WorldWideScience

Sample records for gene transfer events

  1. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  2. In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing.

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J; Nauta, Arjen

    2009-06-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.

  3. In Silico Prediction of Horizontal Gene Transfer Events in Lactobacillus bulgaricus and Streptococcus thermophilus Reveals Protocooperation in Yogurt Manufacturing▿ †

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen

    2009-01-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564

  4. Identification of horizontally transferred genes in the genus Colletotrichum reveals a steady tempo of bacterial to fungal gene transfer.

    Science.gov (United States)

    Jaramillo, Vinicio D Armijos; Sukno, Serenella A; Thon, Michael R

    2015-01-02

    Horizontal gene transfer (HGT) is the stable transmission of genetic material between organisms by means other than vertical inheritance. HGT has an important role in the evolution of prokaryotes but is relatively rare in eukaryotes. HGT has been shown to contribute to virulence in eukaryotic pathogens. We studied the importance of HGT in plant pathogenic fungi by identifying horizontally transferred genes in the genomes of three members of the genus Colletotrichum. We identified eleven HGT events from bacteria into members of the genus Colletotrichum or their ancestors. The HGT events include genes involved in amino acid, lipid and sugar metabolism as well as lytic enzymes. Additionally, the putative minimal dates of transference were calculated using a time calibrated phylogenetic tree. This analysis reveals a constant flux of genes from bacteria to fungi throughout the evolution of subphylum Pezizomycotina. Genes that are typically transferred by HGT are those that are constantly subject to gene duplication and gene loss. The functions of some of these genes suggest roles in niche adaptation and virulence. We found no evidence of a burst of HGT events coinciding with major geological events. In contrast, HGT appears to be a constant, albeit rare phenomenon in the Pezizomycotina, occurring at a steady rate during their evolution.

  5. Horizontal gene transfer in an acid mine drainage microbial community.

    Science.gov (United States)

    Guo, Jiangtao; Wang, Qi; Wang, Xiaoqi; Wang, Fumeng; Yao, Jinxian; Zhu, Huaiqiu

    2015-07-04

    Horizontal gene transfer (HGT) has been widely identified in complete prokaryotic genomes. However, the roles of HGT among members of a microbial community and in evolution remain largely unknown. With the emergence of metagenomics, it is nontrivial to investigate such horizontal flow of genetic materials among members in a microbial community from the natural environment. Because of the lack of suitable methods for metagenomics gene transfer detection, microorganisms from a low-complexity community acid mine drainage (AMD) with near-complete genomes were used to detect possible gene transfer events and suggest the biological significance. Using the annotation of coding regions by the current tools, a phylogenetic approach, and an approximately unbiased test, we found that HGTs in AMD organisms are not rare, and we predicted 119 putative transferred genes. Among them, 14 HGT events were determined to be transfer events among the AMD members. Further analysis of the 14 transferred genes revealed that the HGT events affected the functional evolution of archaea or bacteria in AMD, and it probably shaped the community structure, such as the dominance of G-plasma in archaea in AMD through HGT. Our study provides a novel insight into HGT events among microorganisms in natural communities. The interconnectedness between HGT and community evolution is essential to understand microbial community formation and development.

  6. A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired genes

    Science.gov (United States)

    2014-01-01

    Background Lateral Gene Transfer (LGT) has recently gained recognition as an important contributor to some eukaryote proteomes, but the mechanisms of acquisition and fixation in eukaryotic genomes are still uncertain. A previously defined norm for LGTs in microbial eukaryotes states that the majority are genes involved in metabolism, the LGTs are typically localized one by one, surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial lineages have contributed to the transferome. Results A unique 34 kbp long fragment with 27 clustered genes (TvLF) of prokaryote origin was identified in the sequenced genome of the protozoan parasite Trichomonas vaginalis. Using a PCR based approach we confirmed the presence of the orthologous fragment in four additional T. vaginalis strains. Detailed sequence analyses unambiguously suggest that TvLF is the result of one single, recent LGT event. The proposed donor is a close relative to the firmicute bacterium Peptoniphilus harei. High nucleotide sequence similarity between T. vaginalis strains, as well as to P. harei, and the absence of homologs in other Trichomonas species, suggests that the transfer event took place after the radiation of the genus Trichomonas. Some genes have undergone pseudogenization and degradation, indicating that they may not be retained in the future. Functional annotations reveal that genes involved in informational processes are particularly prone to degradation. Conclusions We conclude that, although the majority of eukaryote LGTs are single gene occurrences, they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. PMID:24898731

