaminergic gene variants. OBJECTIVE: To study the potential association between allelic variants of dopamine D2 receptor (DRD2, ANKK1 (ankyrin repeat and kinase domain containing 1, dopamine D4 receptor (DRD4, catechol-O-methyl transferase (COMT and dopamine transporter (SLC6A3 genes and heroin dependence in Hungarian patients. METHODS: 303 heroin dependent subjects and 555 healthy controls were genotyped for 7 single nucleotide polymorphisms (SNPs rs4680 of the COMT gene; rs1079597 and rs1800498 of the DRD2 gene; rs1800497 of the ANKK1 gene; rs1800955, rs936462 and rs747302 of the DRD4 gene. Four variable number of tandem repeats (VNTRs were also genotyped: 120 bp duplication and 48 bp VNTR in exon 3 of DRD4 and 40 bp VNTR and intron 8 VNTR of SLC6A3. We also perform a multivariate analysis of associations using Bayesian networks in Bayesian multilevel analysis (BN-BMLA. FINDINGS AND CONCLUSIONS: In single marker analysis the TaqIA (rs1800497 and TaqIB (rs1079597 variants were associated with heroin dependence. Moreover, -521 C/T SNP (rs1800955 of the DRD4 gene showed nominal association with a possible protective effect of the C allele. After applying the Bonferroni correction TaqIB was still significant suggesting that the minor (A allele of the TaqIB SNP is a risk component in the genetic background of heroin dependence. The findings of the additional multiple marker analysis are consistent with the results of the single marker analysis, but this method was able to reveal an indirect effect of a promoter polymorphism (rs936462 of the DRD4 gene and this effect is mediated through the -521 C/T (rs1800955 polymorphism in the promoter.

  11. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  12. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

    Science.gov (United States)

    Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

    2016-11-01

    The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

  13. Mixed Bartter-Gitelman syndrome: an inbred family with a heterogeneous phenotype expression of a novel variant in the CLCNKB gene.

    Science.gov (United States)

    Al-Shibli, Amar; Yusuf, Madinah; Abounajab, Issam; Willems, Patrick J

    2014-01-01

    Patients with renal diseases associated with salt-losing tubulopathies categorized as Gitelman and classic form of Bartter syndrome have undergone genetic screening for possible mutation capture in two different genes: SLC12A3 and CLCNKB. Clinical symptoms of these two diseases may overlap. Bartter syndrome and Gitelman syndrome are autosomal recessive salt-losing tubulopathies with hypokalemia, metabolic alkalosis, hyperreninemia, hyperplasia of the juxtaglomerular apparatus, hyperaldosteronism, and, in some patients, hypomagnesemia. Here we describe four patients from an inbred family with a novel missense variant in the CLCNKB gene. All of patients are asymptomatic; yet they have the typical metabolic abnormality of salt losing tubulopathies. One of those patients had hypomagnesaemia while others not. Clinical and laboratory data of all patients was described. All 4 patients have a homozygous c.490G > T missense variant in exon 5 of the CLCNKB gene. This variant alters a glycine into a cysteine on amino acid position 164 of the resulting protein (p.Gly164Cys). The c.490G > T variant is a novel variant not previously described in other patients nor controls. Polyphen analysis predicts the variation to be possibly damaging. Analysis of SLC12A3 was normal. Here in we are describing a novel homozygous c.490G > T missense variation was identified in exon 5 of the CLCNKB gene was identified in an Emirati patients with a mild manifestation of Bartter - Gitelman syndrome.

  14. Genetic variant SLC2A2 [corrected] Is associated with risk of cardiovascular disease – assessing the individual and cumulative effect of 46 type 2 diabetes related genetic variants.

    Directory of Open Access Journals (Sweden)

    Anders Borglykke

    Full Text Available To assess the individual and combined effect of 46 type 2 diabetes related risk alleles on incidence of a composite CVD endpoint.Data from the first Danish MONICA study (N = 3523 and the Inter99 study (N = 6049 was used. Using Cox proportional hazard regression the individual effect of each risk allele on incident CVD was analyzed. Risk was presented as hazard ratios (HR per risk allele.During 80,859 person years 1441 incident cases of CVD (fatal and non-fatal occurred in the MONICA study. In Inter99 942 incident cases were observed during 61,239 person years. In the Danish MONICA study four gene variants were significantly associated with incident CVD independently of known diabetes status at baseline; SLC2A2 rs11920090 (HR 1.147, 95% CI 1.027-1.283 , P = 0.0154, C2CD4A rs7172432 (1.112, 1.027-1.205 , P = 0.0089, GCKR rs780094 (1.094, 1.007-1.188 , P = 0.0335 and C2CD4B rs11071657 (1.092, 1.007-1.183 , P = 0.0323. The genetic score was significantly associated with increased risk of CVD (1.025, 1.010-1.041, P = 0.0016. In Inter99 two gene variants were associated with risk of CVD independently of diabetes; SLC2A2 (HR 1.180, 95% CI 1.038-1.341 P = 0.0116 and FTO (0.909, 0.827-0.998, P = 0.0463. Analysing the two populations together we found SLC2A2 rs11920090 (HR 1.164, 95% CI 1.070-1.267, P = 0.0004 meeting the Bonferroni corrected threshold for significance. GCKR rs780094 (1.076, 1.010-1.146, P = 0.0229, C2CD4B rs11071657 (1.067, 1.003-1.135, P = 0.0385 and NOTCH2 rs10923931 (1.104 (1.001 ; 1.217 , P = 0.0481 were found associated with CVD without meeting the corrected threshold. The genetic score was significantly associated with increased risk of CVD (1.018, 1.006-1.031, P = 0.0043.This study showed that out of the 46 genetic variants examined only the minor risk allele of SLC2A2 rs11920090 was significantly (P = 0.0005 associated with a composite endpoint of incident CVD below the threshold for statistical significance corrected for

  15. Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification

    Science.gov (United States)

    Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús

    2014-01-01

    Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463

  16. rs1004819 is the main disease-associated IL23R variant in German Crohn's disease patients: combined analysis of IL23R, CARD15, and OCTN1/2 variants.

    Directory of Open Access Journals (Sweden)

    Jürgen Glas

    Full Text Available BACKGROUND: The IL23R gene has been identified as a susceptibility gene for inflammatory bowel disease (IBD in the North American population. The aim of our study was to test this association in a large German IBD cohort and to elucidate potential interactions with other IBD genes as well as phenotypic consequences of IL23R variants. METHODS: Genomic DNA from 2670 Caucasian individuals including 833 patients with Crohn's disease (CD, 456 patients with ulcerative colitis (UC, and 1381 healthy unrelated controls was analyzed for 10 IL23R SNPs. Genotyping included the NOD2 variants p.Arg702Trp, p.Gly908Arg, and p.Leu1007fsX1008 and polymorphisms in SLC22A4/OCTN1 (1672 C-->T and SLC22A5/OCTN2 (-207 G-->C. RESULTS: All IL23R gene variants analyzed displayed highly significant associations with CD. The strongest association was found for the SNP rs1004819 [P = 1.92x10(-11; OR 1.56; 95 % CI (1.37-1.78]. 93.2% of the rs1004819 TT homozygous carriers as compared to 78% of CC wildtype carriers had ileal involvement [P = 0.004; OR 4.24; CI (1.46-12.34]. The coding SNP rs11209026 (p.Arg381Gln was protective for CD [P = 8.04x10(-8; OR 0.43; CI (0.31-0.59]. Similar, but weaker associations were found in UC. There was no evidence for epistasis between the IL23R gene and the CD susceptibility genes CARD15 and SLC22A4/5. CONCLUSION: IL23R is an IBD susceptibility gene, but has no epistatic interaction with CARD15 and SLC22A4/5. rs1004819 is the major IL23R variant associated with CD in the German population, while the p.Arg381Gln IL23R variant is a protective marker for CD and UC.

  17. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

    Directory of Open Access Journals (Sweden)

    Sughondhabirom Atapol

    2007-10-01

    Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

  18. Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

    Directory of Open Access Journals (Sweden)

    Maura Mack

    2017-08-01

    Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.

  19. SLC45A2 mutation frequency in Oculocutaneous Albinism Italian patients doesn't differ from other European studies.

    Science.gov (United States)

    Mauri, Lucia; Barone, Luca; Al Oum, Muna; Del Longo, Alessandra; Piozzi, Elena; Manfredini, Emanuela; Stanzial, Franco; Benedicenti, Francesco; Penco, Silvana; Patrosso, Maria Cristina

    2014-01-01

    Oculocutaneous Albinism (OCA) is a heterogeneous group of inherited diseases involving hair, skin and eyes. To date, six forms are recognized on the effects of different melanogenesis genes. OCA4 is caused by mutations in SLC45A2 showing a heterogeneous phenotype ranging from white hair, blue irides and nystagmus to brown/black hair, brown irides and no nystagmus. The high clinic variety often leads to misdiagnosis. Our aim is to contribute to OCA4 diagnosis defining SLC45A2 genetic variants in Italian patients with OCA without any TYR, OCA2 and TYRP1 gene defects. After the clinical diagnosis of OCA, all patients received genetic counseling and genetic test. Automatic sequencing of TYR, OCA2, and TYRP1 genes was performed on DNA of 117 albino patients. Multiplex Ligation-dependent Probe Amplification (MLPA) was carried out on TYR and OCA2 genes to increase the mutation rate. SLC45A2 gene sequencing was then executed in the patients with a single mutation in one of the TYR, OCA2, TYRP1 genes and in the patients, which resulted negative at the screening of these genes. SLC45A2 gene analysis was performed in 41 patients and gene alterations were found in 5 patients. Four previously reported SLC45A2 mutations were found: p.G100S, p.W202C, p.A511E and c.986delC, and three novel variants were identified: p.M265L, p.H94D, and c.1156+1G>A. All the alterations have been detected in the group of patients without mutations in the other OCA genes. Three new variants were identified in OCA4 gene; the analysis allowed the classification of a patient previously misdiagnosed as OA1 because of skin and hair pigmentation presence. The molecular defects in SLC45A2 gene represent the 3.4% in this cohort of Italian patients, similar to other Caucasian populations; our data differ from those previously published by an Italian researcher group, obtained on a smaller cohort of patients. © 2013 Elsevier B.V. All rights reserved.

  20. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  1. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.

    Science.gov (United States)

    Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima

    Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  2. Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

    DEFF Research Database (Denmark)

    Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

    2012-01-01

    ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

  3. The SLC4A7 variant rs4973768 is associated with breast cancer risk: evidence from a case-control study and a meta-analysis.

    Science.gov (United States)

    Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao

    2012-12-01

    Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.

  4. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  5. Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

    Science.gov (United States)

    Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

    2017-01-01

    ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

  6. A common variant within the HNF1B gene is associated with overall survival of multiple myeloma patients

    DEFF Research Database (Denmark)

    Ríos-Tamayo, Rafael; Lupiañez, Carmen Belén; Campa, Daniele

    2016-01-01

    Diabetogenic single nucleotide polymorphisms (SNPs) have recently been associated with multiple myeloma (MM) risk but their impact on overall survival (OS) of MM patients has not been analysed yet. In order to investigate the impact of 58 GWAS-identified variants for type 2 diabetes (T2D) on OS...... of patients with MM, we analysed genotyping data of 936 MM patients collected by the International Multiple Myeloma rESEarch (IMMENSE) consortium and an independent set of 700 MM patients recruited by the University Clinic of Heidelberg. A meta-analysis of the cox regression results of the two sets showed...... that rs7501939 located in the HNF1B gene negatively impacted OS (HRRec= 1.44, 95% CI = 1.18-1.76, P = 0.0001). The meta-analysis also showed a noteworthy gender-specific association of the SLC30A8rs13266634 SNP with OS. The presence of each additional copy of the minor allele at rs13266634 was associated...

  7. Sodium bicarbonate cotransporter NBCe2 gene variants increase sodium and bicarbonate transport in human renal proximal tubule cells.

    Science.gov (United States)

    Gildea, John J; Xu, Peng; Kemp, Brandon A; Carlson, Julia M; Tran, Hanh T; Bigler Wang, Dora; Langouët-Astrié, Christophe J; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

    2018-01-01

    Salt sensitivity of blood pressure affects >30% of the hypertensive and >15% of the normotensive population. Variants of the electrogenic sodium bicarbonate cotransporter NBCe2 gene, SLC4A5, are associated with increased blood pressure in several ethnic groups. SLC4A5 variants are also highly associated with salt sensitivity, independent of hypertension. However, little is known about how NBCe2 contributes to salt sensitivity, although NBCe2 regulates renal tubular sodium bicarbonate transport. We hypothesized that SLC4A5 rs10177833 and rs7571842 increase NBCe2 expression and human renal proximal tubule cell (hRPTC) sodium transport and may be a cause of salt sensitivity of blood pressure. To characterize the hRPTC ion transport of wild-type (WT) and homozygous variants (HV) of SLC4A5. The expressions of NBCe2 mRNA and protein were not different between hRPTCs carrying WT or HV SLC4A5 before or after dopaminergic or angiotensin (II and III) stimulation. However, luminal to basolateral sodium transport, NHE3 protein, and Cl-/HCO3- exchanger activity in hRPTCs were higher in HV than WT SLC4A5. Increasing intracellular sodium enhanced the apical location of NBCe2 in HV hRPTCs (4.24±0.35% to 11.06±1.72% (P<0.05, N = 3, 2-way ANOVA, Holm-Sidak test)) as determined by Total Internal Reflection Fluorescence Microscopy (TIRFM). In hRPTCs isolated from kidney tissue, increasing intracellular sodium enhanced bicarbonate-dependent pH recovery rate and increased NBCe2 mRNA and protein expressions to a greater extent in HV than WT SLC4A5 (+38.00±6.23% vs HV normal salt (P<0.01, N = 4, 2-way ANOVA, Holm-Sidak test)). In hRPTCs isolated from freshly voided urine, bicarbonate-dependent pH recovery was also faster in those from salt-sensitive and carriers of HV SLC4A5 than from salt-resistant and carriers of WT SLC4A5. The faster NBCe2-specific bicarbonate-dependent pH recovery rate in HV SCL4A5 was normalized by SLC4A5- but not SLC4A4-shRNA. The binding of purified hepatocyte

  8. Prenatal exposure to maternal depressed mood and the MTHFR C677T variant affect SLC6A4 methylation in infants at birth.

    Directory of Open Access Journals (Sweden)

    Angela M Devlin

    2010-08-01

    Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.

  9. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    Science.gov (United States)

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  10. Common type 2 diabetes risk gene variants associate with gestational diabetes

    DEFF Research Database (Denmark)

    Lauenborg, Jeannet; Grarup, Niels; Damm, Peter

    2009-01-01

    Objective: We aimed to examine the association between gestational diabetes (GDM) and eleven recently identified type 2 diabetes susceptibility loci. Research Design and Methods: Type 2 diabetes risk variants in TCF7L2, CDKAL1, SLC30A8, HHEX/IDE, CDKN2A/2B, IGF2BP2, FTO, TCF2, PPARG, KCNJ11 and WFS......1 loci were genotyped in a cohort of women with a history of GDM (n=283) and in glucose tolerant women of the population-based Inter99 cohort (n=2,446). Results: All the risk alleles in the 11 examined type 2 diabetes risk variants showed an odds ratio greater than 1 for the GDM group compared...... previously proven type 2 diabetes risk alleles equals the findings from association studies on type 2 diabetes. This supports the hypothesis that GDM and type 2 diabetes are two of the same entity....

  11. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

  12. [ROLE OF SLC2A9 AND ABCG2 GENE POLYMORPHISMS IN ORIGIN OF HYPERURICEMIA AND GOUT].

    Science.gov (United States)

    Fadieieva, A; Prystupa, L; Pogorelova, O; Kirichenko, N; Dudchenko, I

    2016-03-01

    The polymorphisms V253I, Q126X, Q141K of SLC2A9 and ABCG2 genes were characterized. GCA и GTC haplotypes of Q126X and Q141K variants can be predictors of gout. The relationship of these polymorphisms with hyperuricaemia according to gender, metabolic syndrome components, with the response to allopurinol was analyzed. It has been established that Q141K polymorphism can directly modulate BCRP-mediated allopurinol and oxypurinol efflux, the K allele is associated with a lower reduction in serum uric acid in response to allopurinol treatment.

  13. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  14. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  15. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  16. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 are associated with type 2 diabetes in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Cheng Hu

    2009-10-01

    Full Text Available Recent advance in genetic studies added the confirmed susceptible loci for type 2 diabetes to eighteen. In this study, we attempt to analyze the independent and joint effect of variants from these loci on type 2 diabetes and clinical phenotypes related to glucose metabolism.Twenty-one single nucleotide polymorphisms (SNPs from fourteen loci were successfully genotyped in 1,849 subjects with type 2 diabetes and 1,785 subjects with normal glucose regulation. We analyzed the allele and genotype distribution between the cases and controls of these SNPs as well as the joint effects of the susceptible loci on type 2 diabetes risk. The associations between SNPs and type 2 diabetes were examined by logistic regression. The associations between SNPs and quantitative traits were examined by linear regression. The discriminative accuracy of the prediction models was assessed by area under the receiver operating characteristic curves. We confirmed the effects of SNPs from PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 on risk for type 2 diabetes, with odds ratios ranging from 1.114 to 1.406 (P value range from 0.0335 to 1.37E-12. But no significant association was detected between SNPs from WFS1, FTO, JAZF1, TSPAN8-LGR5, THADA, ADAMTS9, NOTCH2-ADAM30 and type 2 diabetes. Analyses on the quantitative traits in the control subjects showed that THADA SNP rs7578597 was association with 2-h insulin during oral glucose tolerance tests (P = 0.0005, empirical P = 0.0090. The joint effect analysis of SNPs from eleven loci showed the individual carrying more risk alleles had a significantly higher risk for type 2 diabetes. And the type 2 diabetes patients with more risk allele tended to have earlier diagnostic ages (P = 0.0006.The current study confirmed the association between PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX, IGF2BP2 and SLC30A8 and type 2 diabetes. These type 2 diabetes risk loci contributed to the disease additively.

  18. Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

    Science.gov (United States)

    Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

    2016-06-01

    Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  19. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  20. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  1. Association analysis between a VNTR intron 8 polymorphism of the dopamine transporter gene (SLC6A3 and obsessive- compulsive disorder in a Brazilian sample Análise de associação entre um polimorfismo VNTR no intron 8 do gene do transportador de dopamina (SLC6A3 e transtorno obsessivo-compulsivo em uma amostra brasileira

    Directory of Open Access Journals (Sweden)

    Karen Miguita

    2007-12-01

    Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR

  2. Association of dopamine gene variants, emotion dysregulation and ADHD in autism spectrum disorder.

    Science.gov (United States)

    Gadow, Kenneth D; Pinsonneault, Julia K; Perlman, Greg; Sadee, Wolfgang

    2014-07-01

    The aim of the present study was to evaluate the association of dopaminergic gene variants with emotion dysregulation (EMD) and attention-deficit/hyperactivity disorder (ADHD) symptoms in children with autism spectrum disorder (ASD). Three dopamine transporter gene (SLC6A3/DAT1) polymorphisms (intron8 5/6 VNTR, 3'-UTR 9/10 VNTR, rs27072 in the 3'-UTR) and one dopamine D2 receptor gene (DRD2) variant (rs2283265) were selected for genotyping based on à priori evidence of regulatory activity or, in the case of DAT1 9/10 VNTR, commonly reported associations with ADHD. A sample of 110 children with ASD was assessed with a rigorously validated DSM-IV-referenced rating scale. Global EMD severity (parents' ratings) was associated with DAT1 intron8 (ηp(2)=.063) and rs2283265 (ηp(2)=.044). Findings for DAT1 intron8 were also significant for two EMD subscales, generalized anxiety (ηp(2)=.065) and depression (ηp(2)=.059), and for DRD2 rs2283265, depression (ηp(2)=.053). DRD2 rs2283265 was associated with teachers' global ratings of ADHD (ηp(2)=.052). DAT1 intron8 was associated with parent-rated hyperactivity (ηp(2)=.045) and both DAT1 9/10 VNTR (ηp(2)=.105) and DRD2 rs2283265 (ηp(2)=.069) were associated with teacher-rated inattention. These findings suggest that dopaminergic gene polymorphisms may modulate EMD and ADHD symptoms in children with ASD but require replication with larger independent samples. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis

    Directory of Open Access Journals (Sweden)

    Larissa Lazzarini Furlan

    2017-11-01

    Conclusions: This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene.

  4. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  5. A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

    Directory of Open Access Journals (Sweden)

    Alexandre Bolze

    Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

  6. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  7. Hybridisation-based resequencing of 17 X-linked intellectual disability genes in 135 patients reveals novel mutations in ATRX, SLC6A8 and PQBP1

    Science.gov (United States)

    Jensen, Lars R; Chen, Wei; Moser, Bettina; Lipkowitz, Bettina; Schroeder, Christopher; Musante, Luciana; Tzschach, Andreas; Kalscheuer, Vera M; Meloni, Ilaria; Raynaud, Martine; van Esch, Hilde; Chelly, Jamel; de Brouwer, Arjan P M; Hackett, Anna; van der Haar, Sigrun; Henn, Wolfram; Gecz, Jozef; Riess, Olaf; Bonin, Michael; Reinhardt, Richard; Ropers, Hans-Hilger; Kuss, Andreas W

    2011-01-01

    X-linked intellectual disability (XLID), also known as X-linked mental retardation, is a highly genetically heterogeneous condition for which mutations in >90 different genes have been identified. In this study, we used a custom-made sequencing array based on the Affymetrix 50k platform for mutation screening in 17 known XLID genes in patients from 135 families and found eight single-nucleotide changes that were absent in controls. For four mutations affecting ATRX (p.1761M>T), PQBP1 (p.155R>X) and SLC6A8 (p.390P>L and p.477S>L), we provide evidence for a functional involvement of these changes in the aetiology of intellectual disability. PMID:21267006

  8. Joint linkage and association analysis with exome sequence data implicates SLC25A40 in hypertriglyceridemia.

    Science.gov (United States)

    Rosenthal, Elisabeth A; Ranchalis, Jane; Crosslin, David R; Burt, Amber; Brunzell, John D; Motulsky, Arno G; Nickerson, Deborah A; Wijsman, Ellen M; Jarvik, Gail P

    2013-12-05

    Hypertriglyceridemia (HTG) is a heritable risk factor for cardiovascular disease. Investigating the genetics of HTG may identify new drug targets. There are ~35 known single-nucleotide variants (SNVs) that explain only ~10% of variation in triglyceride (TG) level. Because of the genetic heterogeneity of HTG, a family study design is optimal for identification of rare genetic variants with large effect size because the same mutation can be observed in many relatives and cosegregation with TG can be tested. We considered HTG in a five-generation family of European American descent (n = 121), ascertained for familial combined hyperlipidemia. By using Bayesian Markov chain Monte Carlo joint oligogenic linkage and association analysis, we detected linkage to chromosomes 7 and 17. Whole-exome sequence data revealed shared, highly conserved, private missense SNVs in both SLC25A40 on chr7 and PLD2 on chr17. Jointly, these SNVs explained 49% of the genetic variance in TG; however, only the SLC25A40 SNV was significantly associated with TG (p = 0.0001). This SNV, c.374A>G, causes a highly disruptive p.Tyr125Cys substitution just outside the second helical transmembrane region of the SLC25A40 inner mitochondrial membrane transport protein. Whole-gene testing in subjects from the Exome Sequencing Project confirmed the association between TG and SLC25A40 rare, highly conserved, coding variants (p = 0.03). These results suggest a previously undescribed pathway for HTG and illustrate the power of large pedigrees in the search for rare, causal variants. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Analysis of SLC16A11 Variants in 12,811 American Indians: Genotype-Obesity Interaction for Type 2 Diabetes and an Association With RNASEK Expression

    Science.gov (United States)

    Traurig, Michael; Hanson, Robert L.; Marinelarena, Alejandra; Kobes, Sayuko; Piaggi, Paolo; Cole, Shelley; Curran, Joanne E.; Blangero, John; Göring, Harald; Kumar, Satish; Nelson, Robert G.; Howard, Barbara V.; Knowler, William C.; Baier, Leslie J.

    2016-01-01

    Genetic variants in SLC16A11 were recently reported to be associated with type 2 diabetes in Mexican and other Latin American populations. The diabetes risk haplotype had a frequency of 50% in Native Americans from Mexico but was rare in Europeans and Africans. In the current study, we analyzed SLC16A11 in 12,811 North American Indians and found that the diabetes risk haplotype, tagged by the rs75493593 A allele, was nominally associated with type 2 diabetes (P = 0.001, odds ratio 1.11). However, there was a strong interaction with BMI (P = 5.1 × 10−7) such that the diabetes association was stronger in leaner individuals. rs75493593 was also strongly associated with BMI in individuals with type 2 diabetes (P = 3.4 × 10−15) but not in individuals without diabetes (P = 0.77). Longitudinal analyses suggest that this is due, in part, to an association of the A allele with greater weight loss following diabetes onset (P = 0.02). Analyses of global gene expression data from adipose tissue, skeletal muscle, and whole blood provide evidence that rs75493593 is associated with expression of the nearby RNASEK gene, suggesting that RNASEK expression may mediate the effect of genotype on diabetes. PMID:26487785

  10. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  11. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  12. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  13. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  14. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  15. Gender-based differences on the association between salt-sensitive genes and obesity in Korean children aged between 8 and 9 years.

    Directory of Open Access Journals (Sweden)

    Myoungsook Lee

    Full Text Available High sodium intake is associated with the development of chronic diseases such as obesity. Although its role in obesity remains controversial, there may be a correlation between salt sensitivity and the early onset of chronic diseases in obese children.In all, 2,163 Korean children (1,106 boys and 1,057 girls aged 8-9 years were recruited from seven elementary schools in Seoul. To evaluate whether obesity risk was modulated by the salt sensitivity, 11 SNPs related to salt sensitive genes (SSG became the target of sodium intakes in obese children.BP, HOMA-IR, LDLc, TG, and the girls' sodium intake significantly increased, but HDLc significantly decreased with increase in BMI. Regardless of sex, the obesity risk was 5.27-fold (CI; 1.320-27.560 higher in the Q2 to Q5 of sodium intake adjusted by energy (4044.9-5058.9 mg/day than in the lowest Q1 level (2287.6 mg/day in obese children. BP was sensitively dependent on insulin resistance and lipid accumulation in all subjects; however, sodium intake may be an independent risk factor of obesity without increasing BP in girls. GRK4 A486V mutant homozygote was highly distributed in the obese group, but other SNPs had no impact. The obesity risk increased 7.06, 16.8, and 46.09-fold more in boys with GRK4 A486V, ACE, and SLC12A3 mutants as sodium intake increased. Among girls, the obesity risk increased in GRK4 A486V heterozygote and CYP11β-2 mutant homozygote although sodium intake was relatively lower, implying that ACE, SLC12A, CYP11β-2, and GRK4 A486V polymorphisms showed gender-based differences with regard to interaction between sodium intake and obesity.A high sodium intake markedly increased the obesity risk in variants of GRK4 A486V regardless of sex. The obesity risk increased with GRK4 A486V, ACE, and SLC12A3 variants in boys, whereas it increased with GRK4 A486V and CYP11B2 variants in girls as sodium intake increased. Obese children with the specific gene variants are recommended to reduce

  16. Gender-based differences on the association between salt-sensitive genes and obesity in Korean children aged between 8 and 9 years.

    Science.gov (United States)

    Lee, Myoungsook; Kim, Mi Kyung; Kim, Seon-Mee; Park, Hyesoon; Park, Chang Gyu; Park, Hye Kyung

    2015-01-01

    High sodium intake is associated with the development of chronic diseases such as obesity. Although its role in obesity remains controversial, there may be a correlation between salt sensitivity and the early onset of chronic diseases in obese children. In all, 2,163 Korean children (1,106 boys and 1,057 girls) aged 8-9 years were recruited from seven elementary schools in Seoul. To evaluate whether obesity risk was modulated by the salt sensitivity, 11 SNPs related to salt sensitive genes (SSG) became the target of sodium intakes in obese children. BP, HOMA-IR, LDLc, TG, and the girls' sodium intake significantly increased, but HDLc significantly decreased with increase in BMI. Regardless of sex, the obesity risk was 5.27-fold (CI; 1.320-27.560) higher in the Q2 to Q5 of sodium intake adjusted by energy (4044.9-5058.9 mg/day) than in the lowest Q1 level (2287.6 mg/day) in obese children. BP was sensitively dependent on insulin resistance and lipid accumulation in all subjects; however, sodium intake may be an independent risk factor of obesity without increasing BP in girls. GRK4 A486V mutant homozygote was highly distributed in the obese group, but other SNPs had no impact. The obesity risk increased 7.06, 16.8, and 46.09-fold more in boys with GRK4 A486V, ACE, and SLC12A3 mutants as sodium intake increased. Among girls, the obesity risk increased in GRK4 A486V heterozygote and CYP11β-2 mutant homozygote although sodium intake was relatively lower, implying that ACE, SLC12A, CYP11β-2, and GRK4 A486V polymorphisms showed gender-based differences with regard to interaction between sodium intake and obesity. A high sodium intake markedly increased the obesity risk in variants of GRK4 A486V regardless of sex. The obesity risk increased with GRK4 A486V, ACE, and SLC12A3 variants in boys, whereas it increased with GRK4 A486V and CYP11B2 variants in girls as sodium intake increased. Obese children with the specific gene variants are recommended to reduce their sodium

  17. SLC26A4 mutations are associated with a specific inner ear malformation.

    Science.gov (United States)

    Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

    2007-03-01

    Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

  18. Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

    Science.gov (United States)

    Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

    2018-01-01

    A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

  19. Interaction between prenatal growth and high-risk genotypes in the development of type 2 diabetes

    DEFF Research Database (Denmark)

    Pulizzi, N; Lyssenko, V; Jonsson, Anna Elisabet

    2009-01-01

    Early environmental factors and genetic variants have been reported to be involved in the pathogenesis of type 2 diabetes. The aim of this study was to investigate whether there is an interaction between birthweight and common variants in the TCF7L2, HHEX, PPARG, KCNJ11, SLC30A8, IGF2BP2, CDKAL1,......, CDKN2A/2B and JAZF1 genes in the risk of developing type 2 diabetes.......Early environmental factors and genetic variants have been reported to be involved in the pathogenesis of type 2 diabetes. The aim of this study was to investigate whether there is an interaction between birthweight and common variants in the TCF7L2, HHEX, PPARG, KCNJ11, SLC30A8, IGF2BP2, CDKAL1...

  20. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  1. Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

    Science.gov (United States)

    Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

    2016-01-01

    To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

  2. Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

    DEFF Research Database (Denmark)

    Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

    2005-01-01

    The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

  3. A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order.

    Science.gov (United States)

    Ramasamy, Adaikalavan; Curjuric, Ivan; Coin, Lachlan J; Kumar, Ashish; McArdle, Wendy L; Imboden, Medea; Leynaert, Benedicte; Kogevinas, Manolis; Schmid-Grendelmeier, Peter; Pekkanen, Juha; Wjst, Matthias; Bircher, Andreas J; Sovio, Ulla; Rochat, Thierry; Hartikainen, Anna-Liisa; Balding, David J; Jarvelin, Marjo-Riitta; Probst-Hensch, Nicole; Strachan, David P; Jarvis, Deborah L

    2011-11-01

    Hay fever or seasonal allergic rhinitis (AR) is a chronic disorder associated with IgE sensitization to grass. The underlying genetic variants have not been studied comprehensively. There is overwhelming evidence that those who have older siblings have less AR, although the mechanism for this remains unclear. We sought to identify common genetic variant associations with prevalent AR and grass sensitization using existing genome-wide association study (GWAS) data and to determine whether genetic variants modify the protective effect of older siblings. Approximately 2.2 million genotyped or imputed single nucleotide polymorphisms were investigated in 4 large European adult cohorts for AR (3,933 self-reported cases vs 8,965 control subjects) and grass sensitization (2,315 cases vs 10,032 control subjects). Three loci reached genome-wide significance for either phenotype. The HLA variant rs7775228, which cis-regulates HLA-DRB4, was strongly associated with grass sensitization and weakly with AR (P(grass) = 1.6 × 10(-9); P(AR) = 8.0 × 10(-3)). Variants in a locus near chromosome 11 open reading frame 30 (C11orf30) and leucine-rich repeat containing 32 (LRRC32), which was previously associated with atopic dermatitis and eczema, were also strongly associated with both phenotypes (rs2155219; P(grass) = 9.4 × 10(-9); P(AR) = 3.8 × 10(-8)). The third genome-wide significant variant was rs17513503 (P(grass) = 1.2 × 10(-8); PAR = 7.4 × 10(-7)) which was located near transmembrane protein 232 (TMEM232) and solute carrier family 25, member 46 (SLC25A46). Twelve further loci with suggestive associations were also identified. Using a candidate gene approach, where we considered variants within 164 genes previously thought to be important, we found variants in 3 further genes that may be of interest: thymic stromal lymphopoietin (TSLP), Toll-like receptor 6 (TLR6) and nucleotide-binding oligomerization domain containing 1 (NOD1/CARD4). We found no evidence for variants

  4. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  5. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

    Directory of Open Access Journals (Sweden)

    Sofie V Hellsten

    Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

  6. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  7. A Novel Missense Mutation in SLC5A5 Gene in a Sudanese Family with Congenital Hypothyroidism.

    Science.gov (United States)

    Watanabe, Yui; Ebrhim, Reham Shareef; Abdullah, Mohamed A; Weiss, Roy E

    2018-05-15

    Thyroid hormone synthesis requires the presence of iodide. The sodium iodide symporter (NIS) is a glycoprotein which mediates the active uptake of iodide from the blood stream into the thyroid grand. NIS defects due to SLC5A5 gene mutations are known to cause congenital hypothyroidism (CH). The proposita is a 28-year-old female whose origin is the North Sudan where neonatal screening for CH is not available. She presented with severe constipation and a goiter at the age of 40 days. Laboratory testing confirmed CH and she was started on levothyroxine (L-T4). Presumably due to the delayed treatment the patient developed mental retardation. Her younger sister presented with a goiter, tongue protrusion and umbilical hernia and the youngest brother was also diagnosed with CH based on the TSH >100 µIU/mL at the age of 22 days and 8 days, respectively. Two siblings were treated with L-T4 and had normal development. Their consanguineous parents had no history of thyroid disorders. We performed whole exome sequencing (WES) on the proposita. WES identified a novel homozygous missense mutation in the SLC5A5 gene: c.1042T>G, p.Tyr348Asp, which was subsequently confirmed by Sanger sequencing. All affected children were homozygous for the same mutation and their unaffected mother was heterozygous. The NIS protein is composed of 13 transmembrane segments (TMS), an extracellular amino-terminus and an intracellular carboxyl terminus. The mutation is located in the TMS IX which has the most β-OH group-containing amino acids (serine and threonine) which is implicated in Na+ binding and translocation. In conclusion, a novel homozygous missense mutation in the SLC5A5 gene was identified in the Sudanese family with CH. The mutation is located in the TMS IX of the NIS protein which is essential for NIS function. Low iodine intake in Sudan is considered to affect severity of hypothyroidism in the patients.

  8. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    Science.gov (United States)

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  9. Analysis of SLC16A11 Variants in 12,811 American Indians: Genotype-Obesity Interaction for Type 2 Diabetes and an Association With RNASEK Expression.

    Science.gov (United States)

    Traurig, Michael; Hanson, Robert L; Marinelarena, Alejandra; Kobes, Sayuko; Piaggi, Paolo; Cole, Shelley; Curran, Joanne E; Blangero, John; Göring, Harald; Kumar, Satish; Nelson, Robert G; Howard, Barbara V; Knowler, William C; Baier, Leslie J; Bogardus, Clifton

    2016-02-01

    Genetic variants in SLC16A11 were recently reported to be associated with type 2 diabetes in Mexican and other Latin American populations. The diabetes risk haplotype had a frequency of 50% in Native Americans from Mexico but was rare in Europeans and Africans. In the current study, we analyzed SLC16A11 in 12,811 North American Indians and found that the diabetes risk haplotype, tagged by the rs75493593 A allele, was nominally associated with type 2 diabetes (P = 0.001, odds ratio 1.11). However, there was a strong interaction with BMI (P = 5.1 × 10(-7)) such that the diabetes association was stronger in leaner individuals. rs75493593 was also strongly associated with BMI in individuals with type 2 diabetes (P = 3.4 × 10(-15)) but not in individuals without diabetes (P = 0.77). Longitudinal analyses suggest that this is due, in part, to an association of the A allele with greater weight loss following diabetes onset (P = 0.02). Analyses of global gene expression data from adipose tissue, skeletal muscle, and whole blood provide evidence that rs75493593 is associated with expression of the nearby RNASEK gene, suggesting that RNASEK expression may mediate the effect of genotype on diabetes. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  10. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  11. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  12. SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

    Directory of Open Access Journals (Sweden)

    Yuan-Zong Song

    Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

  13. Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies.

    Science.gov (United States)

    Salter, Claire G; Beijer, Danique; Hardy, Holly; Barwick, Katy E S; Bower, Matthew; Mademan, Ines; De Jonghe, Peter; Deconinck, Tine; Russell, Mark A; McEntagart, Meriel M; Chioza, Barry A; Blakely, Randy D; Chilton, John K; De Bleecker, Jan; Baets, Jonathan; Baple, Emma L; Walk, David; Crosby, Andrew H

    2018-04-01

    To identify the genetic cause of disease in 2 previously unreported families with forms of distal hereditary motor neuropathies (dHMNs). The first family comprises individuals affected by dHMN type V, which lacks the cardinal clinical feature of vocal cord paralysis characteristic of dHMN-VII observed in the second family. Next-generation sequencing was performed on the proband of each family. Variants were annotated and filtered, initially focusing on genes associated with neuropathy. Candidate variants were further investigated and confirmed by dideoxy sequence analysis and cosegregation studies. Thorough patient phenotyping was completed, comprising clinical history, examination, and neurologic investigation. dHMNs are a heterogeneous group of peripheral motor neuron disorders characterized by length-dependent neuropathy and progressive distal limb muscle weakness and wasting. We previously reported a dominant-negative frameshift mutation located in the concluding exon of the SLC5A7 gene encoding the choline transporter (CHT), leading to protein truncation, as the likely cause of dominantly-inherited dHMN-VII in an extended UK family. In this study, our genetic studies identified distinct heterozygous frameshift mutations located in the last coding exon of SLC5A7 , predicted to result in the truncation of the CHT C-terminus, as the likely cause of the condition in each family. This study corroborates C-terminal CHT truncation as a cause of autosomal dominant dHMN, confirming upper limb predominating over lower limb involvement, and broadening the clinical spectrum arising from CHT malfunction.

  14. Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.

    Science.gov (United States)

    Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke

    2018-06-01

    In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .

  15. Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations.

    Directory of Open Access Journals (Sweden)

    Melanie Kolz

    2009-06-01

    Full Text Available Elevated serum uric acid levels cause gout and are a risk factor for cardiovascular disease and diabetes. To investigate the polygenetic basis of serum uric acid levels, we conducted a meta-analysis of genome-wide association scans from 14 studies totalling 28,141 participants of European descent, resulting in identification of 954 SNPs distributed across nine loci that exceeded the threshold of genome-wide significance, five of which are novel. Overall, the common variants associated with serum uric acid levels fall in the following nine regions: SLC2A9 (p = 5.2x10(-201, ABCG2 (p = 3.1x10(-26, SLC17A1 (p = 3.0x10(-14, SLC22A11 (p = 6.7x10(-14, SLC22A12 (p = 2.0x10(-9, SLC16A9 (p = 1.1x10(-8, GCKR (p = 1.4x10(-9, LRRC16A (p = 8.5x10(-9, and near PDZK1 (p = 2.7x10(-9. Identified variants were analyzed for gender differences. We found that the minor allele for rs734553 in SLC2A9 has greater influence in lowering uric acid levels in women and the minor allele of rs2231142 in ABCG2 elevates uric acid levels more strongly in men compared to women. To further characterize the identified variants, we analyzed their association with a panel of metabolites. rs12356193 within SLC16A9 was associated with DL-carnitine (p = 4.0x10(-26 and propionyl-L-carnitine (p = 5.0x10(-8 concentrations, which in turn were associated with serum UA levels (p = 1.4x10(-57 and p = 8.1x10(-54, respectively, forming a triangle between SNP, metabolites, and UA levels. Taken together, these associations highlight additional pathways that are important in the regulation of serum uric acid levels and point toward novel potential targets for pharmacological intervention to prevent or treat hyperuricemia. In addition, these findings strongly support the hypothesis that transport proteins are key in regulating serum uric acid levels.