  7. Detection of Horizontal Gene Transfers from Phylogenetic Comparisons

    Science.gov (United States)

    Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente

    2012-01-01

    Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653

  8. Horizontal gene transfer in silkworm, Bombyx mori

    Science.gov (United States)

    2011-01-01

    Background The domesticated silkworm, Bombyx mori, is the model insect for the order Lepidoptera, has economically important values, and has gained some representative behavioral characteristics compared to its wild ancestor. The genome of B. mori has been fully sequenced while function analysis of BmChi-h and BmSuc1 genes revealed that horizontal gene transfer (HGT) maybe bestow a clear selective advantage to B. mori. However, the role of HGT in the evolutionary history of B. mori is largely unexplored. In this study, we compare the whole genome of B. mori with those of 382 prokaryotic and eukaryotic species to investigate the potential HGTs. Results Ten candidate HGT events were defined in B. mori by comprehensive sequence analysis using Maximum Likelihood and Bayesian method combining with EST checking. Phylogenetic analysis of the candidate HGT genes suggested that one HGT was plant-to- B. mori transfer while nine were bacteria-to- B. mori transfer. Furthermore, functional analysis based on expression, coexpression and related literature searching revealed that several HGT candidate genes have added important characters, such as resistance to pathogen, to B. mori. Conclusions Results from this study clearly demonstrated that HGTs play an important role in the evolution of B. mori although the number of HGT events in B. mori is in general smaller than those of microbes and other insects. In particular, interdomain HGTs in B. mori may give rise to functional, persistent, and possibly evolutionarily significant new genes. PMID:21595916

  9. Evolution of glutamate dehydrogenase genes: evidence for lateral gene transfer within and between prokaryotes and eukaryotes

    Directory of Open Access Journals (Sweden)

    Roger Andrew J

    2003-06-01

    Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.

  10. Differences in lateral gene transfer in hypersaline versus thermal environments

    Directory of Open Access Journals (Sweden)

    House Christopher H

    2011-07-01

    Full Text Available Abstract Background The role of lateral gene transfer (LGT in the evolution of microorganisms is only beginning to be understood. While most LGT events occur between closely related individuals, inter-phylum and inter-domain LGT events are not uncommon. These distant transfer events offer potentially greater fitness advantages and it is for this reason that these "long distance" LGT events may have significantly impacted the evolution of microbes. One mechanism driving distant LGT events is microbial transformation. Theoretically, transformative events can occur between any two species provided that the DNA of one enters the habitat of the other. Two categories of microorganisms that are well-known for LGT are the thermophiles and halophiles. Results We identified potential inter-class LGT events into both a thermophilic class of Archaea (Thermoprotei and a halophilic class of Archaea (Halobacteria. We then categorized these LGT genes as originating in thermophiles and halophiles respectively. While more than 68% of transfer events into Thermoprotei taxa originated in other thermophiles, less than 11% of transfer events into Halobacteria taxa originated in other halophiles. Conclusions Our results suggest that there is a fundamental difference between LGT in thermophiles and halophiles. We theorize that the difference lies in the different natures of the environments. While DNA degrades rapidly in thermal environments due to temperature-driven denaturization, hypersaline environments are adept at preserving DNA. Furthermore, most hypersaline environments, as topographical minima, are natural collectors of cellular debris. Thus halophiles would in theory be exposed to a greater diversity and quantity of extracellular DNA than thermophiles.

  11. Differences in lateral gene transfer in hypersaline versus thermal environments.

    Science.gov (United States)

    Rhodes, Matthew E; Spear, John R; Oren, Aharon; House, Christopher H

    2011-07-08

    The role of lateral gene transfer (LGT) in the evolution of microorganisms is only beginning to be understood. While most LGT events occur between closely related individuals, inter-phylum and inter-domain LGT events are not uncommon. These distant transfer events offer potentially greater fitness advantages and it is for this reason that these "long distance" LGT events may have significantly impacted the evolution of microbes. One mechanism driving distant LGT events is microbial transformation. Theoretically, transformative events can occur between any two species provided that the DNA of one enters the habitat of the other. Two categories of microorganisms that are well-known for LGT are the thermophiles and halophiles. We identified potential inter-class LGT events into both a thermophilic class of Archaea (Thermoprotei) and a halophilic class of Archaea (Halobacteria). We then categorized these LGT genes as originating in thermophiles and halophiles respectively. While more than 68% of transfer events into Thermoprotei taxa originated in other thermophiles, less than 11% of transfer events into Halobacteria taxa originated in other halophiles. Our results suggest that there is a fundamental difference between LGT in thermophiles and halophiles. We theorize that the difference lies in the different natures of the environments. While DNA degrades rapidly in thermal environments due to temperature-driven denaturization, hypersaline environments are adept at preserving DNA. Furthermore, most hypersaline environments, as topographical minima, are natural collectors of cellular debris. Thus halophiles would in theory be exposed to a greater diversity and quantity of extracellular DNA than thermophiles.

  12. Deduction of probable events of lateral gene transfer through comparison of phylogenetic trees by recursive consolidation and rearrangement

    Directory of Open Access Journals (Sweden)

    Charlebois Robert L

    2005-04-01

    Full Text Available Abstract Background When organismal phylogenies based on sequences of single marker genes are poorly resolved, a logical approach is to add more markers, on the assumption that weak but congruent phylogenetic signal will be reinforced in such multigene trees. Such approaches are valid only when the several markers indeed have identical phylogenies, an issue which many multigene methods (such as the use of concatenated gene sequences or the assembly of supertrees do not directly address. Indeed, even when the true history is a mixture of vertical descent for some genes and lateral gene transfer (LGT for others, such methods produce unique topologies. Results We have developed software that aims to extract evidence for vertical and lateral inheritance from a set of gene trees compared against an arbitrary reference tree. This evidence is then displayed as a synthesis showing support over the tree for vertical inheritance, overlaid with explicit lateral gene transfer (LGT events inferred to have occurred over the history of the tree. Like splits-tree methods, one can thus identify nodes at which conflict occurs. Additionally one can make reasonable inferences about vertical and lateral signal, assigning putative donors and recipients. Conclusion A tool such as ours can serve to explore the reticulated dimensionality of molecular evolution, by dissecting vertical and lateral inheritance at high resolution. By this, we mean that individual nodes can be examined not only for congruence, but also for coherence in light of LGT. We assert that our tools will facilitate the comparison of phylogenetic trees, and the interpretation of conflicting data.

  13. Characterization of an ancient lepidopteran lateral gene transfer.

    Directory of Open Access Journals (Sweden)

    David Wheeler

    Full Text Available Bacteria to eukaryote lateral gene transfers (LGT are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31 from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65-145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea. Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material.

  14. The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool

    Directory of Open Access Journals (Sweden)

    Nan Zhao

    2018-02-01

    Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.

  15. Detecting Horizontal Gene Transfer between Closely Related Taxa.

    Directory of Open Access Journals (Sweden)

    Orit Adato

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT, the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM. Using CRM, the algorithm assigns a confidence score based on "unusual" sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain.

  16. Risks from GMOs due to horizontal gene transfer.

    Science.gov (United States)

    Keese, Paul

    2008-01-01

    Horizontal gene transfer (HGT) is the stable transfer of genetic material from one organism to another without reproduction or human intervention. Transfer occurs by the passage of donor genetic material across cellular boundaries, followed by heritable incorporation to the genome of the recipient organism. In addition to conjugation, transformation and transduction, other diverse mechanisms of DNA and RNA uptake occur in nature. The genome of almost every organism reveals the footprint of many ancient HGT events. Most commonly, HGT involves the transmission of genes on viruses or mobile genetic elements. HGT first became an issue of public concern in the 1970s through the natural spread of antibiotic resistance genes amongst pathogenic bacteria, and more recently with commercial production of genetically modified (GM) crops. However, the frequency of HGT from plants to other eukaryotes or prokaryotes is extremely low. The frequency of HGT to viruses is potentially greater, but is restricted by stringent selection pressures. In most cases the occurrence of HGT from GM crops to other organisms is expected to be lower than background rates. Therefore, HGT from GM plants poses negligible risks to human health or the environment.

  17. Radiopharmaceuticals to monitor gene transfer

    International Nuclear Information System (INIS)

    Wiebe, L. I.; Morin, K. W.; Knaus, E. E.