  16. Gender-Based Differences on the Association between Salt-Sensitive Genes and Obesity in Korean Children Aged between 8 and 9 Years

    Science.gov (United States)

    Kim, Seon-Mee; Park, Hyesoon; Park, Chang gyu; Park, Hye Kyung

    2015-01-01

    Background High sodium intake is associated with the development of chronic diseases such as obesity. Although its role in obesity remains controversial, there may be a correlation between salt sensitivity and the early onset of chronic diseases in obese children. Methods In all, 2,163 Korean children (1,106 boys and 1,057 girls) aged 8–9 years were recruited from seven elementary schools in Seoul. To evaluate whether obesity risk was modulated by the salt sensitivity, 11 SNPs related to salt sensitive genes (SSG) became the target of sodium intakes in obese children. Results BP, HOMA-IR, LDLc, TG, and the girls’ sodium intake significantly increased, but HDLc significantly decreased with increase in BMI. Regardless of sex, the obesity risk was 5.27-fold (CI; 1.320–27.560) higher in the Q2 to Q5 of sodium intake adjusted by energy (4044.9–5058.9 mg/day) than in the lowest Q1 level (2287.6 mg/day) in obese children. BP was sensitively dependent on insulin resistance and lipid accumulation in all subjects; however, sodium intake may be an independent risk factor of obesity without increasing BP in girls. GRK4 A486V mutant homozygote was highly distributed in the obese group, but other SNPs had no impact. The obesity risk increased 7.06, 16.8, and 46.09-fold more in boys with GRK4 A486V, ACE, and SLC12A3 mutants as sodium intake increased. Among girls, the obesity risk increased in GRK4 A486V heterozygote and CYP11β-2 mutant homozygote although sodium intake was relatively lower, implying that ACE, SLC12A, CYP11β-2, and GRK4 A486V polymorphisms showed gender-based differences with regard to interaction between sodium intake and obesity. Conclusion A high sodium intake markedly increased the obesity risk in variants of GRK4 A486V regardless of sex. The obesity risk increased with GRK4 A486V, ACE, and SLC12A3 variants in boys, whereas it increased with GRK4 A486V and CYP11B2 variants in girls as sodium intake increased. Obese children with the specific gene

  17. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  18. [Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

    Science.gov (United States)

    Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

    2014-11-01

    Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

  19. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  20. Exome-wide association study reveals novel susceptibility genes to sporadic dilated cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Ulrike Esslinger

    Full Text Available Dilated cardiomyopathy (DCM is an important cause of heart failure with a strong familial component. We performed an exome-wide array-based association study (EWAS to assess the contribution of missense variants to sporadic DCM.116,855 single nucleotide variants (SNVs were analyzed in 2796 DCM patients and 6877 control subjects from 6 populations of European ancestry. We confirmed two previously identified associations with SNVs in BAG3 and ZBTB17 and discovered six novel DCM-associated loci (Q-value<0.01. The lead-SNVs at novel loci are common and located in TTN, SLC39A8, MLIP, FLNC, ALPK3 and FHOD3. In silico fine mapping identified HSPB7 as the most likely candidate at the ZBTB17 locus. Rare variant analysis (MAF<0.01 demonstrated significant association for TTN variants only (P = 0.0085. All candidate genes but one (SLC39A8 exhibit preferential expression in striated muscle tissues and mutations in TTN, BAG3, FLNC and FHOD3 are known to cause familial cardiomyopathy. We also investigated a panel of 48 known cardiomyopathy genes. Collectively, rare (n = 228, P = 0.0033 or common (n = 36, P = 0.019 variants with elevated in silico severity scores were associated with DCM, indicating that the spectrum of genes contributing to sporadic DCM extends beyond those identified here.We identified eight loci independently associated with sporadic DCM. The functions of the best candidate genes at these loci suggest that proteostasis regulation might play a role in DCM pathophysiology.

  1. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  2. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  3. Effects of 16 genetic variants on fasting glucose and type 2 diabetes in South Asians: ADCY5 and GLIS3 variants may predispose to type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Simon D Rees

    Full Text Available BACKGROUND: The Meta-Analysis of Glucose and Insulin related traits Consortium (MAGIC recently identified 16 loci robustly associated with fasting glucose, some of which were also associated with type 2 diabetes. The purpose of our study was to explore the role of these variants in South Asian populations of Punjabi ancestry, originating predominantly from the District of Mirpur, Pakistan. METHODOLOGY/PRINCIPAL FINDINGS: Sixteen single nucleotide polymorphisms (SNPs were genotyped in 1678 subjects with type 2 diabetes and 1584 normoglycaemic controls from two Punjabi populations; one resident in the UK and one indigenous to the District of Mirpur. In the normoglycaemic controls investigated for fasting glucose associations, 12 of 16 SNPs displayed β values with the same direction of effect as that seen in European studies, although only the SLC30A8 rs11558471 SNP was nominally associated with fasting glucose (β = 0.063 [95% CI: 0.013, 0.113] p = 0.015. Of interest, the MTNR1B rs10830963 SNP displayed a negative β value for fasting glucose in our study; this effect size was significantly lower than that seen in Europeans (p = 1.29×10(-4. In addition to previously reported type 2 diabetes risk variants in TCF7L2 and SLC30A8, SNPs in ADCY5 (rs11708067 and GLIS3 (rs7034200 displayed evidence for association with type 2 diabetes, with odds ratios of 1.23 (95% CI: 1.09, 1.39; p = 9.1×10(-4 and 1.16 (95% CI: 1.05, 1.29; p = 3.49×10(-3 respectively. CONCLUSIONS/SIGNIFICANCE: Although only the SLC30A8 rs11558471 SNP was nominally associated with fasting glucose in our study, the finding that 12 out of 16 SNPs displayed a direction of effect consistent with European studies suggests that a number of these variants may contribute to fasting glucose variation in individuals of South Asian ancestry. We also provide evidence for the first time in South Asians that alleles of SNPs in GLIS3 and ADCY5 may confer risk of type 2 diabetes.

  4. Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

    Science.gov (United States)

    Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

    2009-11-01

    The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

  5. Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

    Directory of Open Access Journals (Sweden)

    Amy J Osborne

    Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

  6. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  7. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  8. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  9. Genetic variants in SLC22A17 and SLC22A7 are associated with anthracycline-induced cardiotoxicity in children

    NARCIS (Netherlands)

    Visscher, Henk; Rassekh, S. Rod; Sandor, George S.; Caron, Huib N.; van Dalen, Elvira C.; Kremer, Leontien C.; van der Pal, Helena J.; Rogers, Paul C.; Rieder, Michael J.; Carleton, Bruce C.; Hayden, Michael R.; Ross, Colin J.; Hayden, Michael; Carleton, Bruce; Ross, Colin; MacLeod, Stuart; Wasserman, Wyeth; Mitton, Craig; Smith, Anne; Hildebrand, Claudette; Pastrana, Lucila Castro; Ghannadan, Reza; Rassekh, Rod; Miao, Fudan; Higginson, Michelle; Borrie, Adrienne; Amstutz, Ursula; Bhavsar, Amit; Nijssen-Jordan, Cheri; Johnson, David; Verbeek, Linda; Kaczowka, Rick; Grundy, Paul; Stobart, Kent; Wilson, Bev; Desai, Sunil; Spavor, Maria; Churcher, Linda; Chow, Terence; Hall, Kevin; Honcharik, Nick; Israels, Sara; Chan, Shanna; Garnham, Byron; Staub, Michelle; Rieder, Michael; Malkin, Becky; Portwine, Carol; Cranston, Amy; Koren, Gideon

    2015-01-01

    To identify novel variants associated with anthracycline-induced cardiotoxicity and to assess these in a genotype-guided risk prediction model. Two cohorts treated for childhood cancer (n = 344 and 218, respectively) were genotyped for 4578 SNPs in drug ADME and toxicity genes. Significant

  10. Population-Specific Resequencing Associates the ATP-Binding Cassette Subfamily C Member 4 Gene With Gout in New Zealand Māori and Pacific Men.

    Science.gov (United States)

    Tanner, Callum; Boocock, James; Stahl, Eli A; Dobbyn, Amanda; Mandal, Asim K; Cadzow, Murray; Phipps-Green, Amanda J; Topless, Ruth K; Hindmarsh, Jennie Harré; Stamp, Lisa K; Dalbeth, Nicola; Choi, Hyon K; Mount, David B; Merriman, Tony R

    2017-07-01

    There is no evidence for a genetic association between organic anion transporters 1-3 (SLC22A6, SLC22A7, and SLC22A8) and multidrug resistance protein 4 (MRP4; encoded by ABCC4) with the levels of serum urate or gout. The Māori and Pacific (Polynesian) population of New Zealand has the highest prevalence of gout worldwide. The aim of this study was to determine whether any Polynesian population-specific genetic variants in SLC22A6-8 and ABCC4 are associated with gout. All participants had ≥3 self-reported Māori and/or Pacific grandparents. Among the total sample set of 1,808 participants, 191 hyperuricemic and 202 normouricemic individuals were resequenced over the 4 genes, and the remaining 1,415 individuals were used for replication. Regression analyses were performed, adjusting for age, sex, and Polynesian ancestry. To study the functional effect of nonsynonymous variants of ABCC4, transport assays were performed in Xenopus laevis oocytes. A total of 39 common variants were detected, with an ABCC4 variant (rs4148500) significantly associated with hyperuricemia and gout. This variant was monomorphic for the urate-lowering allele in Europeans. There was evidence for an association of rs4148500 with gout in the resequenced samples (odds ratio [OR] 1.62 [P = 0.012]) that was replicated (OR 1.25 [P = 0.033]) and restricted to men (OR 1.43 [P = 0.001] versus OR 0.98 [P = 0.89] in women). The gout risk allele was associated with fractional excretion of uric acid in male individuals (β = -0.570 [P = 0.01]). A rare population-specific allele (P1036L) with predicted strong functional consequence reduced the uric acid transport activity of ABCC4 by 30%. An association between ABCC4 and gout and fractional excretion of uric acid is consistent with the established role of MRP4 as a unidirectional renal uric acid efflux pump. © 2017, American College of Rheumatology.

  11. HFE gene variants affect iron in the brain.

    Science.gov (United States)

    Nandar, Wint; Connor, James R

    2011-04-01

    Iron accumulation in the brain and increased oxidative stress are consistent observations in many neurodegenerative diseases. Thus, we have begun examination into gene mutations or allelic variants that could be associated with loss of iron homeostasis. One of the mechanisms leading to iron overload is a mutation in the HFE gene, which is involved in iron metabolism. The 2 most common HFE gene variants are C282Y (1.9%) and H63D (8.9%). The C282Y HFE variant is more commonly associated with hereditary hemochromatosis, which is an autosomal recessive disorder, characterized by iron overload in a number of systemic organs. The H63D HFE variant appears less frequently associated with hemochromatosis, but its role in the neurodegenerative diseases has received more attention. At the cellular level, the HFE mutant protein resulting from the H63D HFE gene variant is associated with iron dyshomeostasis, increased oxidative stress, glutamate release, tau phosphorylation, and alteration in inflammatory response, each of which is under investigation as a contributing factor to neurodegenerative diseases. Therefore, the HFE gene variants are proposed to be genetic modifiers or a risk factor for neurodegenerative diseases by establishing an enabling milieu for pathogenic agents. This review will discuss the current knowledge of the association of the HFE gene variants with neurodegenerative diseases: amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and ischemic stroke. Importantly, the data herein also begin to dispel the long-held view that the brain is protected from iron accumulation associated with the HFE mutations.

  12. Associations of serum uric acid and SLC2A9 variant with depressive and anxiety disorders: a population-based study.

    Directory of Open Access Journals (Sweden)

    Tanica Lyngdoh

    Full Text Available Limited information exists regarding the association between serum uric acid (SUA and psychiatric disorders. We explored the relationship between SUA and subtypes of major depressive disorder (MDD and specific anxiety disorders. Additionally, we examined the association of SLC2A9 rs6855911 variant with anxiety disorders.We conducted a cross-sectional analysis on 3,716 individuals aged 35-66 years previously selected for the population-based CoLaus survey and who agreed to undergo further psychiatric evaluation. SUA was measured using uricase-PAP method. The French translation of the semi-structured Diagnostic Interview for Genetic Studies was used to establish lifetime and current diagnoses of depression and anxiety disorders according to the DSM-IV criteria.Men reported significantly higher levels of SUA compared to women (357±74 µmol/L vs. 263±64 µmol/L. The prevalence of lifetime and current MDD was 44% and 18% respectively while the corresponding estimates for any anxiety disorders were 18% and 10% respectively. A quadratic hockey-stick shaped curve explained the relationship between SUA and social phobia better than a linear trend. However, with regards to the other specific anxiety disorders and other subtypes of MDD, there was no consistent pattern of association. Further analyses using SLC2A9 rs6855911 variant, known to be strongly associated with SUA, supported the quadratic relationship observed between SUA phenotype and social phobia.A quadratic relationship between SUA and social phobia was observed consistent with a protective effect of moderately elevated SUA on social phobia, which disappears at higher concentrations. Further studies are needed to confirm our observations.

  13. Sudden Sensorineural Hearing Loss and Polymorphisms in Iron Homeostasis Genes: New Insights from a Case-Control Study

    Directory of Open Access Journals (Sweden)

    Alessandro Castiglione

    2015-01-01

    Full Text Available Background. Even if various pathophysiological events have been proposed as explanations, the putative cause of sudden hearing loss remains unclear. Objectives. To investigate and to reveal associations (if any between the main iron-related gene variants and idiopathic sudden sensorineural hearing loss. Study Design. Case-control study. Materials and Methods. A total of 200 sudden sensorineural hearing loss patients (median age 63.65 years; range 10–92 were compared with 400 healthy control subjects. The following genetic variants were investigated: the polymorphism c.−8CG in the promoter of the ferroportin gene (FPN1; SLC40A1, the two isoforms C1 and C2 (p.P570S of the transferrin protein (TF, the amino acidic substitutions p.H63D and p.C282Y in the hereditary hemochromatosis protein (HFE, and the polymorphism c.–582AG in the promoter of the HEPC gene, which encodes the protein hepcidin (HAMP. Results. The homozygous genotype c.−8GG of the SLC40A1 gene revealed an OR for ISSNHL risk of 4.27 (CI 95%, 2.65–6.89; P=0.001, being overrepresented among cases. Conclusions. Our study indicates that the homozygous genotype FPN1 −8GG was significantly associated with increased risk of developing sudden hearing loss. These findings suggest new research should be conducted in the field of iron homeostasis in the inner ear.

  14. Molecular basis of albinism in India: evaluation of seven potential candidate genes and some new findings.

    Science.gov (United States)

    Mondal, M; Sengupta, M; Samanta, S; Sil, A; Ray, K

    2012-12-15

    Albinism represents a group of genetic disorders with a broad spectrum of hypopigmentary phenotypes dependent on the genetic background of the patients. Oculocutaneous albinism (OCA) patients have little or no pigment in their eyes, skin and hair, whereas ocular albinism (OA) primarily presents the ocular symptoms, and the skin and hair color may vary from near normal to very fair. Mutations in genes directly or indirectly regulating melanin production are responsible for different forms of albinism with overlapping clinical features. In this study, 27 albinistic individuals from 24 families were screened for causal variants by a PCR-sequencing based approach. TYR, OCA2, TYRP1, SLC45A2, SLC24A5, TYRP2 and SILV were selected as candidate genes. We identified 5 TYR and 3 OCA2 mutations, majority in homozygous state, in 8 unrelated patients including a case of autosomal recessive ocular albinism (AROA). A homozygous 4-nucleotide novel insertion in SLC24A5 was detected in a person showing with extreme cutaneous hypopigmentation. A potential causal variant was identified in the TYRP2 gene in a single patient. Haplotype analyses in the patients carrying homozygous mutations in the classical OCA genes suggested founder effect. This is the first report of an Indian AROA patient harboring a mutation in OCA2. Our results also reveal for the first time that mutations in SLC24A5 could contribute to extreme hypopigmentation in humans. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  16. Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

    Science.gov (United States)

    Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

    2016-10-01

    The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

  17. MYO7A and USH2A gene sequence variants in Italian patients with Usher syndrome.

    Science.gov (United States)

    Sodi, Andrea; Mariottini, Alessandro; Passerini, Ilaria; Murro, Vittoria; Tachyla, Iryna; Bianchi, Benedetta; Menchini, Ugo; Torricelli, Francesca

    2014-01-01

    To analyze the spectrum of sequence variants in the MYO7A and USH2A genes in a group of Italian patients affected by Usher syndrome (USH). Thirty-six Italian patients with a diagnosis of USH were recruited. They received a standard ophthalmologic examination, visual field testing, optical coherence tomography (OCT) scan, and electrophysiological tests. Fluorescein angiography and fundus autofluorescence imaging were performed in selected cases. All the patients underwent an audiologic examination for the 0.25-8,000 Hz frequencies. Vestibular function was evaluated with specific tests. DNA samples were analyzed for sequence variants of the MYO7A gene (for USH1) and the USH2A gene (for USH2) with direct sequencing techniques. A few patients were analyzed for both genes. In the MYO7A gene, ten missense variants were found; three patients were compound heterozygous, and two were homozygous. Thirty-four USH2A gene variants were detected, including eight missense variants, nine nonsense variants, six splicing variants, and 11 duplications/deletions; 19 patients were compound heterozygous, and three were homozygous. Four MYO7A and 17 USH2A variants have already been described in the literature. Among the novel mutations there are four USH2A large deletions, detected with multiplex ligation dependent probe amplification (MLPA) technology. Two potentially pathogenic variants were found in 27 patients (75%). Affected patients showed variable clinical pictures without a clear genotype-phenotype correlation. Ten variants in the MYO7A gene and 34 variants in the USH2A gene were detected in Italian patients with USH at a high detection rate. A selective analysis of these genes may be valuable for molecular analysis, combining diagnostic efficiency with little time wastage and less resource consumption.

  18. Effects of Genotype and Child Abuse on DNA Methylation and Gene Expression at the Serotonin Transporter

    Directory of Open Access Journals (Sweden)

    Meeshanthini eVijayendran

    2012-06-01

    Full Text Available Altered regulation of the serotonin transporter (SLC6A4 is hypothesized to be a key event in many forms of neuropsychiatric illness, yet our understanding of the molecular mechanisms through which changes in gene function could lead to illness remains incomplete. In prior studies, we and others have demonstrated that methylation of CpG residues in the promoter associated CpG island alters SLC6A4 gene expression, that the extent of that DNA methylation in child abuse is genotype dependent, and that adverse childhood experiences such as child sex abuse are related to methylation. However, we have not examined whether these effects are splice variant specific, whether the association of methylation to gene expression varies as a function of genotype, and whether methylation in other SLC6A4 gene regions are more likely candidates for GxE effects. In the current investigation we measured methylation in lymphoblast DNA from 158 female subjects in the Iowa Adoption Studies at 16 CpG residues spread across the SLC6A4 locus, and analyzed their relationship to gene expression for two SLC6A4 splice variants. Methylation of two CpG residues in the shore of the CpG island (cg22584138 and cg05951817, a location immediately upstream from exon 1A, predicted gene expression for the splice variant containing Exon 1A + 1B. Methylation at two residues in the CpG island itself (cg 25769822 and cg05016953 was associated with total SLC6A4 expression. Examination of these four CpG residues indicated that methylation of cg22584138 was influenced by both genotype and sex abuse, whereas methylation of cg05016953 was influenced only by sex abuse history. Factors influencing methylation at other CpG dinucleotide pairs were not identified. We conclude that methylation effects on transcription may vary as a function of underlying gene motif and splice variant, and that the shore of CpG islands, upstream of TSS, may be of particular interest in examining environmental effects

  19. Deleterious genetic variants in ciliopathy genes increase risk of ritodrine-induced cardiac and pulmonary side effects.

    Science.gov (United States)

    Seo, Heewon; Kwon, Eun Jin; You, Young-Ah; Park, Yoomi; Min, Byung Joo; Yoo, Kyunghun; Hwang, Han-Sung; Kim, Ju Han; Kim, Young Ju

    2018-01-24

    Ritodrine is a commonly used tocolytic to prevent preterm labour. However, it can cause unexpected serious adverse reactions, such as pulmonary oedema, pulmonary congestion, and tachycardia. It is unknown whether such adverse reactions are associated with pharmacogenomic variants in patients. Whole-exome sequencing of 13 subjects with serious ritodrine-induced cardiac and pulmonary side-effects was performed to identify causal genes and variants. The deleterious impact of nonsynonymous substitutions for all genes was computed and compared between cases (n = 13) and controls (n = 30). The significant genes were annotated with Gene Ontology (GO), and the associated disease terms were categorised into four functional classes for functional enrichment tests. To assess the impact of distributed rare variants in cases with side effects, we carried out rare variant association tests with a minor allele frequency ≤ 1% using the burden test, the sequence Kernel association test (SKAT), and optimised SKAT. We identified 28 genes that showed significantly lower gene-wise deleteriousness scores in cases than in controls. Three of the identified genes-CYP1A1, CYP8B1, and SERPINA7-are pharmacokinetic genes. The significantly identified genes were categorized into four functional classes: ion binding, ATP binding, Ca 2+ -related, and ciliopathies-related. These four classes were significantly enriched with ciliary genes according to SYSCILIA Gold Standard genes (P side effects may be associated with deleterious genetic variants in ciliary and pharmacokinetic genes.

  20. Replication and Relevance of Multiple Susceptibility Loci Discovered from Genome Wide Association Studies for Type 2 Diabetes in an Indian Population.

    Directory of Open Access Journals (Sweden)

    Nagaraja M Phani

    Full Text Available Several genetic variants for type 2 diabetes (T2D have been identified through genome wide association studies (GWAS from Caucasian population; however replication studies were not consistent across various ethnicities. Objective of the current study is to examine the possible correlation of 9 most significant GWAS single nucleotide polymorphisms (SNPs for T2D susceptibility as well as the interactive effect of these variants on the risk of T2D in an Indian population.Case-control cohorts of 1156 individuals were genotyped for 9 SNPs from an Indian population. Association analyses were performed using logistic regression after adjusting for covariates. Multifactor dimensionality reduction (MDR analysis was adopted to determine gene-gene interactions and discriminatory power of combined SNP effect was assessed by grouping individuals based on the number of risk alleles and by calculating area under the receiver-operator characteristic curve (AUC.We confirm the association of TCF7L2 (rs7903146 and SLC30A8 (rs13266634 with T2D. MDR analysis showed statistically significant interactions among four SNPs of SLC30A8 (rs13266634, IGF2BP2 (rs4402960, HHEX (rs1111875 and CDKN2A (rs10811661 genes. Cumulative analysis showed an increase in odds ratio against the baseline group of individuals carrying 5 to 6 risk alleles and discriminatory power of genetic test based on 9 variants showed higher AUC value when analyzed along with body mass index (BMI.These results provide a strong evidence for independent association between T2D and SNPs for in TCF7L2 and SLC30A8. MDR analysis demonstrates that independently non-significant variants may interact with one another resulting in increased disease susceptibility in the population tested.

  1. Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

    Science.gov (United States)

    Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

    2016-08-01

    The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

  2. Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions.

    Science.gov (United States)

    Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel

    2015-07-15

    Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

  3. The longitudinal association of common susceptibility variants for type 2 diabetes and obesity with fasting glucose level and BMI

    Directory of Open Access Journals (Sweden)

    Beilby John P

    2010-10-01

    Full Text Available Abstract Background Variation in the effects of genetic variants on physiological traits over time or with age may alter the trajectories of these traits. However, few studies have investigated this possibility for variants associated with type 2 diabetes or obesity, and these show little consensus. We aimed to characterise the possible longitudinal associations of common diabetes-susceptibility variants in the KCNJ11, PPARG, TCF7L2, IGF2BP2, CDKAL1, SLC30A8 and HHEX gene loci, with fasting glucose level; and of an obesity-associated variant in the FTO gene, with body mass index (BMI. Methods The study analysed data from the Busselton Health Study (n = 4,554. Cross-sectional association analyses included family data and used the total association test. Longitudinal association analyses of unrelated participant data (n = 2,864 used linear mixed-effects models. Results In cross-sectional analyses, we observed associations of the T allele at the IGF2BP2 single nucleotide polymorphism (SNP rs4402960 with raised fasting glucose (p = 0.045, and the A allele at the FTO SNP rs9939609 with raised BMI (p = 0.003. Longitudinal analyses showed no significant associations between SNPs and changes in fasting glucose or BMI in the same individuals, either over mean follow-up times of 18.7 and 21.8 years respectively, or with age during adulthood. Conclusions There was no indication that the effects of common type 2 diabetes variants on fasting glucose varied with age during adulthood or over time.

  4. A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.

    Science.gov (United States)

    Wijesena, Hiruni R; Schmutz, Sheila M

    2015-01-01

    Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  6. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    Science.gov (United States)

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  8. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  9. Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Robb

    Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.

  10. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  11. Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

    2010-01-01

    Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

  12. DiffSLC: A graph centrality method to detect essential proteins of a protein-protein interaction network.

    Science.gov (United States)

    Mistry, Divya; Wise, Roger P; Dickerson, Julie A

    2017-01-01

    Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be

  13. In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines

    Directory of Open Access Journals (Sweden)

    Shreya M. Patel

    2015-09-01

    Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.

  14. Detection of two non-synonymous SNPs in SLC45A2 on BTA20 as candidate causal mutations for oculocutaneous albinism in Braunvieh cattle.

    Science.gov (United States)

    Rothammer, Sophie; Kunz, Elisabeth; Seichter, Doris; Krebs, Stefan; Wassertheurer, Martina; Fries, Ruedi; Brem, Gottfried; Medugorac, Ivica

    2017-10-05

    Cases of albinism have been reported in several species including cattle. So far, research has identified many genes that are involved in this eye-catching phenotype. Thus, when two paternal Braunvieh half-sibs with oculocutaneous albinism were detected on a private farm, we were interested in knowing whether their phenotype was caused by an already known gene/mutation. Analysis of genotyping data (50K) of the two albino individuals, their mothers and five other relatives identified a 47.61-Mb candidate haplotype on Bos taurus chromosome BTA20. Subsequent comparisons of the sequence of this haplotype with sequence data from four Braunvieh sires and the Aurochs genome identified two possible candidate causal mutations at positions 39,829,806 bp (G/A; R45Q) and 39,864,148 bp (C/T; T444I) that were absent in 1682 animals from various bovine breeds included in the 1000 bull genomes project. Both polymorphisms represent coding variants in the SLC45A2 gene, for which the human equivalent harbors numerous variants associated with oculocutaneous albinism type 4. We demonstrate an association of R45Q and T444I with the albino phenotype by targeted genotyping. Although the candidate gene SLC45A2 is known to be involved in albinism in different species, to date in cattle only mutations in the TYR and MITF genes were reported to be associated with albinism or albinism-like phenotypes. Thus, our study extends the list of genes that are associated with bovine albinism. However, further research and more samples from related animals are needed to elucidate if only one of these two single nucleotide polymorphisms or the combination of both is the actual causal variant.

  15. Identification of Five Novel Variants in Chinese Oculocutaneous Albinism by Targeted Next-Generation Sequencing.

    Science.gov (United States)

    Qiu, Biyuan; Ma, Tao; Peng, Chunyan; Zheng, Xiaoqin; Yang, Jiyun

    2018-04-01

    The diagnosis of oculocutaneous albinism (OCA) is established using clinical signs and symptoms. OCA is, however, a highly genetically heterogeneous disease with mutations identified in at least nineteen unique genes, many of which produce overlapping phenotypic traits. Thus, differentiating genetic OCA subtypes for diagnoses and genetic counseling is challenging, based on clinical presentation alone, and would benefit from a comprehensive molecular diagnostic. To develop and validate a more comprehensive, targeted, next-generation-sequencing-based diagnostic for the identification of OCA-causing variants. The genomic DNA samples from 28 OCA probands were analyzed by targeted next-generation sequencing (NGS), and the candidate variants were confirmed through Sanger sequencing. We observed mutations in the TYR, OCA2, and SLC45A2 genes in 25/28 (89%) patients with OCA. We identified 38 pathogenic variants among these three genes, including 5 novel variants: c.1970G>T (p.Gly657Val), c.1669A>C (p.Thr557Pro), c.2339-2A>C, and c.1349C>G (p.Thr450Arg) in OCA2; c.459_470delTTTTGCTGCCGA (p.Ala155_Phe158del) in SLC45A2. Our findings expand the mutational spectrum of OCA in the Chinese population, and the assay we developed should be broadly useful as a molecular diagnostic, and as an aid for genetic counseling for OCA patients.

  16. Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

    Science.gov (United States)

    Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

    2017-07-01

    Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

  17. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  18. Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

    Science.gov (United States)

    Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

    2017-01-01

    We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  19. Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

    Science.gov (United States)

    Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

    2001-09-01

    Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

  20. Association between gene variants and response to buprenorphine maintenance treatment.

    Science.gov (United States)

    Gerra, Gilberto; Somaini, Lorenzo; Leonardi, Claudio; Cortese, Elena; Maremmani, Icro; Manfredini, Matteo; Donnini, Claudia

    2014-01-30

    A variety of studies were addressed to differentiate responders and non-responders to substitution treatment among heroin dependent patients, without conclusive findings. In particular, preliminary pharmacogenetic findings have been reported to predict treatment effectiveness in mental health and substance use disorders. Aim of the present study was to investigate the possible association of buprenorphine (BUP) treatment outcome with gene variants that may affect kappa-opioid receptors and dopamine system function. One hundred and seven heroin addicts (West European, Caucasians) who underwent buprenorphine maintenance treatment were genotyped and classified into two groups (A and B) on the basis of treatment outcome. Non-responders to buprenorphine (group B) have been identified taking into account early drop out, continuous use of heroin, severe behavioral or psychiatric problems, misbehavior and diversion during the 6 months treatment period. No difference was evidenced between responders and non-responders to BUP in the frequency of kappa opioid receptor (OPRK1) 36G>T SNP. The frequency of dopamine transporter (DAT) gene polymorphism (SLC6A3/DAT1), allele 10, was evidently much higher in "non-responder" than in "responder" individuals (64.9% vs. 55.93%) whereas the frequency of the category of other alleles (6, 7 and 11) was higher in responder than in non-responder individuals (11.02% vs. 2.13% respectively). On one hand, the hypothesis that possible gene-related changes in kappa-opioid receptor could consistently affect buprenorphine pharmacological action and clinical effectiveness was not confirmed in our study, at least in relation to the single nucleotide polymorphism 36G>T. On the other hand, the possibility that gene-related dopamine changes could have reduced BUP effectiveness and impaired maintenance treatment outcome was cautiously supported by our findings. DAT1 gene variants such as allele 10, previously reported in association with personality and

  1. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Bianca Maria Rotoli

    2018-03-01

    Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.

  2. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  3. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  4. The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

    1995-12-10

    The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

  5. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  6. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Genetic variation of the GLUT10 glucose transporter (SLC2A10) and relationships to type 2 diabetes and intermediary traits

    DEFF Research Database (Denmark)

    Andersen, Gitte; Rose, Christian Schack; Hamid, Yasmin Hassan

    2003-01-01

    The SLC2A10 gene encodes the GLUT10 facilitative glucose transporter, which is expressed in high amounts in liver and pancreas. The gene is mapped to chromosome 20q12-q13.1, a region that has been shown to be linked to type 2 diabetes. The gene was examined in 61 Danish type 2 diabetic patients......, and a total of six variants (-27C-->T, Ala206Thr, Ala272Ala, IVS2 + 10G-->A, IVS4 + 18T-->G, and IVS4 + 26G-->A) were identified and investigated in an association study, which included 503 type 2 diabetic patients and 510 glucose-tolerant control subjects. None of the variants were associated with type 2...... substantially to the pathogenesis of type 2 diabetes in the examined study population. However, the codon 206 polymorphism may be related to the interindividual variation in fasting and oral glucose-induced serum insulin levels....

  8. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  9. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  10. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  11. Analysis of protein-altering variants in telomerase genes and their association with MUC5B common variant status in patients with idiopathic pulmonary fibrosis: a candidate gene sequencing study.

    Science.gov (United States)

    Dressen, Amy; Abbas, Alexander R; Cabanski, Christopher; Reeder, Janina; Ramalingam, Thirumalai R; Neighbors, Margaret; Bhangale, Tushar R; Brauer, Matthew J; Hunkapiller, Julie; Reeder, Jens; Mukhyala, Kiran; Cuenco, Karen; Tom, Jennifer; Cowgill, Amy; Vogel, Jan; Forrest, William F; Collard, Harold R; Wolters, Paul J; Kropski, Jonathan A; Lancaster, Lisa H; Blackwell, Timothy S; Arron, Joseph R; Yaspan, Brian L

    2018-06-08

    Idiopathic pulmonary fibrosis (IPF) risk has a strong genetic component. Studies have implicated variations at several loci, including TERT, surfactant genes, and a single nucleotide polymorphism at chr11p15 (rs35705950) in the intergenic region between TOLLIP and MUC5B. Patients with IPF who have risk alleles at rs35705950 have longer survival from the time of IPF diagnosis than do patients homozygous for the non-risk allele, whereas patients with shorter telomeres have shorter survival times. We aimed to assess whether rare protein-altering variants in genes regulating telomere length are enriched in patients with IPF homozygous for the non-risk alleles at rs35705950. Between Nov 1, 2014, and Nov 1, 2016, we assessed blood samples from patients aged 40 years or older and of European ancestry with sporadic IPF from three international phase 3 clinical trials (INSPIRE, CAPACITY, ASCEND), one phase 2 study (RIFF), and US-based observational studies (Vanderbilt Clinical Interstitial Lung Disease Registry and the UCSF Interstitial Lung Disease Clinic registry cohorts) at the Broad Institute (Cambridge, MA, USA) and Human Longevity (San Diego, CA, USA). We also assessed blood samples from non-IPF controls in several clinical trials. We did whole-genome sequencing to assess telomere length and identify rare protein-altering variants, stratified by rs35705950 genotype. We also assessed rare functional variation in TERT exons and compared telomere length and disease progression across genotypes. We assessed samples from 1510 patients with IPF and 1874 non-IPF controls. 30 (3%) of 1046 patients with an rs35705950 risk allele had a rare protein-altering variant in TERT compared with 34 (7%) of 464 non-risk allele carriers (odds ratio 0·40 [95% CI 0·24-0·66], p=0·00039). Subsequent analyses identified enrichment of rare protein-altering variants in PARN and RTEL1, and rare variation in TERC in patients with IPF compared with controls. We expanded our study population to

  12. Lack of association between VNTR polymorphism of dopamine transporter gene (SLC6A3 and schizophrenia in a Brazilian sample Ausência de associação entre o polimorfismo VNTR do gene do transportador de dopamina (SLC6A3 e esquizofrenia em uma população brasileira

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2004-12-01

    Full Text Available A role of dopaminergic dysfunction has been postulated in the aetiology of schizophrenia. We hypothesized that variations in the dopamine transporter gene (SLC6A3 may be associated with schizophrenia. We conducted case-control and family based analysis on the polymorphic SLC6A3 variable number tandem repeat (VNTR in a sample of 220 schizophrenic patients, 226 gender and ethnic matched controls, and 49 additional case-parent trios. No differences were found in allelic or genotypic distributions between cases and controls and no significant transmission distortions from heterozygous parents to schizophrenic offspring were detected. Thus, our results do not support an association of the SLC6A3 VNTR with schizophrenia in our sample.Genes do sistema dopaminérgico são de escolha para a pesquisa de susceptibilidade para a esquizofrenia. Desse modo, possível contribuição do polimorfismo do gene do transportador de dopamina (SLC6A3 no aumento da vulnerabilidade para a esquizofrenia foi investigada no presente estudo. Analisou-se a distribuição do sítio polimórfico do gene do transportador de dopamina (VNTR em uma população de 220 pacientes com esquizofrenia (critério diagnóstico: DSM-IV e comparou-se com a distribuição em uma população controle de 226 indivíduos pareados para sexo e etnia. Nenhuma diferença foi observada na distribuição dos alelos entre casos e controles. O mesmo polimorfismo também foi investigado em uma segunda amostra composta por 49 trios (pais e probando. O resultado também foi negativo. Tais dados não dão suporte para a participação do polimorfismo do gene do transportador de dopamina no aumento de susceptibilidade para esquizofrenia na amostra estudada.

  13. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  14. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  15. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  16. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  17. Common variants at the CHEK2 gene locus and risk of epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Lawrenson, Kate; Iversen, Edwin S; Tyrer, Jonathan

    2015-01-01

    genes and EOC risk. We genotyped 2896 common variants at 143 gene loci in DNA samples from 15 397 patients with invasive EOC and controls. We found evidence of associations with EOC risk for variants at FANCA, EXO1, E2F4, E2F2, CREB5 and CHEK2 genes (P ≤ 0.001). The strongest risk association......, CHEK2 gene expression was significantly higher in primary EOCs compared to normal fallopian tube tissues (P = 3.72×10(-8)). We also identified an association between genotypes of the candidate causal SNP rs12166475 (r (2) = 0.99 with rs6005807) and CHEK2 expression (P = 2.70×10(-8)). These data suggest...... that common variants at 22q12.1 are associated with risk of serous EOC and CHEK2 as a plausible target susceptibility gene....

  18. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  19. [The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

    Science.gov (United States)

    Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

    2014-01-01

    We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

  20. A global evolutionary and metabolic analysis of human obesity gene risk variants.

    Science.gov (United States)

    Castillo, Joseph J; Hazlett, Zachary S; Orlando, Robert A; Garver, William S

    2017-09-05

    It is generally accepted that the selection of gene variants during human evolution optimized energy metabolism that now interacts with our obesogenic environment to increase the prevalence of obesity. The purpose of this study was to perform a global evolutionary and metabolic analysis of human obesity gene risk variants (110 human obesity genes with 127 nearest gene risk variants) identified using genome-wide association studies (GWAS) to enhance our knowledge of early and late genotypes. As a result of determining the mean frequency of these obesity gene risk variants in 13 available populations from around the world our results provide evidence for the early selection of ancestral risk variants (defined as selection before migration from Africa) and late selection of derived risk variants (defined as selection after migration from Africa). Our results also provide novel information for association of these obesity genes or encoded proteins with diverse metabolic pathways and other human diseases. The overall results indicate a significant differential evolutionary pattern for the selection of obesity gene ancestral and derived risk variants proposed to optimize energy metabolism in varying global environments and complex association with metabolic pathways and other human diseases. These results are consistent with obesity genes that encode proteins possessing a fundamental role in maintaining energy metabolism and survival during the course of human evolution. Copyright © 2017. Published by Elsevier B.V.

  1. A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Naila Al Mahmuda

    2016-05-01

    Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

  2. Physiology of SLC12 transporters: lessons from inherited human genetic mutations and genetically engineered mouse knockouts.

    Science.gov (United States)

    Gagnon, Kenneth B; Delpire, Eric

    2013-04-15

    Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.

  3. Association studies of novel obesity-related gene variants with quantitative metabolic phenotypes in a population-based sample of 6,039 Danish individuals

    DEFF Research Database (Denmark)

    Burgdorf, K S; Gjesing, A P; Grarup, N

    2012-01-01

    .0011) using the HOMA-insulin resistance (HOMA-IR) index and a 2.2% reduction (p = 0.0014) with the Matsuda index. Of the variants associated with WHR, LYPLAL1/SLC30A10 rs4846567 G allele carriers showed a 5.2% lower HOMA-IR (p = 0.00086) in women, indicating improved insulin sensitivity. Female carriers...... of the VEGFA rs6905288 A allele were insulin resistant, with a 3.7% increase in HOMA-IR (p = 0.00036) and 4.0% decrease in Matsuda index (p = 2 x 10(-4)). Our correlative findings from analysing single-locus data suggest that some variation in validated BMI and WHR loci are associated with either increased...

  4. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  5. Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

    Science.gov (United States)

    De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

    2013-07-01

    Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

  6. Identification of polymorphism in the SCL24A5 gene of cattle

    Directory of Open Access Journals (Sweden)

    Paola Crepaldi

    2010-01-01

    Full Text Available The SLC24A5 (Solute Carrier family 24, member 5 gene is implicated in skin pigmentation in zebrafish and humans as it regulates the morphogenesis of melanosomes, specialized lysosomes involved in melanin deposit. In humans, the ancestral allele predominates in African and East Asian populations, while the allelic variant is nearly fixed in European populations and correlates with lighter pigmentation. Considering the role of melanin in the protecting of DNA from ultraviolet radiation, the lack of information in cattle and the importance of polymorphisms associated with pigmentation phenotypes, we investigated the SLC24A5 gene in cattle with light and dark skin pigmentation. To identify SNPs (Single Nucleotide Polymorphisms in this gene and their association to dark skin pigmentation in cattle, each of the nine SLC24A5 exons, three introns (1, 3 and 8 and a portion of intron 5, were sequenced in a set of sixteen animals belonging to four Italian cattle breeds, two African zebu breeds and two African sanga breeds. The region spanning exons 3 and 4 was sequenced in fifteen animals belonging to seven additional breeds. A total of sixteen SNPs were identified: eleven positioned in introns (six in intron 1, one in intron 5 and four in intron 8 and five in exons (one in exon 1, two in exon 6 and two in exon 7. Three SNPs (located in exons 1, 6 and 7 were non synonymous, determining Pro19Leu, Ala238Val, and Met341Ile amino acid changes, respectively. All the SNPs identified were polymorphic between Bos taurus, Bos indicus and Sanga, while none of them resulted associated with the studied phenotype and discriminated the three breeds (Chianina, Mucubal and Goudali characterized by dark pigmented skin from the others.