    1997-01-01

    Advances in genetic engineering and molecular biology have opened the door to disease treatment by transferring genes to cells that are responsible for the pathological condition being addressed. These genes can serve to supplement or introduce the function of indigenous genes that are either inadequately expressed or that are congenitally absent in the patient. They can introduce new functions such as drug sensitization to provide a unique therapeutic target. Gene transfer is readily monitored in vitro using a range of histochemical and biochemical tests that are ''built in'' to the therapeutic gene cassette. In vivo, in situ monitoring of the gene transfer and gene expression processes can be achieved with these tests only if biopsy is possible. Scintigraphic imaging can offer unique information on both the extent and location of gene expression, provided that an appropriate reporter gene is included in the therapeutic cassette. This overview includes a brief orientation to gene transfer therapy and is followed by a review of current approaches to gene therapy imaging. The concluding section deals with imaging based on radiolabelled nucleoside substrates for herpes simplex type-1 thymidine kinase, with emphasis on IVFRU, a stable potent and selective HSV-1 TK substrate developed in their laboratories

  18. Evidence of recent interkingdom horizontal gene transfer between bacteria and Candida parapsilosis

    Directory of Open Access Journals (Sweden)

    Butler Geraldine

    2008-06-01

    Full Text Available Abstract Background To date very few incidences of interdomain gene transfer into fungi have been identified. Here, we used the emerging genome sequences of Candida albicans WO-1, Candida tropicalis, Candida parapsilosis, Clavispora lusitaniae, Pichia guilliermondii, and Lodderomyces elongisporus to identify recent interdomain HGT events. We refer to these as CTG species because they translate the CTG codon as serine rather than leucine, and share a recent common ancestor. Results Phylogenetic and syntenic information infer that two C. parapsilosis genes originate from bacterial sources. One encodes a putative proline racemase (PR. Phylogenetic analysis also infers that there were independent transfers of bacterial PR enzymes into members of the Pezizomycotina, and protists. The second HGT gene in C. parapsilosis belongs to the phenazine F (PhzF superfamily. Most CTG species also contain a fungal PhzF homolog. Our phylogeny suggests that the CTG homolog originated from an ancient HGT event, from a member of the proteobacteria. An analysis of synteny suggests that C. parapsilosis has lost the endogenous fungal form of PhzF, and subsequently reacquired it from a proteobacterial source. There is evidence that Schizosaccharomyces pombe and Basidiomycotina also obtained a PhzF homolog through HGT. Conclusion Our search revealed two instances of well-supported HGT from bacteria into the CTG clade, both specific to C. parapsilosis. Therefore, while recent interkingdom gene transfer has taken place in the CTG lineage, its occurrence is rare. However, our analysis will not detect ancient gene transfers, and we may have underestimated the global extent of HGT into CTG species.

  19. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  20. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  1. Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.

    Directory of Open Access Journals (Sweden)

    Imke Schmitt

    Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.

  2. Translating gene transfer: a stalled effort.

    Science.gov (United States)

    Greenberg, Alexandra J; McCormick, Jennifer; Tapia, Carmen J; Windebank, Anthony J

    2011-08-01

    The journey of gene transfer from laboratory to clinic has been slow and fraught with many challenges and barriers. Despite the development of the initial technology in the early 1970s, a standard clinical treatment involving "gene therapy" remains to be seen. Furthermore, much was written about the technology in the early 1990s, but since then, not much has been written about the journey of gene transfer. The translational path of gene transfer thus far, both pitfalls and successes, can serve as a study not only in navigating ethical and safety concerns, but also in the importance of scientist-public interactions. Here, we examine the translational progress of gene transfer and what can be gleaned from its history. © 2011 Wiley Periodicals, Inc.

  3. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A.

    Science.gov (United States)

    Rangarajan, Savita; Walsh, Liron; Lester, Will; Perry, David; Madan, Bella; Laffan, Michael; Yu, Hua; Vettermann, Christian; Pierce, Glenn F; Wong, Wing Y; Pasi, K John

    2017-12-28

    Patients with hemophilia A rely on exogenous factor VIII to prevent bleeding in joints, soft tissue, and the central nervous system. Although successful gene transfer has been reported in patients with hemophilia B, the large size of the factor VIII coding region has precluded improved outcomes with gene therapy in patients with hemophilia A. We infused a single intravenous dose of a codon-optimized adeno-associated virus serotype 5 (AAV5) vector encoding a B-domain-deleted human factor VIII (AAV5-hFVIII-SQ) in nine men with severe hemophilia A. Participants were enrolled sequentially into one of three dose cohorts (low dose [one participant], intermediate dose [one participant], and high dose [seven participants]) and were followed through 52 weeks. Factor VIII activity levels remained at 3 IU or less per deciliter in the recipients of the low or intermediate dose. In the high-dose cohort, the factor VIII activity level was more than 5 IU per deciliter between weeks 2 and 9 after gene transfer in all seven participants, and the level in six participants increased to a normal value (>50 IU per deciliter) that was maintained at 1 year after receipt of the dose. In the high-dose cohort, the median annualized bleeding rate among participants who had previously received prophylactic therapy decreased from 16 events before the study to 1 event after gene transfer, and factor VIII use for participant-reported bleeding ceased in all the participants in this cohort by week 22. The primary adverse event was an elevation in the serum alanine aminotransferase level to 1.5 times the upper limit of the normal range or less. Progression of preexisting chronic arthropathy in one participant was the only serious adverse event. No neutralizing antibodies to factor VIII were detected. The infusion of AAV5-hFVIII-SQ was associated with the sustained normalization of factor VIII activity level over a period of 1 year in six of seven participants who received a high dose, with

  4. Translating Gene Transfer: A Stalled Effort

    OpenAIRE

    Greenberg, Alexandra J.; McCormick, Jennifer; Tapia, Carmen J.; Windebank, Anthony J.

    2011-01-01

    The journey of gene transfer from laboratory to clinic has been slow and fraught with many challenges and barriers. Despite the development of the initial technology in the early 1970s, a standard clinical treatment involving “gene therapy” remains to be seen. Furthermore, much was written about the technology in the early 1990s, but since then, not much has been written about the journey of gene transfer. The translational path of gene transfer thus far, both pitfalls and successes, can serv...

  5. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  6. A reconstruction problem for a class of phylogenetic networks with lateral gene transfers.

    Science.gov (United States)

    Cardona, Gabriel; Pons, Joan Carles; Rosselló, Francesc

    2015-01-01

    Lateral, or Horizontal, Gene Transfers are a type of asymmetric evolutionary events where genetic material is transferred from one species to another. In this paper we consider LGT networks, a general model of phylogenetic networks with lateral gene transfers which consist, roughly, of a principal rooted tree with its leaves labelled on a set of taxa, and a set of extra secondary arcs between nodes in this tree representing lateral gene transfers. An LGT network gives rise in a natural way to a principal phylogenetic subtree and a set of secondary phylogenetic subtrees, which, roughly, represent, respectively, the main line of evolution of most genes and the secondary lines of evolution through lateral gene transfers. We introduce a set of simple conditions on an LGT network that guarantee that its principal and secondary phylogenetic subtrees are pairwise different and that these subtrees determine, up to isomorphism, the LGT network. We then give an algorithm that, given a set of pairwise different phylogenetic trees [Formula: see text] on the same set of taxa, outputs, when it exists, the LGT network that satisfies these conditions and such that its principal phylogenetic tree is [Formula: see text] and its secondary phylogenetic trees are [Formula: see text].

  7. Beyond Agrobacterium-Mediated Transformation: Horizontal Gene Transfer from Bacteria to Eukaryotes.

    Science.gov (United States)

    Lacroix, Benoît; Citovsky, Vitaly

    2018-03-03

    Besides the massive gene transfer from organelles to the nuclear genomes, which occurred during the early evolution of eukaryote lineages, the importance of horizontal gene transfer (HGT) in eukaryotes remains controversial. Yet, increasing amounts of genomic data reveal many cases of bacterium-to-eukaryote HGT that likely represent a significant force in adaptive evolution of eukaryotic species. However, DNA transfer involved in genetic transformation of plants by Agrobacterium species has traditionally been considered as the unique example of natural DNA transfer and integration into eukaryotic genomes. Recent discoveries indicate that the repertoire of donor bacterial species and of recipient eukaryotic hosts potentially are much wider than previously thought, including donor bacterial species, such as plant symbiotic nitrogen-fixing bacteria (e.g., Rhizobium etli) and animal bacterial pathogens (e.g., Bartonella henselae, Helicobacter pylori), and recipient species from virtually all eukaryotic clades. Here, we review the molecular pathways and potential mechanisms of these trans-kingdom HGT events and discuss their utilization in biotechnology and research.