  7. GxGrare: gene-gene interaction analysis method for rare variants from high-throughput sequencing data.

    Science.gov (United States)

    Kwon, Minseok; Leem, Sangseob; Yoon, Joon; Park, Taesung

    2018-03-19

    With the rapid advancement of array-based genotyping techniques, genome-wide association studies (GWAS) have successfully identified common genetic variants associated with common complex diseases. However, it has been shown that only a small proportion of the genetic etiology of complex diseases could be explained by the genetic factors identified from GWAS. This missing heritability could possibly be explained by gene-gene interaction (epistasis) and rare variants. There has been an exponential growth of gene-gene interaction analysis for common variants in terms of methodological developments and practical applications. Also, the recent advancement of high-throughput sequencing technologies makes it possible to conduct rare variant analysis. However, little progress has been made in gene-gene interaction analysis for rare variants. Here, we propose GxGrare which is a new gene-gene interaction method for the rare variants in the framework of the multifactor dimensionality reduction (MDR) analysis. The proposed method consists of three steps; 1) collapsing the rare variants, 2) MDR analysis for the collapsed rare variants, and 3) detect top candidate interaction pairs. GxGrare can be used for the detection of not only gene-gene interactions, but also interactions within a single gene. The proposed method is illustrated with 1080 whole exome sequencing data of the Korean population in order to identify causal gene-gene interaction for rare variants for type 2 diabetes. The proposed GxGrare performs well for gene-gene interaction detection with collapsing of rare variants. GxGrare is available at http://bibs.snu.ac.kr/software/gxgrare which contains simulation data and documentation. Supported operating systems include Linux and OS X.

  8. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  9. Association Study with 77 SNPs Confirms the Robust Role for the rs10830963/G of MTNR1B Variant and Identifies Two Novel Associations in Gestational Diabetes Mellitus Development.

    Directory of Open Access Journals (Sweden)

    Klara Rosta

    Full Text Available Genetic variation in human maternal DNA contributes to the susceptibility for development of gestational diabetes mellitus (GDM.We assessed 77 maternal single nucleotide gene polymorphisms (SNPs for associations with GDM or plasma glucose levels at OGTT in pregnancy.960 pregnant women (after dropouts 820: case/control: m99'WHO: 303/517, IADPSG: 287/533 were enrolled in two countries into this case-control study. After genomic DNA isolation the 820 samples were collected in a GDM biobank and assessed using KASP (LGC Genomics genotyping assay. Logistic regression risk models were used to calculate ORs according to IADPSG/m'99WHO criteria based on standard OGTT values.The most important risk alleles associated with GDM were rs10830963/G of MTNR1B (OR = 1.84/1.64 [IADPSG/m'99WHO], p = 0.0007/0.006, rs7754840/C (OR = 1.51/NS, p = 0.016 of CDKAL1 and rs1799884/T (OR = 1.4/1.56, p = 0.04/0.006 of GCK. The rs13266634/T (SLC30A8, OR = 0.74/0.71, p = 0.05/0.02 and rs7578326/G (LOC646736/IRS1, OR = 0.62/0.60, p = 0.001/0.006 variants were associated with lower risk to develop GDM. Carrying a minor allele of rs10830963 (MTNR1B; rs7903146 (TCF7L2; rs1799884 (GCK SNPs were associated with increased plasma glucose levels at routine OGTT.We confirmed the robust association of MTNR1B rs10830963/G variant with GDM binary and glycemic traits in this Caucasian case-control study. As novel associations we report the minor, G allele of the rs7578326 SNP in the LOC646736/IRS1 region as a significant and the rs13266634/T SNP (SLC30A8 as a suggestive protective variant against GDM development. Genetic susceptibility appears to be more preponderant in individuals who meet both the modified 99'WHO and the IADPSG GDM diagnostic criteria.

  10. Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

    Science.gov (United States)

    Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

    2018-06-15

    Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

  11. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  12. Comprehensive evaluation of one-carbon metabolism pathway gene variants and renal cell cancer risk.

    Directory of Open Access Journals (Sweden)

    Todd M Gibson

    Full Text Available Folate and one-carbon metabolism are linked to cancer risk through their integral role in DNA synthesis and methylation. Variation in one-carbon metabolism genes, particularly MTHFR, has been associated with risk of a number of cancers in epidemiologic studies, but little is known regarding renal cancer.Tag single nucleotide polymorphisms (SNPs selected to produce high genomic coverage of 13 gene regions of one-carbon metabolism (ALDH1L1, BHMT, CBS, FOLR1, MTHFR, MTR, MTRR, SHMT1, SLC19A1, TYMS and the closely associated glutathione synthesis pathway (CTH, GGH, GSS were genotyped for 777 renal cell carcinoma (RCC cases and 1,035 controls in the Central and Eastern European Renal Cancer case-control study. Associations of individual SNPs (n = 163 with RCC risk were calculated using unconditional logistic regression adjusted for age, sex and study center. Minimum p-value permutation (Min-P tests were used to identify gene regions associated with risk, and haplotypes were evaluated within these genes.The strongest associations with RCC risk were observed for SLC19A1 (P(min-P = 0.03 and MTHFR (P(min-P = 0.13. A haplotype consisting of four SNPs in SLC19A1 (rs12483553, rs2838950, rs2838951, and rs17004785 was associated with a 37% increased risk (p = 0.02, and exploratory stratified analysis suggested the association was only significant among those in the lowest tertile of vegetable intake.To our knowledge, this is the first study to comprehensively examine variation in one-carbon metabolism genes in relation to RCC risk. We identified a novel association with SLC19A1, which is important for transport of folate into cells. Replication in other populations is required to confirm these findings.

  13. Solute Carrier Family 26 Member a2 (slc26a2 Regulates Otic Development and Hair Cell Survival in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Fei Liu

    Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.

  14. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

    Science.gov (United States)

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-09-30

    Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

  15. Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

    Directory of Open Access Journals (Sweden)

    MyPhuong T Le

    Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

  16. Neuropathological characteristics of the brain in two patients with SLC19A3 mutations related to the biotin-thiamine-responsive basal ganglia disease

    Directory of Open Access Journals (Sweden)

    Maciej Pronicki

    2017-06-01

    Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.

  17. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

  19. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  20. Common variants at the CHEK2 gene locus and risk of epithelial ovarian cancer.

    Science.gov (United States)

    Lawrenson, Kate; Iversen, Edwin S; Tyrer, Jonathan; Weber, Rachel Palmieri; Concannon, Patrick; Hazelett, Dennis J; Li, Qiyuan; Marks, Jeffrey R; Berchuck, Andrew; Lee, Janet M; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bandera, Elisa V; Bean, Yukie; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bruinsma, Fiona; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Chen, Ann; Chen, Zhihua; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Plisiecka-Halasa, Joanna; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; du Bois, Andreas; Eccles, Diana; Easton, Douglas T; Edwards, Robert P; Eilber, Ursula; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goode, Ellen L; Goodman, Marc T; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis Nazihah; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus; Hosono, Satoyo; Jakubowska, Anna; Paul, James; Jensen, Allan; Karlan, Beth Y; Kjaer, Susanne Kruger; Kelemen, Linda E; Kellar, Melissa; Kelley, Joseph L; Kiemeney, Lambertus A; Krakstad, Camilla; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Cannioto, Rikki; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; Nevanlinna, Heli; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B; Narod, Steven A; Nedergaard, Lotte; Ness, Roberta B; Noor Azmi, Mat Adenan; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Permuth-Wey, Jennifer; Phelan, Catherine M; Pike, Malcolm C; Poole, Elizabeth M; Ramus, Susan J; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Budzilowska, Agnieszka; Sellers, Thomas A; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Sucheston, Lara; Tangen, Ingvild L; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Timorek, Agnieszka; Tworoger, Shelley S; Van Nieuwenhuysen, Els; Vergote, Ignace; Vierkant, Robert A; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna H; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Coetzee, Gerhard A; Freedman, Matthew L; Monteiro, Alvaro N A; Moes-Sosnowska, Joanna; Kupryjanczyk, Jolanta; Pharoah, Paul D; Gayther, Simon A; Schildkraut, Joellen M

    2015-11-01

    Genome-wide association studies have identified 20 genomic regions associated with risk of epithelial ovarian cancer (EOC), but many additional risk variants may exist. Here, we evaluated associations between common genetic variants [single nucleotide polymorphisms (SNPs) and indels] in DNA repair genes and EOC risk. We genotyped 2896 common variants at 143 gene loci in DNA samples from 15 397 patients with invasive EOC and controls. We found evidence of associations with EOC risk for variants at FANCA, EXO1, E2F4, E2F2, CREB5 and CHEK2 genes (P ≤ 0.001). The strongest risk association was for CHEK2 SNP rs17507066 with serous EOC (P = 4.74 x 10(-7)). Additional genotyping and imputation of genotypes from the 1000 genomes project identified a slightly more significant association for CHEK2 SNP rs6005807 (r (2) with rs17507066 = 0.84, odds ratio (OR) 1.17, 95% CI 1.11-1.24, P = 1.1×10(-7)). We identified 293 variants in the region with likelihood ratios of less than 1:100 for representing the causal variant. Functional annotation identified 25 candidate SNPs that alter transcription factor binding sites within regulatory elements active in EOC precursor tissues. In The Cancer Genome Atlas dataset, CHEK2 gene expression was significantly higher in primary EOCs compared to normal fallopian tube tissues (P = 3.72×10(-8)). We also identified an association between genotypes of the candidate causal SNP rs12166475 (r (2) = 0.99 with rs6005807) and CHEK2 expression (P = 2.70×10(-8)). These data suggest that common variants at 22q12.1 are associated with risk of serous EOC and CHEK2 as a plausible target susceptibility gene. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Yan Xiaofei

    2011-09-01

    Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

  2. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Science.gov (United States)

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  3. Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

    Directory of Open Access Journals (Sweden)

    Hsin-Chou Yang

    Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

  4. Looking on the bright side of serotonin transporter gene variation.

    NARCIS (Netherlands)

    Homberg, J.R.; Lesch, K.P.

    2011-01-01

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for

  5. Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Māori, Pacific Island, and Caucasian case-control sample sets.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R

    2009-11-01

    To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.

  6. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    Directory of Open Access Journals (Sweden)

    Nancy D Merner

    2015-10-01

    Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.

  7. Microsatellite Instability Use in Mismatch Repair Gene Sequence Variant Classification

    Directory of Open Access Journals (Sweden)

    Bryony A. Thompson

    2015-03-01

    Full Text Available Inherited mutations in the DNA mismatch repair genes (MMR can cause MMR deficiency and increased susceptibility to colorectal and endometrial cancer. Microsatellite instability (MSI is the defining molecular signature of MMR deficiency. The clinical classification of identified MMR gene sequence variants has a direct impact on the management of patients and their families. For a significant proportion of cases sequence variants of uncertain clinical significance (also known as unclassified variants are identified, constituting a challenge for genetic counselling and clinical management of families. The effect on protein function of these variants is difficult to interpret. The presence or absence of MSI in tumours can aid in determining the pathogenicity of associated unclassified MMR gene variants. However, there are some considerations that need to be taken into account when using MSI for variant interpretation. The use of MSI and other tumour characteristics in MMR gene sequence variant classification will be explored in this review.

  8. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  9. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  10. The SLC24 gene family of Na⁺/Ca²⁺-K⁺ exchangers: from sight and smell to memory consolidation and skin pigmentation.

    Science.gov (United States)

    Schnetkamp, Paul P M

    2013-01-01

    Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  12. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  13. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  14. Genetic Variants Contribute to Gene Expression Variability in Humans

    Science.gov (United States)

    Hulse, Amanda M.; Cai, James J.

    2013-01-01

    Expression quantitative trait loci (eQTL) studies have established convincing relationships between genetic variants and gene expression. Most of these studies focused on the mean of gene expression level, but not the variance of gene expression level (i.e., gene expression variability). In the present study, we systematically explore genome-wide association between genetic variants and gene expression variability in humans. We adapt the double generalized linear model (dglm) to simultaneously fit the means and the variances of gene expression among the three possible genotypes of a biallelic SNP. The genomic loci showing significant association between the variances of gene expression and the genotypes are termed expression variability QTL (evQTL). Using a data set of gene expression in lymphoblastoid cell lines (LCLs) derived from 210 HapMap individuals, we identify cis-acting evQTL involving 218 distinct genes, among which 8 genes, ADCY1, CTNNA2, DAAM2, FERMT2, IL6, PLOD2, SNX7, and TNFRSF11B, are cross-validated using an extra expression data set of the same LCLs. We also identify ∼300 trans-acting evQTL between >13,000 common SNPs and 500 randomly selected representative genes. We employ two distinct scenarios, emphasizing single-SNP and multiple-SNP effects on expression variability, to explain the formation of evQTL. We argue that detecting evQTL may represent a novel method for effectively screening for genetic interactions, especially when the multiple-SNP influence on expression variability is implied. The implication of our results for revealing genetic mechanisms of gene expression variability is discussed. PMID:23150607

  15. Identifying noncoding risk variants using disease-relevant gene regulatory networks.

    Science.gov (United States)

    Gao, Long; Uzun, Yasin; Gao, Peng; He, Bing; Ma, Xiaoke; Wang, Jiahui; Han, Shizhong; Tan, Kai

    2018-02-16

    Identifying noncoding risk variants remains a challenging task. Because noncoding variants exert their effects in the context of a gene regulatory network (GRN), we hypothesize that explicit use of disease-relevant GRNs can significantly improve the inference accuracy of noncoding risk variants. We describe Annotation of Regulatory Variants using Integrated Networks (ARVIN), a general computational framework for predicting causal noncoding variants. It employs a set of novel regulatory network-based features, combined with sequence-based features to infer noncoding risk variants. Using known causal variants in gene promoters and enhancers in a number of diseases, we show ARVIN outperforms state-of-the-art methods that use sequence-based features alone. Additional experimental validation using reporter assay further demonstrates the accuracy of ARVIN. Application of ARVIN to seven autoimmune diseases provides a holistic view of the gene subnetwork perturbed by the combinatorial action of the entire set of risk noncoding mutations.

  16. Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study.

    Science.gov (United States)

    Le Quesne Stabej, Polona; Saihan, Zubin; Rangesh, Nell; Steele-Stallard, Heather B; Ambrose, John; Coffey, Alison; Emmerson, Jenny; Haralambous, Elene; Hughes, Yasmin; Steel, Karen P; Luxon, Linda M; Webster, Andrew R; Bitner-Glindzicz, Maria

    2012-01-01

    Usher syndrome (USH) is an autosomal recessive disorder comprising retinitis pigmentosa, hearing loss and, in some cases, vestibular dysfunction. It is clinically and genetically heterogeneous with three distinctive clinical types (I-III) and nine Usher genes identified. This study is a comprehensive clinical and genetic analysis of 172 Usher patients and evaluates the contribution of digenic inheritance. The genes MYO7A, USH1C, CDH23, PCDH15, USH1G, USH2A, GPR98, WHRN, CLRN1 and the candidate gene SLC4A7 were sequenced in 172 UK Usher patients, regardless of clinical type. No subject had definite mutations (nonsense, frameshift or consensus splice site mutations) in two different USH genes. Novel missense variants were classified UV1-4 (unclassified variant): UV4 is 'probably pathogenic', based on control frequency A being the most common USH1 mutation in the cohort). USH2A was responsible for 79.3% of USH2 families and GPR98 for only 6.6%. No mutations were found in USH1G, WHRN or SLC4A7. One or two pathogenic/likely pathogenic variants were identified in 86% of cases. No convincing cases of digenic inheritance were found. It is concluded that digenic inheritance does not make a significant contribution to Usher syndrome; the observation of multiple variants in different genes is likely to reflect polymorphic variation, rather than digenic effects.

  17. Variant of Rett syndrome and CDKL5 gene

    DEFF Research Database (Denmark)

    Pini, Giorgio; Bigoni, Stefania; Engerström, Ingegerd Witt

    2012-01-01

    UNLABELLED: Rett syndrome (RTT) is a severe neurodevelopmental disorder affecting almost exclusively females. The Hanefeld variant, or early-onset seizure variant, has been associated with mutations in CDKL5 gene. AIMS: In recent years more than 60 patients with mutations in the CDKL5 gene have...... been described in the literature, but the cardiorespiratory phenotype has not been reported. Our aim is to describe clinical and autonomic features of these girls. METHODS: 10 girls with CDKL5 mutations and a diagnosis of Hanefeld variant have been evaluated on axiological and clinical aspects. In all...

  18. Spectrum of PAH gene variants among a population of Han Chinese patients with phenylketonuria from northern China.

    Science.gov (United States)

    Liu, Ning; Huang, Qiuying; Li, Qingge; Zhao, Dehua; Li, Xiaole; Cui, Lixia; Bai, Ying; Feng, Yin; Kong, Xiangdong

    2017-10-05

    Phenylketonuria (PKU), which primarily results from a deficiency of phenylalanine hydroxylase (PAH), is one of the most common inherited inborn errors of metabolism that impairs postnatal cognitive development. The incidence of various PAH variations differs by race and ethnicity. The aim of the present study was to characterize the PAH gene variants of a Han population from Northern China. In total, 655 PKU patients and their families were recruited for this study; each proband was diagnosed both clinically and biochemically with phenylketonuria. Subjects were sequentially screened for single-base variants and exon deletions or duplications within PAH via direct Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA). A spectrum of 174 distinct PAH variants was identified: 152 previously documented variants and 22 novel variants. While single-base variants were distributed throughout the 13 exons, they were particularly concentrated in exons 7 (33.3%), 11 (14.2%), 6 (13.2%), 12 (11.0%), 3 (10.4%), and 5 (4.4%). The predominant variant was p.Arg243Gln (17.7%), followed by Ex6-96A > G (8.3%), p.Val399 = (6.4%), p.Arg53His (4.7%), p.Tyr356* (4.7%), p.Arg241Cys (4.6%), p.Arg413Pro (4.6%), p.Arg111* (4.4%), and c.442-1G > A (3.4%). Notably, two patients were also identified as carrying de novo variants. The composition of PAH gene variants in this Han population from Northern China was distinct from those of other ethnic groups. As such, the construction of a PAH gene variant database for Northern China is necessary to lay a foundation for genetic-based diagnoses, prenatal diagnoses, and population screening.

  19. SLC5A8-Mediated Switching of STAT3 from a Pro-Oncogenic Signal into a Pro-Apoptotic Signal in Breast Cancer

    Science.gov (United States)

    2011-06-01

    provokes lung metastasis. (5) Both STAT3 and SLC5A8 knockout showed the similar phenotype, like mammary gland involution delay, mastitis and...100 ng/ml cholera toxin, 0.01mg/ml bovine insulin and 500 ng/ml hydrocortisone. HBL100 cells was grown in McCoy 5A with 10% FBS. MCF7 and BT20

  20. Effects of genetic variants of the bovine WNT8A gene on nine ...

    Indian Academy of Sciences (India)

    2016-11-15

    Nov 15, 2016 ... College of Veterinary Medicine, Northwest A & F University, Yangling, Shaanxi ... using DNA pool sequencing and PCR–RFLP method. ... outputs of the complex Wnt8A locus and regulated the mesodermal patterning and .... structure analysis of the Wnt8A gene in the Qinchuan cattle population is shown in.

  1. A Combined Study of SLC6A15 Gene Polymorphism and the Resting-State Functional Magnetic Resonance Imaging in First-Episode Drug-Naive Major Depressive Disorder.

    Science.gov (United States)

    Wang, Lijuan; Liu, Zhifen; Cao, Xiaohua; Li, Jianying; Zhang, Aixia; Sun, Ning; Yang, Chunxia; Zhang, Kerang

    2017-09-01

    The SLC6A15 gene has been identified as a novel candidate gene for major depressive disorder (MDD). However, the mechanism underlying the effects of how the SLC6A15 gene affects functional brain activity of patients with MDD remains unknown. In the present study, we investigated the effect of the SLC6A15 gene polymorphism, rs1545843, on resting-state brain function in MDD with the imaging genomic technology and the regional homogeneity (ReHo) method. Sixty-seven MDD patients and 44 healthy controls underwent functional magnetic resonance imaging scans and genotyping. The differences in ReHo between genotypes were initially tested using the student's t test. We then performed a 2 × 2 (genotypes × disease status) analysis of variance to identify the main effects of genotypes, disease status, and their interactions in MDD. MDD patients with A+ genotypes showed decreased ReHo in the medial cingulum compared with MDD patients with the GG genotype. This was in contrast to normal controls with A+ genotypes who showed increased ReHo in the posterior cingulum and the frontal, temporal, and parietal lobes and decreased ReHo in the left corpus callosum, compared with controls with the GG genotypes. The main effect of disease was found in the frontal, parietal, and temporal lobes. The main effect of genotypes was found in the left corpus callosum and the frontal lobe. There was no interaction between rs1545843 genotypes and disease status. We found that the left corpus callosum ReHo was positively correlated with total scores of the Hamilton Depression Scale (HAMD) (p = 0.021), so as was the left inferior parietal gyrus ReHo with cognitive disorder (p = 0.02). In addition, the right middle temporal gyrus had a negative correlation with retardation (p = 0.049). We observed an association between the SLC6A15 rs1545843 and resting-state brain function of the corpus callosum, cingulum and the frontal, parietal, and temporal lobes in MDD patients, which may be

  2. High-performance web services for querying gene and variant annotation.

    Science.gov (United States)

    Xin, Jiwen; Mark, Adam; Afrasiabi, Cyrus; Tsueng, Ginger; Juchler, Moritz; Gopal, Nikhil; Stupp, Gregory S; Putman, Timothy E; Ainscough, Benjamin J; Griffith, Obi L; Torkamani, Ali; Whetzel, Patricia L; Mungall, Christopher J; Mooney, Sean D; Su, Andrew I; Wu, Chunlei

    2016-05-06

    Efficient tools for data management and integration are essential for many aspects of high-throughput biology. In particular, annotations of genes and human genetic variants are commonly used but highly fragmented across many resources. Here, we describe MyGene.info and MyVariant.info, high-performance web services for querying gene and variant annotation information. These web services are currently accessed more than three million times permonth. They also demonstrate a generalizable cloud-based model for organizing and querying biological annotation information. MyGene.info and MyVariant.info are provided as high-performance web services, accessible at http://mygene.info and http://myvariant.info . Both are offered free of charge to the research community.

  3. Serotonin-Related Gene Polymorphisms and Asymptomatic Neurocognitive Impairment in HIV-Infected Alcohol Abusers

    Directory of Open Access Journals (Sweden)

    Karina Villalba

    2016-01-01

    Full Text Available HIV-infected individuals continue to experience neurocognitive deterioration despite virologically successful treatments. While the cause remains unclear, evidence suggests that HIV-associated neurocognitive disorders (HAND may be associated with neurobehavioral dysfunction. Genetic variants have been explored to identify risk markers to determine neuropathogenesis of neurocognitive deterioration. Memory deficits and executive dysfunction are highly prevalent among HIV-infected adults. These conditions can affect their quality of life and HIV risk-taking behaviors. Single nucleotide polymorphisms in the SLC6A4, TPH2, and GALM genes may affect the activity of serotonin and increase the risk of HAND. The present study explored the relationship between SLC6A4, TPH2, and GALM genes and neurocognitive impairment in HIV-infected alcohol abusers. A total of 267 individuals were genotyped for polymorphisms in SLC6A4 5-HTTLPR, TPH2 rs4570625, and GALM rs6741892. To assess neurocognitive functions, the Short Category and the Auditory Verbal Learning Tests were used. TPH2 SNP rs4570625 showed a significant association with executive function in African American males (odds ratio 4.8, 95% CI, 1.5–14.8; P=0.005. Similarly, GALM SNP rs6741892 showed an increased risk with African American males (odds ratio 2.4, 95% CI, 1.2–4.9; P=0.02. This study suggests that TPH2 rs4570625 and GALM rs6741892 polymorphisms may be risk factors for HAND.

  4. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study.

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-04-01

    Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.

  5. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  6. Case Report Identification of a novel SLC45A2 mutation in albinism by targeted next-generation sequencing.

    Science.gov (United States)

    Xue, J J; Xue, J F; Xue, H Q; Guo, Y Y; Liu, Y; Ouyang, N

    2016-09-19

    Albinism is a diverse group of hypopigmentary disorders caused by multiple-genetic defects. The genetic diagnosis of patients affected with albinism by Sanger sequencing is often complex, expensive, and time-consuming. In this study, we performed targeted next-generation sequencing to screen for 16 genes in a patient with albinism, and identified 21 genetic variants, including 19 known single nucleotide polymorphisms, one novel missense mutation (c.1456 G>A), and one disease-causing mutation (c.478 G>C). The novel mutation was not observed in 100 controls, and was predicted to be a damaging mutation by SIFT and Polyphen. Thus, we identified a novel mutation in SLC45A2 in a Chinese family, expanding the mutational spectrum of albinism. Our results also demonstrate that targeted next-generation sequencing is an effective genetic test for albinism.

  7. Three new genetic loci (R1210C in CFH, variants in COL8A1 and RAD51B are independently related to progression to advanced macular degeneration.

    Directory of Open Access Journals (Sweden)

    Johanna M Seddon

    Full Text Available To assess the independent impact of new genetic variants on conversion to advanced stages of AMD, controlling for established risk factors, and to determine the contribution of genes in predictive models.In this prospective longitudinal study of 2765 individuals, 777 subjects progressed to neovascular disease (NV or geographic atrophy (GA in either eye over 12 years. Recently reported genetic loci were assessed for their independent effects on incident advanced AMD after controlling for 6 established loci in 5 genes, and demographic, behavioral, and macular characteristics. New variants which remained significantly related to progression were then added to a final multivariate model to assess their independent effects. The contribution of genes to risk models was assessed using reclassification tables by determining risk within cross-classified quintiles for alternative models.THREE NEW GENETIC VARIANTS WERE SIGNIFICANTLY RELATED TO PROGRESSION: rare variant R1210C in CFH (hazard ratio (HR 2.5, 95% confidence interval [CI] 1.2-5.3, P = 0.01, and common variants in genes COL8A1 (HR 2.0, 95% CI 1.1-3.5, P = 0.02 and RAD51B (HR 0.8, 95% CI 0.60-0.97, P = 0.03. The area under the curve statistic (AUC was significantly higher for the 9 gene model (.884 vs the 0 gene model (.873, P = .01. AUC's for the 9 vs 6 gene models were not significantly different, but reclassification analyses indicated significant added information for more genes, with adjusted odds ratios (OR for progression within 5 years per one quintile increase in risk score of 2.7, P<0.001 for the 9 vs 6 loci model, and OR 3.5, P<0.001 for the 9 vs. 0 gene model. Similar results were seen for NV and GA.Rare variant CFH R1210C and common variants in COL8A1 and RAD51B plus six genes in previous models contribute additional predictive information for advanced AMD beyond macular and behavioral phenotypes.

  8. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  9. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

    Science.gov (United States)

    Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

    2012-11-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

  10. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  11. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  12. Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

    Science.gov (United States)

    Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

    2018-01-10

    Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

  13. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    OpenAIRE

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...

  14. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  15. Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

    International Nuclear Information System (INIS)

    Tan, Hua-Zhen; Wu, Zhi-Yong; Wu, Jian-Yi; Long, Lin; Jiao, Ji-Wei; Peng, Yu-Hui; Xu, Yi-Wei; Li, Shan-Shan; Wang, Wei; Zhang, Jian-Jun; Li, En-Min; Xu, Li-Yan

    2016-01-01

    SLC52A3 was recently identified as a susceptibility gene for esophageal squamous cell carcinoma (ESCC). However, associations between the single nucleotide polymorphisms (SNPs) rs13042395 (C > T) and rs3746803 (G > A) in SLC52A3 and risk, tumor characteristics and survival of ESCC patients remain inconclusive and of unknown prognostic significance. Analyses of the association between SNPs in SLC52A3 and ESCC risk were performed on 479 ESCC cases, together with 479 controls, in a case-control study. Blood samples for cases and controls were collected and genotyped by real-time polymerase chain reaction (PCR) using TaqMan assays. Among the 479 ESCC cases, 343 cases with complete clinical data were used to investigate the association between SNPs and ESCC clinical characteristics; 288 cases with complete clinical data and 5-year follow-up data were used to analyze the association between SNPs and prognosis. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSAs) were used to investigate the biological function of rs13042395. No association was found between SLC52A3 rs3746803 and susceptibility, tumor characteristics or survival of ESCC patients. For rs13042395, TT genotype carriers were likely to have reduced lymph node metastasis (odds ratio (OR) = 0.55, 95 % confidence interval (CI), 0.31–0.98) and longer relapse-free survival time (P = 0.03) . Also, both rs13042395 (hazard ratio (HR) = 0.62, 95 % CI, 0.38–0.99) and regional lymph node metastasis (HR = 2.06, 95 % CI, 1.36–3.13 for N1 vs. N0; HR = 2.88, 95 % CI, 1.70–4.86 for N2 vs. N0; HR = 2.08, 95 % CI, 1.01–4.30 for N3 vs. N0) were independent factors affecting relapse-free survival for ESCC patients who underwent surgery. Dual luciferase reporter assays and EMSAs suggested that the CC genotype of rs13042395 enhanced SLC52A3 expression, probably via binding with specific transcription factors. The rs13042395 polymorphism in SLC52A3 is associated with regional lymph node

  16. Friendships Moderate an Association Between a Dopamine Gene Variant and Political Ideology.

    Science.gov (United States)

    Settle, Jaime E; Dawes, Christopher T; Christakis, Nicholas A; Fowler, James H

    2010-01-01

    Scholars in many fields have long noted the importance of social context in the development of political ideology. Recent work suggests that political ideology also has a heritable component, but no specific gene variant or combination of variants associated with political ideology have so far been identified. Here, we hypothesize that individuals with a genetic predisposition toward seeking out new experiences will tend to be more liberal, but only if they are embedded in a social context that provides them with multiple points of view. Using data from the National Longitudinal Study of Adolescent Health, we test this hypothesis by investigating an association between self-reported political ideology and the 7R variant of the dopamine receptor D4 gene (DRD4), which has previously been associated with novelty seeking. Among those with DRD4-7R, we find that the number of friendships a person has in adolescence is significantly associated with liberal political ideology. Among those without the gene variant, there is no association. This is the first study to elaborate a specific gene-environment interaction that contributes to ideological self-identification, and it highlights the importance of incorporating both nature and nurture into the study of political preferences.

  17. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study1234

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-01-01

    Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971

  18. Urine screening for patients with developmental disabilities detected a patient with creatine transporter deficiency due to a novel missense mutation in SLC6A8.

    Science.gov (United States)

    Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi

    2014-08-01

    Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  19. Genetic mapping and exome sequencing identify variants associated with five novel diseases.

    Directory of Open Access Journals (Sweden)

    Erik G Puffenberger

    Full Text Available The Clinic for Special Children (CSC has integrated biochemical and molecular methods into a rural pediatric practice serving Old Order Amish and Mennonite (Plain children. Among the Plain people, we have used single nucleotide polymorphism (SNP microarrays to genetically map recessive disorders to large autozygous haplotype blocks (mean = 4.4 Mb that contain many genes (mean = 79. For some, uninformative mapping or large gene lists preclude disease-gene identification by Sanger sequencing. Seven such conditions were selected for exome sequencing at the Broad Institute; all had been previously mapped at the CSC using low density SNP microarrays coupled with autozygosity and linkage analyses. Using between 1 and 5 patient samples per disorder, we identified sequence variants in the known disease-causing genes SLC6A3 and FLVCR1, and present evidence to strongly support the pathogenicity of variants identified in TUBGCP6, BRAT1, SNIP1, CRADD, and HARS. Our results reveal the power of coupling new genotyping technologies to population-specific genetic knowledge and robust clinical data.

  20. Arrhythmogenic KCNE gene variants: current knowledge and future challenges

    Directory of Open Access Journals (Sweden)

    Shawn M Crump

    2014-01-01

    Full Text Available There are twenty-five known inherited cardiac arrhythmia susceptibility genes, all of which encode either ion channel pore-forming subunits or proteins that regulate aspects of ion channel biology such as function, trafficking and localization. The human KCNE gene family comprises five potassium channel regulatory subunits, sequence variants in each of which are associated with cardiac arrhythmias. KCNE gene products exhibit promiscuous partnering and in some cases ubiquitous expression, hampering efforts to unequivocally correlate each gene to specific native potassium currents. Likewise, deducing the molecular etiology of cardiac arrhythmias in individuals harboring rare KCNE gene variants, or more common KCNE polymorphisms, can be challenging. In this review we provide an update on putative arrhythmia-causing KCNE gene variants, and discuss current thinking and future challenges in the study of molecular mechanisms of KCNE-associated cardiac rhythm disturbances.

  1. Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

    Science.gov (United States)

    Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

    2011-01-01

    Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

  2. Exome sequencing reveals frequent deleterious germline variants in cancer susceptibility genes in women with invasive breast cancer undergoing neoadjuvant chemotherapy.

    Science.gov (United States)

    Ellingson, Marissa S; Hart, Steven N; Kalari, Krishna R; Suman, Vera; Schahl, Kimberly A; Dockter, Travis J; Felten, Sara J; Sinnwell, Jason P; Thompson, Kevin J; Tang, Xiaojia; Vedell, Peter T; Barman, Poulami; Sicotte, Hugues; Eckel-Passow, Jeanette E; Northfelt, Donald W; Gray, Richard J; McLaughlin, Sarah A; Moreno-Aspitia, Alvaro; Ingle, James N; Moyer, Ann M; Visscher, Daniel W; Jones, Katie; Conners, Amy; McDonough, Michelle; Wieben, Eric D; Wang, Liewei; Weinshilboum, Richard; Boughey, Judy C; Goetz, Matthew P

    2015-09-01

    When sequencing blood and tumor samples to identify targetable somatic variants for cancer therapy, clinically relevant germline variants may be uncovered. We evaluated the prevalence of deleterious germline variants in cancer susceptibility genes in women with breast cancer referred for neoadjuvant chemotherapy and returned clinically actionable results to patients. Exome sequencing was performed on blood samples from women with invasive breast cancer referred for neoadjuvant chemotherapy. Germline variants within 142 hereditary cancer susceptibility genes were filtered and reviewed for pathogenicity. Return of results was offered to patients with deleterious variants in actionable genes if they were not aware of their result through clinical testing. 124 patients were enrolled (median age 51) with the following subtypes: triple negative (n = 43, 34.7%), HER2+ (n = 37, 29.8%), luminal B (n = 31, 25%), and luminal A (n = 13, 10.5%). Twenty-eight deleterious variants were identified in 26/124 (21.0%) patients in the following genes: ATM (n = 3), BLM (n = 1), BRCA1 (n = 4), BRCA2 (n = 8), CHEK2 (n = 2), FANCA (n = 1), FANCI (n = 1), FANCL (n = 1), FANCM (n = 1), FH (n = 1), MLH3 (n = 1), MUTYH (n = 2), PALB2 (n = 1), and WRN (n = 1). 121/124 (97.6%) patients consented to return of research results. Thirteen (10.5%) had actionable variants, including four that were returned to patients and led to changes in medical management. Deleterious variants in cancer susceptibility genes are highly prevalent in patients with invasive breast cancer referred for neoadjuvant chemotherapy undergoing exome sequencing. Detection of these variants impacts medical management.

  3. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    = 250.44, p = 0.011. Similarly, significant association was observed between Tridimensional Personality Questionnaire Reward Dependence scores and AVPR1a RS1 (chi-square = 20.16, p = 0.01. Two-locus analysis (RS1 and RS3 conditional on HTTLPR and VNTR was highly significant (LRS = 162.95, p = 0.001. Promoter repeat regions in the AVPR1a gene have been robustly demonstrated to play a role in molding a range of social behaviors in many vertebrates and, more recently, in humans. Additionally, serotonergic neurotransmission in some human studies appears to mediate human religious and spiritual experiences. We therefore hypothesize that the association between AVPR1a and SLC6A4 reflects the social communication, courtship, and spiritual facets of the dancing phenotype rather than other aspects of this complex phenotype, such as sensorimotor integration.

  4. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    = 250.44, p = 0.011. Similarly, significant association was observed between Tridimensional Personality Questionnaire Reward Dependence scores and AVPR1a RS1 (chi-square = 20.16, p = 0.01. Two-locus analysis (RS1 and RS3 conditional on HTTLPR and VNTR was highly significant (LRS = 162.95, p = 0.001. Promoter repeat regions in the AVPR1a gene have been robustly demonstrated to play a role in molding a range of social behaviors in many vertebrates and, more recently, in humans. Additionally, serotonergic neurotransmission in some human studies appears to mediate human religious and spiritual experiences. We therefore hypothesize that the association between AVPR1a and SLC6A4 reflects the social communication, courtship, and spiritual facets of the dancing phenotype rather than other aspects of this complex phenotype, such as sensorimotor integration.

  5. Pleiotropic Effects of Variants in Dementia Genes in Parkinson Disease

    Directory of Open Access Journals (Sweden)

    Laura Ibanez

    2018-04-01

    Full Text Available Background: The prevalence of dementia in Parkinson disease (PD increases dramatically with advancing age, approaching 80% in patients who survive 20 years with the disease. Increasing evidence suggests clinical, pathological and genetic overlap between Alzheimer disease, dementia with Lewy bodies and frontotemporal dementia with PD. However, the contribution of the dementia-causing genes to PD risk, cognitive impairment and dementia in PD is not fully established.Objective: To assess the contribution of coding variants in Mendelian dementia-causing genes on the risk of developing PD and the effect on cognitive performance of PD patients.Methods: We analyzed the coding regions of the amyloid-beta precursor protein (APP, Presenilin 1 and 2 (PSEN1, PSEN2, and Granulin (GRN genes from 1,374 PD cases and 973 controls using pooled-DNA targeted sequence, human exome-chip and whole-exome sequencing (WES data by single variant and gene base (SKAT-O and burden tests analyses. Global cognitive function was assessed using the Mini-Mental State Examination (MMSE or the Montreal Cognitive Assessment (MoCA. The effect of coding variants in dementia-causing genes on cognitive performance was tested by multiple regression analysis adjusting for gender, disease duration, age at dementia assessment, study site and APOE carrier status.Results: Known AD pathogenic mutations in the PSEN1 (p.A79V and PSEN2 (p.V148I genes were found in 0.3% of all PD patients. There was a significant burden of rare, likely damaging variants in the GRN and PSEN1 genes in PD patients when compared with frequencies in the European population from the ExAC database. Multiple regression analysis revealed that PD patients carrying rare variants in the APP, PSEN1, PSEN2, and GRN genes exhibit lower cognitive tests scores than non-carrier PD patients (p = 2.0 × 10−4, independent of age at PD diagnosis, age at evaluation, APOE status or recruitment site.Conclusions: Pathogenic mutations in

  6. Common and rare variants in the exons and regulatory regions of osteoporosis-related genes improve osteoporotic fracture risk prediction.

    Science.gov (United States)

    Lee, Seung Hun; Kang, Moo Il; Ahn, Seong Hee; Lim, Kyeong-Hye; Lee, Gun Eui; Shin, Eun-Soon; Lee, Jong-Eun; Kim, Beom-Jun; Cho, Eun-Hee; Kim, Sang-Wook; Kim, Tae-Ho; Kim, Hyun-Ju; Yoon, Kun-Ho; Lee, Won Chul; Kim, Ghi Su; Koh, Jung-Min; Kim, Shin-Yoon

    2014-11-01

    Osteoporotic fracture risk is highly heritable, but genome-wide association studies have explained only a small proportion of the heritability to date. Genetic data may improve prediction of fracture risk in osteopenic subjects and assist early intervention and management. To detect common and rare variants in coding and regulatory regions related to osteoporosis-related traits, and to investigate whether genetic profiling improves the prediction of fracture risk. This cross-sectional study was conducted in three clinical units in Korea. Postmenopausal women with extreme phenotypes (n = 982) were used for the discovery set, and 3895 participants were used for the replication set. We performed targeted resequencing of 198 genes. Genetic risk scores from common variants (GRS-C) and from common and rare variants (GRS-T) were calculated. Nineteen common variants in 17 genes (of the discovered 34 functional variants in 26 genes) and 31 rare variants in five genes (of the discovered 87 functional variants in 15 genes) were associated with one or more osteoporosis-related traits. Accuracy of fracture risk classification was improved in the osteopenic patients by adding GRS-C to fracture risk assessment models (6.8%; P risk in an osteopenic individual.

  7. Serotonin Transporter Gene ("SLC6A4") Methylation Associates with Neonatal Intensive Care Unit Stay and 3-month-old Temperament in Preterm Infants

    Science.gov (United States)

    Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato

    2016-01-01

    Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…

  8. The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Fukada

    Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.

  9. Burden of rare variants in ALS genes influences survival in familial and sporadic ALS.

    Science.gov (United States)

    Pang, Shirley Yin-Yu; Hsu, Jacob Shujui; Teo, Kay-Cheong; Li, Yan; Kung, Michelle H W; Cheah, Kathryn S E; Chan, Danny; Cheung, Kenneth M C; Li, Miaoxin; Sham, Pak-Chung; Ho, Shu-Leong

    2017-10-01

    Genetic variants are implicated in the development of amyotrophic lateral sclerosis (ALS), but it is unclear whether the burden of rare variants in ALS genes has an effect on survival. We performed whole genome sequencing on 8 familial ALS (FALS) patients with superoxide dismutase 1 (SOD1) mutation and whole exome sequencing on 46 sporadic ALS (SALS) patients living in Hong Kong and found that 67% had at least 1 rare variant in the exons of 40 ALS genes; 22% had 2 or more. Patients with 2 or more rare variants had lower probability of survival than patients with 0 or 1 variant (p = 0.001). After adjusting for other factors, each additional rare variant increased the risk of respiratory failure or death by 60% (p = 0.0098). The presence of the rare variant was associated with the risk of ALS (Odds ratio 1.91, 95% confidence interval 1.03-3.61, p = 0.03), and ALS patients had higher rare variant burden than controls (MB, p = 0.004). Our findings support an oligogenic basis with the burden of rare variants affecting the development and survival of ALS. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

    International Nuclear Information System (INIS)

    Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

    2008-01-01

    The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed

  11. ZIP8 zinc transporter: indispensable role for both multiple-organ organogenesis and hematopoiesis in utero.

    Directory of Open Access Journals (Sweden)

    Marina Gálvez-Peralta

    Full Text Available Previously this laboratory characterized Slc39a8-encoded ZIP8 as a Zn(2+/(HCO(3(-(2 symporter; yet, the overall physiological importance of ZIP8 at the whole-organism level remains unclear. Herein we describe the phenotype of the hypomorphic Slc39a8(neo/neo mouse which has retained the neomycin-resistance gene in intron 3, hence causing significantly decreased ZIP8 mRNA and protein levels in embryo, fetus, placenta, yolk sac, and several tissues of neonates. The Slc39a8(neo allele is associated with diminished zinc and iron uptake in mouse fetal fibroblast and liver-derived cultures; consequently, Slc39a8(neo/neo newborns exhibit diminished zinc and iron levels in several tissues. Slc39a8(neo/neo homozygotes from gestational day(GD-11.5 onward are pale, growth-stunted, and die between GD18.5 and 48 h postnatally. Defects include: severely hypoplastic spleen; hypoplasia of liver, kidney, lung, and lower limbs. Histologically, Slc39a8(neo/neo neonates show decreased numbers of hematopoietic islands in yolk sac and liver. Low hemoglobin, hematocrit, red cell count, serum iron, and total iron-binding capacity confirmed severe anemia. Flow cytometry of fetal liver cells revealed the erythroid series strikingly affected in the hypomorph. Zinc-dependent 5-aminolevulinic acid dehydratase, required for heme synthesis, was not different between Slc39a8(+/+ and Slc39a8(neo/neo offspring. To demonstrate further that the mouse phenotype is due to ZIP8 deficiency, we bred Slc39a8(+/neo with BAC-transgenic BTZIP8-3 line (carrying three extra copies of the Slc39a8 allele; this cross generated viable Slc39a8(neo/neo_BTZIP8-3(+/+ pups showing none of the above-mentioned congenital defects-proving Slc39a8(neo/neo causes the described phenotype. Our study demonstrates that ZIP8-mediated zinc transport plays an unappreciated critical role during in utero and neonatal growth, organ morphogenesis, and hematopoiesis.

  12. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    Science.gov (United States)

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-07

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

  13. MSX1 gene variant - its presence in tooth absence - a case control genetic study.

    Science.gov (United States)

    Reddy, Naveen Admala; Adusumilli, Gopinath; Devanna, Raghu; Pichai, Saravanan; Rohra, Mayur Gobindram; Arjunan, Sharmila

    2013-10-01

    Non Syndromic tooth agenesis is a congenital anomaly with significant medical, psychological and social ramifications. There is sufficient evidence to hypothesize that locus for this condition can be identified by candidate genes. The aim of this study was to test whether MSX1 671 T>C gene variant was involved in etiology of Non Syndromic tooth agenesis in Raichur Patients. Blood samples were collected with informed consent from 50 subjects having Non Syndromic tooth agenesis and 50 controls. Genomic DNA was extracted from the blood samples, Polymerase Chain Reaction was performed (PCR) and Restriction Fragment Length Polymorphism (RFLP) was performed for digestion products that were evaluated. The RESULTS showed positive correlation between MSX1671 T>C gene variant and Non Syndromic tooth agenesis in Raichur Patients. MSX1 671 T>C gene variant may be a good screening marker for Non Syndromic tooth agenesis in Raichur Patients . How to cite this article:Reddy NA, Adusumilli G, Devanna R, Pichai S, Rohra MG, Arjunan S. Msx1 Gene Variant - Its Presence in Tooth Absence - A Case Control Genetic Study. J Int Oral Health 2013; 5(5):20-6.

  14. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Mutations in OTOF, CLDN14 & SLC26A4 genes as major causes of hearing impairment in Dhadkai village, Jammu & Kashmir, India

    Directory of Open Access Journals (Sweden)

    Nishtha Pandey

    2017-01-01

    Interpretation & conclusions: This study suggested considerable genetic heterogeneity in the causation of hearing loss in Dhadkai. Recessive mutations were observed in at least three genes causing hearing loss: OTOF (p.R708X, SLC26A4 (p.Y556X and CLDN14 (p.V85D. Mutation p.R708X appeared to be the major cause of hearing impairment in Dhadkai.

  16. Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

    Science.gov (United States)

    Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

    2017-04-01

    The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

  17. Global transcriptome profiling identifies KLF15 and SLC25A10 as modifiers of adipocytes insulin sensitivity in obese women.

    Directory of Open Access Journals (Sweden)

    Agné Kulyté

    Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in

  18. Epithelial-Mesenchymal Transition (EMT) Gene Variants and Epithelial Ovarian Cancer (EOC) Risk.

    Science.gov (United States)

    Amankwah, Ernest K; Lin, Hui-Yi; Tyrer, Jonathan P; Lawrenson, Kate; Dennis, Joe; Chornokur, Ganna; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V; Bean, Yukie T; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bunker, Clareann H; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chen, Zhihua; Chen, Y Ann; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F; Eccles, Diana M; Edwards, Robert P; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goodman, Marc T; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hasmad, Hanis N; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Claus K; Hogdall, Estrid; Hosono, Satoyo; Iversen, Edwin S; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Jim, Heather; Kellar, Melissa; Kiemeney, Lambertus A; Krakstad, Camilla; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; McNeish, Ian; Menon, Usha; Milne, Roger L; Modugno, Francesmary; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Permuth-Wey, Jennifer; Pike, Malcolm C; Poole, Elizabeth M; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Spiewankiewicz, Beata; Sucheston-Campbell, Lara; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Lotte; Tangen, Ingvild L; Tworoger, Shelley S; van Altena, Anne M; Vierkant, Robert A; Vergote, Ignace; Walsh, Christine S; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Wu, Anna H; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Kelemen, Linda E; Berchuck, Andrew; Schildkraut, Joellen M; Ramus, Susan J; Goode, Ellen L; Monteiro, Alvaro N A; Gayther, Simon A; Narod, Steven A; Pharoah, Paul D P; Sellers, Thomas A; Phelan, Catherine M

    2015-12-01

    Epithelial-mesenchymal transition (EMT) is a process whereby epithelial cells assume mesenchymal characteristics to facilitate cancer metastasis. However, EMT also contributes to the initiation and development of primary tumors. Prior studies that explored the hypothesis that EMT gene variants contribute to epithelial ovarian carcinoma (EOC) risk have been based on small sample sizes and none have sought replication in an independent population. We screened 15,816 single-nucleotide polymorphisms (SNPs) in 296 genes in a discovery phase using data from a genome-wide association study of EOC among women of European ancestry (1,947 cases and 2,009 controls) and identified 793 variants in 278 EMT-related genes that were nominally (P < 0.05) associated with invasive EOC. These SNPs were then genotyped in a larger study of 14,525 invasive-cancer patients and 23,447 controls. A P-value <0.05 and a false discovery rate (FDR) <0.2 were considered statistically significant. In the larger dataset, GPC6/GPC5 rs17702471 was associated with the endometrioid subtype among Caucasians (odds ratio (OR) = 1.16, 95% CI = 1.07-1.25, P = 0.0003, FDR = 0.19), whereas F8 rs7053448 (OR = 1.69, 95% CI = 1.27-2.24, P = 0.0003, FDR = 0.12), F8 rs7058826 (OR = 1.69, 95% CI = 1.27-2.24, P = 0.0003, FDR = 0.12), and CAPN13 rs1983383 (OR = 0.79, 95% CI = 0.69-0.90, P = 0.0005, FDR = 0.12) were associated with combined invasive EOC among Asians. In silico functional analyses revealed that GPC6/GPC5 rs17702471 coincided with DNA regulatory elements. These results suggest that EMT gene variants do not appear to play a significant role in the susceptibility to EOC. © 2015 WILEY PERIODICALS, INC.

  19. Prevalence of deleterious germline variants in risk genes including BRCA1/2 in consecutive ovarian cancer patients (AGO-TR-1.

    Directory of Open Access Journals (Sweden)

    Philipp Harter

    Full Text Available Identification of families at risk for ovarian cancer offers the opportunity to consider prophylactic surgery thus reducing ovarian cancer mortality. So far, identification of potentially affected families in Germany was solely performed via family history and numbers of affected family members with breast or ovarian cancer. However, neither the prevalence of deleterious variants in BRCA1/2 in ovarian cancer in Germany nor the reliability of family history as trigger for genetic counselling has ever been evaluated.Prospective counseling and germline testing of consecutive patients with primary diagnosis or with platinum-sensitive relapse of an invasive epithelial ovarian cancer. Testing included 25 candidate and established risk genes. Among these 25 genes, 16 genes (ATM, BRCA1, BRCA2, CDH1, CHEK2, MLH1, MSH2, MSH6, NBN, PMS2, PTEN, PALB2, RAD51C, RAD51D, STK11, TP53 were defined as established cancer risk genes. A positive family history was defined as at least one relative with breast cancer or ovarian cancer or breast cancer in personal history.In total, we analyzed 523 patients: 281 patients with primary diagnosis of ovarian cancer and 242 patients with relapsed disease. Median age at primary diagnosis was 58 years (range 16-93 and 406 patients (77.6% had a high-grade serous ovarian cancer. In total, 27.9% of the patients showed at least one deleterious variant in all 25 investigated genes and 26.4% in the defined 16 risk genes. Deleterious variants were most prevalent in the BRCA1 (15.5%, BRCA2 (5.5%, RAD51C (2.5% and PALB2 (1.1% genes. The prevalence of deleterious variants did not differ significantly between patients at primary diagnosis and relapse. The prevalence of deleterious variants in BRCA1/2 (and in all 16 risk genes in patients <60 years was 30.2% (33.2% versus 10.6% (18.9% in patients ≥60 years. Family history was positive in 43% of all patients. Patients with a positive family history had a prevalence of deleterious variants

  20. Molecular characterization of a genetic variant of the steroid hormone-binding globulin gene in heterozygous subjects

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, D.O.; Catterall, J.F. [Population Council, New York, NY (United States); Carino, C. [Instituto National de la Nutricion, Mexico City, MX (United States)] [and others

    1995-04-01

    Steroid hormone-binding globulin in human serum displays different isoelectric focusing (IEF) patterns among individuals, suggesting genetic variation in the gene for this extracellular steroid carrier protein. Analysis of allele frequencies and family studies suggested the existence of two codominant alleles of the gene. Subsequent determination of the molecular basis of a variant of the gene was carried out using DNA from homozygous individuals from a single Belgian family. It was of interest to characterize other variant individuals to determine whether all variants identified by IEF phenotyping were caused by the same mutation or whether other mutations occurred in the gene in different populations. Previous studies identified Mexican subjects who were heterozygous for the variant IEF phenotype. Denaturing gradient gel electrophoresis was used to localize the mutation in these subjects and to purify the variant allele for DNA sequence analysis. The results show that the mutation in this population is identical to that identified in the Belgian family, and no other mutations were detected in the gene. These data represent the first analysis of steroid hormone-binding globulin gene variation in heterozygous subjects and further support the conclusion of biallelism of the gene worldwide. 11 refs., 2 figs., 1 tab.

  1. Rare variants analysis of cutaneous malignant melanoma genes in Parkinson's disease.

    Science.gov (United States)

    Lubbe, S J; Escott-Price, V; Brice, A; Gasser, T; Pittman, A M; Bras, J; Hardy, J; Heutink, P; Wood, N M; Singleton, A B; Grosset, D G; Carroll, C B; Law, M H; Demenais, F; Iles, M M; Bishop, D T; Newton-Bishop, J; Williams, N M; Morris, H R

    2016-12-01

    A shared genetic susceptibility between cutaneous malignant melanoma (CMM) and Parkinson's disease (PD) has been suggested. We investigated this by assessing the contribution of rare variants in genes involved in CMM to PD risk. We studied rare variation across 29 CMM risk genes using high-quality genotype data in 6875 PD cases and 6065 controls and sought to replicate findings using whole-exome sequencing data from a second independent cohort totaling 1255 PD cases and 473 controls. No statistically significant enrichment of rare variants across all genes, per gene, or for any individual variant was detected in either cohort. There were nonsignificant trends toward different carrier frequencies between PD cases and controls, under different inheritance models, in the following CMM risk genes: BAP1, DCC, ERBB4, KIT, MAPK2, MITF, PTEN, and TP53. The very rare TYR p.V275F variant, which is a pathogenic allele for recessive albinism, was more common in PD cases than controls in 3 independent cohorts. Tyrosinase, encoded by TYR, is the rate-limiting enzyme for the production of neuromelanin, and has a role in the production of dopamine. These results suggest a possible role for another gene in the dopamine-biosynthetic pathway in susceptibility to neurodegenerative Parkinsonism, but further studies in larger PD cohorts are needed to accurately determine the role of these genes/variants in disease pathogenesis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. The emerging physiological roles of the SLC14A family of urea transporters

    Science.gov (United States)

    Stewart, Gavin

    2011-01-01

    In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978

  3. The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

    Directory of Open Access Journals (Sweden)

    Nadia Bayou

    2008-01-01

    We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

  4. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    International Nuclear Information System (INIS)

    Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

    2009-01-01

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  5. Tyrosine receptor kinase B gene variants (NTRK2 variants) are associated with depressive disorders in temporal lobe epilepsy.

    Science.gov (United States)

    Torres, Carolina Machado; Siebert, Marina; Bock, Hugo; Mota, Suelen Mandelli; Castan, Juliana Unis; Scornavacca, Francisco; de Castro, Luiza Amaral; Saraiva-Pereira, Maria Luiza; Bianchin, Marino Muxfeldt

    2017-06-01

    Psychiatric comorbidities are highly prevalent in epilepsy, adding an important burden to the disease and profoundly affecting the quality of life of these individuals. Patients with temporal lobe epilepsy (TLE) are especially at risk to develop depression and several lines of evidence suggest that the association of depression with epilepsy might be related to common biological substrates. In this study, we test whether NTRK2 allele variants are associated with mood disorders or depressive disorders in patients with TLE. An association study of 163 patients with TLE. The NTRK2 variants studied were rs1867283, rs10868235, rs1147198, rs11140800, rs1187286, rs2289656, rs1624327, rs1443445, rs3780645, and rs2378672. All patients were submitted to the Structured Clinical Interview for DSM-IV (SCID) and epilepsy patients with mood disorders or depressive disorders were compared to epilepsy patients without mood disorders or depressive disorders. In our TLE cohort, 76 patients (46.6%) showed mood disorders. After logistic regression, independent risk factors for mood disorders in TLE were female sex, presence of concomitant anxiety disorders, and genetic variations in rs1867283 and rs10868235 NTRK2 variants. Depressive disorders accounted for this results and independent variables associated with depressive disorders in TLE were female sex (OR=2.59; 95%CI=1.15-5.82; p=0.021), presence of concomitant anxiety disorders (OR=3.72; 95%CI=1.71-8.06; p=0.001) or psychotic disorders (OR=3.86; 95%CI=1.12-13.25; p=0.032), A/A genotype in the rs1867283 NTRK2 gene (OR=3.06; 95%CI=1.25-7.50; p=0.015) and C/C genotype in the rs10868235 NTRK2 gene (OR=3.54; 1.55-8.08; p=0.003). Similarly, these genotypes also remained independently and significantly associated with depressive disorders when patients with depressive disorders were compared to TLE patients without any psychiatric comorbidity. In the present study, female sex, presence of concomitant anxiety or psychotic disorders, and

  6. Genetic Variants Involved in Mitochondrial Oxidative Metabolism are associated with Type 2 Diabetes Mellitus in studies of 8,441 Danes

    DEFF Research Database (Denmark)

    Snogdal, Lena Sønder; Henriksen, Jan Erik; Beck-Nielsen, Henning

      Aims: Type 2 Diabetes (T2D) is characterized by insulin resistance and failure of the pancreatic beta cells to compensate for this defect. Several studies have demonstrated a link between insulin resistance and impaired mitochondrial oxidative phosphorylation (OxPhos) in skeletal muscle. Recently...... by the Diabetes Genetics Replication And Meta-analysis Consortium (DIAGRAM), we found that among 1284 SNPs in 119 OxPhos genes, 39 SNPs in 7 genes showed potential association with T2D (p0.8). One SNP...... a surrogate marker (BIG-AIR) for insulin secretion and variants in COX5B (rs11904110) and COX10 (rs10521253), and between fasting p-glucose and a variant in COX5B (rs11904110) and 2-h post-OGTT plasma glucose and a variant in NDUFV3 (rs8134542) (pgenetic variants...

  7. Severe hypertriglyceridemia in a patient heterozygous for a lipoprotein lipase gene allele with two novel missense variants.

    Science.gov (United States)

    Kassner, Ursula; Salewsky, Bastian; Wühle-Demuth, Marion; Szijarto, Istvan Andras; Grenkowitz, Thomas; Binner, Priska; März, Winfried; Steinhagen-Thiessen, Elisabeth; Demuth, Ilja

    2015-09-01

    Rare monogenic hyperchylomicronemia is caused by loss-of-function mutations in genes involved in the catabolism of triglyceride-rich lipoproteins, including the lipoprotein lipase gene, LPL. Clinical hallmarks of this condition are eruptive xanthomas, recurrent pancreatitis and abdominal pain. Patients with LPL deficiency and severe or recurrent pancreatitis are eligible for the first gene therapy treatment approved by the European Union. Therefore the precise molecular diagnosis of familial hyperchylomicronemia may affect treatment decisions. We present a 57-year-old male patient with excessive hypertriglyceridemia despite intensive lipid-lowering therapy. Abdominal sonography showed signs of chronic pancreatitis. Direct DNA sequencing and cloning revealed two novel missense variants, c.1302A>T and c.1306G>A, in exon 8 of the LPL gene coexisting on the same allele. The variants result in the amino-acid exchanges p.(Lys434Asn) and p.(Gly436Arg). They are located in the carboxy-terminal domain of lipoprotein lipase that interacts with the glycosylphosphatidylinositol-anchored HDL-binding protein (GPIHBP1) and are likely of functional relevance. No further relevant mutations were found by direct sequencing of the genes for APOA5, APOC2, LMF1 and GPIHBP1. We conclude that heterozygosity for damaging mutations of LPL may be sufficient to produce severe hypertriglyceridemia and that chylomicronemia may be transmitted in a dominant manner, at least in some families.

  8. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  9. Multiple ovarian antral follicles in a preterm infant with neonatal intrahepatic cholestasis caused by citrin deficiency: a clinical, genetic and transcriptional analysis.

    Science.gov (United States)

    Lin, Wei-Xia; Zhang, Zhan-Hui; Deng, Mei; Cai, Xiang-Ran; Song, Yuan-Zong

    2012-09-01

    Neonatal intrahepatic cholestasis caused by citrin deficiency (NICCD) is an autosomal recessive disease caused by the dysfunction of citrin, an aspartate/glutamate carrier encoded by the SLC25A13 gene. Considerable progress has been made on the diagnosis and treatment of NICCD, but its clinical and molecular features still remain far from being completely elucidated and generally understood. The infant, a preterm female delivered at a gestational age of 31 weeks, was referred to our hospital at the age of 8 months because of jaundice lasting for 4.5 months and ovarian masses uncovered for 3 months. Besides serum indices indicating cholestasis, elevated serum levels of luteinizing hormone, follicle stimulating hormone and estradiol were also detected. Abdominal magnetic resonance imaging demonstrated bilateral multi-cystic ovarian masses, with the largest size being 7.4 × 6.2 × 9.6 mm(3). SLC25A13 gene analysis revealed that the patient was a compound heterozygote of c.1177+1G>A and c.754G>A. The paternally-inherited mutation c.754G>A was a novel one with a carrier rate of less than 1%. SLC25A13 transcriptional study in peripheral blood lymphocytes (PBLs) documented a novel splice variant r.616_848del which resulted from c.754G>A, with another variant r.1019_1177del from the maternally-inherited c.1177+1G>A mutation. The diagnoses were NICCD and multiple ovarian antral follicles (minipuberty), and the patient responded well to a galactose-free and medium chain triglyceride (MCT)-enriched formula. The findings in this paper expanded the clinical and molecular spectrum of the SLC25A13 gene, and lent support to the concept that PBLs could be taken as a feasible specimen source for SLC25A13 transcriptional analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    OpenAIRE

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-01-01

    Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...

  11. Three new genetic loci (R1210C in CFH, variants in COL8A1 and RAD51B) are independently related to progression to advanced macular degeneration.

    Science.gov (United States)

    Seddon, Johanna M; Reynolds, Robyn; Yu, Yi; Rosner, Bernard

    2014-01-01

    To assess the independent impact of new genetic variants on conversion to advanced stages of AMD, controlling for established risk factors, and to determine the contribution of genes in predictive models. In this prospective longitudinal study of 2765 individuals, 777 subjects progressed to neovascular disease (NV) or geographic atrophy (GA) in either eye over 12 years. Recently reported genetic loci were assessed for their independent effects on incident advanced AMD after controlling for 6 established loci in 5 genes, and demographic, behavioral, and macular characteristics. New variants which remained significantly related to progression were then added to a final multivariate model to assess their independent effects. The contribution of genes to risk models was assessed using reclassification tables by determining risk within cross-classified quintiles for alternative models. THREE NEW GENETIC VARIANTS WERE SIGNIFICANTLY RELATED TO PROGRESSION: rare variant R1210C in CFH (hazard ratio (HR) 2.5, 95% confidence interval [CI] 1.2-5.3, P = 0.01), and common variants in genes COL8A1 (HR 2.0, 95% CI 1.1-3.5, P = 0.02) and RAD51B (HR 0.8, 95% CI 0.60-0.97, P = 0.03). The area under the curve statistic (AUC) was significantly higher for the 9 gene model (.884) vs the 0 gene model (.873), P = .01. AUC's for the 9 vs 6 gene models were not significantly different, but reclassification analyses indicated significant added information for more genes, with adjusted odds ratios (OR) for progression within 5 years per one quintile increase in risk score of 2.7, Padvanced AMD beyond macular and behavioral phenotypes.

  12. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  13. SLC6A3 coding variant Ala559Val found in two autism probands alters dopamine transporter function and trafficking.

    Science.gov (United States)

    Bowton, E; Saunders, C; Reddy, I A; Campbell, N G; Hamilton, P J; Henry, L K; Coon, H; Sakrikar, D; Veenstra-VanderWeele, J M; Blakely, R D; Sutcliffe, J; Matthies, H J G; Erreger, K; Galli, A

    2014-10-14

    Emerging evidence associates dysfunction in the dopamine (DA) transporter (DAT) with the pathophysiology of autism spectrum disorder (ASD). The human DAT (hDAT; SLC6A3) rare variant with an Ala to Val substitution at amino acid 559 (hDAT A559V) was previously reported in individuals with bipolar disorder or attention-deficit hyperactivity disorder (ADHD). We have demonstrated that this variant is hyper-phosphorylated at the amino (N)-terminal serine (Ser) residues and promotes an anomalous DA efflux phenotype. Here, we report the novel identification of hDAT A559V in two unrelated ASD subjects and provide the first mechanistic description of its impaired trafficking phenotype. DAT surface expression is dynamically regulated by DAT substrates including the psychostimulant amphetamine (AMPH), which causes hDAT trafficking away from the plasma membrane. The integrity of DAT trafficking directly impacts DA transport capacity and therefore dopaminergic neurotransmission. Here, we show that hDAT A559V is resistant to AMPH-induced cell surface redistribution. This unique trafficking phenotype is conferred by altered protein kinase C β (PKCβ) activity. Cells expressing hDAT A559V exhibit constitutively elevated PKCβ activity, inhibition of which restores the AMPH-induced hDAT A559V membrane redistribution. Mechanistically, we link the inability of hDAT A559V to traffic in response to AMPH to the phosphorylation of the five most distal DAT N-terminal Ser. Mutation of these N-terminal Ser to Ala restores AMPH-induced trafficking. Furthermore, hDAT A559V has a diminished ability to transport AMPH, and therefore lacks AMPH-induced DA efflux. Pharmacological inhibition of PKCβ or Ser to Ala substitution in the hDAT A559V background restores AMPH-induced DA efflux while promoting intracellular AMPH accumulation. Although hDAT A559V is a rare variant, it has been found in multiple probands with neuropsychiatric disorders associated with imbalances in DA neurotransmission

  14. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  15. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  16. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk.

    Science.gov (United States)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S L; Chen, Zhihua; Chen, Ann Y; Permuth-Wey, Jennifer; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V; Bean, Yukie T; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bunker, Clareann H; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F; Eccles, Diana M; Edwards, Robert P; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goodman, Marc T; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Claus K; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Kelemen, Linda E; Kellar, Mellissa; Kiemeney, Lambertus A; Krakstad, Camilla; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; McNeish, Iain; Menon, Usha; Milne, Roger L; Modugno, Francesmary; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Pike, Malcolm C; Poole, Elizabeth M; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Lotte; Tangen, Ingvild L; Tworoger, Shelley S; van Altena, Anne M; Vierkant, Robert A; Vergote, Ignace; Walsh, Christine S; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Wu, Anna H; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N; Berchuck, Andrew; Iversen, Edwin S; Schildkraut, Joellen M; Ramus, Susan J; Goode, Ellen L; Monteiro, Alvaro N A; Gayther, Simon A; Narod, Steven A; Pharoah, Paul D P; Sellers, Thomas A; Phelan, Catherine M

    2015-01-01

    Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). These results, generated on a large cohort of women, revealed associations between inherited cellular transport

  17. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2009-11-20

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  18. SLCO1B1 and SLC19A1 gene variants and irinotecan-induced rapid response and survival: a prospective multicenter pharmacogenetics study of metastatic colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Liu Huang

    Full Text Available Rapid response to chemotherapy in metastatic colorectal cancer (mCRC patients (response within 12 weeks of chemotherapy may increase the chance of complete resection and improved survival. Few molecular markers predict irinotecan-induced rapid response and survival. Single-nucleotide polymorphisms (SNPs in solute carrier genes are reported to correlate with the variable pharmacokinetics of irinotecan and folate in cancer patients. This study aims to evaluate the predictive role of 3 SNPs in mCRC patients treated with irinotecan and fluoropyrimidine-containing regimens.Three SNPs were selected and genotyped in 137 mCRC patients from a Chinese prospective multicenter trial (NCT01282658. The chi-squared test, univariate and multivariable logistic regression model, and receiver operating characteristic analysis were used to evaluate correlations between the genotypes and rapid response. Kaplan-Meier survival analysis and Cox proportional hazard models were used to evaluate the associations between genotypes and survival outcomes. Benjamini and Hochberg False Discovery Rate correction was used in multiple testing.Genotype GA/AA of SNP rs2306283 of the gene SLCO1B1 and genotype GG of SNP rs1051266 of the gene SLC19A1 were associated with a higher rapid response rate (odds ratio [OR] =3.583 and 3.521, 95%CI =1.301-9.871 and 1.271-9.804, p=0.011 and p=0.013, respectively. The response rate was 70% in patients with both genotypes, compared with only 19.7% in the remaining patients (OR = 9.489, 95%CI = 2.191-41.093, Fisher's exact test p=0.002. Their significances were all maintained even after multiple testing (all p c < 0.05. The rs2306283 GA/AA genotype was also an independent prognostic factor of longer progression-free survival (PFS (hazard ratio = 0.402, 95%CI = 0.171-0.945, p=0.037. None of the SNPs predicted overall survival.Polymorphisms of solute carriers' may be useful to predict rapid response to irinotecan plus fluoropyrimidine and PFS in m

  19. Candidate gene association study in type 2 diabetes indicates a role for genes involved in beta-cell function as well as insulin action.

    Directory of Open Access Journals (Sweden)

    Inês Barroso

    2003-10-01

    Full Text Available Type 2 diabetes is an increasingly common, serious metabolic disorder with a substantial inherited component. It is characterised by defects in both insulin secretion and action. Progress in identification of specific genetic variants predisposing to the disease has been limited. To complement ongoing positional cloning efforts, we have undertaken a large-scale candidate gene association study. We examined 152 SNPs in 71 candidate genes for association with diabetes status and related phenotypes in 2,134 Caucasians in a case-control study and an independent quantitative trait (QT cohort in the United Kingdom. Polymorphisms in five of 15 genes (33% encoding molecules known to primarily influence pancreatic beta-cell function-ABCC8 (sulphonylurea receptor, KCNJ11 (KIR6.2, SLC2A2 (GLUT2, HNF4A (HNF4alpha, and INS (insulin-significantly altered disease risk, and in three genes, the risk allele, haplotype, or both had a biologically consistent effect on a relevant physiological trait in the QT study. We examined 35 genes predicted to have their major influence on insulin action, and three (9%-INSR, PIK3R1, and SOS1-showed significant associations with diabetes. These results confirm the genetic complexity of Type 2 diabetes and provide evidence that common variants in genes influencing pancreatic beta-cell function may make a significant contribution to the inherited component of this disease. This study additionally demonstrates that the systematic examination of panels of biological candidate genes in large, well-characterised populations can be an effective complement to positional cloning approaches. The absence of large single-gene effects and the detection of multiple small effects accentuate the need for the study of larger populations in order to reliably identify the size of effect we now expect for complex diseases.

  20. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  1. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  2. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  3. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  4. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  5. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  6. Genetic variants in the choline acetyltransferase (ChAT) gene are modestly associated with normal cognitive function in the elderly

    DEFF Research Database (Denmark)

    Mengel-From, J; Christensen, K; Thinggaard, M

    2011-01-01

    Genetic variants in the choline acetyltransferase (ChAT) gene have been suggested as risk factors for neurodegenerative Alzheimer's disease (AD). Here we tested the importance of genetic variants in the ChAT gene in normal cognitive function of elderly in a study sample of Danish twins...... and singletons (N = 2070). The ChAT rs3810950 A allele, which has been associated with increased risk for AD, was found to be associated with a decrease cognitive status evaluated by a five-component cognitive composite score [P = 0.03, regression coefficient -0.30, 95% confidence interval (CI) -0.57 to -0...

  7. Association of MEP1A gene variants with insulin metabolism in central European women with polycystic ovary syndrome.

    Science.gov (United States)

    Lam, Uyen D P; Lerchbaum, Elisabeth; Schweighofer, Natascha; Trummer, Olivia; Eberhard, Katharina; Genser, Bernd; Pieber, Thomas R; Obermayer-Pietsch, Barbara

    2014-03-10

    Polycystic ovary syndrome (PCOS) shows not only hyperandrogenemia, hirsutism and fertility problems, but also metabolic disturbances including obesity, cardiovascular events and type-2 diabetes. Accumulating evidence suggests some degree of inflammation associated with prominent aspects of PCOS. We aimed to investigate the association of genetic variants 3'UTR rs17468190 (G/T) of the inflammation-associated gene MEP1A (GenBank ID: NM_005588.2) with metabolic disturbances in PCOS and healthy control women. Genetic variants rs17468190 (G/T) of MEP1A gene were analyzed in 576 PCOS women and 206 controls by using the Taqman fluorogenic 5'-exonuclease assay. This polymorphism was tested for association with anthropometric, metabolic, hormonal, and functional parameters of PCOS. There was a borderline significant difference in genotype distribution between PCOS and control women (p=0.046). In overweight/obese PCOS patients, the variants rs17468190 (G/T) in the MEP1A gene are associated with glucose and insulin metabolism. In a dominant model, the GG genotype of the MEP1A gene was more strongly associated with insulin metabolism in overweight/obese PCOS women (body mass index, BMI>25 kg/m(2)), than in GT+TT genotypes. The MEP1A GG-carriers showed a significantly increased homeostatic model assessment - insulin resistance (HOMA-IR) (p=0.003), elevation of fasting insulin (p=0.004) and stimulated insulin (30 min, pdisease modification in PCOS. It might contribute to the abnormalities of glucose metabolism and insulin sensitivity and serve as a diagnostic or therapeutic target gene for PCOS. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  9. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603

  10. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  11. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  12. Hearing-loss-associated gene detection in neonatal intensive care unit.

    Science.gov (United States)

    Yang, S M; Liu, Ying; Liu, C; Yin, A H; Wu, Y F; Zheng, X E; Yang, H M; Yang, J

    2018-02-01

    To investigate the frequency and mutation spectrum of hearing loss-associated gene mutation in Neonatal Intensive Care Unit (NICU). Neonates (n=2305) admitted to NICU were enrolled in this study. Nine prominent hearing loss-associated genes, GJB2 (35 del G, 176 del 16,235 del C, 299 del AT), GJB3 (538 C > T), SLC26A4 (IVS7-2A > G, 2168 A > G) and mtDNA 12S rRNA(1555 A > G, 1494 C > T), were detected. There were 73 cases hearing-loss-associated gene mutation among 2305 cases, the mutation frequency was 3.1%, with 40 cases GJB2 (235del C) mutation (54.8%), 6 cases GJB2 (299 del AT) mutation (8.2%), 21 cases SLC26A4 (IVS 7-2 A > G) mutation (28.7%), 4 cases SLC26A4 (2168 A > G) mutation (5.5%), 2 cases of GJB2 (235del C) combined SLC26A4 (IVS 7-2 A > G, 2168 A > G) mutation (2.8%). Among 73 gene mutation cases, preterm neonates presented in 18 cases, accounting for 24.7% (18/73); hyperbilirubinemia in 13 cases, accounting for 17.8% (13/73); Torch Syndrome in 15 cases, with 12 cases CMV, 2 cases rubella, 1 case toxoplasm, respectively, totally accounting for 20.54% (15/73); neonatal pneumonia in 12 cases, accounting for 16.4% (12/73); birth asphyxia in 5 cases, accounting for 6.9% (5/73); sepsis in 5 cases, accounting for 6.9% (5/73); others in 5 cases, accounting for 6.8% (5/73) . The frequency of hearing loss-associated gene mutation was higher in NICU.There were hearing loss-associated gene mutations in the NICU, suggesting this mutation may complicate with perinatal high-risk factors.

  13. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  15. A de novo variant in the ASPRV1 gene in a dog with ichthyosis.

    Science.gov (United States)

    Bauer, Anina; Waluk, Dominik P; Galichet, Arnaud; Timm, Katrin; Jagannathan, Vidhya; Sayar, Beyza S; Wiener, Dominique J; Dietschi, Elisabeth; Müller, Eliane J; Roosje, Petra; Welle, Monika M; Leeb, Tosso

    2017-03-01

    Ichthyoses are a heterogeneous group of inherited cornification disorders characterized by generalized dry skin, scaling and/or hyperkeratosis. Ichthyosis vulgaris is the most common form of ichthyosis in humans and caused by genetic variants in the FLG gene encoding filaggrin. Filaggrin is a key player in the formation of the stratum corneum, the uppermost layer of the epidermis and therefore crucial for barrier function. During terminal differentiation of keratinocytes, the precursor profilaggrin is cleaved by several proteases into filaggrin monomers and eventually processed into free amino acids contributing to the hydration of the cornified layer. We studied a German Shepherd dog with a novel form of ichthyosis. Comparing the genome sequence of the affected dog with 288 genomes from genetically diverse non-affected dogs we identified a private heterozygous variant in the ASPRV1 gene encoding "aspartic peptidase, retroviral-like 1", which is also known as skin aspartic protease (SASPase). The variant was absent in both parents and therefore due to a de novo mutation event. It was a missense variant, c.1052T>C, affecting a conserved residue close to an autoprocessing cleavage site, p.(Leu351Pro). ASPRV1 encodes a retroviral-like protease involved in profilaggrin-to-filaggrin processing. By immunofluorescence staining we showed that the filaggrin expression pattern was altered in the affected dog. Thus, our findings provide strong evidence that the identified de novo variant is causative for the ichthyosis in the affected dog and that ASPRV1 plays an essential role in skin barrier formation. ASPRV1 is thus a novel candidate gene for unexplained human forms of ichthyoses.

  16. A de novo variant in the ASPRV1 gene in a dog with ichthyosis.

    Directory of Open Access Journals (Sweden)

    Anina Bauer

    2017-03-01

    Full Text Available Ichthyoses are a heterogeneous group of inherited cornification disorders characterized by generalized dry skin, scaling and/or hyperkeratosis. Ichthyosis vulgaris is the most common form of ichthyosis in humans and caused by genetic variants in the FLG gene encoding filaggrin. Filaggrin is a key player in the formation of the stratum corneum, the uppermost layer of the epidermis and therefore crucial for barrier function. During terminal differentiation of keratinocytes, the precursor profilaggrin is cleaved by several proteases into filaggrin monomers and eventually processed into free amino acids contributing to the hydration of the cornified layer. We studied a German Shepherd dog with a novel form of ichthyosis. Comparing the genome sequence of the affected dog with 288 genomes from genetically diverse non-affected dogs we identified a private heterozygous variant in the ASPRV1 gene encoding "aspartic peptidase, retroviral-like 1", which is also known as skin aspartic protease (SASPase. The variant was absent in both parents and therefore due to a de novo mutation event. It was a missense variant, c.1052T>C, affecting a conserved residue close to an autoprocessing cleavage site, p.(Leu351Pro. ASPRV1 encodes a retroviral-like protease involved in profilaggrin-to-filaggrin processing. By immunofluorescence staining we showed that the filaggrin expression pattern was altered in the affected dog. Thus, our findings provide strong evidence that the identified de novo variant is causative for the ichthyosis in the affected dog and that ASPRV1 plays an essential role in skin barrier formation. ASPRV1 is thus a novel candidate gene for unexplained human forms of ichthyoses.

  17. Toxin Gene Analysis of a Variant Strain of Clostridium difficile That Causes Human Clinical Disease

    Science.gov (United States)

    Sambol, Susan P.; Merrigan, Michelle M.; Lyerly, David; Gerding, Dale N.; Johnson, Stuart

    2000-01-01

    A toxin variant strain of Clostridium difficile was isolated from two patients with C. difficile-associated disease (CDAD), one of whom died from extensive pseudomembranous colitis. This strain, identified by restriction endonuclease analysis (REA) as type CF2, was not detected by an immunoassay for C. difficile toxin A. Culture supernatants of CF2 failed to elicit significant enterotoxic activity in the rabbit ileal loop assay but did produce atypical cytopathic effects in cell culture assay. Southern hybridization, PCR amplification, and DNA sequence analyses were performed on the toxin A (tcdA) and toxin B (tcdB) genes of type CF2 isolate 5340. Type CF2 5340 tcdA exhibited a 1,821-bp truncation, due to three deletions in the 3′ end of the gene, and a point mutation in the 5′ end of the gene, resulting in a premature stop codon at tcdA position 139. Type CF2 5340 tcdB exhibited multiple nucleotide base substitutions in the 5′ end of the gene compared to tcdB of the standard toxigenic strain VPI 10463. Type CF2 5340 toxin gene nucleotide sequences and deduced amino acid sequences showed a strong resemblance to those of the previously described variant C. difficile strain 1470, a strain reported to have reduced pathogenicity and no association with clinical illness in humans. REA of strain 1470 identified this strain as a distinct type (CF1) within the same REA group as the closely related type CF2. A review of our clinical-isolate collection identified five additional patients infected with type CF2, three of whom had documented CDAD. PCR amplification of the 3′ end of tcdA demonstrated identical 1.8-kb deletions in all seven type CF2 isolates. REA type CF2 is a toxin variant strain of C. difficile that retains the ability to cause disease in humans but is not detected in clinical immunoassays for toxin A. PMID:10992443

  18. Analysis of IL12B gene variants in inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Jürgen Glas

    Full Text Available BACKGROUND: IL12B encodes the p40 subunit of IL-12, which is also part of IL-23. Recent genome-wide association studies identified IL12B and IL23R as susceptibility genes for inflammatory bowel disease (IBD. However, the phenotypic effects and potential gene-gene interactions of IL12B variants are largely unknown. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed IL12B gene variants regarding association with Crohn's disease (CD and ulcerative colitis (UC. Genomic DNA from 2196 individuals including 913 CD patients, 318 UC patients and 965 healthy, unrelated controls was analyzed for four SNPs in the IL12B gene region (rs3212227, rs17860508, rs10045431, rs6887695. Our analysis revealed an association of the IL12B SNP rs6887695 with susceptibility to IBD (p = 0.035; OR 1.15 [95% CI 1.01-1.31] including a trend for rs6887695 for association with CD (OR 1.41; [0.99-1.31], p = 0.066 and UC (OR 1.18 [0.97-1.43], p = 0.092. CD patients, who were homozygous C/C carriers of this SNP, had significantly more often non-stricturing, non-penetrating disease than carriers of the G allele (p = 6.8×10(-5; OR = 2.84, 95% CI 1.66-4.84, while C/C homozygous UC patients had less often extensive colitis than G allele carriers (p = 0.029; OR = 0.36, 95% CI 0.14-0.92. In silico analysis predicted stronger binding of the minor C allele of rs6887695 to the transcription factor RORα which is involved in Th17 differentiation. Differences regarding the binding to the major and minor allele sequence of rs6887695 were also predicted for the transcription factors HSF1, HSF2, MZF1 and Oct-1. Epistasis analysis revealed weak epistasis of the IL12B SNP rs6887695 with several SNPs (rs11889341, rs7574865, rs7568275, rs8179673, rs10181656, rs7582694 in the STAT4 gene which encodes the major IL-12 downstream transcription factor STAT4 (p<0.05 but there was no epistasis between IL23R and IL12B variants. CONCLUSIONS/SIGNIFICANCE: The IL12B SNP rs6887695

  19. Kicker thyratron experience from SLC

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

    1991-05-01

    The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

  20. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  1. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  2. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  3. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  4. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  5. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  6. Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Ming LEI

    2012-01-01

    Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.