  8. The standard lateral gene transfer model is statistically consistent for pectinate four-taxon trees

    DEFF Research Database (Denmark)

    Sand, Andreas; Steel, Mike

    2013-01-01

    Evolutionary events such as incomplete lineage sorting and lateral gene transfers constitute major problems for inferring species trees from gene trees, as they can sometimes lead to gene trees which conflict with the underlying species tree. One particularly simple and efficient way to infer...... species trees from gene trees under such conditions is to combine three-taxon analyses for several genes using a majority vote approach. For incomplete lineage sorting this method is known to be statistically consistent; however, for lateral gene transfers it was recently shown that a zone...... of inconsistency exists for a specific four-taxon tree topology, and it was posed as an open question whether inconsistencies could exist for other four-taxon tree topologies? In this letter we analyze all remaining four-taxon topologies and show that no other inconsistencies exist....

  9. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  10. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Science.gov (United States)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523

  11. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes.

    Science.gov (United States)

    Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van

    2017-10-23

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  12. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Directory of Open Access Journals (Sweden)

    Etienne G.J. Danchin

    2017-10-01

    Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  13. Recombination and horizontal transfer of nodulation and ACC deaminase (acdS) genes within Alpha- and Betaproteobacteria nodulating legumes of the Cape Fynbos biome.

    Science.gov (United States)

    Lemaire, Benny; Van Cauwenberghe, Jannick; Chimphango, Samson; Stirton, Charles; Honnay, Olivier; Smets, Erik; Muasya, A Muthama

    2015-11-01

    The goal of this work is to study the evolution and the degree of horizontal gene transfer (HGT) within rhizobial genera of both Alphaproteobacteria (Mesorhizobium, Rhizobium) and Betaproteobacteria (Burkholderia), originating from South African Fynbos legumes. By using a phylogenetic approach and comparing multiple chromosomal and symbiosis genes, we revealed conclusive evidence of high degrees of horizontal transfer of nodulation genes among closely related species of both groups of rhizobia, but also among species with distant genetic backgrounds (Rhizobium and Mesorhizobium), underscoring the importance of lateral transfer of symbiosis traits as an important evolutionary force among rhizobia of the Cape Fynbos biome. The extensive exchange of symbiosis genes in the Fynbos is in contrast with a lack of significant events of HGT among Burkholderia symbionts from the South American Cerrado and Caatinga biome. Furthermore, homologous recombination among selected housekeeping genes had a substantial impact on sequence evolution within Burkholderia and Mesorhizobium. Finally, phylogenetic analyses of the non-symbiosis acdS gene in Mesorhizobium, a gene often located on symbiosis islands, revealed distinct relationships compared to the chromosomal and symbiosis genes, suggesting a different evolutionary history and independent events of gene transfer. The observed events of HGT and incongruence between different genes necessitate caution in interpreting topologies from individual data types. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Widespread of horizontal gene transfer in the human genome.

    Science.gov (United States)

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-04-04

    A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. From the pair-wise alignments between human genome and 53 vertebrate genomes, 1,467 human genome regions (2.6 M bases) from all chromosomes were found to be more conserved with non-mammals than with most mammals. These human genome regions involve 642 known genes, which are enriched with ion binding. Compared to known horizontal gene transfer regions in the human genome, there were few overlapping regions, which indicated horizontal gene transfer is more common than we expected in the human genome. Horizontal gene transfer impacts hundreds of human genes and this study provided insight into potential mechanisms of HGT in the human genome.

  15. Gene transfer therapy in vascular diseases.

    Science.gov (United States)

    McKay, M J; Gaballa, M A

    2001-01-01

    Somatic gene therapy of vascular diseases is a promising new field in modern medicine. Recent advancements in gene transfer technology have greatly evolved our understanding of the pathophysiologic role of candidate disease genes. With this knowledge, the expression of selective gene products provides the means to test the therapeutic use of gene therapy in a multitude of medical conditions. In addition, with the completion of genome sequencing programs, gene transfer can be used also to study the biologic function of novel genes in vivo. Novel genes are delivered to targeted tissue via several different vehicles. These vectors include adenoviruses, retroviruses, plasmids, plasmid/liposomes, and oligonucleotides. However, each one of these vectors has inherent limitations. Further investigations into developing delivery systems that not only allow for efficient, targeted gene transfer, but also are stable and nonimmunogenic, will optimize the clinical application of gene therapy in vascular diseases. This review further discusses the available mode of gene delivery and examines six major areas in vascular gene therapy, namely prevention of restenosis, thrombosis, hypertension, atherosclerosis, peripheral vascular disease in congestive heart failure, and ischemia. Although we highlight some of the recent advances in the use of gene therapy in treating vascular disease discovered primarily during the past two years, many excellent studies published during that period are not included in this review due to space limitations. The following is a selective review of practical uses of gene transfer therapy in vascular diseases. This review primarily covers work performed in the last 2 years. For earlier work, the reader may refer to several excellent review articles. For instance, Belalcazer et al. (6) reviewed general aspects of somatic gene therapy and the different vehicles used for the delivery of therapeutic genes. Gene therapy in restenosis and stimulation of

  16. Widespread of horizontal gene transfer in the human genome

    OpenAIRE

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-01-01

    Background A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. Results From the pa...