  7. Novel SLC19A3 Promoter Deletion and Allelic Silencing in Biotin-Thiamine-Responsive Basal Ganglia Encephalopathy.

    Directory of Open Access Journals (Sweden)

    Irene Flønes

    Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.

  8. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  9. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  10. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  11. Association study of genetic variants in estrogen metabolic pathway genes and colorectal cancer risk and survival.

    Science.gov (United States)

    Li, Shuwei; Xie, Lisheng; Du, Mulong; Xu, Kaili; Zhu, Lingjun; Chu, Haiyan; Chen, Jinfei; Wang, Meilin; Zhang, Zhengdong; Gu, Dongying

    2018-05-16

    Although studies have investigated the association of genetic variants and the abnormal expression of estrogen-related genes with colorectal cancer risk, the evidence remains inconsistent. We clarified the relationship of genetic variants in estrogen metabolic pathway genes with colorectal cancer risk and survival. A case-control study was performed to assess the association of single-nucleotide polymorphisms (SNPs) in ten candidate genes with colorectal cancer risk in a Chinese population. A logistic regression model and Cox regression model were used to calculate SNP effects on colorectal cancer susceptibility and survival, respectively. Expression quantitative trait loci (eQTL) analysis was conducted using the Genotype-Tissue Expression (GTEx) project dataset. The sequence kernel association test (SKAT) was used to perform gene-set analysis. Colorectal cancer risk and rs3760806 in SULT2B1 were significantly associated in both genders [male: OR = 1.38 (1.15-1.66); female: OR = 1.38 (1.13-1.68)]. Two SNPs in SULT1E1 were related to progression-free survival (PFS) [rs1238574: HR = 1.24 (1.02-1.50), P = 2.79 × 10 -2 ; rs3822172: HR = 1.30 (1.07-1.57), P = 8.44 × 10 -3 ] and overall survival (OS) [rs1238574: HR = 1.51 (1.16-1.97), P = 2.30 × 10 -3 ; rs3822172: HR = 1.53 (1.67-2.00), P = 2.03 × 10 -3 ]. Moreover, rs3760806 was an eQTL for SULT2B1 in colon samples (transverse: P = 3.6 × 10 -3 ; sigmoid: P = 1.0 × 10 -3 ). SULT2B1 expression was significantly higher in colorectal tumor tissues than in normal tissues in the Cancer Genome Atlas (TCGA) database (P colorectal cancer susceptibility and survival.

  12. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  13. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  14. A role for coding functional variants in HNF4A in type 2 diabetes susceptibility

    DEFF Research Database (Denmark)

    Jafar-Mohammadi, B; Groves, C J; Gjesing, A P

    2011-01-01

    Rare mutations in the gene HNF4A, encoding the transcription factor hepatocyte nuclear factor 4α (HNF-4A), account for ~5% of cases of MODY and more frequent variants in this gene may be involved in multifactorial forms of diabetes. Two low-frequency, non-synonymous variants in HNF4A (V255M, minor...... allele frequency [MAF] ~0.1%; T130I, MAF ~3.0%)-known to influence downstream HNF-4A target gene expression-are of interest, but previous type 2 diabetes association reports were inconclusive. We aimed to evaluate the contribution of these variants to type 2 diabetes susceptibility through large...

  15. Targeted deep resequencing identifies coding variants in the PEAR1 gene that play a role in platelet aggregation.

    Directory of Open Access Journals (Sweden)

    Yoonhee Kim

    Full Text Available Platelet aggregation is heritable, and genome-wide association studies have detected strong associations with a common intronic variant of the platelet endothelial aggregation receptor1 (PEAR1 gene both in African American and European American individuals. In this study, we used a sequencing approach to identify additional exonic variants in PEAR1 that may also determine variability in platelet aggregation in the GeneSTAR Study. A 0.3 Mb targeted region on chromosome 1q23.1 including the entire PEAR1 gene was Sanger sequenced in 104 subjects (45% male, 49% African American, age = 52±13 selected on the basis of hyper- and hypo- aggregation across three different agonists (collagen, epinephrine, and adenosine diphosphate. Single-variant and multi-variant burden tests for association were performed. Of the 235 variants identified through sequencing, 61 were novel, and three of these were missense variants. More rare variants (MAF<5% were noted in African Americans compared to European Americans (108 vs. 45. The common intronic GWAS-identified variant (rs12041331 demonstrated the most significant association signal in African Americans (p = 4.020×10(-4; no association was seen for additional exonic variants in this group. In contrast, multi-variant burden tests indicated that exonic variants play a more significant role in European Americans (p = 0.0099 for the collective coding variants compared to p = 0.0565 for intronic variant rs12041331. Imputation of the individual exonic variants in the rest of the GeneSTAR European American cohort (N = 1,965 supports the results noted in the sequenced discovery sample: p = 3.56×10(-4, 2.27×10(-7, 5.20×10(-5 for coding synonymous variant rs56260937 and collagen, epinephrine and adenosine diphosphate induced platelet aggregation, respectively. Sequencing approaches confirm that a common intronic variant has the strongest association with platelet aggregation in African Americans

  16. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  17. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  18. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  19. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  20. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  1. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  2. BSG and MCT1 Genetic Variants Influence Survival in Multiple Myeloma Patients

    Directory of Open Access Journals (Sweden)

    Piotr Łacina

    2018-04-01

    Full Text Available Multiple myeloma (MM is a haematologic malignancy characterized by the presence of atypical plasma cells. Basigin (BSG, CD147 controls lactate export through the monocarboxylic acid transporter 1 (MCT1, SLC16A1 and supports MM survival and proliferation. Additionally, BSG is implicated in response to treatment with immunomodulatory drugs (thalidomide and its derivatives. We investigated the role of single nucleotide polymorphisms (SNPs in the gene coding for BSG and SLC16A1 in MM. Following an in silico analysis, eight SNPs (four in BSG and four in SLC16A1 predicted to have a functional effect were selected and analyzed in 135 MM patients and 135 healthy individuals. Alleles rs4919859 C, rs8637 G, and haplotype CG were associated with worse progression-free survival (p = 0.006, p = 0.017, p = 0.002, respectively, while rs7556664 A, rs7169 T and rs1049434 A (all in linkage disequilibrium (LD, r2 > 0.98 were associated with better overall survival (p = 0.021. Similar relationships were observed in thalidomide-treated patients. Moreover, rs4919859 C, rs8637 G, rs8259 A and the CG haplotype were more common in patients in stages II–III of the International Staging System (p < 0.05, while rs8259 A correlated with higher levels of β-2-microglobulin and creatinine (p < 0.05. Taken together, our results show that BSG and SLC16A1 variants affect survival, and may play an important role in MM.

  3. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  4. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  5. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  6. Comparison of gene-based rare variant association mapping methods for quantitative traits in a bovine population with complex familial relationships.

    Science.gov (United States)

    Zhang, Qianqian; Guldbrandtsen, Bernt; Calus, Mario P L; Lund, Mogens Sandø; Sahana, Goutam

    2016-08-17

    There is growing interest in the role of rare variants in the variation of complex traits due to increasing evidence that rare variants are associated with quantitative traits. However, association methods that are commonly used for mapping common variants are not effective to map rare variants. Besides, livestock populations have large half-sib families and the occurrence of rare variants may be confounded with family structure, which makes it difficult to disentangle their effects from family mean effects. We compared the power of methods that are commonly applied in human genetics to map rare variants in cattle using whole-genome sequence data and simulated phenotypes. We also studied the power of mapping rare variants using linear mixed models (LMM), which are the method of choice to account for both family relationships and population structure in cattle. We observed that the power of the LMM approach was low for mapping a rare variant (defined as those that have frequencies lower than 0.01) with a moderate effect (5 to 8 % of phenotypic variance explained by multiple rare variants that vary from 5 to 21 in number) contributing to a QTL with a sample size of 1000. In contrast, across the scenarios studied, statistical methods that are specialized for mapping rare variants increased power regardless of whether multiple rare variants or a single rare variant underlie a QTL. Different methods for combining rare variants in the test single nucleotide polymorphism set resulted in similar power irrespective of the proportion of total genetic variance explained by the QTL. However, when the QTL variance is very small (only 0.1 % of the total genetic variance), these specialized methods for mapping rare variants and LMM generally had no power to map the variants within a gene with sample sizes of 1000 or 5000. We observed that the methods that combine multiple rare variants within a gene into a meta-variant generally had greater power to map rare variants compared

  7. Association and interaction analyses of 5-HT3 receptor and serotonin transporter genes with alcohol, cocaine, and nicotine dependence using the SAGE data.

    Science.gov (United States)

    Yang, Jiekun; Li, Ming D

    2014-07-01

    Previous studies have implicated genes encoding the 5-HT3AB receptors (HTR3A and HTR3B) and the serotonin transporter (SLC6A4), both independently and interactively, in alcohol (AD), cocaine (CD), and nicotine dependence (ND). However, whether these genetic effects also exist in subjects with comorbidities remains largely unknown. We used 1,136 African-American (AA) and 2,428 European-American (EA) subjects from the Study of Addiction: Genetics and Environment (SAGE) to determine associations between 88 genotyped or imputed variants within HTR3A, HTR3B, and SLC6A4 and three types of addictions, which were measured by DSM-IV diagnoses of AD, CD, and ND and the Fagerström Test for Nicotine Dependence (FTND), an independent measure of ND commonly used in tobacco research. Individual SNP-based association analysis revealed a significant association of rs2066713 in SLC6A4 with FTND in AA (β = -1.39; P = 1.6E - 04). Haplotype-based association analysis found one major haplotype formed by SNPs rs3891484 and rs3758987 in HTR3B that was significantly associated with AD in the AA sample, and another major haplotype T-T-G, formed by SNPs rs7118530, rs12221649, and rs2085421 in HTR3A, which showed significant association with FTND in the EA sample. Considering the biologic roles of the three genes and their functional relations, we used the GPU-based Generalized Multifactor Dimensionality Reduction (GMDR-GPU) program to test SNP-by-SNP interactions within the three genes and discovered two- to five-variant models that have significant impacts on AD, CD, ND, or FTND. Interestingly, most of the SNPs included in the genetic interaction model(s) for each addictive phenotype are either overlapped or in high linkage disequilibrium for both AA and EA samples, suggesting these detected variants in HTR3A, HTR3B, and SLC6A4 are interactively contributing to etiology of the three addictive phenotypes examined in this study.

  8. Evaluation of variants of melanoma-associated antigen genes and mRNA transcripts in melanomas of dogs.

    Science.gov (United States)

    Stell, Anneliese J; Dobson, Jane M; Scase, Timothy J; Catchpole, Brian

    2009-12-01

    OBJECTIVE-To characterize variability in melanoma-associated antigen (MAA) genes and gene expression in melanomas of dogs. ANIMALS-18 dogs with malignant melanomas and 8 healthy control dogs. PROCEDURES-cDNA was prepared from malignant melanoma biopsy specimens and from pigmented oral mucocutaneous tissues of healthy control dogs. Genomic DNA was extracted from poorly pigmented melanomas. A PCR assay was performed by use of Melan-A, SILV, or tyrosinase-specific primers. RESULTS-Splice variants of Melan-A and SILV were identified in malignant melanomas and also in healthy pigmented tissues, whereas a tyrosinase splice variant was detected in melanoma tissues only. A short interspersed nuclear element (SINE) insertion mutation was identified in the SILV gene in 1 of 10 poorly pigmented melanomas. Six novel exonic single nucleotide polymorphisms (SNPs; 3 synonymous and 3 nonsynonymous) were detected in the tyrosinase gene, and 1 nonsynonymous exonic SNP was detected in the SILV gene. CONCLUSIONS AND CLINICAL RELEVANCE-Variants of MAA mRNA were detected in malignant melanoma tissues of dogs. The importance of MAA alternative transcripts expressed in melanomas and normal pigmented tissues was unclear, but they may have represented a means of regulating melanin synthesis. The tyrosinase splice variant was detected only in melanomas and could potentially be a tumor-specific target for immunotherapy. A SILV SINE insertion mutation was identified in a melanoma from a Great Dane, a breed known to carry this mutation (associated with merle coat color). The nonsynonymous SNPs detected in tyrosinase and SILV transcripts did not appear to affect tumor pigmentation.

  9. Whole-exome sequencing identified a variant in EFTUD2 gene in establishing a genetic diagnosis.

    Science.gov (United States)

    Rengasamy Venugopalan, S; Farrow, E G; Lypka, M

    2017-06-01

    Craniofacial anomalies are complex and have an overlapping phenotype. Mandibulofacial Dysostosis and Oculo-Auriculo-Vertebral Spectrum are conditions that share common craniofacial phenotype and present a challenge in arriving at a diagnosis. In this report, we present a case of female proband who was given a differential diagnosis of Treacher Collins syndrome or Hemifacial Microsomia without certainty. Prior genetic testing reported negative for 22q deletion and FGFR screenings. The objective of this study was to demonstrate the critical role of whole-exome sequencing in establishing a genetic diagnosis of the proband. The participants were 14½-year-old affected female proband/parent trio. Proband/parent trio were enrolled in the study. Surgical tissue sample from the proband and parental blood samples were collected and prepared for whole-exome sequencing. Illumina HiSeq 2500 instrument was used for sequencing (125 nucleotide reads/84X coverage). Analyses of variants were performed using custom-developed software, RUNES and VIKING. Variant analyses following whole-exome sequencing identified a heterozygous de novo pathogenic variant, c.259C>T (p.Gln87*), in EFTUD2 (NM_004247.3) gene in the proband. Previous studies have reported that the variants in EFTUD2 gene were associated with Mandibulofacial Dysostosis with Microcephaly. Patients with facial asymmetry, micrognathia, choanal atresia and microcephaly should be analyzed for variants in EFTUD2 gene. Next-generation sequencing techniques, such as whole-exome sequencing offer great promise to improve the understanding of etiologies of sporadic genetic diseases. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Genetic variants and early cigarette smoking and nicotine dependence phenotypes in adolescents.

    Directory of Open Access Journals (Sweden)

    Jennifer O'Loughlin

    Full Text Available While the heritability of cigarette smoking and nicotine dependence (ND is well-documented, the contribution of specific genetic variants to specific phenotypes has not been closely examined. The objectives of this study were to test the associations between 321 tagging single-nucleotide polymorphisms (SNPs that capture common genetic variation in 24 genes, and early smoking and ND phenotypes in novice adolescent smokers, and to assess if genetic predictors differ across these phenotypes.In a prospective study of 1294 adolescents aged 12-13 years recruited from ten Montreal-area secondary schools, 544 participants who had smoked at least once during the 7-8 year follow-up provided DNA. 321 single-nucleotide polymorphisms (SNPs in 24 candidate genes were tested for an association with number of cigarettes smoked in the past 3 months, and with five ND phenotypes (a modified version of the Fagerstrom Tolerance Questionnaire, the ICD-10 and three clusters of ND symptoms representing withdrawal symptoms, use of nicotine for self-medication, and a general ND/craving symptom indicator.The pattern of SNP-gene associations differed across phenotypes. Sixteen SNPs in seven genes (ANKK1, CHRNA7, DDC, DRD2, COMT, OPRM1, SLC6A3 (also known as DAT1 were associated with at least one phenotype with a p-value <0.01 using linear mixed models. After permutation and FDR adjustment, none of the associations remained statistically significant, although the p-values for the association between rs557748 in OPRM1 and the ND/craving and self-medication phenotypes were both 0.076.Because the genetic predictors differ, specific cigarette smoking and ND phenotypes should be distinguished in genetic studies in adolescents. Fifteen of the 16 top-ranked SNPs identified in this study were from loci involved in dopaminergic pathways (ANKK1/DRD2, DDC, COMT, OPRM1, and SLC6A3.Dopaminergic pathways may be salient during early smoking and the development of ND.

  11. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  12. SLC2A9 and ZNF518B polymorphisms correlate with gout-related metabolic indices in Chinese Tibetan populations.

    Science.gov (United States)

    Zhang, X Y; Geng, T T; Liu, L J; Yuan, D Y; Feng, T; Kang, L L; Jin, T B; Chen, C

    2015-08-19

    Current evidence suggests that heredity and metabolic syndrome contribute to gout progression. SLC2A9 and ZNF518B may play a role in gout progression in different populations, but no studies have focused on the Tibetan Chinese population. In this study, we determined whether variations in these 2 genes were correlated with gout-related indices in Chinese-Tibetan gout patients. We detected 6 single nucleotide polymorphisms in SLC2A9 and ZNF518B in 319 Chinese Tibetan gout patients. One-way analysis of variance was used to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators. Polymorphisms in SLC2A9 and ZNF518B affected multiple risk factors related to gout development. Significant differences in serum triglyceride levels and high-density lipoprotein-cholesterol level were detected between different genotypic groups with SLC2A9 polymorphisms rs13129697 (P = 0.022), rs4447863 (P = 0.018), and rs1014290 (P = 0.045). Similarly in ZNF518B, rs3217 (P = 0.016) and rs10016022 (P = 0.046) were associated with high creatinine and glucose levels, respectively. This study is the first to investigate and identify positive correlations between SLC2A9 and ZNF518B gene polymorphisms and metabolic indices in Tibetan gout patients. We found significant evidence indicating that genetic polymorphisms affect gout-related factors in Chinese Tibetan populations.

  13. Homozygous SLC6A17 mutations cause autosomal-recessive intellectual disability with progressive tremor, speech impairment, and behavioral problems.

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-03-05

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  15. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  16. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  17. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  18. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  19. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  20. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  1. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  2. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  3. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  4. HFE gene C282Y variant is associated with colorectal cancer in Caucasians: a meta-analysis.

    Science.gov (United States)

    Chen, Weidong; Zhao, Hua; Li, Tiegang; Yao, Hongliang

    2013-08-01

    The HFE gene has been suggested to play an important role in the pathogenesis of colorectal cancer. However, the results have been conflicting. In this study, we performed a meta-analysis to clarify the association of HFE gene C282Y variant with colorectal cancer. PubMed and Embase were retrieved to identify the potential literature. Pooled odds ratio (OR) with 95 % confidence interval (CI) was calculated using fixed- or random-effects model. A total of eight papers including nine studies (7,588 colorectal cancer cases and 81,571 controls) for HFE gene C282Y variant were included in the meta-analysis. The result indicated that HFE gene C282Y variant was significantly associated with colorectal cancer under recessive model (OR = 2.00, 95 % CI = 1.32-3.04), with no evidence of between-study heterogeneity (I (2) = 0.2 %, p = 0.432). Further subgroup analysis by number of cases suggested the effect was significant in studies with more than 500 cases (OR = 2.51, 95 % CI = 1.58-3.98, I (2) = 0.0 %, p = 0.921), but not in studies with less than 500 cases (OR = 0.75, 95 % CI = 0.28-1.97, I (2) = 0.0 %, p = 0.622). The current meta-analysis supported the positive association of HFE gene C282Y variant with colorectal cancer. Further large-scale studies with the consideration for gene-gene/gene-environment interactions should be conducted to investigate the association.

  5. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  6. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  7. RS 10767664 gene variant in Brain Derived Neurotrophic Factor (BDNF) affect metabolic changes and insulin resistance after a standard hypocaloric diet.

    Science.gov (United States)

    de Luis, Daniel Antonio; Fernández Ovalle, H; Izaola, O; Primo, D; Aller, Rocío

    2018-02-01

    Role of BDNF variants on change in body weight and cardiovascular risk factors after weight loss remains unclear in obese patients. Our aim was to analyze the effects of rs10767664 BDNF gene polymorphism on body weight, cardiovascular risk factors and serum adipokine levels after a standard hypocaloric diet in obese subjects. A Caucasian population of 80 obese patients was analyzed before and after 3months on a standard hypocaloric diet. Fifty patients (62.5%) had the genotype AA and 30 (37.5%) subjects had the next genotypes; AT (25 patients, 31.3%) or TT (5 study subjects, 6.3%) (second group). In non T allele carriers, the decreases in weight-3.4±2.9kg (T allele group -1.7±2.0kg:p=0.01), BMI -1.5±0.2kg (T allele group -1.2±0.5kg:p=0.02), fat mass-2.3±1.1kg (T allele group -1.7±0.9kg:p=0.009), waist circumference-3.8±2.4cm (T allele group -2.1±3.1cm:p=0.008), triglycerides -13.2±7.5mg/dl (T allele group +2.8±1.2mg/dl:p=0.02), insulin -2.1±1.9mUI/L (T allele group -0.3±1.0mUI/L:p=0.01), HOMA-IR -0.9±0.4 (T allele group -0.1±0.8:p=0.01) and leptin -10.1±9.5ng/dl (T allele group -3.1±0.2ng/dl:p=0.01) were higher than T allele carriers. rs10767664 variant of BDNF gene modify anthropometric and biochemical changes after weight loss with a hypocaloric diet. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  9. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  10. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  11. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  12. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  13. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  14. Identification of rare high-risk copy number variants affecting the dopamine transporter gene in mental disorders

    DEFF Research Database (Denmark)

    Hoeffding, Louise Kristine Enggaard; Duong, Linh T T; Ingason, Andres

    2016-01-01

    BACKGROUND: The dopamine transporter, also known as solute carrier 6A3 (SLC6A3), plays an important role in synaptic transmission by regulating the reuptake of dopamine in the synapses. In line with this, variations in the gene encoding this transporter have been linked to both schizophrenia and ...

  15. Expression of the human growth hormone variant gene in cultured fibroblasts and transgenic mice

    International Nuclear Information System (INIS)

    Selden, R.F.; Wagner, T.E.; Blethen, S.; Yun, J.S.; Rowe, M.E.; Goodman, H.M.

    1988-01-01

    The nucleotide sequence of the human growth hormone variant gene, one of the five members of the growth hormone gene family, predicts that it encodes a growth hormone-like protein. As a first step in determining whether this gene is functional in humans, the authors have expressed a mouse methallothionein I/human growth hormone variant fusion gene in mouse L cells and in transgenic mice. The growth hormone variant protein expressed in transiently transfected L cells is distinct from growth hormone itself with respect to reactivity with anti-growth hormone monoclonal antibodies, behavior during column chromatography, and isoelectric point. Transgenic mice expressing the growth hormone variant protein are 1.4- to 1.9-fold larger than nontransgenic controls, suggesting that the protein has growth-promoting properties

  16. The D313Y variant in the GLA gene - no evidence of a pathogenic role in Fabry disease

    DEFF Research Database (Denmark)

    Hasholt, Lis; Ballegaard, Martin; Bundgaard, Henning

    2017-01-01

    Fabry disease is an X- linked inherited lysosomal storage disease caused by mutations in the GLA gene encoding the lysosomal enzyme alpha-galactosidase A (α-Gal A). The possible pathological significance of the D313Y variant in the GLA gene has not been verified and it may be a Fabry variant. Our......, and the presence in Fabry females did not significantly enhance the phenotype of a known causative mutation in the GLA gene (G271S). Our findings indicate that the D313Y variant is not causative to nor enhancing Fabry disease phenotype. The D313Y variant in the GLA gene was not disease causative in 2 Danish...... families. Investigating male family members were crucial in excluding the Fabry phenotype, and thus very important for proper genetic counceling of all family members, as well as overdiagnosing a devastating genetic disease....

  17. Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

    Science.gov (United States)

    Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

    2018-01-01

    The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

  18. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  19. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  20. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  1. Screening for common copy-number variants in cancer genes.

    Science.gov (United States)

    Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L

    2010-12-01

    For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  3. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  4. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  5. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  6. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  7. A genetic variant in 12q13, a possible risk factor for bipolar disorder, is associated with depressive state, accounting for stressful life events.

    Directory of Open Access Journals (Sweden)

    Ayu Shimasaki

    Full Text Available Genome-wide association studies (GWASs have identified a number of susceptibility genes for schizophrenia (SCZ and bipolar disorder (BD. However, the identification of risk genes for major depressive disorder (MDD has been unsuccessful because the etiology of MDD is more influenced by environmental factors; thus, gene-environment (G × E interactions are important, such as interplay with stressful life events (SLEs. We assessed the G×E interactions and main effects of genes targeting depressive symptoms. Using a case-control design, 922 hospital staff members were evaluated for depressive symptoms according to Beck Depressive Inventory (BDI; "depression" and "control" groups were classified by scores of 10 in the BDI test, SLEs, and personality. A total of sixty-three genetic variants were selected on the basis of previous GWASs of MDD, SCZ, and BD as well as candidate-gene (SLC6A4, BDNF, DBH, and FKBP5 studies. Logistic regression analysis revealed a marginally significant interaction (genetic variant × SLE at rs4523957 (P uncorrected = 0.0034 with depression and a significant association of single nucleotide polymorphism identified from evidence of BD GWAS (rs7296288, downstream of DHH at 12q13.1 with depression as the main effect (P uncorrected = 9.4 × 10(-4, P corrected = 0.0424. We also found that SLEs had a larger impact on depression (odds ratio ∼ 3, as reported previously. These results suggest that DHH plays a possible role in depression etiology; however, variants from MDD or SCZ GWAS evidence or candidate genes showed no significant associations or minimal effects of interactions with SLEs on depression.

  8. Analysis of IL12B Gene Variants in Inflammatory Bowel Disease

    Science.gov (United States)

    Wagner, Johanna; Olszak, Torsten; Fries, Christoph; Tillack, Cornelia; Friedrich, Matthias; Beigel, Florian; Stallhofer, Johannes; Steib, Christian; Wetzke, Martin; Göke, Burkhard; Ochsenkühn, Thomas; Diegelmann, Julia; Czamara, Darina; Brand, Stephan

    2012-01-01

    Background IL12B encodes the p40 subunit of IL-12, which is also part of IL-23. Recent genome-wide association studies identified IL12B and IL23R as susceptibility genes for inflammatory bowel disease (IBD). However, the phenotypic effects and potential gene-gene interactions of IL12B variants are largely unknown. Methodology/Principal Findings We analyzed IL12B gene variants regarding association with Crohn's disease (CD) and ulcerative colitis (UC). Genomic DNA from 2196 individuals including 913 CD patients, 318 UC patients and 965 healthy, unrelated controls was analyzed for four SNPs in the IL12B gene region (rs3212227, rs17860508, rs10045431, rs6887695). Our analysis revealed an association of the IL12B SNP rs6887695 with susceptibility to IBD (p = 0.035; OR 1.15 [95% CI 1.01–1.31] including a trend for rs6887695 for association with CD (OR 1.41; [0.99–1.31], p = 0.066) and UC (OR 1.18 [0.97–1.43], p = 0.092). CD patients, who were homozygous C/C carriers of this SNP, had significantly more often non-stricturing, non-penetrating disease than carriers of the G allele (p = 6.8×10−5; OR = 2.84, 95% CI 1.66–4.84), while C/C homozygous UC patients had less often extensive colitis than G allele carriers (p = 0.029; OR = 0.36, 95% CI 0.14–0.92). In silico analysis predicted stronger binding of the minor C allele of rs6887695 to the transcription factor RORα which is involved in Th17 differentiation. Differences regarding the binding to the major and minor allele sequence of rs6887695 were also predicted for the transcription factors HSF1, HSF2, MZF1 and Oct-1. Epistasis analysis revealed weak epistasis of the IL12B SNP rs6887695 with several SNPs (rs11889341, rs7574865, rs7568275, rs8179673, rs10181656, rs7582694) in the STAT4 gene which encodes the major IL-12 downstream transcription factor STAT4 (p<0.05) but there was no epistasis between IL23R and IL12B variants. Conclusions/Significance The IL12B SNP rs6887695 modulates

  9. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  10. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Science.gov (United States)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A. T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kelemen, Linda E.; Kellar, Mellissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F. A. G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N.; Berchuck, Andrew; Iversen, Edwin S.; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N. A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2015-01-01

    Background Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. Methods In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. Results The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). Conclusion These results, generated on a large cohort of women, revealed associations

  11. Exomic sequencing of immune-related genes reveals novel candidate variants associated with alopecia universalis.

    Directory of Open Access Journals (Sweden)

    Seungbok Lee

    Full Text Available Alopecia areata (AA is a common autoimmune disorder mostly presented as round patches of hair loss and subclassified into alopecia totalis/alopecia universalis (AT/AU based on the area of alopecia. Although AA is relatively common, only 5% of AA patients progress to AT/AU, which affect the whole scalp and whole body respectively. To determine genetic determinants of this orphan disease, we undertook whole-exome sequencing of 6 samples from AU patients, and 26 variants in immune-related genes were selected as candidates. When an additional 14 AU samples were genotyped for these candidates, 6 of them remained at the level of significance in comparison with 155 Asian controls (p<1.92×10(-3. Linkage disequilibrium was observed between some of the most significant SNPs, including rs41559420 of HLA-DRB5 (p<0.001, OR 44.57 and rs28362679 of BTNL2 (p<0.001, OR 30.21. While BTNL2 was reported as a general susceptibility gene of AA previously, HLA-DRB5 has not been implicated in AA. In addition, we found several genetic variants in novel genes (HLA-DMB, TLR1, and PMS2 and discovered an additional locus on HLA-A, a known susceptibility gene of AA. This study provides further evidence for the association of previously reported genes with AA and novel findings such as HLA-DRB5, which might represent a hidden culprit gene for AU.

  12. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome

    OpenAIRE

    Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi

    2012-01-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...

  13. Effects of dopamine D2 receptor (DRD2) and transporter (SLC6A3) polymorphisms on smoking cue-induced cigarette craving among African-American smokers.

    Science.gov (United States)

    Erblich, J; Lerman, C; Self, D W; Diaz, G A; Bovbjerg, D H

    2005-04-01

    Cue-induced craving for addictive substances has long been known to contribute to the problem of persistent addiction in humans. Research in animals over the past decade has solidly established the central role of dopamine in cue-induced craving for addictive substances, including nicotine. Analogous studies in humans, however, are lacking, especially among African-American smokers, who have lower quit rates than Caucasian smokers. Based on the animal literature, the study's objective was to test the hypothesis that smokers carrying specific variants in dopamine-related genes previously associated with risk for addictive behaviors would exhibit heightened levels of cigarette craving following laboratory exposure to cues. To this end, cigarette craving was induced in healthy African-American smokers (n=88) through laboratory exposure to smoking cues. Smokers carrying either the DRD2 (D2 dopamine receptor gene) TaqI A1 RFLP or the SLC6A3 (dopamine transporter gene) 9-repeat VNTR polymorphisms had stronger cue-induced cravings than noncarriers (Ps cue-induced craving in humans, and suggest a possible genetic risk factor for persistent smoking behavior in African-American smokers.

  14. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  15. Changes in global gene expression profiles induced by HPV 16 E6 oncoprotein variants in cervical carcinoma C33-A cells

    International Nuclear Information System (INIS)

    Zacapala-Gómez, Ana Elvira; Del Moral-Hernández, Oscar; Villegas-Sepúlveda, Nicolás; Hidalgo-Miranda, Alfredo; Romero-Córdoba, Sandra Lorena

    2016-01-01

    We analyzed the effects of the expression of HPV 16 E6 oncoprotein variants (AA-a, AA-c, E-A176/G350, E-C188/G350, E-G350), and the E-Prototype in global gene expression profiles in an in vitro model. E6 gene was cloned into an expression vector fused to GFP and was transfected in C33-A cells. Affymetrix GeneChip Human Transcriptome Array 2.0 platform was used to analyze the expression of over 245,000 coding transcripts. We found that HPV16 E6 variants altered the expression of 387 different genes in comparison with E-Prototype. The altered genes are involved in cellular processes related to the development of cervical carcinoma, such as adhesion, angiogenesis, apoptosis, differentiation, cell cycle, proliferation, transcription and protein translation. Our results show that polymorphic changes in HPV16 E6 natural variants are sufficient to alter the overall gene expression profile in C33-A cells, explaining in part the observed differences in oncogenic potential of HPV16 variants. - Highlights: • Amino acid changes in HPV16 E6 variants modulate the transciption of specific genes. • This is the first comparison of global gene expression profile of HPV 16 E6 variants. • Each HPV 16 E6 variant appears to have its own molecular signature.

  16. Changes in global gene expression profiles induced by HPV 16 E6 oncoprotein variants in cervical carcinoma C33-A cells

    Energy Technology Data Exchange (ETDEWEB)

    Zacapala-Gómez, Ana Elvira, E-mail: zak_ana@yahoo.com.mx [Laboratorio de Biomedicina Molecular, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero, Chilpancingo, Gro., México (Mexico); Del Moral-Hernández, Oscar, E-mail: odelmoralh@gmail.com [Laboratorio de Biomedicina Molecular, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero, Chilpancingo, Gro., México (Mexico); Villegas-Sepúlveda, Nicolás, E-mail: nvillega@cinvestav.mx [Departamento de Biomedicina Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), México, D.F., México (Mexico); Hidalgo-Miranda, Alfredo, E-mail: ahidalgo@inmegen.gob.mx [Laboratorio de Genómica del Cáncer, Instituto Nacional de Medicina Genómica (INMEGEN), México, D.F., México (Mexico); Romero-Córdoba, Sandra Lorena, E-mail: sromero_cordoba@hotmail.com [Laboratorio de Genómica del Cáncer, Instituto Nacional de Medicina Genómica (INMEGEN), México, D.F., México (Mexico); and others

    2016-01-15

    We analyzed the effects of the expression of HPV 16 E6 oncoprotein variants (AA-a, AA-c, E-A176/G350, E-C188/G350, E-G350), and the E-Prototype in global gene expression profiles in an in vitro model. E6 gene was cloned into an expression vector fused to GFP and was transfected in C33-A cells. Affymetrix GeneChip Human Transcriptome Array 2.0 platform was used to analyze the expression of over 245,000 coding transcripts. We found that HPV16 E6 variants altered the expression of 387 different genes in comparison with E-Prototype. The altered genes are involved in cellular processes related to the development of cervical carcinoma, such as adhesion, angiogenesis, apoptosis, differentiation, cell cycle, proliferation, transcription and protein translation. Our results show that polymorphic changes in HPV16 E6 natural variants are sufficient to alter the overall gene expression profile in C33-A cells, explaining in part the observed differences in oncogenic potential of HPV16 variants. - Highlights: • Amino acid changes in HPV16 E6 variants modulate the transciption of specific genes. • This is the first comparison of global gene expression profile of HPV 16 E6 variants. • Each HPV 16 E6 variant appears to have its own molecular signature.

  17. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Gene variants associated with antisocial behaviour: a latent variable approach.

    Science.gov (United States)

    Bentley, Mary Jane; Lin, Haiqun; Fernandez, Thomas V; Lee, Maria; Yrigollen, Carolyn M; Pakstis, Andrew J; Katsovich, Liliya; Olds, David L; Grigorenko, Elena L; Leckman, James F

    2013-10-01

    The aim of this study was to determine if a latent variable approach might be useful in identifying shared variance across genetic risk alleles that is associated with antisocial behaviour at age 15 years. Using a conventional latent variable approach, we derived an antisocial phenotype in 328 adolescents utilizing data from a 15-year follow-up of a randomized trial of a prenatal and infancy nurse-home visitation programme in Elmira, New York. We then investigated, via a novel latent variable approach, 450 informative genetic polymorphisms in 71 genes previously associated with antisocial behaviour, drug use, affiliative behaviours and stress response in 241 consenting individuals for whom DNA was available. Haplotype and Pathway analyses were also performed. Eight single-nucleotide polymorphisms (SNPs) from eight genes contributed to the latent genetic variable that in turn accounted for 16.0% of the variance within the latent antisocial phenotype. The number of risk alleles was linearly related to the latent antisocial variable scores. Haplotypes that included the putative risk alleles for all eight genes were also associated with higher latent antisocial variable scores. In addition, 33 SNPs from 63 of the remaining genes were also significant when added to the final model. Many of these genes interact on a molecular level, forming molecular networks. The results support a role for genes related to dopamine, norepinephrine, serotonin, glutamate, opioid and cholinergic signalling as well as stress response pathways in mediating susceptibility to antisocial behaviour. This preliminary study supports use of relevant behavioural indicators and latent variable approaches to study the potential 'co-action' of gene variants associated with antisocial behaviour. It also underscores the cumulative relevance of common genetic variants for understanding the aetiology of complex behaviour. If replicated in future studies, this approach may allow the identification of a

  19. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  20. Identification of a large intronic transposal insertion in SLC17A5 causing sialic acid storage disease

    NARCIS (Netherlands)

    Tarailo-Graovac, M. (Maja); Drögemöller, B.I. (Britt I.); Wasserman, W.W. (Wyeth W.); C.J. Ross; A.M.W. van den Ouweland (Ans); N. Darin (Niklas); Kollberg, G. (Gittan); Van Karnebeek, C.D.M. (Clara D. M.); Blomqvist, M. (Maria)

    2017-01-01

    textabstractBackground: Sialic acid storage diseases are neurodegenerative disorders characterized by accumulation of sialic acid in the lysosome. These disorders are caused by mutations in SLC17A5, the gene encoding sialin, a sialic acid transporter located in the lysosomal membrane. The most

  1. Comprehensive phenotype/genotype analyses of the norepinephrine transporter gene (SLC6A2 in ADHD: relation to maternal smoking during pregnancy.

    Directory of Open Access Journals (Sweden)

    Geeta A Thakur

    Full Text Available Despite strong pharmacological evidence implicating the norepinephrine transporter in ADHD, genetic studies have yielded largely insignificant results. We tested the association between 30 tag SNPs within the SLC6A2 gene and ADHD, with stratification based on maternal smoking during pregnancy, an environmental factor strongly associated with ADHD.Children (6-12 years old diagnosed with ADHD according to DSM-IV criteria were comprehensively evaluated with regard to several behavioral and cognitive dimensions of ADHD as well as response to a fixed dose of methylphenidate (MPH using a double-blind placebo controlled crossover trial. Family-based association tests (FBAT, including categorical and quantitative trait analyses, were conducted in 377 nuclear families.A highly significant association was observed with rs36021 (and linked SNPs in the group where mothers smoked during pregnancy. Association was noted with categorical DSM-IV ADHD diagnosis (Z=3.74, P=0.0002, behavioral assessments by parents (CBCL, P=0.00008, as well as restless-impulsive subscale scores on Conners'-teachers (P=0.006 and parents (P=0.006. In this subgroup, significant association was also observed with cognitive deficits, more specifically sustained attention, spatial working memory, planning, and response inhibition. The risk allele was associated with significant improvement of behavior as measured by research staff (Z=3.28, P=0.001, parents (Z=2.62, P=0.009, as well as evaluation in the simulated academic environment (Z=3.58, P=0.0003.By using maternal smoking during pregnancy to index a putatively more homogeneous group of ADHD, highly significant associations were observed between tag SNPs within SLC6A2 and ADHD diagnosis, behavioral and cognitive measures relevant to ADHD and response to MPH. This comprehensive phenotype/genotype analysis may help to further understand this complex disorder and improve its treatment. Clinical trial registration information - Clinical

  2. New tools for Mendelian disease gene identification: PhenoDB variant analysis module; and GeneMatcher, a web-based tool for linking investigators with an interest in the same gene.

    Science.gov (United States)

    Sobreira, Nara; Schiettecatte, François; Boehm, Corinne; Valle, David; Hamosh, Ada

    2015-04-01

    Identifying the causative variant from among the thousands identified by whole-exome sequencing or whole-genome sequencing is a formidable challenge. To make this process as efficient and flexible as possible, we have developed a Variant Analysis Module coupled to our previously described Web-based phenotype intake tool, PhenoDB (http://researchphenodb.net and http://phenodb.org). When a small number of candidate-causative variants have been identified in a study of a particular patient or family, a second, more difficult challenge becomes proof of causality for any given variant. One approach to this problem is to find other cases with a similar phenotype and mutations in the same candidate gene. Alternatively, it may be possible to develop biological evidence for causality, an approach that is assisted by making connections to basic scientists studying the gene of interest, often in the setting of a model organism. Both of these strategies benefit from an open access, online site where individual clinicians and investigators could post genes of interest. To this end, we developed GeneMatcher (http://genematcher.org), a freely accessible Website that enables connections between clinicians and researchers across the world who share an interest in the same gene(s). © 2015 WILEY PERIODICALS, INC.

  3. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  4. A Genetic Biomarker of Oxidative Stress, the Paraoxonase-1 Q192R Gene Variant, Associates with Cardiomyopathy in CKD: A Longitudinal Study

    Directory of Open Access Journals (Sweden)

    E. Dounousi

    2016-01-01

    Full Text Available Background. Oxidative stress is a hallmark of CKD and this alteration is strongly implicated in LV hypertrophy and in LV dysfunction. Methods and Patients. We resorted to the strongest genetic biomarker of paraoxonase-1 (PON1 activity, the Q192R variant in the PON1 gene, to unbiasedly assess (Mendelian randomization the cross-sectional and longitudinal association of this gene-variant with LV mass and function in 206 CKD patients with a 3-year follow-up. Results. The R allele of Q192R polymorphism associated with oxidative stress as assessed by plasma 8-isoPGF2α (P=0.03 and was dose-dependently related in a direct fashion to LVMI (QQ: 131.4 ± 42.6 g/m2; RQ: 147.7 ± 51.1 g/m2; RR: 167.3 ± 41.9 g/m2; P=0.001 and in an inverse fashion to systolic function (LV Ejection Fraction (QQ: 79 ± 12%; RQ: 69 ± 9%; RR: 65 ± 10% P=0.002. On longitudinal observation, this gene variant associated with the evolution of the same echocardiographic indicators [LVMI: 13.40 g/m2 per risk allele, P=0.005; LVEF: −2.96% per risk allele, P=0.001]. Multivariate analyses did not modify these associations. Conclusion. In CKD patients, the R allele of the Q192R variant in the PON1 gene is dose-dependently related to the severity of LVH and LV dysfunction and associates with the longitudinal evolution of these cardiac alterations. These results are compatible with the hypothesis that oxidative stress is implicated in cardiomyopathy in CKD patients.

  5. An Integrated Enterprise Accelerator Database for the SLC Control System

    International Nuclear Information System (INIS)

    2002-01-01

    Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations

  6. Comprehensive investigation of cytokine- and immune-related gene variants in HBV-associated hepatocellular carcinoma patients.

    Science.gov (United States)

    Yu, Fengxue; Zhang, Xiaolin; Tian, Suzhai; Geng, Lianxia; Xu, Weili; Ma, Ning; Wang, Mingbang; Jia, Yuan; Liu, Xuechen; Ma, Junji; Quan, Yuan; Zhang, Chaojun; Guo, Lina; An, Wenting; Liu, Dianwu

    2017-12-22

    Host genotype may be closely related to the different outcomes of Hepatitis B virus (HBV) infection. To identify the association of variants and HBV infection, we comprehensively investigated the cytokine- and immune-related gene mutations in patients with HBV associated hepatocellular carcinoma (HBV-HCC). Fifty-three HBV-HCC patients, 53 self-healing cases (SH) with HBV infection history and 53 healthy controls (HCs) were recruited, the whole exon region of 404 genes were sequenced at >900× depth. Comprehensive variants and gene levels were compared between HCC and HC, and HCC and SH. Thirty-nine variants (adjusted P HBV-HCC. Thirty-four variants were from eight human leukocyte antigen (HLA) genes that were previously reported to be associated with HBV-HCC. The novelties of our study are: five variants (rs579876, rs579877, rs368692979, NM_145007:c.*131_*130delTG, NM_139165:exon5:c.623-2->TT) from three genes ( REAT1E , NOD-like receptor (NLR) protein 11 ( NLRP11 ), hydroxy-carboxylic acid receptor 2 ( HCAR2 )) were found strongly associated with HBV-HCC. We found 39 different variants in 11 genes that were significantly related to HBV-HCC. Five of them were new findings. Our data implied that chronic hepatitis B patients who carry these variants are at a high risk of developing HCC. © 2017 The Author(s).

  7. Pooled Resequencing of 122 Ulcerative Colitis Genes in a Large Dutch Cohort Suggests Population-Specific Associations of Rare Variants in MUC2.

    Science.gov (United States)

    Visschedijk, Marijn C; Alberts, Rudi; Mucha, Soren; Deelen, Patrick; de Jong, Dirk J; Pierik, Marieke; Spekhorst, Lieke M; Imhann, Floris; van der Meulen-de Jong, Andrea E; van der Woude, C Janneke; van Bodegraven, Adriaan A; Oldenburg, Bas; Löwenberg, Mark; Dijkstra, Gerard; Ellinghaus, David; Schreiber, Stefan; Wijmenga, Cisca; Rivas, Manuel A; Franke, Andre; van Diemen, Cleo C; Weersma, Rinse K

    2016-01-01

    Genome-wide association studies have revealed several common genetic risk variants for ulcerative colitis (UC). However, little is known about the contribution of rare, large effect genetic variants to UC susceptibility. In this study, we performed a deep targeted re-sequencing of 122 genes in Dutch UC patients in order to investigate the contribution of rare variants to the genetic susceptibility to UC. The selection of genes consists of 111 established human UC susceptibility genes and 11 genes that lead to spontaneous colitis when knocked-out in mice. In addition, we sequenced the promoter regions of 45 genes where known variants exert cis-eQTL-effects. Targeted pooled re-sequencing was performed on DNA of 790 Dutch UC cases. The Genome of the Netherlands project provided sequence data of 500 healthy controls. After quality control and prioritization based on allele frequency and pathogenicity probability, follow-up genotyping of 171 rare variants was performed on 1021 Dutch UC cases and 1166 Dutch controls. Single-variant association and gene-based analyses identified an association of rare variants in the MUC2 gene with UC. The associated variants in the Dutch population could not be replicated in a German replication cohort (1026 UC cases, 3532 controls). In conclusion, this study has identified a putative role for MUC2 on UC susceptibility in the Dutch population and suggests a population-specific contribution of rare variants to UC.

  8. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Genetic variants in hormone-related genes and risk of breast cancer.

    Directory of Open Access Journals (Sweden)

    Tess Clendenen

    Full Text Available Sex hormones play a key role in the development of breast cancer. Certain polymorphic variants (SNPs and repeat polymorphisms in hormone-related genes are associated with sex hormone levels. However, the relationship observed between these genetic variants and breast cancer risk has been inconsistent. We conducted a case-control study nested within two prospective cohorts to assess the relationship between specific genetic variants in hormone-related genes and breast cancer risk. In total, 1164 cases and 2111 individually-matched controls were included in the study. We did not observe an association between potential functional genetic polymorphisms in the estrogen pathway, SHBG rs6259, ESR1 rs2234693, CYP19 rs10046 and rs4775936, and UGT1A1 rs8175347, or the progesterone pathway, PGR rs1042838, with the risk of breast cancer. Our results suggest that these genetic variants do not have a strong effect on breast cancer risk.

  10. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  11. Pathological assessment of mismatch repair gene variants in Lynch syndrome

    DEFF Research Database (Denmark)

    Rasmussen, Lene Juel; Heinen, Christopher D; Royer-Pokora, Brigitte

    2012-01-01

    Lynch syndrome (LS) is caused by germline mutations in DNA mismatch repair (MMR) genes and is the most prevalent hereditary colorectal cancer syndrome. A significant proportion of variants identified in MMR and other common cancer susceptibility genes are missense or noncoding changes whose...

  12. Genetic Diversity within Alphaherpesviruses: Characterization of a Novel Variant of Herpes Simplex Virus 2.

    Science.gov (United States)

    Burrel, Sonia; Désiré, Nathalie; Marlet, Julien; Dacheux, Laurent; Seang, Sophie; Caumes, Eric; Bourhy, Hervé; Agut, Henri; Boutolleau, David

    2015-12-01

    Very low levels of variability have been reported for the herpes simplex virus 2 (HSV-2) genome. We recently described a new genetic variant of HSV-2 (HSV-2v) characterized by a much higher degree of variability for the UL30 gene (DNA polymerase) than observed for the HG52 reference strain. Retrospective screening of 505 clinical isolates of HSV-2 by a specific real-time PCR assay targeting the UL30 gene led to the identification of 13 additional HSV-2v isolates, resulting in an overall prevalence of 2.8%. Phylogenetic analyses on the basis of microsatellite markers and gene sequences showed clear differences between HSV-2v and classical HSV-2. Thirteen of the 14 patients infected with HSV-2v originated from West or Central Africa, and 9 of these patients were coinfected with HIV. These results raise questions about the origin of this new virus. Preliminary results suggest that HSV-2v may have acquired genomic segments from chimpanzee alphaherpesvirus (ChHV) by recombination. This article deals with the highly topical question of the origin of this new HSV-2 variant identified in patients with HIV coinfection originating mostly from West or Central Africa. HSV-2v clearly differed from classical HSV-2 isolates in phylogenetic analyses and may be linked to simian ChHV. This new HSV-2 variant highlights the possible occurrence of recombination between human and simian herpesviruses under natural conditions, potentially presenting greater challenges for the future. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2010-10-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

  14. Report on the SLC control system

    International Nuclear Information System (INIS)

    Phinney, N.

    1985-05-01

    The SLC control system is based on a VAX 11/780 Host computer with approximately 50 microprocessor clusters which provide distributed intelligence and control of all CAMAC interface modules. This paper will present an overview of the system including current status and a description of the software architecture and communication protocols. 8 refs

  15. Spectrum and Frequency of the GJB2 Gene Pathogenic Variants in a Large Cohort of Patients with Hearing Impairment Living in a Subarctic Region of Russia (the Sakha Republic.

    Directory of Open Access Journals (Sweden)

    Nikolay A Barashkov

    Full Text Available Pathogenic variants in the GJB2 gene, encoding connexin 26, are known to be a major cause of hearing impairment (HI. More than 300 allelic variants have been identified in the GJB2 gene. Spectrum and allelic frequencies of the GJB2 gene vary significantly among different ethnic groups worldwide. Until now, the spectrum and frequency of the pathogenic variants in exon 1, exon 2 and the flanking intronic regions of the GJB2 gene have not been described thoroughly in the Sakha Republic (Yakutia, which is located in a subarctic region in Russia. The complete sequencing of the non-coding and coding regions of the GJB2 gene was performed in 393 patients with HI (Yakuts-296, Russians-51, mixed and other ethnicities-46 and in 187 normal hearing individuals of Yakut (n = 107 and Russian (n = 80 populations. In the total sample (n = 580, we revealed 12 allelic variants of the GJB2 gene, 8 of which were recessive pathogenic variants. Ten genotypes with biallelic recessive pathogenic variants in the GJB2 gene (in a homozygous or a compound heterozygous state were found in 192 out of 393 patients (48.85%. We found that the most frequent GJB2 pathogenic variant in the Yakut patients was c.-23+1G>A (51.82% and that the second most frequent was c.109G>A (2.37%, followed by c.35delG (1.64%. Pathogenic variants с.35delG (22.34%, c.-23+1G>A (5.31%, and c.313_326del14 (2.12% were found to be the most frequent among the Russian patients. The carrier frequencies of the c.-23+1G>A and с.109G>A pathogenic variants in the Yakut control group were 10.20% and 2.80%, respectively. The carrier frequencies of с.35delG and c.101T>C were identical (2.5% in the Russian control group. We found that the contribution of the GJB2 gene pathogenic variants in HI in the population of the Sakha Republic (48.85% was the highest among all of the previously studied regions of Asia. We suggest that extensive accumulation of the c.-23+1G>A pathogenic variant in the indigenous Yakut

  16. Spectrum and Frequency of the GJB2 Gene Pathogenic Variants in a Large Cohort of Patients with Hearing Impairment Living in a Subarctic Region of Russia (the Sakha Republic).

    Science.gov (United States)

    Barashkov, Nikolay A; Pshennikova, Vera G; Posukh, Olga L; Teryutin, Fedor M; Solovyev, Aisen V; Klarov, Leonid A; Romanov, Georgii P; Gotovtsev, Nyurgun N; Kozhevnikov, Andrey A; Kirillina, Elena V; Sidorova, Oksana G; Vasilyevа, Lena M; Fedotova, Elvira E; Morozov, Igor V; Bondar, Alexander A; Solovyevа, Natalya A; Kononova, Sardana K; Rafailov, Adyum M; Sazonov, Nikolay N; Alekseev, Anatoliy N; Tomsky, Mikhail I; Dzhemileva, Lilya U; Khusnutdinova, Elza K; Fedorova, Sardana A

    2016-01-01

    Pathogenic variants in the GJB2 gene, encoding connexin 26, are known to be a major cause of hearing impairment (HI). More than 300 allelic variants have been identified in the GJB2 gene. Spectrum and allelic frequencies of the GJB2 gene vary significantly among different ethnic groups worldwide. Until now, the spectrum and frequency of the pathogenic variants in exon 1, exon 2 and the flanking intronic regions of the GJB2 gene have not been described thoroughly in the Sakha Republic (Yakutia), which is located in a subarctic region in Russia. The complete sequencing of the non-coding and coding regions of the GJB2 gene was performed in 393 patients with HI (Yakuts-296, Russians-51, mixed and other ethnicities-46) and in 187 normal hearing individuals of Yakut (n = 107) and Russian (n = 80) populations. In the total sample (n = 580), we revealed 12 allelic variants of the GJB2 gene, 8 of which were recessive pathogenic variants. Ten genotypes with biallelic recessive pathogenic variants in the GJB2 gene (in a homozygous or a compound heterozygous state) were found in 192 out of 393 patients (48.85%). We found that the most frequent GJB2 pathogenic variant in the Yakut patients was c.-23+1G>A (51.82%) and that the second most frequent was c.109G>A (2.37%), followed by c.35delG (1.64%). Pathogenic variants с.35delG (22.34%), c.-23+1G>A (5.31%), and c.313_326del14 (2.12%) were found to be the most frequent among the Russian patients. The carrier frequencies of the c.-23+1G>A and с.109G>A pathogenic variants in the Yakut control group were 10.20% and 2.80%, respectively. The carrier frequencies of с.35delG and c.101T>C were identical (2.5%) in the Russian control group. We found that the contribution of the GJB2 gene pathogenic variants in HI in the population of the Sakha Republic (48.85%) was the highest among all of the previously studied regions of Asia. We suggest that extensive accumulation of the c.-23+1G>A pathogenic variant in the indigenous Yakut

  17. Two siblings with early infantile myoclonic encephalopathy due to mutation in the gene encoding mitochondrial glutamate/H+ symporter SLC25A22.

    Science.gov (United States)

    Cohen, Rony; Basel-Vanagaite, Lina; Goldberg-Stern, Hadassah; Halevy, Ayelet; Shuper, Avinoam; Feingold-Zadok, Michal; Behar, Doron M; Straussberg, Rachel

    2014-11-01

    To characterize a new subset of early myoclonic encephalopathy usually associated with metabolic etiologies with a new genetic entity. We describe two siblings with early myoclonic encephalopathy born to consanguineous parents of Arab Muslim origin from Israel. We used homozygosity mapping and candidate gene sequencing to reveal the genetic basis of the myoclonic syndrome. We found a rare missense mutation in the gene encoding one of the two mitochondrial glutamate/H symporters, SLC25A22. The phenotype of early myoclonic encephalopathy was first linked to the same mutation in 2005 in patients of the same ethnicity as our family. Owing to the devastating nature of this encephalopathy, we focus attention on its clinical history, epileptic semiology, distinct electroencephalography features, and genetic basis. We provide the evidence that an integrated diagnostic strategy combining homozygosity mapping with candidate gene sequencing is efficient in consanguineous families with highly heterogeneous autosomal recessive diseases. Copyright © 2014 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  18. The rs9939609 gene variant in FTO modified the metabolic response of weight loss after a 3-month intervention with a hypocaloric diet.

    Science.gov (United States)

    de Luis, Daniel Antonio; Aller, Rocío; Conde, Rosa; Izaola, Olatz; Gonzalez Sagrado, Manuel; Castrodeza Sanz, Javier

    2013-01-01

    Common polymorphisms in the fat mass and obesity associated gene (FTO) have been linked to obesity in some populations. Nevertheless, the role of FTO variants on body weight response after dietary intervention remains equivocal. We decided to analyze the effects of the rs9939609 FTO gene polymorphism on body weight changes and metabolic parameters after 3 months of a hypocaloric diet. Before and after 3 months on a low-fat hypocaloric diet, a white population of 106 subjects with obesity was analyzed. Of the study subjects, 35 (33%) had the genotype TT and 71 (67%) had the next genotypes; TA (46 study subjects, 43.4%) or AA (25 study subjects, 23.6%). After dietary treatment and in TT group, weight, waist circumference, total cholesterol, LDL-cholesterol, insulin, and homeostasis model assessment decreases were less than subjects carrying the A allele [-3.1 (3.6) vs -2.4 (4.1) kg: P < 0.05], waist circumference [-5.4 (6.4) vs -2.6 (4.8) cm; P < 0.05], total cholesterol [-12.3 (35.3) vs -6.4 (4.7) mg/dL; P < 0.05], LDL-cholesterol [-22.3 (30.5) vs -10.7 (30.5) mg/dL; P < 0.05], insulin [-1.89 (5.5) vs +0.94 (8.2) mUI/L; P < 0.05], and homeostasis model assessment [-0.46 (1.11) vs -0.01 (2.4); P < 0.05]. Our study confirmed a higher weight loss in A carriers of FTO rs9939609 polymorphism than in TT genotype study subjects.

  19. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  20. Association between Age at Diagnosis of Graves' Disease and Variants in Genes Involved in Immune Response

    Science.gov (United States)

    Jurecka-Lubieniecka, Beata; Ploski, Rafal; Kula, Dorota; Krol, Aleksandra; Bednarczuk, Tomasz; Kolosza, Zofia; Tukiendorf, Andrzej; Szpak-Ulczok, Sylwia; Stanjek-Cichoracka, Anita; Polanska, Joanna; Jarzab, Barbara

    2013-01-01

    Background Graves' disease (GD) is a complex disease in which genetic predisposition is modified by environmental factors. The aim of the study was to examine the association between genetic variants in genes encoding proteins involved in immune response and the age at diagnosis of GD. Methods 735 GD patients and 1216 healthy controls from Poland were included into the study. Eight genetic variants in the HLA-DRB1, TNF, CTLA4, CD40, NFKb, PTPN22, IL4 and IL10 genes were genotyped. Patients were stratified by the age at diagnosis of GD and the association with genotype was analysed. Results Polymorphism in the HLA-DRB1, TNF and CTLA4 genes were associated with GD. The carriers of the HLA DRB1*03 allele were more frequent in patients with age at GD diagnosis ≤30 years than in patients with older age at GD diagnosis. Conclusions HLADRB1*03 allele is associated with young age at diagnosis of Graves' disease in polish population. PMID:23544060

  1. Molecular and clinical characteristics of MSH6 variants : An analysis of 25 index carriers of a germline variant

    NARCIS (Netherlands)

    Olderode - Berends, Maria; Wu, Ying; Sijmons, RH; Mensink, RGJ; van der Sluis, T; Hordijk-Hos, JM; de Vries, EGE; Hollema, H; Karrenbeld, Arend; Buys, CHCM; van der Zee, AGJ; Hofstra, RMW; Kleibeuker, JH

    The MSH6 gene is one of the mismatch-repair genes involved in hereditary nonpolyposis colorectal cancer (HNPCC). Three hundred sixteen individuals who were known or suspected to have HNPCC were analyzed for MSH6 germline mutations. For 25 index patients and 8 relatives with MSH6 variants, molecular

  2. Screening of SHOX gene sequence variants in Saudi Arabian children with idiopathic short stature.

    Science.gov (United States)

    Alharthi, Abdulla A; El-Hallous, Ehab I; Talaat, Iman M; Alghamdi, Hamed A; Almalki, Matar I; Gaber, Ahmed

    2017-10-01

    Short stature affects approximately 2%-3% of children, representing one of the most frequent disorders for which clinical attention is sought during childhood. Despite assumed genetic heterogeneity, mutations or deletions in the short stature homeobox-containing gene ( SHOX ) are frequently detected in subjects with short stature. Idiopathic short stature (ISS) refers to patients with short stature for various unknown reasons. The goal of this study was to screen all the exons of SHOX to identify related mutations. We screened all the exons of SHOX for mutations analysis in 105 ISS children patients (57 girls and 48 boys) living in Taif governorate, KSA using a direct DNA sequencing method. Height, arm span, and sitting height were recorded, and subischial leg length was calculated. A total of 30 of 105 ISS patients (28%) contained six polymorphic variants in exons 1, 2, 4, and 6. One mutation was found in the DNA domain binding region of exon 4. Three of these polymorphic variants were novel, while the others were reported previously. There were no significant differences in anthropometric measures in ISS patients with and without identifiable polymorphic variants in SHOX . In Saudi Arabia ISS patients, rather than SHOX , it is possible that new genes are involved in longitudinal growth. Additional molecular analysis is required to diagnose and understand the etiology of this disease.

  3. Common Genetic Variants Found in HLA and KIR Immune Genes in Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Anthony R Torres

    2016-10-01

    Full Text Available The common variant - common disease hypothesis was proposed to explain diseases with strong inheritance. This model suggests that a genetic disease is the result of the combination of several common genetic variants. Common genetic variants are described as a 5% frequency differential between diseased versus matched control populations. This theory was recently supported by an epidemiology paper stating that about 50% of genetic risk for autism resides in common variants. However, rare variants, rather than common variants, have been found in numerous genome wide genetic studies and many have concluded that the common variant—common disease hypothesis is incorrect. One interpretation is that rare variants are major contributors to genetic diseases and autism involves the interaction of many rare variants, especially in the brain. It is obvious there is much yet to be learned about autism genetics.Evidence has been mounting over the years indicating immune involvement in autism, particularly the HLA genes on chromosome 6 and KIR genes on chromosome 19. These two large multigene complexes have important immune functions and have been shown to interact to eliminate unwanted virally infected and malignant cells. HLA proteins have important functions in antigen presentation in adaptive immunity and specific epitopes on HLA class I proteins act as cognate ligands for KIR receptors in innate immunity. Data suggests that HLA alleles and KIR activating genes/haplotypes are common variants in different autism populations. For example, class I allele (HLA-A2 and HLA-G 14bp-indel frequencies are significantly increased by more than 5% over control populations (Table2. The HLA-DR4 Class II and shared epitope frequencies are significantly above the control populations (Table 2. Three activating KIR genes: 3DS1, 2DS1 and 2DS2 have increased frequencies of 15%, 22% and 14% in autism populations, respectively. There is a 6% increase in total activating KIR

  4. Triosephosphate isomerase gene promoter variation: -5G/A and -8G/A polymorphisms in clinical malaria groups in two African populations.

    Science.gov (United States)

    Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula

    2015-06-01

    TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Genetic association analysis of 30 genes related to obesity in a European American population.

    Science.gov (United States)

    Li, P; Tiwari, H K; Lin, W-Y; Allison, D B; Chung, W K; Leibel, R L; Yi, N; Liu, N

    2014-05-01

    Obesity, which is frequently associated with diabetes, hypertension and cardiovascular diseases, is primarily the result of a net excess of caloric intake over energy expenditure. Human obesity is highly heritable, but the specific genes mediating susceptibility in non-syndromic obesity remain unclear. We tested candidate genes in pathways related to food intake and energy expenditure for association with body mass index (BMI). We reanalyzed 355 common genetic variants of 30 candidate genes in seven molecular pathways related to obesity in 1982 unrelated European Americans from the New York Cancer Project. Data were analyzed by using a Bayesian hierarchical generalized linear model. The BMIs were log-transformed and then adjusted for covariates, including age, age(2), gender and diabetes status. The single-nucleotide polymorphisms (SNPs) were modeled as additive effects. With the stipulated adjustments, nine SNPs in eight genes were significantly associated with BMI: ghrelin (GHRL; rs35683), agouti-related peptide (AGRP; rs5030980), carboxypeptidase E (CPE; rs1946816 and rs4481204), glucagon-like peptide-1 receptor (GLP1R; rs2268641), serotonin receptors (HTR2A; rs912127), neuropeptide Y receptor (NPY5R;Y5R1c52), suppressor of cytokine signaling 3 (SOCS3; rs4969170) and signal transducer and activator of transcription 3 (STAT3; rs4796793). We also found a gender-by-SNP interaction (rs1745837 in HTR2A), which indicated that variants in the gene HTR2A had a stronger association with BMI in males. In addition, NPY1R was detected as having a significant gene effect even though none of the SNPs in this gene was significant. Variations in genes AGRP, CPE, GHRL, GLP1R, HTR2A, NPY1R, NPY5R, SOCS3 and STAT3 showed modest associations with BMI in European Americans. The pathways in which these genes participate regulate energy intake, and thus these associations are mechanistically plausible in this context.

  6. The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

    OpenAIRE

    Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

    2014-01-01

    As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

  7. A gene-based analysis of variants in the serum/glucocorticoid regulated kinase (SGK genes with blood pressure responses to sodium intake: the GenSalt Study.

    Directory of Open Access Journals (Sweden)

    Changwei Li

    Full Text Available Serum and glucocorticoid regulated kinase (SGK plays a critical role in the regulation of renal sodium transport. We examined the association between SGK genes and salt sensitivity of blood pressure (BP using single-marker and gene-based association analysis.A 7-day low-sodium (51.3 mmol sodium/day followed by a 7-day high-sodium intervention (307.8 mmol sodium/day was conducted among 1,906 Chinese participants. BP measurements were obtained at baseline and each intervention using a random-zero sphygmomanometer. Additive associations between each SNP and salt-sensitivity phenotypes were assessed using a mixed linear regression model to account for family dependencies. Gene-based analyses were conducted using the truncated p-value method. The Bonferroni-method was used to adjust for multiple testing in all analyses.In single-marker association analyses, SGK1 marker rs2758151 was significantly associated with diastolic BP (DBP response to high-sodium intervention (P = 0.0010. DBP responses (95% confidence interval to high-sodium intervention for genotypes C/C, C/T, and T/T were 2.04 (1.57 to 2.52, 1.79 (1.42 to 2.16, and 0.85 (0.30 to 1.41 mmHg, respectively. Similar trends were observed for SBP and MAP responses although not significant (P = 0.15 and 0.0026, respectively. In addition, gene-based analyses demonstrated significant associations between SGK1 and SBP, DBP and MAP responses to high sodium intervention (P = 0.0002, 0.0076, and 0.00001, respectively. Neither SGK2 nor SGK3 were associated with the salt-sensitivity phenotypes in single-maker or gene-based analyses.The current study identified association of the SGK1 gene and BP salt-sensitivity in the Han Chinese population. Further studies are warranted to identify causal SGK1 gene variants.

  8. Novel factor VIII variants with a modified furin cleavage site improve the efficacy of gene therapy for hemophilia A.

    Science.gov (United States)

    Nguyen, G N; George, L A; Siner, J I; Davidson, R J; Zander, C B; Zheng, X L; Arruda, V R; Camire, R M; Sabatino, D E

    2017-01-01

    Essentials Factor (F) VIII is an inefficiently expressed protein. Furin deletion FVIII variants were purified and characterized using in vitro and in vivo assays. These minimally modified novel FVIII variants have enhanced function. These variants provide a strategy for increasing FVIII expression in hemophilia A gene therapy. Background The major challenge for developing gene-based therapies for hemophilia A is that human factor VIII (hFVIII) has intrinsic properties that result in inefficient biosynthesis. During intracellular processing, hFVIII is predominantly cleaved at a paired basic amino acid cleaving enzyme (PACE) or furin cleavage site to yield a heterodimer that is the major form of secreted protein. Previous studies with B-domain-deleted (BDD) canine FVIII and hFVIII-R1645H, both differing from hFVIII by a single amino acid at this site, suggested that these proteins are secreted mainly in a single polypeptide chain (SC) form and exhibit enhanced function. Objective We hypothesized that deletion(s) of the furin site modulates FVIII biology and may enhance its function. Methods A series of recombinant hFVIII-furin deletion variants were introduced into hFVIII-BDD [Δ1645, 1645-46(Δ2), 1645-47(Δ3), 1645-48(Δ4), or Δ1648] and characterized. Results In vitro, recombinant purified Δ3 and Δ4 were primarily SC and, interestingly, had 2-fold higher procoagulant activity compared with FVIII-BDD. In vivo, the variants also have improved hemostatic function. After adeno-associated viral (AAV) vector delivery, the expression of these variants is 2-4-fold higher than hFVIII-BDD. Protein challenges of each variant in mice tolerant to hFVIII-BDD showed no anti-FVIII immune response. Conclusions These data suggest that the furin deletion hFVIII variants are superior to hFVIII-BDD without increased immunogenicity. In the setting of gene-based therapeutics, these novel variants provide a unique strategy to increase FVIII expression, thus lowering the vector dose, a

  9. A custom correlation coefficient (CCC) approach for fast identification of multi-SNP association patterns in genome-wide SNPs data.

    Science.gov (United States)

    Climer, Sharlee; Yang, Wei; de las Fuentes, Lisa; Dávila-Román, Victor G; Gu, C Charles

    2014-11-01

    Complex diseases are often associated with sets of multiple interacting genetic factors and possibly with unique sets of the genetic factors in different groups of individuals (genetic heterogeneity). We introduce a novel concept of custom correlation coefficient (CCC) between single nucleotide polymorphisms (SNPs) that address genetic heterogeneity by measuring subset correlations autonomously. It is used to develop a 3-step process to identify candidate multi-SNP patterns: (1) pairwise (SNP-SNP) correlations are computed using CCC; (2) clusters of so-correlated SNPs identified; and (3) frequencies of these clusters in disease cases and controls compared to identify disease-associated multi-SNP patterns. This method identified 42 candidate multi-SNP associations with hypertensive heart disease (HHD), among which one cluster of 22 SNPs (six genes) included 13 in SLC8A1 (aka NCX1, an essential component of cardiac excitation-contraction coupling) and another of 32 SNPs had 29 from a different segment of SLC8A1. While allele frequencies show little difference between cases and controls, the cluster of 22 associated alleles were found in 20% of controls but no cases and the other in 3% of controls but 20% of cases. These suggest that both protective and risk effects on HHD could be exerted by combinations of variants in different regions of SLC8A1, modified by variants from other genes. The results demonstrate that this new correlation metric identifies disease-associated multi-SNP patterns overlooked by commonly used correlation measures. Furthermore, computation time using CCC is a small fraction of that required by other methods, thereby enabling the analyses of large GWAS datasets. © 2014 WILEY PERIODICALS, INC.

  10. Isolation of Shiga toxin-producing Escherichia coli harboring variant Shiga toxin genes from seafood

    Directory of Open Access Journals (Sweden)

    Sreepriya Prakasan

    2018-03-01

    Full Text Available Background and Aim: Shiga toxin-producing Escherichia coli (STEC are important pathogens of global significance. STEC are responsible for numerous food-borne outbreaks worldwide and their presence in food is a potential health hazard. The objective of the present study was to determine the incidence of STEC in fresh seafood in Mumbai, India, and to characterize STEC with respect to their virulence determinants. Materials and Methods: A total of 368 E. coli were isolated from 39 fresh seafood samples (18 finfish and 21 shellfish using culture-based methods. The isolates were screened by polymerase chain reaction (PCR for the genes commonly associated with STEC. The variant Shiga toxin genes were confirmed by Southern blotting and hybridization followed by DNA sequencing. Results: One or more Shiga toxins genes were detected in 61 isolates. Of 39 samples analyzed, 10 (25.64% samples harbored STEC. Other virulence genes, namely, eaeA (coding for an intimin and hlyA (hemolysin A were detected in 43 and 15 seafood isolates, respectively. The variant stx1 genes from 6 isolates were sequenced, five of which were found to be stx1d variants, while one sequence varied considerably from known stx1 sequences. Southern hybridization and DNA sequence analysis suggested putative Shiga toxin variant genes (stx2 in at least 3 other isolates. Conclusion: The results of this study showed the occurrence of STEC in seafood harboring one or more Shiga toxin genes. The detection of STEC by PCR may be hampered due to the presence of variant genes such as the stx1d in STEC. This is the first report of stx1d gene in STEC isolated from Indian seafood.

  11. antiSMASH 3.0a comprehensive resource for the genome mining of biosynthetic gene clusters

    DEFF Research Database (Denmark)

    Weber, Tilmann; Blin, Kai; Duddela, Srikanth

    2015-01-01

    Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we...... introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration...... of the recently published ClusterFinder algorithm now allows using this probabilistic algorithm to detect putative gene clusters of unknown types. Also, a new dereplication variant of the ClusterBlast module now identifies similarities of identified clusters to any of 1172 clusters with known end products...

  12. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  13. Impaired 8-Hydroxyguanine Repair Activity of MUTYH Variant p.Arg109Trp Found in a Japanese Patient with Early-Onset Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Kazuya Shinmura

    2014-01-01

    Full Text Available Purpose. The biallelic inactivation of the 8-hydroxyguanine repair gene MUTYH leads to MUTYH-associated polyposis (MAP, which is characterized by colorectal multiple polyps and carcinoma(s. However, only limited information regarding MAP in the Japanese population is presently available. Since early-onset colorectal cancer (CRC is a characteristic of MAP and might be caused by the inactivation of another 8-hydroxyguanine repair gene, OGG1, we investigated whether germline MUTYH and OGG1 mutations are involved in early-onset CRC in Japanese patients. Methods. Thirty-four Japanese patients with early-onset CRC were examined for germline MUTYH and OGG1 mutations using sequencing. Results. Biallelic pathogenic mutations were not found in any of the patients; however, a heterozygous p.Arg19*  MUTYH variant and a heterozygous p.Arg109Trp MUTYH variant were detected in one patient each. The p.Arg19* and p.Arg109Trp corresponded to p.Arg5* and p.Arg81Trp, respectively, in the type 2 nuclear-form protein. The defective DNA repair activity of p.Arg5* is apparent, while that of p.Arg81Trp has been demonstrated using DNA cleavage and supF forward mutation assays. Conclusion. These results suggest that biallelic MUTYH or OGG1 pathogenic mutations are rare in Japanese patients with early-onset CRC; however, the p.Arg19* and p.Arg109Trp MUTYH variants are associated with functional impairments.

  14. [Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

    Science.gov (United States)

    Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

    2012-03-01

    The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  15. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  16. Genes y variantes polimórficas asociadas a la enfermedad cardiovascular

    Directory of Open Access Journals (Sweden)

    Eliana C. Portilla

    2014-09-01

    Full Text Available La aterosclerosis se considera como la principal causante de enfermedades cardiovasculares. Es una enfermedad multifactorial, caracterizada por procesos inflamatorios y la internalización continua de moléculas lipídicas al interior del vaso. Los estudios de genes candidato han proporcionado conocimiento acerca de la fisiopatología de esta enfermedad y han permitido la postulación de algunos polimorfismos como responsables de la susceptibilidad genética en diversas poblaciones. En particular, estos polimorfismos que modulan ciertas vías moleculares tales como el estrés oxidativo, el metabolismo lipídico y la trombogénesis se asocian con el desarrollo de las enfermedades cardiovasculares. Se han conducido varios estudios para identificar nuevas variantes asociadas con la enfermedad que han permitido el descubrimiento de nuevas vías de la enfermedad. Aunque el hallazgo de nuevos genes asociados a la enfermedad cardiovascular a través de enfoques como el escaneo global del genoma ha contribuido al entendimiento del desarrollo de esta condición, el conocimiento aún es limitado y poco concluyente. El objetivo de esta revisión es identificar los genes y las variantes polimórficas asociadas a la enfermedad cardiovascular, de acuerdo con los diferentes enfoques de análisis de asociación genética.

  17. Association between genetic variants of the clock gene and obesity and sleep duration.

    Science.gov (United States)

    Valladares, Macarena; Obregón, Ana María; Chaput, Jean-Philippe

    2015-12-01

    Obesity is a multifactorial disease caused by the interaction of genetic and environmental factors related to lifestyle aspects. It has been shown that reduced sleep is associated with increased body mass index (BMI). Circadian Locomotor Output Cycles Kaput (CLOCK) gene variants have also been associated with obesity. The objective of this mini-review was to discuss the available literature related to CLOCK gene variants associated with adiposity and sleep duration in humans. In total, 16 articles complied with the terms of the search that reported CLOCK variants associated with sleep duration, energy intake, and BMI. Overall, six CLOCK single nucleotide polymorphisms (SNPs) have been associated with sleep duration, and three variants have been associated with energy intake variables. Overall, the most studied area has been the association of CLOCK gene with obesity; close to eight common variants have been associated with obesity. The most studied CLOCK SNP in different populations is rs1801260, and most of these populations correspond to European populations. Collectively, identifying at risk CLOCK genotypes is a new area of research that may help identify individuals who are more susceptible to overeating and gaining weight when exposed to short sleep durations.

  18. Rare coding variants associated with blood pressure variation in 15 914 individuals of African ancestry.

    Science.gov (United States)

    Nandakumar, Priyanka; Lee, Dongwon; Richard, Melissa A; Tekola-Ayele, Fasil; Tayo, Bamidele O; Ware, Erin; Sung, Yun J; Salako, Babatunde; Ogunniyi, Adesola; Gu, C Charles; Grove, Megan L; Fornage, Myriam; Kardia, Sharon; Rotimi, Charles; Cooper, Richard S; Morrison, Alanna C; Ehret, Georg; Chakravarti, Aravinda

    2017-07-01

    Hypertension is a major risk factor for all cardiovascular diseases, especially among African Americans. This study focuses on identifying specific blood pressure (BP) genes using 15 914 individuals of African ancestry from eight cohorts (Africa America Diabetes Mellitus, Atherosclerosis Risk in Communities Study, Coronary Artery Risk Development in young Adults, Genetics Network, Genetic Epidemiology Network of Arteriopathy, Howard University Family Study, Hypertension Genetic Epidemiology Network, and Loyola University Chicago Cohort) to further genetic findings in this population which has generally been underrepresented in BP studies. We genotyped and performed various single variant and gene-based exome-wide analyses on 15 914 individuals on the Illumina HumanExome Beadchip v1.0 or v1.1 to test association with SBP and DBP long-term average residuals that were adjusted for age, age-squared, sex, and BMI. We identified rare variants affecting SBP and DBP in 10 genes: AFF1, GAPDHS, SLC28A3, COL6A1, CRYBA2, KRBA1, SEL1L3, YOD1, CCDC13, and QSOX1. Prior experimental evidence for six of these 10 candidate genes supports their involvement in cardiovascular mechanisms, corroborating their potential roles in BP regulation. Although our results require replication or validation due to their low numbers of carriers, and an ethnicity-specific genotyping array may be more informative, this study, which has identified several candidate genes in this population most susceptible to hypertension, presents one of the largest African-ancestry BP studies to date and the largest including analysis of rare variants.

  19. Illustrating, Quantifying, and Correcting for Bias in Post-hoc Analysis of Gene-Based Rare Variant Tests of Association

    Directory of Open Access Journals (Sweden)

    Kelsey E. Grinde

    2017-09-01

    Full Text Available To date, gene-based rare variant testing approaches have focused on aggregating information across sets of variants to maximize statistical power in identifying genes showing significant association with diseases. Beyond identifying genes that are associated with diseases, the identification of causal variant(s in those genes and estimation of their effect is crucial for planning replication studies and characterizing the genetic architecture of the locus. However, we illustrate that straightforward single-marker association statistics can suffer from substantial bias introduced by conditioning on gene-based test significance, due to the phenomenon often referred to as “winner's curse.” We illustrate the ramifications of this bias on variant effect size estimation and variant prioritization/ranking approaches, outline parameters of genetic architecture that affect this bias, and propose a bootstrap resampling method to correct for this bias. We find that our correction method significantly reduces the bias due to winner's curse (average two-fold decrease in bias, p < 2.2 × 10−6 and, consequently, substantially improves mean squared error and variant prioritization/ranking. The method is particularly helpful in adjustment for winner's curse effects when the initial gene-based test has low power and for relatively more common, non-causal variants. Adjustment for winner's curse is recommended for all post-hoc estimation and ranking of variants after a gene-based test. Further work is necessary to continue seeking ways to reduce bias and improve inference in post-hoc analysis of gene-based tests under a wide variety of genetic architectures.

  20. High Prevalence of Diabetes-Predisposing Variants in MODY Genes Among Danish Women With Gestational Diabetes Mellitus

    DEFF Research Database (Denmark)

    Gjesing, Anette Marianne Prior; Rui, Gao; Lauenborg, Jeannet

    2017-01-01

    Context: Gestational diabetes mellitus (GDM), defined as any degree of glucose intolerance with first recognition during pregnancy, is a heterogeneous form of diabetes characterized by various degrees ofβ-cell dysfunction. Objectives: We aimed to estimate the prevalence of possibly pathogenic...... variants in the maturity-onset diabetes of the young genesGCK,HNF1A,HNF4A,HNF1B, andINSamong women with GDM. Furthermore, we examined the glucose tolerance status in variant carriers vs noncarriers at follow-up. Design Setting and Patients: We sequenced the coding regions and intron/exon boundaries of.......9% (95% confidence interval: 3.5% to 8.4%). At follow-up, 15 out of 135 women with diabetes (11%) were carriers of variants inGCK,HNF1A,HNF4A,HNF1B, orINS. Conclusions: Almost 6% of Danish women with diet-treated GDM have possibly pathogenic variants inGCK,HNF1A,HNF4A,HNF1B, orINS. These women...

  1. An update on the genetic architecture of hyperuricemia and gout.

    Science.gov (United States)

    Merriman, Tony R

    2015-04-10

    Genome-wide association studies that scan the genome for common genetic variants associated with phenotype have greatly advanced medical knowledge. Hyperuricemia is no exception, with 28 loci identified. However, genetic control of pathways determining gout in the presence of hyperuricemia is still poorly understood. Two important pathways determining hyperuricemia have been confirmed (renal and gut excretion of uric acid with glycolysis now firmly implicated). Major urate loci are SLC2A9 and ABCG2. Recent studies show that SLC2A9 is involved in renal and gut excretion of uric acid and is implicated in antioxidant defense. Although etiological variants at SLC2A9 are yet to be identified, it is clear that considerable genetic complexity exists at the SLC2A9 locus, with multiple statistically independent genetic variants and local epistatic interactions. The positions of implicated genetic variants within or near chromatin regions involved in transcriptional control suggest that this mechanism (rather than structural changes in SLC2A9) is important in regulating the activity of SLC2A9. ABCG2 is involved primarily in extra-renal uric acid under-excretion with the etiological variant influencing expression. At the other 26 loci, probable causal genes can be identified at three (PDZK1, SLC22A11, and INHBB) with strong candidates at a further 10 loci. Confirmation of the causal gene will require a combination of re-sequencing, trans-ancestral mapping, and correlation of genetic association data with expression data. As expected, the urate loci associate with gout, although inconsistent effect sizes for gout require investigation. Finally, there has been no genome-wide association study using clinically ascertained cases to investigate the causes of gout in the presence of hyperuricemia. In such a study, use of asymptomatic hyperurcemic controls would be expected to increase the ability to detect genetic associations with gout.