  17. Genomic Evidence of Chemotrophic Metabolisms in Deep-Dwelling Chloroflexi Conferred by Ancient Horizontal Gene Transfer Events

    Science.gov (United States)

    Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.

    2017-12-01

    The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates

  18. Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi.

    Science.gov (United States)

    Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J

    2009-07-01

    Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.

  19. Two Horizontally Transferred Xenobiotic Resistance Gene Clusters Associated with Detoxification of Benzoxazolinones by Fusarium Species

    Science.gov (United States)

    Glenn, Anthony E.; Davis, C. Britton; Gao, Minglu; Gold, Scott E.; Mitchell, Trevor R.; Proctor, Robert H.; Stewart, Jane E.; Snook, Maurice E.

    2016-01-01

    Microbes encounter a broad spectrum of antimicrobial compounds in their environments and often possess metabolic strategies to detoxify such xenobiotics. We have previously shown that Fusarium verticillioides, a fungal pathogen of maize known for its production of fumonisin mycotoxins, possesses two unlinked loci, FDB1 and FDB2, necessary for detoxification of antimicrobial compounds produced by maize, including the γ-lactam 2-benzoxazolinone (BOA). In support of these earlier studies, microarray analysis of F. verticillioides exposed to BOA identified the induction of multiple genes at FDB1 and FDB2, indicating the loci consist of gene clusters. One of the FDB1 cluster genes encoded a protein having domain homology to the metallo-β-lactamase (MBL) superfamily. Deletion of this gene (MBL1) rendered F. verticillioides incapable of metabolizing BOA and thus unable to grow on BOA-amended media. Deletion of other FDB1 cluster genes, in particular AMD1 and DLH1, did not affect BOA degradation. Phylogenetic analyses and topology testing of the FDB1 and FDB2 cluster genes suggested two horizontal transfer events among fungi, one being transfer of FDB1 from Fusarium to Colletotrichum, and the second being transfer of the FDB2 cluster from Fusarium to Aspergillus. Together, the results suggest that plant-derived xenobiotics have exerted evolutionary pressure on these fungi, leading to horizontal transfer of genes that enhance fitness or virulence. PMID:26808652

  20. The chromosomal organization of horizontal gene transfer in bacteria.

    Science.gov (United States)

    Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C

    2017-10-10

    Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising  ~ 1% of the chromosomal regions in 80 bacterial species.

  1. Detection of horizontal transfer of individual genes by anomalous oligomer frequencies

    Directory of Open Access Journals (Sweden)

    Elhai Jeff

    2012-06-01

    Full Text Available Abstract Background Understanding the history of life requires that we understand the transfer of genetic material across phylogenetic boundaries. Detecting genes that were acquired by means other than vertical descent is a basic step in that process. Detection by discordant phylogenies is computationally expensive and not always definitive. Many have used easily computed compositional features as an alternative procedure. However, different compositional methods produce different predictions, and the effectiveness of any method is not well established. Results The ability of octamer frequency comparisons to detect genes artificially seeded in cyanobacterial genomes was markedly increased by using as a training set those genes that are highly conserved over all bacteria. Using a subset of octamer frequencies in such tests also increased effectiveness, but this depended on the specific target genome and the source of the contaminating genes. The presence of high frequency octamers and the GC content of the contaminating genes were important considerations. A method comprising best practices from these tests was devised, the Core Gene Similarity (CGS method, and it performed better than simple octamer frequency analysis, codon bias, or GC contrasts in detecting seeded genes or naturally occurring transposons. From a comparison of predictions with phylogenetic trees, it appears that the effectiveness of the method is confined to horizontal transfer events that have occurred recently in evolutionary time. Conclusions The CGS method may be an improvement over existing surrogate methods to detect genes of foreign origin.