  2. Increased burden of deleterious variants in essential genes in autism spectrum disorder.

    Science.gov (United States)

    Ji, Xiao; Kember, Rachel L; Brown, Christopher D; Bućan, Maja

    2016-12-27

    Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication, and repetitive behavior. It is estimated that hundreds of genes contribute to ASD. We asked if genes with a strong effect on survival and fitness contribute to ASD risk. Human orthologs of genes with an essential role in pre- and postnatal development in the mouse [essential genes (EGs)] are enriched for disease genes and under strong purifying selection relative to human orthologs of mouse genes with a known nonlethal phenotype [nonessential genes (NEGs)]. This intolerance to deleterious mutations, commonly observed haploinsufficiency, and the importance of EGs in development suggest a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. With a comprehensive catalog of 3,915 mammalian EGs, we provide compelling evidence for a stronger contribution of EGs to ASD risk compared with NEGs. By examining the exonic de novo and inherited variants from 1,781 ASD quartet families, we show a significantly higher burden of damaging mutations in EGs in ASD probands compared with their non-ASD siblings. The analysis of EGs in the developing brain identified clusters of coexpressed EGs implicated in ASD. Finally, we suggest a high-priority list of 29 EGs with potential ASD risk as targets for future functional and behavioral studies. Overall, we show that large-scale studies of gene function in model organisms provide a powerful approach for prioritization of genes and pathogenic variants identified by sequencing studies of human disease.

  3. Sexually dimorphic effects of oxytocin receptor gene (OXTR variants on Harm Avoidance

    Directory of Open Access Journals (Sweden)

    Stankova Trayana

    2012-07-01

    Full Text Available Abstract Background Recent research has suggested that oxytocin receptor gene (OXTR variants may account for individual differences in social behavior, the effects of stress and parenting styles. Little is known, however, on a putative role of the gene in heritable temperamental traits. Methods We addressed effects of two common OXTR variants, rs237900 and rs237902, on personality dimensions in 99 healthy subjects using the Temperament and Character Inventory. Results When sex was controlled for and an OXTR genotype*sex interaction term was included in the regression model, 11% of the variance in Harm Avoidance could be explained (uncorrected p ≤ 0.01. Female carriers of the minor alleles scored highest, and a novel A217T mutation emerged in the most harm avoidant male participant. Conclusions Findings lend support to a modulatory effect of common OXTR variants on Harm Avoidance in healthy caucasian women and invite resequencing of the gene in anxiety phenotypes to identify more explanatory functional variation.

  4. Excessive burden of lysosomal storage disorder gene variants in Parkinson's disease

    NARCIS (Netherlands)

    Robak, L.A.; Jansen, I.E.; Rooij, J van; Uitterlinden, A.G.; Kraaij, R.; Jankovic, J.; Heutink, P.; Shulman, J.M.; Bloem, B.; Post, B.; Scheffer, H.; Warrenburg, B.P.C. van de; et al.,

    2017-01-01

    Mutations in the glucocerebrosidase gene (GBA), which cause Gaucher disease, are also potent risk factors for Parkinson's disease. We examined whether a genetic burden of variants in other lysosomal storage disorder genes is more broadly associated with Parkinson's disease susceptibility. The

  5. Two novel rare variants of APOA5 gene found in subjects with severe hypertriglyceridemia.

    Science.gov (United States)

    Pisciotta, Livia; Fresa, Raffaele; Bellocchio, Antonella; Guido, Virgilia; Priore Oliva, Claudio; Calandra, Sebastiano; Bertolini, Stefano

    2011-11-20

    Common variants of APOA5 gene affect plasma triglyceride (TG) in the population and a number of rare variants APOA5 have been reported in individuals with hypertriglyceridemia (HTG). APOA5 was analysed in 98 HTG individuals (plasma TG >9 mmol/L) in whom no mutations in LPL and APOC2 had been found. Two patients were found to be heterozygous for two novel APOA5 variants. The first variant (p.L253P) was identified in an obese male who consumed a diet rich in fat and simple sugars. He was also a carrier in trans of the common TG-raising p.S19W SNP (5*3 haplotype). The second variant (c.295-297 del GAG, p.E99 del) was found in a lean male with no life style or metabolic factors known to affect plasma TG. He was a carrier in trans of the TG-raising 5*2 haplotype and was homozygous for the rare c.1337T allele of a SNP of GCKR gene. No mutations in other genes affecting plasma TG (LMF1 and GPIHBP1) were found in these patients. These APOA5 variants, resulted to be deleterious in silico, were not found in 350 control subjects. These novel APOA5 variants predispose to HTG in combination with other genetic or nutritional factors. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  7. Characterizing and evaluating the expression of the type IIb sodium-dependent phosphate cotransporter (slc34a2) gene and its potential influence on phosphorus utilization efficiency in yellow catfish (Pelteobagrus fulvidraco).

    Science.gov (United States)

    Chen, Pei; Tang, Qin; Wang, Chunfang

    2016-02-01

    A sodium-dependent phosphate cotransporter gene, NaPi-IIb (slc34a2), was isolated from yellow catfish (Pelteobagrus fulvidraco) intestine through homology cloning and the rapid amplification of cDNA ends. The full-length cDNA of slc34a2 consisted of 2326 bp with an open reading frame encoding 621 amino acids, a 160-bp 5' untranslated region, and a 300-bp 3' untranslated region. The deduced amino acid sequence showed 79.0 and 70.9% sequence identity to Astyanax mexicanus and Pundamilia nyererei, respectively. The membrane-spanning domains based on the hydrophilic and hydrophobic properties of the deduced amino acids were predicted, and results showed that the putative protein had eight transmembrane domains, with the intracellular NH2 and COOH termini. Two functional regions including first intracellular loop and third extracellular loop as well as the six N-glycosylation sites in second extracellular loop were found. The slc34a2 mRNA in the tested tissues was examined through semiquantitative reverse transcription polymerase chain reaction and quantitative real-time PCR, with the highest level found in the anterior intestine, followed by the posterior and middle intestines. The slc34a2 mRNA expression in the whole intestine under different dietary phosphorus (P) treatments was detected using qPCR. The results showed that the slc34a2 expression levels in the low-P groups (0.33 and 0.56%) were significantly higher (p < 0.05) than levels in the sufficient-P (0.81%) and high-P (1.15, 1.31, and 1.57%) groups. High expression of slc34a2 mRNA in low-P groups stimulated P utilization efficiency, indicating the close relationship between genotype and phenotype in yellow catfish. In contrast with conventional strategies (formula and feeding strategies), this study provided another possible approach by using molecular techniques to increase the P utilization in yellow catfish.

  8. The expanding spectrum of COL2A1 gene variants IN 136 patients with a skeletal dysplasia phenotype.

    Science.gov (United States)

    Barat-Houari, Mouna; Dumont, Bruno; Fabre, Aurélie; Them, Frédéric Tm; Alembik, Yves; Alessandri, Jean-Luc; Amiel, Jeanne; Audebert, Séverine; Baumann-Morel, Clarisse; Blanchet, Patricia; Bieth, Eric; Brechard, Marie; Busa, Tiffany; Calvas, Patrick; Capri, Yline; Cartault, François; Chassaing, Nicolas; Ciorca, Vidrica; Coubes, Christine; David, Albert; Delezoide, Anne-Lise; Dupin-Deguine, Delphine; El Chehadeh, Salima; Faivre, Laurence; Giuliano, Fabienne; Goldenberg, Alice; Isidor, Bertrand; Jacquemont, Marie-Line; Julia, Sophie; Kaplan, Josseline; Lacombe, Didier; Lebrun, Marine; Marlin, Sandrine; Martin-Coignard, Dominique; Martinovic, Jelena; Masurel, Alice; Melki, Judith; Mozelle-Nivoix, Monique; Nguyen, Karine; Odent, Sylvie; Philip, Nicole; Pinson, Lucile; Plessis, Ghislaine; Quélin, Chloé; Shaeffer, Elise; Sigaudy, Sabine; Thauvin, Christel; Till, Marianne; Touraine, Renaud; Vigneron, Jacqueline; Baujat, Geneviève; Cormier-Daire, Valérie; Le Merrer, Martine; Geneviève, David; Touitou, Isabelle

    2016-07-01

    Heterozygous COL2A1 variants cause a wide spectrum of skeletal dysplasia termed type II collagenopathies. We assessed the impact of this gene in our French series. A decision tree was applied to select 136 probands (71 Stickler cases, 21 Spondyloepiphyseal dysplasia congenita cases, 11 Kniest dysplasia cases, and 34 other dysplasia cases) before molecular diagnosis by Sanger sequencing. We identified 66 different variants among the 71 positive patients. Among those patients, 18 belonged to multiplex families and 53 were sporadic. Most variants (38/44, 86%) were located in the triple helical domain of the collagen chain and glycine substitutions were mainly observed in severe phenotypes, whereas arginine to cysteine changes were more often encountered in moderate phenotypes. This series of skeletal dysplasia is one of the largest reported so far, adding 44 novel variants (15%) to published data. We have confirmed that about half of our Stickler patients (46%) carried a COL2A1 variant, and that the molecular spectrum was different across the phenotypes. To further address the question of genotype-phenotype correlation, we plan to screen our patients for other candidate genes using a targeted next-generation sequencing approach.

  9. Gene-wise association of variants in four lysosomal storage disorder genes in neuropathologically confirmed Lewy body disease.

    Directory of Open Access Journals (Sweden)

    Lorraine N Clark

    Full Text Available Variants in GBA are associated with Lewy Body (LB pathology. We investigated whether variants in other lysosomal storage disorder (LSD genes also contribute to disease pathogenesis.We performed a genetic analysis of four LSD genes including GBA, HEXA, SMPD1, and MCOLN1 in 231 brain autopsies. Brain autopsies included neuropathologically defined LBD without Alzheimer Disease (AD changes (n = 59, AD without significant LB pathology (n = 71, Alzheimer disease and lewy body variant (ADLBV (n = 68, and control brains without LB or AD neuropathology (n = 33. Sequencing of HEXA, SMPD1, MCOLN1 and GBA followed by 'gene wise' genetic association analysis was performed. To determine the functional effect, a biochemical analysis of GBA in a subset of brains was also performed. GCase activity was measured in a subset of brain samples (n = 64 that included LBD brains, with or without GBA mutations, and control brains. A lipidomic analysis was also performed in brain autopsies (n = 67 which included LBD (n = 34, ADLBV (n = 3, AD (n = 4, PD (n = 9 and control brains (n = 17, comparing GBA mutation carriers to non-carriers.In a 'gene-wise' analysis, variants in GBA, SMPD1 and MCOLN1 were significantly associated with LB pathology (p range: 0.03-4.14 x10(-5. Overall, the mean levels of GCase activity were significantly lower in GBA mutation carriers compared to non-carriers (p<0.001. A significant increase and accumulation of several species for the lipid classes, ceramides and sphingolipids, was observed in LBD brains carrying GBA mutations compared to controls (p range: p<0.05-p<0.01.Our study indicates that variants in GBA, SMPD1 and MCOLN1 are associated with LB pathology. Biochemical data comparing GBA mutation carrier to non-carriers support these findings, which have important implications for biomarker development and therapeutic strategies.

  10. Substrate specificity of the electrogenic sodium/bicarbonate cotransporter NBCe1-A (SLC4A4, variant A) from humans and rabbits.

    Science.gov (United States)

    Lee, Seong-Ki; Boron, Walter F; Parker, Mark D

    2013-04-01

    In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.

  11. Mask locations in the SLC final focus region

    International Nuclear Information System (INIS)

    Cence, R.J.

    1983-01-01

    The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point

  12. Gene-wise association of variants in four lysosomal storage disorder genes in neuropathologically confirmed Lewy body disease.

    Science.gov (United States)

    Clark, Lorraine N; Chan, Robin; Cheng, Rong; Liu, Xinmin; Park, Naeun; Parmalee, Nancy; Kisselev, Sergey; Cortes, Etty; Torres, Paola A; Pastores, Gregory M; Vonsattel, Jean P; Alcalay, Roy; Marder, Karen; Honig, Lawrence L; Fahn, Stanley; Mayeux, Richard; Shelanski, Michael; Di Paolo, Gilbert; Lee, Joseph H

    2015-01-01

    Variants in GBA are associated with Lewy Body (LB) pathology. We investigated whether variants in other lysosomal storage disorder (LSD) genes also contribute to disease pathogenesis. We performed a genetic analysis of four LSD genes including GBA, HEXA, SMPD1, and MCOLN1 in 231 brain autopsies. Brain autopsies included neuropathologically defined LBD without Alzheimer Disease (AD) changes (n = 59), AD without significant LB pathology (n = 71), Alzheimer disease and lewy body variant (ADLBV) (n = 68), and control brains without LB or AD neuropathology (n = 33). Sequencing of HEXA, SMPD1, MCOLN1 and GBA followed by 'gene wise' genetic association analysis was performed. To determine the functional effect, a biochemical analysis of GBA in a subset of brains was also performed. GCase activity was measured in a subset of brain samples (n = 64) that included LBD brains, with or without GBA mutations, and control brains. A lipidomic analysis was also performed in brain autopsies (n = 67) which included LBD (n = 34), ADLBV (n = 3), AD (n = 4), PD (n = 9) and control brains (n = 17), comparing GBA mutation carriers to non-carriers. In a 'gene-wise' analysis, variants in GBA, SMPD1 and MCOLN1 were significantly associated with LB pathology (p range: 0.03-4.14 x10(-5)). Overall, the mean levels of GCase activity were significantly lower in GBA mutation carriers compared to non-carriers (plipid classes, ceramides and sphingolipids, was observed in LBD brains carrying GBA mutations compared to controls (p range: p<0.05-p<0.01). Our study indicates that variants in GBA, SMPD1 and MCOLN1 are associated with LB pathology. Biochemical data comparing GBA mutation carrier to non-carriers support these findings, which have important implications for biomarker development and therapeutic strategies.

  13. SLC beam line error analysis using a model-based expert system

    International Nuclear Information System (INIS)

    Lee, M.; Kleban, S.

    1988-02-01

    Commissioning particle beam line is usually a very time-consuming and labor-intensive task for accelerator physicists. To aid in commissioning, we developed a model-based expert system that identifies error-free regions, as well as localizing beam line errors. This paper will give examples of the use of our system for the SLC commissioning. 8 refs., 5 figs

  14. Genetic frequencies related to severe or profound sensorineural hearing loss in Inner Mongolia Autonomous Region

    Directory of Open Access Journals (Sweden)

    Yongzhi Liu

    Full Text Available Abstract The aim was to study the frequencies of common deafness-related mutations and their contribution to hearing loss in different regions of Inner Mongolia. A total of 738 deaf children were recruited from five different ethnic groups of Inner Mongolia, including Han Chinese (n=486, Mongolian (n=216, Manchurian (n=24, Hui (n=6 and Daur (n=6. Nine common mutations in four genes (GJB2, SLC26A4, GJB3 and mitochondrial MT-RNR1 gene were detected by allele-specific PCR and universal array. At least one mutated allele was detected in 282 patients. Pathogenic mutations were detected in 168 patients: 114 were homozygotes and 54 were compound heterozygotes. The 114 patients were carriers of only one mutated allele. The frequency of GJB2 variants in Han Chinese (21.0% was higher than that in Mongolians (16.7%, but not significantly different. On the other hand, the frequency of SLC26A4 variants in Han Chinese (14.8% was lower than that in Mongolians (19.4%, but also not significantly different. The frequency of patients with pathogenic mutations was different in Ulanqab (21.4%, Xilingol (40.0%, Chifeng (40.0%, Hulunbeier (30.0%, Hohhot (26.3%, and in Baotou (0%. In conclusion, the frequency of mutated alleles in deafness-related genes did not differ between Han Chinese and Mongolians. However, differences in the distribution of common deafness-related mutations were found among the investigated areas of Inner Mongolia.

  15. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  16. Illustrating, Quantifying, and Correcting for Bias in Post-hoc Analysis of Gene-Based Rare Variant Tests of Association

    Science.gov (United States)

    Grinde, Kelsey E.; Arbet, Jaron; Green, Alden; O'Connell, Michael; Valcarcel, Alessandra; Westra, Jason; Tintle, Nathan

    2017-01-01

    To date, gene-based rare variant testing approaches have focused on aggregating information across sets of variants to maximize statistical power in identifying genes showing significant association with diseases. Beyond identifying genes that are associated with diseases, the identification of causal variant(s) in those genes and estimation of their effect is crucial for planning replication studies and characterizing the genetic architecture of the locus. However, we illustrate that straightforward single-marker association statistics can suffer from substantial bias introduced by conditioning on gene-based test significance, due to the phenomenon often referred to as “winner's curse.” We illustrate the ramifications of this bias on variant effect size estimation and variant prioritization/ranking approaches, outline parameters of genetic architecture that affect this bias, and propose a bootstrap resampling method to correct for this bias. We find that our correction method significantly reduces the bias due to winner's curse (average two-fold decrease in bias, p bias and improve inference in post-hoc analysis of gene-based tests under a wide variety of genetic architectures. PMID:28959274

  17. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  18. Peeling skin syndrome associated with novel variant in FLG2 gene.

    Science.gov (United States)

    Alfares, Ahmed; Al-Khenaizan, Sultan; Al Mutairi, Fuad

    2017-12-01

    Peeling skin syndrome is a rare genodermatosis characterized by variably pruritic superficial generalized peeling of the skin with several genes involved until now little is known about the association between FLG2 and peeling skin syndrome. We describe multiple family members from a consanguineous Saudi family with peeling skin syndrome. Next Generation Sequencing identifies a cosegregating novel variant in FLG2 c.632C>G (p.Ser211*) as a likely etiology in this family. Here, we reported on the clinical manifestation of homozygous loss of function variant in FLG2 as a disease-causing gene for peeling skin syndrome and expand the dermatology findings. © 2017 Wiley Periodicals, Inc.

  19. Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Daniela Paccagnini

    2009-09-01

    Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

  20. Study on the IFNL4 gene ss469415590 variant in Ukrainian population

    Directory of Open Access Journals (Sweden)

    Kucherenko A. M.

    2014-09-01

    Full Text Available Aim. To determine genotype and allele disribution for the IFNL4 gene ss469415590 and examine it for linkage with the IL28B gene rs12979860 in Ukrainian population. Methods. The studied group consisted of 100 unrelated donors of Eastern European origin representing the population of Ukraine. Genotyping for the IFNL4 gene ss469415590 was performed using the amplification-refractory mutation system PCR. Genotyping for the IL28B gene rs12979860 was performed by the PCR-based restriction fragment length polymorphism assay. Results. Genotype frequencies for both studied variants showed no significant deviation from those expected according to Hardy-Weinberg equilibrium. Allelic distribution for ss469415590 was: TT – 0.665, G – 0.335. Allelic frequencies of rs12979860 were: C – 0.655, T – 0.345. The results of likelihood ratio test indicated a linkage disequilibrium between the studied variants (p > 0.0001, the major alleles ss469415590 TT and rs12979860 C were in phase. The genetic structure of Ukrainian population in terms of two studied polymorphic variants is similar to the European population presented in the «1000 genomes» project. Conclusions. Considering a tight linkage revealed in Ukrainian population between the ss469415590 variant and rs12979860, a crucial genetic marker of chronic hepatitis C treatment efficiency, this polymorphism might be a promising target for further investigation as a pharmacogenetic marker.

  1. [Comparison of protective properties of the smallpox DNA-vaccine based on the variola virus A30L gene and its variant with modified codon usage].

    Science.gov (United States)

    Maksiutov, R A; Shchelkunov, S N

    2011-01-01

    Efficacy of candidate DNA-vaccines based on the variola virus natural gene A30L and artificial gene A30Lopt with modified codon usage, optimized for expression in mammalian cells, was tested. The groups of mice were intracutaneously immunized three times with three-week intervals with candidate DNA-vaccines: pcDNA_A30L or pcDNA_A30Lopt, and in three weeks after the last immunization all mice in the groups were intraperitoneally infected by the ectromelia virus K1 strain in 10 LD50 dose for the estimation of protection. It was shown that the DNA-vaccines based on natural gene A30L and codon-optimized gene A30Lopt elicited virus, thereby neutralizing the antibody response and protected mice from lethal intraperitoneal challenge with the ectromelia virus with lack of statistically significant difference.

  2. Comprehensive Pathway-Based Association Study of DNA Repair Gene Variants and the Risk of Nasopharyngeal Carcinoma

    Science.gov (United States)

    Qin, Hai-De; Shugart, Yin Yao; Bei, Jin-Xin; Pan, Qing-Hua; Chen, Lina; Feng, Qi-Sheng; Chen, Li-Zhen; Huang, Wei; Liu, Jian Jun; Jorgensen, Timothy J.; Zeng, Yi-Xin; Jia, Wei-Hua

    2011-01-01

    DNA repair plays a central role in protecting against environmental carcinogenesis, and genetic variants of DNA repair genes have been reported to be associated with several human malignancies. To assess whether DNA gene variants were associated with nasopharyngeal carcinoma (NPC) risk, a candidate gene association study was conducted among the Cantonese population within the Guangdong Province, China --the ethnic group with the highest risk for NPC. A two-stage study design was utilized. In the discovery stage, 676 tagging SNPs covering 88 DNA repair genes were genotyped in a matched case-control study (cases/controls = 755/755). Eleven SNPs with Ptrend Cantonese population (cases/controls = 1,568/1,297). Two of the SNPs (rs927220 and rs11158728) – both in RAD51L1 – remained strongly associated with NPC. The SNP rs927220 had a significant Pcombined of 5.55 × 10−5, with OR = 1.20 (95%CI = 1.10 to 1.30), Bonferroni corrected P = 0.0381. The other SNP (rs11158728), which is in strong LD with rs927220 (r2 = 0.7), had a significant Pcombined of 2.0 × 10−4, Bonferroni corrected P = 0.1372. Gene-environment interaction analysis suggested that the exposures of salted-fish consumption and cigarette smoking had potential interactions with DNA repair gene variations, but need to be further investigated. Our findings support the notion that DNA repair genes, in particular RAD51L1, play a role in NPC etiology and development. PMID:21368091

  3. Limitations of interaction-point spot-size tuning at the SLC

    International Nuclear Information System (INIS)

    Emma, P.; Hendrickson, L.J.; Zimmermann, F.; Raimondi, P.

    1997-05-01

    At the Stanford Linear Collider (SLC), the interaction-point spot size is minimized by repeatedly correcting, for both beams, various low-order optical aberrations, such as dispersion, waist position or coupling. These corrections are performed about every 8 hours, by minimizing the IP spot size while exciting different orthogonal combinations of final-focus magnets. The spot size itself is determined by measuring the beam deflection angle as a function of the beam-beam separation. Additional information is derived from the energy loss due to beamstrahlung and from luminosity-related signals. In the 1996 SLC run, the typical corrections were so large as to imply a 20-40% average luminosity loss due to residual uncompensated or fluctuating tunable aberrations. In this paper, the authors explore the origin of these large tuning corrections and study possible mitigations for the next SLC run

  4. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  5. A common SLC26A4-linked haplotype underlying non-syndromic hearing loss with enlargement of the vestibular aqueduct

    DEFF Research Database (Denmark)

    Chattaraj, Parna; Munjal, Tina; Honda, Keiji

    2017-01-01

    BACKGROUND: Enlargement of the vestibular aqueduct (EVA) is the most common radiological abnormality in children with sensorineural hearing loss. Mutations in coding regions and splice sites of the SLC26A4 gene are often detected in Caucasians with EVA. Approximately one-fourth of patients with E...

  6. Identification of a novel vga(E) gene variant that confers resistance to pleuromutilins, lincosamides and streptogramin A antibiotics in staphylococci of porcine origin.

    Science.gov (United States)

    Li, Jun; Li, Beibei; Wendlandt, Sarah; Schwarz, Stefan; Wang, Yang; Wu, Congming; Ma, Zhiyong; Shen, Jianzhong

    2014-04-01

    To investigate the genetic basis of pleuromutilin resistance in coagulase-negative staphylococci of porcine origin that do not carry known pleuromutilin resistance genes and to determine the localization and genetic environment of the identified resistance gene. Plasmid DNA of two pleuromutilin-resistant Staphylococcus cohnii and Staphylococcus simulans isolates was transformed into Staphylococcus aureus RN4220. The identified resistance plasmids were sequenced completely. The candidate gene for pleuromutilin resistance was cloned into shuttle vector pAM401. S. aureus RN4220 transformants carrying this recombinant shuttle vector were tested for their MICs. S. cohnii isolate SA-7 and S. simulans isolate SSI1 carried the same plasmid of 5584 bp, designated pSA-7. A variant of the vga(E) gene was detected, which encodes a 524 amino acid ATP-binding cassette protein. The variant gene shared 85.7% nucleotide sequence identity and the variant protein 85.3% amino acid sequence identity with the original vga(E) gene and Vga(E) protein, respectively. The Vga(E) variant conferred cross-resistance to pleuromutilins, lincosamides and streptogramin A antibiotics. Plasmid pSA-7 showed an organization similar to that of the apmA-carrying plasmid pKKS49 from methicillin-resistant S. aureus and the dfrK-carrying plasmid pKKS966 from Staphylococcus hyicus. Sequence comparisons suggested that recombination events may have played a role in the acquisition of this vga(E) variant. A novel vga(E) gene variant was identified, which was located on a small plasmid and was not associated with the transposon Tn6133 [in contrast to the original vga(E) gene]. The plasmid location may enable its further dissemination to other staphylococci and possibly also to other bacteria.

  7. SLC Final Performance and Lessons

    International Nuclear Information System (INIS)

    Phinney, Nan

    2000-01-01

    The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined

  8. UMD-USHbases: a comprehensive set of databases to record and analyse pathogenic mutations and unclassified variants in seven Usher syndrome causing genes.

    Science.gov (United States)

    Baux, David; Faugère, Valérie; Larrieu, Lise; Le Guédard-Méreuze, Sandie; Hamroun, Dalil; Béroud, Christophe; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

    2008-08-01

    Using the Universal Mutation Database (UMD) software, we have constructed "UMD-USHbases", a set of relational databases of nucleotide variations for seven genes involved in Usher syndrome (MYO7A, CDH23, PCDH15, USH1C, USH1G, USH3A and USH2A). Mutations in the Usher syndrome type I causing genes are also recorded in non-syndromic hearing loss cases and mutations in USH2A in non-syndromic retinitis pigmentosa. Usher syndrome provides a particular challenge for molecular diagnostics because of the clinical and molecular heterogeneity. As many mutations are missense changes, and all the genes also contain apparently non-pathogenic polymorphisms, well-curated databases are crucial for accurate interpretation of pathogenicity. Tools are provided to assess the pathogenicity of mutations, including conservation of amino acids and analysis of splice-sites. Reference amino acid alignments are provided. Apparently non-pathogenic variants in patients with Usher syndrome, at both the nucleotide and amino acid level, are included. The UMD-USHbases currently contain more than 2,830 entries including disease causing mutations, unclassified variants or non-pathogenic polymorphisms identified in over 938 patients. In addition to data collected from 89 publications, 15 novel mutations identified in our laboratory are recorded in MYO7A (6), CDH23 (8), or PCDH15 (1) genes. Information is given on the relative involvement of the seven genes, the number and distribution of variants in each gene. UMD-USHbases give access to a software package that provides specific routines and optimized multicriteria research and sorting tools. These databases should assist clinicians and geneticists seeking information about mutations responsible for Usher syndrome.

  9. Rare HFE variants are the most frequent cause of hemochromatosis in non-c282y homozygous patients with hemochromatosis.

    Science.gov (United States)

    Hamdi-Rozé, Houda; Beaumont-Epinette, Marie-Pascale; Ben Ali, Zeineb; Le Lan, Caroline; Loustaud-Ratti, Véronique; Causse, Xavier; Loreal, Olivier; Deugnier, Yves; Brissot, Pierre; Jouanolle, Anne-Marie; Bardou-Jacquet, Edouard

    2016-12-01

    p.Cys282Tyr (C282Y) homozygosity explains most cases of HFE-related hemochromatosis, but a significant number of patients presenting with typical type I hemochromatosis phenotype remain unexplained. We sought to describe the clinical relevance of rare HFE variants in non-C282Y homozygotes. Patients referred for hemochromatosis to the National Reference Centre for Rare Iron Overload Diseases from 2004 to 2010 were studied. Sequencing was performed for coding region and intronic flanking sequences of HFE, HAMP, HFE2, TFR2, and SLC40A1. Nine private HFE variants were identified in 13 of 206 unrelated patients. Among those, five have not been previously described: p.Leu270Argfs*4, p.Ala271Valfs*25, p.Tyr52*, p.Lys166Asn, and p.Asp141Tyr. Our results show that rare HFE variants are identified more frequently than variants in the other genes associated with iron overload. Rare HFE variants are therefore the most frequent cause of hemochromatosis in non-C282Y homozygote HFE patients. Am. J. Hematol. 91:1202-1205, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Circadian gene variants and susceptibility to type 2 diabetes: a pilot study.

    Directory of Open Access Journals (Sweden)

    M Ann Kelly

    Full Text Available Disruption of endogenous circadian rhythms has been shown to increase the risk of developing type 2 diabetes, suggesting that circadian genes might play a role in determining disease susceptibility. We present the results of a pilot study investigating the association between type 2 diabetes and selected single nucleotide polymorphisms (SNPs in/near nine circadian genes. The variants were chosen based on their previously reported association with prostate cancer, a disease that has been suggested to have a genetic link with type 2 diabetes through a number of shared inherited risk determinants.The pilot study was performed using two genetically homogeneous Punjabi cohorts, one resident in the United Kingdom and one indigenous to Pakistan. Subjects with (N = 1732 and without (N = 1780 type 2 diabetes were genotyped for thirteen circadian variants using a competitive allele-specific polymerase chain reaction method. Associations between the SNPs and type 2 diabetes were investigated using logistic regression. The results were also combined with in silico data from other South Asian datasets (SAT2D consortium and white European cohorts (DIAGRAM+ using meta-analysis. The rs7602358G allele near PER2 was negatively associated with type 2 diabetes in our Punjabi cohorts (combined odds ratio [OR] = 0.75 [0.66-0.86], p = 3.18 × 10(-5, while the BMAL1 rs11022775T allele was associated with an increased risk of the disease (combined OR = 1.22 [1.07-1.39], p = 0.003. Neither of these associations was replicated in the SAT2D or DIAGRAM+ datasets, however. Meta-analysis of all the cohorts identified disease associations with two variants, rs2292912 in CRY2 and rs12315175 near CRY1, although statistical significance was nominal (combined OR = 1.05 [1.01-1.08], p = 0.008 and OR = 0.95 [0.91-0.99], p = 0.015 respectively.None of the selected circadian gene variants was associated with type 2 diabetes with study-wide significance after meta-analysis. The nominal

  11. Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

    Directory of Open Access Journals (Sweden)

    Thomas Lundåsen

    Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

  12. Bats: Body mass index, forearm mass index, blood glucose levels and SLC2A2 genes for diabetes

    Science.gov (United States)

    Meng, Fanxing; Zhu, Lei; Huang, Wenjie; Irwin, David M.; Zhang, Shuyi

    2016-01-01

    Bats have an unusually large volume of endocrine tissue, with a large population of beta cells, and an elevated sensitivity to glucose and insulin. This makes them excellent animal models for studying diabetes mellitus. We evaluated bats as models for diabetes in terms of lifestyle and genetic factors. For lifestyle factors, we generated data sets of 149 body mass index (BMI) and 860 forearm mass index (FMI) measurements for different species of bats. Both showed negative inter-species correlations with blood glucose levels in sixteen bats examined. The negative inter-species correlations may reflect adaptation of a small insectivorous ancestor to a larger frugivore. We identified an 11 bp deletion in the proximal promoter of SLC2A2 that we predicted would disrupt binding sites for the transcription repressor ZNF354C. In frugivorous bats this could explain the relatively high expression of this gene, resulting in a better capacity to absorb glucose and decrease blood glucose levels. PMID:27439361

  13. Genetic variants of ACE (Insertion/Deletion) and AGT (M268T) genes in patients with diabetes and nephropathy.

    Science.gov (United States)

    Shaikh, Rozeena; Shahid, Syed M; Mansoor, Qaisar; Ismail, Muhammad; Azhar, Abid

    2014-06-01

    Diabetes mellitus (DM) has been a growing epidemic worldwide and poses a major socio-economic challenge. The leading cause of DM death is nephropathy due to end-stage renal disease (ESRD). This study aims to identify the possible association of I/D variants of the ACE gene and M268T (rs699) of the AGT gene of renin-angiotensin-aldosterone system (RAAS). Study subjects include 115 patients with DM, 110 with diabetic nephropathy (DN) and 110 controls. Fasting blood samples were collected for biochemical analyses and PCR amplification of specific regions of the ACE and AGT genes using primers. The distribution of ACE (I/D) II 28.8%, ID 35.6% and DD 35.6% while in DN II 24.5%, ID 41% and DD 34.5%. The AGT (M268T) genotypes were distributed in DM as TT 30.4%, MT 66.9% and MM 2.6% while in DN subjects TT 56.4%, MT 42.7% and MM 0.9%. Significant differences were observed in the DD genotype and D allele of the ACE gene and the TT genotype and T allele of AGT genes between diabetic patients with and without nephropathy. The study may conclude that the D allele polymorphism in the ACE gene and the T allele polymorphism in AGT gene may be considered as genetic risk factors for the development of nephropathy in diabetes. © The Author(s) 2014.

  14. Common variants in Mendelian kidney disease genes and their association with renal function.

    Science.gov (United States)

    Parsa, Afshin; Fuchsberger, Christian; Köttgen, Anna; O'Seaghdha, Conall M; Pattaro, Cristian; de Andrade, Mariza; Chasman, Daniel I; Teumer, Alexander; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Kim, Young J; Taliun, Daniel; Li, Man; Feitosa, Mary; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; Glazer, Nicole; Isaacs, Aaron; Rao, Madhumathi; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Couraki, Vincent; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Kollerits, Barbara; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Hofer, Edith; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Döring, Angela; Wichmann, H-Erich; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; van Duijn, Cornelia M; Borecki, Ingrid; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Bochud, Murielle; Heid, Iris M; Siscovick, David S; Fox, Caroline S; Kao, W Linda; Böger, Carsten A

    2013-12-01

    Many common genetic variants identified by genome-wide association studies for complex traits map to genes previously linked to rare inherited Mendelian disorders. A systematic analysis of common single-nucleotide polymorphisms (SNPs) in genes responsible for Mendelian diseases with kidney phenotypes has not been performed. We thus developed a comprehensive database of genes for Mendelian kidney conditions and evaluated the association between common genetic variants within these genes and kidney function in the general population. Using the Online Mendelian Inheritance in Man database, we identified 731 unique disease entries related to specific renal search terms and confirmed a kidney phenotype in 218 of these entries, corresponding to mutations in 258 genes. We interrogated common SNPs (minor allele frequency >5%) within these genes for association with the estimated GFR in 74,354 European-ancestry participants from the CKDGen Consortium. However, the top four candidate SNPs (rs6433115 at LRP2, rs1050700 at TSC1, rs249942 at PALB2, and rs9827843 at ROBO2) did not achieve significance in a stage 2 meta-analysis performed in 56,246 additional independent individuals, indicating that these common SNPs are not associated with estimated GFR. The effect of less common or rare variants in these genes on kidney function in the general population and disease-specific cohorts requires further research.

  15. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Science.gov (United States)

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

    2018-05-04

    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  16. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Directory of Open Access Journals (Sweden)

    Vincent Lepori

    2018-05-01

    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  17. Mutation analysis of SLC26A4 for Pendred syndrome and nonsyndromic hearing loss by high-resolution melting

    DEFF Research Database (Denmark)

    Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl

    2011-01-01

    Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites...

  18. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

    OpenAIRE

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

    2014-01-01

    Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

  19. Homozygous sequence variants in the WNT10B gene underlie split hand/foot malformation

    Directory of Open Access Journals (Sweden)

    Asmat Ullah

    2018-01-01

    Full Text Available Abstract Split-hand/split-foot malformation (SHFM, also known as ectrodactyly is a rare genetic disorder. It is a clinically and genetically heterogeneous group of limb malformations characterized by absence/hypoplasia and/or median cleft of hands and/or feet. To date, seven genes underlying SHFM have been identified. This study described four consanguineous families (A-D segregating SHFM in an autosomal recessive manner. Linkage in the families was established to chromosome 12p11.1–q13.13 harboring WNT10B gene. Sequence analysis identified a novel homozygous nonsense variant (p.Gln154* in exon 4 of the WNT10B gene in two families (A and B. In the other two families (C and D, a previously reported variant (c.300_306dupAGGGCGG; p.Leu103Argfs*53 was detected. This study further expands the spectrum of the sequence variants reported in the WNT10B gene, which result in the split hand/foot malformation.

  20. Frequency of the Hemochromatosis Gene (HFE Variants in a Jordanian Arab Population and in Diabetics from the Same Region

    Directory of Open Access Journals (Sweden)

    Asem Alkhateeb

    2009-01-01

    Full Text Available Hereditary HFE-linked hemochromatosis is a frequent recessive disorder among individuals of northern European ancestry. The clinical characteristic of this disease is the gradual accumulation of iron in internal organs, which ultimately may lead to organ damage and death. Three allelic variants of HFE gene have been correlated with hereditary hemochromatosis: C282Y is significantly associated with hereditary hemochromatosis in populations of Celtic origin, H63D and S65C are associated with milder form of iron overload. In this study we performed mutation analysis to identify allele frequency of the three variants of HFE gene in Jordanian Arab population, to assess deviations of these frequencies from those detected elsewhere, and to determine if there is an increased frequency of these variants in a diabetic population (Type 2 diabetes from the same area. DNA was extracted from blood samples of 440 individuals attending King Abdullah University Hospital for ambulatory services. We used polymerase chain reaction (PCR to amplify exons 2 and 4 of the HFE gene then restriction fragment length polymorphism (RFLP method to detect the variants. There were neither homozygous nor heterozygous for C282Y variant. For the H63D variant, 0.68% were homozygous and 21.1% were heterozygous. For the S65C variant, there were no homozygous and 0.23% were heterozygous. Allelic frequencies were, 0%, 11.25%, and 0.11% for C282Y, H63D, and S65C, respectively. Our samples were subdivided into two categories of type 2 diabetic (89 cases and controls (blood donors, 204 cases and compared with regard to the H63D variant. Both groups did not have homozygous H63D variant. H63D heterozygous in diabetics were 23.60% and in blood donor controls 22.55%. Allelic frequency of the mutant H63D allele was 11.80% in diabetics and 11.27% for the blood donor controls. This is the first study to show the frequency of the three hemochromatosis gene variants in Jordan with the interesting

  1. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  2. Epithelial-Mesenchymal Transition (EMT) Gene Variants and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Amankwah, Ernest K.; Lin, Hui-Yi; Tyrer, Jonathan P.

    2015-01-01

    women of European ancestry (1,947 cases and 2,009 controls) and identified 793 variants in 278 EMT-related genes that were nominally (P ....27-2.24, P = 0.0003, FDR = 0.12), F8 rs7058826 (OR = 1.69, 95% CI = 1.27-2.24, P = 0.0003, FDR = 0.12), and CAPN13 rs1983383 (OR = 0.79, 95% CI = 0.69-0.90, P = 0.0005, FDR = 0.12) were associated with combined invasive EOC among Asians. In silico functional analyses revealed that GPC6/GPC5 rs17702471...

  3. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  4. Reciprocal Relationship between Head Size, an Autism Endophenotype, and Gene Dosage at 19p13.12 Points to AKAP8 and AKAP8L.

    Directory of Open Access Journals (Sweden)

    Rebecca A Nebel

    Full Text Available Microcephaly and macrocephaly are overrepresented in individuals with autism and are thought to be disease-related risk factors or endophenotypes. Analysis of DNA microarray results from a family with a low functioning autistic child determined that the proband and two additional unaffected family members who carry a rare inherited 760 kb duplication of unknown clinical significance at 19p13.12 are macrocephalic. Consideration alongside overlapping deletion and duplication events in the literature provides support for a strong relationship between gene dosage at this locus and head size, with losses and gains associated with microcephaly (p=1.11x10(-11 and macrocephaly (p=2.47x10(-11, respectively. Data support A kinase anchor protein 8 and 8-like (AKAP8 and AKAP8L as candidate genes involved in regulation of head growth, an interesting finding given previous work implicating the AKAP gene family in autism. Towards determination of which of AKAP8 and AKAP8L may be involved in the modulation of head size and risk for disease, we analyzed exome sequencing data for 693 autism families (2591 individuals where head circumference data were available. No predicted loss of function variants were observed, precluding insights into relationship to head size, but highlighting strong evolutionary conservation. Taken together, findings support the idea that gene dosage at 19p13.12, and AKAP8 and/or AKAP8L in particular, play an important role in modulation of head size and may contribute to autism risk. Exome sequencing of the family also identified a rare inherited variant predicted to disrupt splicing of TPTE / PTEN2, a PTEN homologue, which may likewise contribute to both macrocephaly and autism risk.

  5. HFE gene variants and iron-induced oxygen radical generation in idiopathic pulmonary fibrosis.

    Science.gov (United States)

    Sangiuolo, Federica; Puxeddu, Ermanno; Pezzuto, Gabriella; Cavalli, Francesco; Longo, Giuliana; Comandini, Alessia; Di Pierro, Donato; Pallante, Marco; Sergiacomi, Gianluigi; Simonetti, Giovanni; Zompatori, Maurizio; Orlandi, Augusto; Magrini, Andrea; Amicosante, Massimo; Mariani, Francesca; Losi, Monica; Fraboni, Daniela; Bisetti, Alberto; Saltini, Cesare

    2015-02-01

    In idiopathic pulmonary fibrosis (IPF), lung accumulation of excessive extracellular iron and macrophage haemosiderin may suggest disordered iron homeostasis leading to recurring microscopic injury and fibrosing damage. The current study population comprised 89 consistent IPF patients and 107 controls. 54 patients and 11 controls underwent bronchoalveolar lavage (BAL). Haemosiderin was assessed by Perls' stain, BAL fluid malondialdehyde (MDA) by high-performance liquid chromatography, BAL cell iron-dependent oxygen radical generation by fluorimetry and the frequency of hereditary haemochromatosis HFE gene variants by reverse dot blot hybridisation. Macrophage haemosiderin, BAL fluid MDA and BAL cell unstimulated iron-dependent oxygen radical generation were all significantly increased above controls (pHFE allelic variants was markedly higher in IPF compared with controls (40.4% versus 22.4%, OR 2.35, p=0.008) and was associated with higher iron-dependent oxygen radical generation (HFE variant 107.4±56.0, HFE wild type (wt) 59.4±36.4 and controls 16.7±11.8 fluorescence units per 10(5) BAL cells; p=0.028 HFE variant versus HFE wt, p=0.006 HFE wt versus controls). The data suggest iron dysregulation associated with HFE allelic variants may play an important role in increasing susceptibility to environmental exposures, leading to recurring injury and fibrosis in IPF. Copyright ©ERS 2015.

  6. Novel variant in the TP63 gene associated to ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome.

    Science.gov (United States)

    Gonzalez, Francisco; Loidi, Lourdes; Abalo-Lojo, Jose M

    2017-01-01

    Ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome is a disorder resulting from anomalous embryonic development of ectodermal tissues. There is evidence that AEC syndrome is caused by mutations in the TP63 gene, which encodes the p63 protein. This is an important regulatory protein involved in epidermal proliferation and differentiation. Genome sequencing was performed in DNA from peripheral blood leukocytes of a newborn with AEC syndrome and her parents. Variants were searched in all coding exons and intron-exon boundaries of the TP63 gene. A heterozygous missense variant (NM_003722.4:c.1063G>C (p.Asp355His) was found in the newborn patient. No variants were found in either of the parents. We identified a previously unreported variant in TP63 gene which seems to be involved in the somatic malformations found in the AEC syndrome. The absence of this variant in both parents suggests that the variant appeared de novo.

  7. A three-step programmed method for the identification of causative gene mutations of maturity onset diabetes of the young (MODY).

    Science.gov (United States)

    Li, Qian; Cao, Xi; Qiu, Hai-Yan; Lu, Jing; Gao, Rui; Liu, Chao; Yuan, Ming-Xia; Yang, Guang-Ran; Yang, Jin-Kui

    2016-08-22

    To establish a three-step programmed method to find gene mutations related to maturity onset diabetes of the young (MODY). Target region capture and next-generation sequencing (NGS) were performed using customized oligonucleotide probes designed to capture suspected genes for MODY in 11 probands with clinically diagnosed MODY. The suspected associations of certain genes with MODY were then confirmed by Sanger sequencing in the probands and their family members. Finally, to validate variants of one of the genes of interest (glucokinase, GCK) as pathogenic mutations, protein function editing by the variant genes was assessed. In the target region capture and NGS phase, a total of nine variants of seven genes (GCK, WFS1, SLC19A2, SH2B1, SERPINB4, RFX6, and GATA6) were identified in eight probands. Two heterozygous GCK mutations located on the same allele (p.Leu77Arg and p.Val101Met) were identified in a MODY family. Sanger sequencing was used to confirm the variants identified by NGS to be present in probands and their diabetic family members, but not in non-diabetic family members. Finally, enzyme kinetic and thermal stability analyses revealed that the p.Leu77Arg mutation or the p.Leu77Arg mutation in combination with the p.Val101Met mutation inactivates GCK function and stability, while mutation of p.Val101Met alone does not. The p.Leu77Arg but not p.Val101Met GCK mutation is therefore considered a pathogenic mutation associated with MODY. Genetic screening coupled with gene-editing protein function testing is an effective and reliable method by which causative gene mutations of MODY can be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Common variants related to serum uric acid concentrations are associated with glucose metabolism and insulin secretion in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Xue Sun

    Full Text Available Elevated serum uric acid concentration is an independent risk factor and predictor of type 2 diabetes (T2D. Whether the uric acid-associated genes have an impact on T2D remains unclear. We aimed to investigate the effects of the uric acid-associated genes on the risk of T2D as well as glucose metabolism and insulin secretion.We recruited 2,199 normal glucose tolerance subjects from the Shanghai Diabetes Study I and II and 2,999 T2D patients from the inpatient database of Shanghai Diabetes Institute. Fifteen single nucleotide polymorphisms (SNPs mapped in or near 11 loci (PDZK1, GCKR, LRP2, SLC2A9, ABCG2, LRRC16A, SLC17A1, SLC17A3, SLC22A11, SLC22A12 and SF1 were genotyped and serum biochemical parameters related to uric acid and T2D were determined.SF1 rs606458 showed strong association to T2D in both males and females (p = 0.034 and 0.0008. In the males, LRRC16A was associated with 2-h insulin and insulin secretion (p = 0.009 and 0.009. SLC22A11 was correlated with HOMA-B and insulin secretion (p = 0.048 and 0.029. SLC2A9 rs3775948 was associated with 2-h glucose (p = 0.043. In the females, LRP2 rs2544390 and rs1333049 showed correlations with fasting insulin, HOMA-IR and insulin secretion (p = 0.028, 0.033 and 0.052 and p = 0.034, 0.047 and 0.038, respectively. SLC2A9 rs11722228 was correlated with 2-h glucose, 2-h insulin and insulin secretion (p = 0.024, 0.049 and 0.049, respectively.Our results indicated that the uric acid-associated genes have an impact on the risk of T2D, glucose metabolism and insulin secretion in a Chinese population.

  9. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    Directory of Open Access Journals (Sweden)

    Lise Bols Toustrup

    2017-03-01

    Full Text Available Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI is caused by variants in the arginine vasopressin (AVP gene. Here we report the generation of induced pluripotent stem cells (iPSCs from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using lentivirus-mediated nuclear reprogramming. The iPSCs carried the expected variant in the AVP gene. Furthermore, the iPSCs expressed pluripotency markers; displayed in vitro differentiation potential to the three germ layers and had a normal karyotype consistent with the original fibroblasts. This iPSC line is useful in future studies focusing on the pathogenesis of adFNDI.

  10. No evidence for association of ataxia-telangiectasia mutated gene T2119C and C3161G amino acid substitution variants with risk of breast cancer

    International Nuclear Information System (INIS)

    Spurdle, Amanda B; Hopper, John L; Chen, Xiaoqing; McCredie, Margaret RE; Giles, Graham G; Newman, Beth; Chenevix-Trench, Georgia; Khanna, KumKum

    2002-01-01

    There is evidence that certain mutations in the double-strand break repair pathway ataxia-telangiectasia mutated gene act in a dominant-negative manner to increase the risk of breast cancer. There are also some reports to suggest that the amino acid substitution variants T2119C Ser707Pro and C3161G Pro1054Arg may be associated with breast cancer risk. We investigate the breast cancer risk associated with these two nonconservative amino acid substitution variants using a large Australian population-based case–control study. The polymorphisms were genotyped in more than 1300 cases and 600 controls using 5' exonuclease assays. Case–control analyses and genotype distributions were compared by logistic regression. The 2119C variant was rare, occurring at frequencies of 1.4 and 1.3% in cases and controls, respectively (P = 0.8). There was no difference in genotype distribution between cases and controls (P = 0.8), and the TC genotype was not associated with increased risk of breast cancer (adjusted odds ratio = 1.08, 95% confidence interval = 0.59–1.97, P = 0.8). Similarly, the 3161G variant was no more common in cases than in controls (2.9% versus 2.2%, P = 0.2), there was no difference in genotype distribution between cases and controls (P = 0.1), and the CG genotype was not associated with an increased risk of breast cancer (adjusted odds ratio = 1.30, 95% confidence interval = 0.85–1.98, P = 0.2). This lack of evidence for an association persisted within groups defined by the family history of breast cancer or by age. The 2119C and 3161G amino acid substitution variants are not associated with moderate or high risks of breast cancer in Australian women

  11. Thiamine responsive megaloblastic anemia: a novel SLC19A2 compound heterozygous mutation in two siblings.

    Science.gov (United States)

    Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana

    2013-08-01

    Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.

  12. Characterization of a rare variant (c.2635-2A>G) of the MSH2 gene in a family with Lynch syndrome.

    Science.gov (United States)

    Cariola, Filomena; Disciglio, Vittoria; Valentini, Anna M; Lotesoriere, Claudio; Fasano, Candida; Forte, Giovanna; Russo, Luciana; Di Carlo, Antonio; Guglielmi, Floranna; Manghisi, Andrea; Lolli, Ivan; Caruso, Maria L; Simone, Cristiano

    2018-04-01

    Lynch syndrome is caused by germline mutations in one of the mismatch repair genes ( MLH1, MSH2, MSH6, and PMS2) or in the EPCAM gene. Lynch syndrome is defined on the basis of clinical, pathological, and genetic findings. Accordingly, the identification of predisposing genes allows for accurate risk assessment and tailored screening protocols. Here, we report a family case with three family members manifesting the Lynch syndrome phenotype, all of which harbor the rare variant c.2635-2A>G affecting the splice site consensus sequence of intron 15 of the MSH2 gene. This mutation was previously described only in one family with Lynch syndrome, in which mismatch repair protein expression in tumor tissues was not assessed. In this study, we report for the first time the molecular characterization of the MSH2 c.2635-2A>G variant through in silico prediction analysis, microsatellite instability, and mismatch repair protein expression experiments on tumor tissues of Lynch syndrome patients. The potential effect of the splice site variant was revealed by three splicing prediction bioinformatics tools, which suggested the generation of a new cryptic splicing site. The potential pathogenic role of this variant was also revealed by the presence of microsatellite instability and the absence of MSH2/MSH6 heterodimer protein expression in the tumor cells of cancer tissues of the affected family members. We provide compelling evidence in favor of the pathogenic role of the MSH2 variant c.2635-2A>G, which could induce an alteration of the canonical splice site and consequently an aberrant form of the protein product (MSH2).

  13. An association study of suicide and candidate genes in the serotonergic system

    DEFF Research Database (Denmark)

    Buttenschøn, Henriette N; Flint, Tracey J; Foldager, Leslie

    2013-01-01

    Introduction: Strong evidence demonstrates a genetic susceptibility to suicidal behaviour and a relationship between suicide and mental disorders. The aim of this study was to test for association between suicide and five selected genetic variants, which had shown association with suicide in other...... populations. Method: We performed a nationwide case-control study on all suicide cases sent for autopsy in Denmark between the years 2000 and 2007. The study comprised 572 cases and 1049 controls and is one of the largest genetic studies in completed suicide to date. The analysed markers were located within...... the Serotonin Transporter (SLC6A4), Monoamine Oxidase-A (MAOA) and the Ttyptophan Hydroxylase I and II (TPH1 and TPH2) genes. Results: None of the genetic markers within SLC6A4, MAOA, TPH1 and TPH2 were significantly associated with completed suicide or suicide method in the basic association tests. Exploratory...

  14. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  15. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    DEFF Research Database (Denmark)

    Toustrup, Lise Bols; Zhou, Yan; Kvistgaard, Helene

    2017-01-01

    Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI) is caused by variants in the arginine vasopressin (AVP) gene. Here we report the generation of induced pluripotent stem cells (iPSCs) from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using...

  16. Genetic variation in biotransformation enzymes, air pollution exposures, and risk of spina bifida.

    Science.gov (United States)

    Padula, Amy M; Yang, Wei; Schultz, Kathleen; Lurmann, Fred; Hammond, S Katharine; Shaw, Gary M

    2018-05-01

    Spina bifida is a birth defect characterized by incomplete closure of the embryonic neural tube. Genetic factors as well as environmental factors have been observed to influence risks for spina bifida. Few studies have investigated possible gene-environment interactions that could contribute to spina bifida risk. The aim of this study is to examine the interaction between gene variants in biotransformation enzyme pathways and ambient air pollution exposures and risk of spina bifida. We evaluated the role of air pollution exposure during pregnancy and gene variants of biotransformation enzymes from bloodspots and buccal cells in a California population-based case-control (86 cases of spina bifida and 208 non-malformed controls) study. We considered race/ethnicity and folic acid vitamin use as potential effect modifiers and adjusted for those factors and smoking. We observed gene-environment interactions between each of the five pollutants and several gene variants: NO (ABCC2), NO 2 (ABCC2, SLC01B1), PM 10 (ABCC2, CYP1A1, CYP2B6, CYP2C19, CYP2D6, NAT2, SLC01B1, SLC01B3), PM 2.5 (CYP1A1 and CYP1A2). These analyses show positive interactions between air pollution exposure during early pregnancy and gene variants associated with metabolizing enzymes. These exploratory results suggest that some individuals based on their genetic background may be more susceptible to the adverse effects of pollution. © 2018 Wiley Periodicals, Inc.

  17. Absence of a primary role for TTN missense variants in arrhythmogenic cardiomyopathy: From a clinical and pathological perspective.

    Science.gov (United States)

    Chen, Kai; Song, Jiangping; Wang, Zhen; Rao, Man; Chen, Liang; Hu, Shengshou

    2018-05-01

    Arrhythmogenic cardiomyopathy (ACM) is an inheritable heart disease characterized by fibro-fatty replacement of the myocardium. TTN missense variants were previously reported as a pathogenic factor for ACM. TTN missense variants are commonly identified in ACM, but have limited effect on the phenotype of ACM. We sequenced 15 ACM-related genes in 35 patients who had a heart transplantation and quantified myocardium, and fibrous and adipose tissue in blocks of the explanted heart. Clinical and pathological characteristics were compared between patients with TTN variants and others. Pedigree analysis was performed in 3 families with TTN variants. TTN variants were detected in 11 patients (all missense, 9 heterozygous and 2 oligogenic form). The TTN truncating variant was absent in the cohort. Patients with TTN variants had late onset age of the disease (31 ±13 years vs 17 ±3 years, P = 0.049) and age of heart transplantation (41 ±14 years vs 24 ±9 years, P = 0.027), larger left ventricle end-diastolic diameter (62 ±10 mm vs 45 ±10 mm, P = 0.019), smaller right ventricular outflow tract (34 ±14 mm vs 50 ±15 mm, P = 0.046), more myocardium (40.8% ±29.4% vs 13.8% ±11.0%, P = 0.017), and less adipose tissue (43.0% ±30.9% vs 66.9% ±18.5%, P = 0.036) in right ventricle than those with desmosomal variants. There was few difference between patients with TTN variants and those without variants. Pedigrees showed none of the family members with TTN missense variants had a disease phenotype, indicating a very low penetrance. TTN missense variants was commonly identified in ACM patients in this cohort, but hardly played a primary role in ACM as causative variants. © 2018 Wiley Periodicals, Inc.

  18. Germline pathogenic variants in PALB2 and other cancer-predisposing genes in families with hereditary diffuse gastric cancer without CDH1 mutation: a whole-exome sequencing study.

    Science.gov (United States)

    Fewings, Eleanor; Larionov, Alexey; Redman, James; Goldgraben, Mae A; Scarth, James; Richardson, Susan; Brewer, Carole; Davidson, Rosemarie; Ellis, Ian; Evans, D Gareth; Halliday, Dorothy; Izatt, Louise; Marks, Peter; McConnell, Vivienne; Verbist, Louis; Mayes, Rebecca; Clark, Graeme R; Hadfield, James; Chin, Suet-Feung; Teixeira, Manuel R; Giger, Olivier T; Hardwick, Richard; di Pietro, Massimiliano; O'Donovan, Maria; Pharoah, Paul; Caldas, Carlos; Fitzgerald, Rebecca C; Tischkowitz, Marc

    2018-04-26

    Germline pathogenic variants in the E-cadherin gene (CDH1) are strongly associated with the development of hereditary diffuse gastric cancer. There is a paucity of data to guide risk assessment and management of families with hereditary diffuse gastric cancer that do not carry a CDH1 pathogenic variant, making it difficult to make informed decisions about surveillance and risk-reducing surgery. We aimed to identify new candidate genes associated with predisposition to hereditary diffuse gastric cancer in affected families without pathogenic CDH1 variants. We did whole-exome sequencing on DNA extracted from the blood of 39 individuals (28 individuals diagnosed with hereditary diffuse gastric cancer and 11 unaffected first-degree relatives) in 22 families without pathogenic CDH1 variants. Genes with loss-of-function variants were prioritised using gene-interaction analysis to identify clusters of genes that could be involved in predisposition to hereditary diffuse gastric cancer. Protein-affecting germline variants were identified in probands from six families with hereditary diffuse gastric cancer; variants were found in genes known to predispose to cancer and in lesser-studied DNA repair genes. A frameshift deletion in PALB2 was found in one member of a family with a history of gastric and breast cancer. Two different MSH2 variants were identified in two unrelated affected individuals, including one frameshift insertion and one previously described start-codon loss. One family had a unique combination of variants in the DNA repair genes ATR and NBN. Two variants in the DNA repair gene RECQL5 were identified in two unrelated families: one missense variant and a splice-acceptor variant. The results of this study suggest a role for the known cancer predisposition gene PALB2 in families with hereditary diffuse gastric cancer and no detected pathogenic CDH1 variants. We also identified new candidate genes associated with disease risk in these families. UK Medical

  19. Elevated Serum Triiodothyronine and Intellectual and Motor Disability with Paroxysmal Dyskinesia Caused by a Monocarboxylate Transporter 8 Gene Mutation

    Science.gov (United States)

    Fuchs, Oliver; Pfarr, Nicole; Pohlenz, Joachim; Schmidt, Heinrich

    2009-01-01

    "Monocarboxylate transporter 8" ("MCT8" or SLC16A2) is important for the neuronal uptake of triiodothyronine (T3) in its function as a specific and active transporter of thyroid hormones across the cell membrane, thus being essential for human brain development. We report on a German male with Allan-Herndon-Dudley syndrome…

  20. Prevalence of pathogenic germline variants detected by multigene sequencing in unselected Japanese patients with ovarian cancer.

    Science.gov (United States)

    Hirasawa, Akira; Imoto, Issei; Naruto, Takuya; Akahane, Tomoko; Yamagami, Wataru; Nomura, Hiroyuki; Masuda, Kiyoshi; Susumu, Nobuyuki; Tsuda, Hitoshi; Aoki, Daisuke

    2017-12-22

    Pathogenic germline BRCA1 , BRCA2 ( BRCA1/2 ), and several other gene variants predispose women to primary ovarian, fallopian tube, and peritoneal carcinoma (OC), although variant frequency and relevance information is scarce in Japanese women with OC. Using targeted panel sequencing, we screened 230 unselected Japanese women with OC from our hospital-based cohort for pathogenic germline variants in 75 or 79 OC-associated genes. Pathogenic variants of 11 genes were identified in 41 (17.8%) women: 19 (8.3%; BRCA1 ), 8 (3.5%; BRCA2 ), 6 (2.6%; mismatch repair genes), 3 (1.3%; RAD51D ), 2 (0.9%; ATM ), 1 (0.4%; MRE11A ), 1 ( FANCC ), and 1 ( GABRA6 ). Carriers of BRCA1/2 or any other tested gene pathogenic variants were more likely to be diagnosed younger, have first or second-degree relatives with OC, and have OC classified as high-grade serous carcinoma (HGSC). After adjustment for these variables, all 3 features were independent predictive factors for pathogenic variants in any tested genes whereas only the latter two remained for variants in BRCA1/2 . Our data indicate similar variant prevalence in Japanese patients with OC and other ethnic groups and suggest that HGSC and OC family history may facilitate genetic predisposition prediction in Japanese patients with OC and referring high-risk patients for genetic counseling and testing.

  1. Morphological study on dental caries induced in WBN/KobSlc rats (Rattus norvegicus) fed a standard laboratory diet.

    Science.gov (United States)

    Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao

    2009-10-01

    In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.

  2. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  3. Genetic polymorphisms of the CASP8 gene promoter may not be associated with colorectal cancer in Han Chinese from southwest China.

    Directory of Open Access Journals (Sweden)

    Mei-Sheng Xiao

    Full Text Available PURPOSE: Caspase 8 (CASP8 plays a critical role in the apoptotic pathway and aberrant regulation of this pathway causes many diseases including cancers. Genetic variants rs3834129 (CTTACT/- and rs3769821 (T/C in the promoter region of the CASP8 gene were documented to be associated with multiple solid cancers and non-Hodgkin's lymphoma (NHL, respectively, despite of some controversies. We aimed to discern potential association of these two variants and rs113686495 (CTGTCATT/-, as well as CASP8 mRNA and protein expression levels with colorectal cancer (CRC in Han Chinese. METHODS: We genotyped CASP8 genetic variants in 305 CRC patients and 342 healthy individuals from Kunming, Southwest China. Expression levels of CASP8 mRNA and protein were quantified in paired cancerous and paracancerous normal tissues by using real-time quantitative PCR and western blot, respectively. We compared the frequencies of alleles, genotypes, and haplotypes between the cases and controls. Correlation of CASP8 mRNA and protein expression levels in paired cancerous and paracancerous normal tissues from patients with different genotypes and clinical expression were also evaluated. RESULTS: There was no association of the CASP8 genetic variants with CRC in our case-control study. The CASP8 gene mRNA expression levels in cancerous and paracancerous normal tissues were similar and there was no significant difference between subjects with different genotypes and clinical features. However, we found that CASP8 protein level was significantly lower in cancerous tissues than in paired paracancerous normal tissues. CONCLUSIONS: Our results suggest that the three CASP8 genetic variants may not be associated with CRC risk in Han Chinese from southwest China. Aberrant CASP8 protein expression may play a role in the pathogenesis of CRC.

  4. A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

    Science.gov (United States)

    Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

    2017-09-01

    Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

  5. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  6. CEACAM6 gene variants in inflammatory bowel disease.

    Science.gov (United States)

    Glas, Jürgen; Seiderer, Julia; Fries, Christoph; Tillack, Cornelia; Pfennig, Simone; Weidinger, Maria; Beigel, Florian; Olszak, Torsten; Lass, Ulrich; Göke, Burkhard; Ochsenkühn, Thomas; Wolf, Christiane; Lohse, Peter; Müller-Myhsok, Bertram; Diegelmann, Julia; Czamara, Darina; Brand, Stephan

    2011-04-29

    The carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) acts as a receptor for adherent-invasive E. coli (AIEC) and its ileal expression is increased in patients with Crohn's disease (CD). Given its contribution to the pathogenesis of CD, we aimed to investigate the role of genetic variants in the CEACAM6 region in patients with inflammatory bowel diseases (IBD). In this study, a total of 2,683 genomic DNA samples (including DNA from 858 CD patients, 475 patients with ulcerative colitis (UC), and 1,350 healthy, unrelated controls) was analyzed for eight CEACAM6 SNPs (rs10415946, rs1805223 = p.Pro42Pro, rs4803507, rs4803508, rs11548735 = p.Gly239Val, rs7246116 = pHis260His, rs2701, rs10416839). In addition, a detailed haplotype analysis and genotype-phenotype analysis were performed. Overall, our genotype analysis did not reveal any significant association of the investigated CEACAM6 SNPs and haplotypes with CD or UC susceptibility, although certain CEACAM6 SNPs modulated CEACAM6 expression in intestinal epithelial cell lines. Despite its function as receptor of AIEC in ileal CD, we found no association of the CEACAM6 SNPs with ileal or ileocolonic CD. Moreover, there was no evidence of epistasis between the analyzed CEACAM6 variants and the main CD-associated NOD2, IL23R and ATG16L1 variants. This study represents the first detailed analysis of CEACAM6 variants in IBD patients. Despite its important role in bacterial attachment in ileal CD, we could not demonstrate a role for CEACAM6 variants in IBD susceptibility or regarding an ileal CD phenotype. Further functional studies are required to analyze if these gene variants modulate ileal bacterial attachment.

  7. CEACAM6 gene variants in inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Jürgen Glas

    Full Text Available BACKGROUND: The carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6 acts as a receptor for adherent-invasive E. coli (AIEC and its ileal expression is increased in patients with Crohn's disease (CD. Given its contribution to the pathogenesis of CD, we aimed to investigate the role of genetic variants in the CEACAM6 region in patients with inflammatory bowel diseases (IBD. METHODOLOGY: In this study, a total of 2,683 genomic DNA samples (including DNA from 858 CD patients, 475 patients with ulcerative colitis (UC, and 1,350 healthy, unrelated controls was analyzed for eight CEACAM6 SNPs (rs10415946, rs1805223 = p.Pro42Pro, rs4803507, rs4803508, rs11548735 = p.Gly239Val, rs7246116 = pHis260His, rs2701, rs10416839. In addition, a detailed haplotype analysis and genotype-phenotype analysis were performed. Overall, our genotype analysis did not reveal any significant association of the investigated CEACAM6 SNPs and haplotypes with CD or UC susceptibility, although certain CEACAM6 SNPs modulated CEACAM6 expression in intestinal epithelial cell lines. Despite its function as receptor of AIEC in ileal CD, we found no association of the CEACAM6 SNPs with ileal or ileocolonic CD. Moreover, there was no evidence of epistasis between the analyzed CEACAM6 variants and the main CD-associated NOD2, IL23R and ATG16L1 variants. CONCLUSIONS: This study represents the first detailed analysis of CEACAM6 variants in IBD patients. Despite its important role in bacterial attachment in ileal CD, we could not demonstrate a role for CEACAM6 variants in IBD susceptibility or regarding an ileal CD phenotype. Further functional studies are required to analyze if these gene variants modulate ileal bacterial attachment.

  8. Enrichment of deleterious variants of mitochondrial DNA polymerase gene (POLG1) in bipolar disorder.

    Science.gov (United States)

    Kasahara, Takaoki; Ishiwata, Mizuho; Kakiuchi, Chihiro; Fuke, Satoshi; Iwata, Nakao; Ozaki, Norio; Kunugi, Hiroshi; Minabe, Yoshio; Nakamura, Kazuhiko; Iwata, Yasuhide; Fujii, Kumiko; Kanba, Shigenobu; Ujike, Hiroshi; Kusumi, Ichiro; Kataoka, Muneko; Matoba, Nana; Takata, Atsushi; Iwamoto, Kazuya; Yoshikawa, Takeo; Kato, Tadafumi

    2017-08-01

    Rare missense variants, which likely account for a substantial portion of the genetic 'dark matter' for a common complex disease, are challenging because the impacts of variants on disease development are difficult to substantiate. This study aimed to examine the impacts of amino acid substitution variants in the POLG1 found in bipolar disorder, as an example and proof of concept, in three different modalities of assessment: in silico predictions, in vitro biochemical assays, and clinical evaluation. We then tested whether deleterious variants in POLG1 contributed to the genetics of bipolar disorder. We searched for variants in the POLG1 gene in 796 Japanese patients with bipolar disorder and 767 controls and comprehensively investigated all 23 identified variants in the three modalities of assessment. POLG1 encodes mitochondrial DNA polymerase and is one of the causative genes for a Mendelian-inheritance mitochondrial disease, which is occasionally accompanied by mood disorders. The healthy control data from the Tohoku Medical Megabank Organization were also employed. Although the frequency of carriers of deleterious variants varied from one method to another, every assessment achieved the same conclusion that deleterious POLG1 variants were significantly enriched in the variants identified in patients with bipolar disorder compared to those in controls. Together with mitochondrial dysfunction in bipolar disorder, the present results suggested deleterious POLG1 variants as a credible risk for the multifactorial disease. © 2016 The Authors. Psychiatry and Clinical Neurosciences published by John Wiley & Sons Australia, Ltd on behalf of Japanese Society of Psychiatry and Neurology.

  9. Genetic variants in PARP1 (rs3219090) and IRF4 (rs12203592) genes associated with melanoma susceptibility in a Spanish population

    International Nuclear Information System (INIS)

    Peña-Chilet, Maria; Ribas, Gloria; Blanquer-Maceiras, Maite; Ibarrola-Villava, Maider; Martinez-Cadenas, Conrado; Martin-Gonzalez, Manuel; Gomez-Fernandez, Cristina; Mayor, Matias; Aviles, Juan Antonio; Lluch, Ana

    2013-01-01

    Few high penetrance genes are known in Malignant Melanoma (MM), however, the involvement of low-penetrance genes such as MC1R, OCA2, ASIP, SLC45A2 and TYR has been observed. Lately, genome-wide association studies (GWAS) have been the ideal strategy to identify new common, low-penetrance susceptibility loci. In this case–control study, we try to validate in our population nine melanoma associated markers selected from published GWAS in melanoma predisposition. We genotyped the 9 markers corresponding to 8 genes (PARP1, MX2, ATM, CCND1, NADSYN1, CASP8, IRF4 and CYP2R1) in 566 cases and 347 controls from a Spanish population using KASPar probes. Genotypes were analyzed by logistic regression and adjusted by phenotypic characteristics. We confirm the protective role in MM of the rs3219090 located on the PARP1 gene (p-value 0.027). Additionally, this SNP was also associated with eye color (p-value 0.002). A second polymorphism, rs12203592, located on the IRF4 gene was associated with protection to develop MM for the dominant model (p-value 0.037). We have also observed an association of this SNP with both lentigines (p-value 0.014) and light eye color (p-value 3.76 × 10 -4 ). Furthermore, we detected a novel association with rs1485993, located on the CCND1 gene, and dark eye color (p-value 4.96 × 10 -4 ). Finally, rs1801516, located on the ATM gene, showed a trend towards a protective role in MM similar to the one firstly described in a GWAS study. To our knowledge, this is the first time that these SNPs have been associated with MM in a Spanish population. We confirmed the proposed role of rs3219090, located on the PARP1 gene, and rs12203592, located on the IRF4 gene, as protective to MM along the same lines as have previous genome-wide associated works. Finally, we have seen associations between IRF4, PARP1, and CCND1 and phenotypic characteristics, confirming previous results for the IRF4 gene and presenting novel data for the last two, suggesting that

  10. Physical activity modifies the effect of SNPs in the SLC2A2 (GLUT2) and ABCC8 (SUR1) genes on the risk of developing type 2 diabetes

    DEFF Research Database (Denmark)

    Oskari Kilpeläinen, Tuomas; Lakka, T A; Laaksonen, D E

    2007-01-01

    . The interaction of the SNPs with the change in PA on the conversion to T2D was assessed using Cox regression with adjustments for the other components of the intervention (dietary changes, weight reduction). The carriers of the common homozygous genotype of rs5393, rs5394, or rs5404 of SLC2A2 and rs3758947...

  11. SLC kicker magnet limitations

    International Nuclear Information System (INIS)

    Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.

    1991-01-01

    The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance

  12. Evaluation of common genetic variants in 82 candidate genes as risk factors for neural tube defects

    LENUS (Irish Health Repository)

    Pangilinan, Faith

    2012-08-02

    AbstractBackgroundNeural tube defects (NTDs) are common birth defects (~1 in 1000 pregnancies in the US and Europe) that have complex origins, including environmental and genetic factors. A low level of maternal folate is one well-established risk factor, with maternal periconceptional folic acid supplementation reducing the occurrence of NTD pregnancies by 50-70%. Gene variants in the folate metabolic pathway (e.g., MTHFR rs1801133 (677 C > T) and MTHFD1 rs2236225 (R653Q)) have been found to increase NTD risk. We hypothesized that variants in additional folate\\/B12 pathway genes contribute to NTD risk.MethodsA tagSNP approach was used to screen common variation in 82 candidate genes selected from the folate\\/B12 pathway and NTD mouse models. We initially genotyped polymorphisms in 320 Irish triads (NTD cases and their parents), including 301 cases and 341 Irish controls to perform case–control and family based association tests. Significantly associated polymorphisms were genotyped in a secondary set of 250 families that included 229 cases and 658 controls. The combined results for 1441 SNPs were used in a joint analysis to test for case and maternal effects.ResultsNearly 70 SNPs in 30 genes were found to be associated with NTDs at the p < 0.01 level. The ten strongest association signals (p-value range: 0.0003–0.0023) were found in nine genes (MFTC, CDKN2A, ADA, PEMT, CUBN, GART, DNMT3A, MTHFD1 and T (Brachyury)) and included the known NTD risk factor MTHFD1 R653Q (rs2236225). The single strongest signal was observed in a new candidate, MFTC rs17803441 (OR = 1.61 [1.23-2.08], p = 0.0003 for the minor allele). Though nominally significant, these associations did not remain significant after correction for multiple hypothesis testing.ConclusionsTo our knowledge, with respect to sample size and scope of evaluation of candidate polymorphisms, this is the largest NTD genetic association study reported to date. The scale of the study and the

  13. Pathogenic substitution of IVS15 + 5G > A in SLC26A4 in patients of Okinawa Islands with enlarged vestibular aqueduct syndrome or Pendred syndrome.

    Science.gov (United States)

    Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio

    2013-05-24

    Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed

  14. Filling Landsat ETM+ SLC-off gaps using a segmentation model approach

    Science.gov (United States)

    Maxwell, Susan

    2004-01-01

    The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.

  15. Whole genome sequencing reveals a novel deletion variant in the KIT gene in horses with white spotted coat colour phenotypes.

    Science.gov (United States)

    Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T

    2017-08-01

    White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.

  16. Common Gene Variants Account for Most Genetic Risk for Autism

    Science.gov (United States)

    ... gene variants account for most genetic risk for autism Roles of heritability, mutations, environment estimated – NIH-funded study. The bulk of risk, or liability, for autism spectrum disorders (ASD) was traced to inherited variations ...

  17. Molecular diagnosis of patients with epilepsy and developmental delay using a customized panel of epilepsy genes.

    Directory of Open Access Journals (Sweden)

    Laura Ortega-Moreno

    Full Text Available Pediatric epilepsies are a group of disorders with a broad phenotypic spectrum that are associated with great genetic heterogeneity, thus making sequential single-gene testing an impractical basis for diagnostic strategy. The advent of next-generation sequencing has increased the success rate of epilepsy diagnosis, and targeted resequencing using genetic panels is the a most cost-effective choice. We report the results found in a group of 87 patients with epilepsy and developmental delay using targeted next generation sequencing (custom-designed Haloplex panel. Using this gene panel, we were able to identify disease-causing variants in 17 out of 87 (19.5% analyzed patients, all found in known epilepsy-associated genes (KCNQ2, CDKL5, STXBP1, SCN1A, PCDH19, POLG, SLC2A1, ARX, ALG13, CHD2, SYNGAP1, and GRIN1. Twelve of 18 variants arose de novo and 6 were novel. The highest yield was found in patients with onset in the first years of life, especially in patients classified as having early-onset epileptic encephalopathy. Knowledge of the underlying genetic cause provides essential information on prognosis and could be used to avoid unnecessary studies, which may result in a greater diagnostic cost-effectiveness.

  18. Common variants in mendelian kidney disease genes and their association with renal function

    NARCIS (Netherlands)

    A. Parsa (Afshin); C. Fuchsberger (Christian); A. Köttgen (Anna); C.M. O'Seaghdha (Conall); C. Pattaro (Cristian); M. de Andrade (Mariza); D.I. Chasman (Daniel); A. Teumer (Alexander); K. Endlich (Karlhans); M. Olden (Matthias); M-H. Chen (Ming-Huei); A. Tin (Adrienne); Y-J. Kim (Yong-Jin); D. Taliun (Daniel); M. Li (Man); M.F. Feitosa (Mary Furlan); M. Gorski (Mathias); Q. Yang (Qiong); C. Hundertmark (Claudia); M.C. Foster (Michael); N. Glazer (Nicole); A.J. Isaacs (Aaron); M. Rao (Madhumathi); G.D. Smith; J.R. O´Connell; M.V. Struchalin (Maksim); T. Tanaka (Toshiko); G. Li (Guo); S.J. Hwang; E.J. Atkinson (Elizabeth); K. Lohman (Kurt); M. Cornelis (Marilyn); A. Johansson (Åsa); A. Tönjes (Anke); A. Dehghan (Abbas); V. Couraki (Vincent); E.G. Holliday (Elizabeth); R. Sorice; Z. Kutalik (Zoltán); T. Lehtimäki (Terho); T. Esko (Tõnu); H. Deshmukh (Harshal); S. Ulivi (Shelia); A.Y. Chu (Audrey); D. Murgia (Daniela); S. Trompet (Stella); M. Imboden (Medea); B. Kollerits (Barbara); G. Pistis (Giorgio); T.B. Harris (Tamara); L.J. Launer (Lenore); T. Aspelund (Thor); G. Eiriksdottir (Gudny); B.D. Mitchell (Braxton); E.A. Boerwinkle (Eric); H. Schmidt (Helena); E. Hofer (Edith); F.B. Hu (Frank); A. Demirkan (Ayşe); B.A. Oostra (Ben); S.T. Turner (Stephen); J. Ding (Jingzhong); J.S. Andrews (Jeanette); B.I. Freedman (Barry); F. Giulianini (Franco); W. Koenig (Wolfgang); T. Illig (Thomas); A. Döring (Angela); H.E. Wichmann (Heinz Erich); L. Zgaga (Lina); T. Zemunik (Tatijana); M. Boban (Mladen); C. Minelli (Cosetta); H.E. Wheeler (Heather); W. Igl (Wilmar); G. Zaboli (Ghazal); S.H. Wild (Sarah); A.F. Wright (Alan); H. Campbell (Harry); D. Ellinghaus (David); U. Nöthlings (Ute); G. Jacobs (Gunnar); R. Biffar (Reiner); F.D.J. Ernst (Florian); G. Homuth (Georg); H.K. Kroemer (Heyo); M. Nauck (Matthias); S. Stracke (Sylvia); U. Vol̈ker (Uwe); H. Völzke (Henry); P. Kovacs (Peter); M. Stumvoll (Michael); R. Mägi (Reedik); A. Hofman (Albert); A.G. Uitterlinden (André); F. Rivadeneira Ramirez (Fernando); Y.S. Aulchenko (Yurii); O. Polasek (Ozren); N. Hastie (Nick); V. Vitart (Veronique); C. Helmer (Catherine); J.J. Wang (Jie Jin); B. Stengel (Bernd); D. Ruggiero; S.M. Bergmann (Sven); M. Kähönen (Mika); J. Viikari (Jorma); T. Nikopensius (Tiit); M.A. Province (Mike); H.M. Colhoun (H.); A.S.F. Doney (Alex); A. Robino (Antonietta); B.K. Krämer (Bernhard); L. Portas (Laura); I. Ford (Ian); B.M. Buckley (Brendan M.); M. Adam (Martin); G.-A. Thun (Gian-Andri); B. Paulweber (Bernhard); M. Haun (Margot); C. Sala (Cinzia); P. Mitchell (Paul); M. Ciullo; P. Vollenweider (Peter); O. Raitakari (Olli); A. Metspalu (Andres); C.N.A. Palmer (Colin); P. Gasparini (Paolo); M. Pirastu (Mario); J.W. Jukema (Jan Wouter); N.M. Probst-Hensch (Nicole M.); F. Kronenberg (Florian); D. Toniolo (Daniela); V. Gudnason (Vilmundur); A.R. Shuldiner (Alan); J. Coresh (Josef); R. Schmidt (Reinhold); L. Ferrucci (Luigi); C.M. van Duijn (Cornelia); I.B. Borecki (Ingrid); S.L.R. Kardia (Sharon); Y. Liu (YongMei); G.C. Curhan (Gary); I. Rudan (Igor); U. Gyllensten (Ulf); J.F. Wilson (James); A. Franke (Andre); P.P. Pramstaller (Peter Paul); R. Rettig (Rainer); I. Prokopenko (Inga); J.C.M. Witteman (Jacqueline); C. Hayward (Caroline); P.M. Ridker (Paul); M. Bochud (Murielle); I.M. Heid (Iris); D.S. Siscovick (David); C.S. Fox (Caroline); W.H.L. Kao (Wen); C.A. Böger (Carsten)

    2013-01-01

    textabstractMany common genetic variants identified by genome-wide association studies for complex traitsmap to genes previously linked to rare inherited Mendelian disorders. A systematic analysis of common single-nucleotide polymorphisms (SNPs) in genes responsible for Mendelian diseases with

  19. Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.

    Directory of Open Access Journals (Sweden)

    Alyaa M Abdel-Haleem

    Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.

  20. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.