  2. Horizontal gene transfer between bacteria.

    Science.gov (United States)

    Heuer, Holger; Smalla, Kornelia

    2007-01-01

    Horizontal gene transfer (HGT) refers to the acquisition of foreign genes by organisms. The occurrence of HGT among bacteria in the environment is assumed to have implications in the risk assessment of genetically modified bacteria which are released into the environment. First, introduced genetic sequences from a genetically modified bacterium could be transferred to indigenous micro-organisms and alter their genome and subsequently their ecological niche. Second, the genetically modified bacterium released into the environment might capture mobile genetic elements (MGE) from indigenous micro-organisms which could extend its ecological potential. Thus, for a risk assessment it is important to understand the extent of HGT and genome plasticity of bacteria in the environment. This review summarizes the present state of knowledge on HGT between bacteria as a crucial mechanism contributing to bacterial adaptability and diversity. In view of the use of GM crops and microbes in agricultural settings, in this mini-review we focus particularly on the presence and role of MGE in soil and plant-associated bacteria and the factors affecting gene transfer.

  3. Horizontal gene transfer in chromalveolates

    Directory of Open Access Journals (Sweden)

    Bhattacharya Debashish

    2007-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT, the non-genealogical transfer of genetic material between different organisms, is considered a potentially important mechanism of genome evolution in eukaryotes. Using phylogenomic analyses of expressed sequence tag (EST data generated from a clonal cell line of a free living dinoflagellate alga Karenia brevis, we investigated the impact of HGT on genome evolution in unicellular chromalveolate protists. Results We identified 16 proteins that have originated in chromalveolates through ancient HGTs before the divergence of the genera Karenia and Karlodinium and one protein that was derived through a more recent HGT. Detailed analysis of the phylogeny and distribution of identified proteins demonstrates that eight have resulted from independent HGTs in several eukaryotic lineages. Conclusion Recurring intra- and interdomain gene exchange provides an important source of genetic novelty not only in parasitic taxa as previously demonstrated but as we show here, also in free-living protists. Investigating the tempo and mode of evolution of horizontally transferred genes in protists will therefore advance our understanding of mechanisms of adaptation in eukaryotes.

  4. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Science.gov (United States)

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  5. Patterns of prokaryotic lateral gene transfers affecting parasitic microbial eukaryotes

    DEFF Research Database (Denmark)

    Alsmark, Cecilia; Foster, Peter G; Sicheritz-Pontén, Thomas

    2013-01-01

    BACKGROUND: The influence of lateral gene transfer on gene origins and biology in eukaryotes is poorly understood compared with those of prokaryotes. A number of independent investigations focusing on specific genes, individual genomes, or specific functional categories from various eukaryotes have...... approach to systematically investigate lateral gene transfer affecting the proteomes of thirteen, mainly parasitic, microbial eukaryotes, representing four of the six eukaryotic super-groups. All of the genomes investigated have been significantly affected by prokaryote-to-eukaryote lateral gene transfers...... indicated that lateral gene transfer does indeed affect eukaryotic genomes. However, the lack of common methodology and criteria in these studies makes it difficult to assess the general importance and influence of lateral gene transfer on eukaryotic genome evolution. RESULTS: We used a phylogenomic...

  6. Involvement of β-carbonic anhydrase (β-CA) genes in bacterial genomic islands and horizontal transfer to protists.

    Science.gov (United States)

    Zolfaghari Emameh, Reza; Barker, Harlan R; Hytönen, Vesa P; Parkkila, Seppo

    2018-05-25

    Genomic islands (GIs) are a type of mobile genetic element (MGE) that are present in bacterial chromosomes. They consist of a cluster of genes which produce proteins that contribute to a variety of functions, including, but not limited to, regulation of cell metabolism, anti-microbial resistance, pathogenicity, virulence, and resistance to heavy metals. The genes carried in MGEs can be used as a trait reservoir in times of adversity. Transfer of genes using MGEs, occurring outside of reproduction, is called horizontal gene transfer (HGT). Previous literature has shown that numerous HGT events have occurred through endosymbiosis between prokaryotes and eukaryotes.Beta carbonic anhydrase (β-CA) enzymes play a critical role in the biochemical pathways of many prokaryotes and eukaryotes. We have previously suggested horizontal transfer of β-CA genes from plasmids of some prokaryotic endosymbionts to their protozoan hosts. In this study, we set out to identify β-CA genes that might have transferred between prokaryotic and protist species through HGT in GIs. Therefore, we investigated prokaryotic chromosomes containing β-CA-encoding GIs and utilized multiple bioinformatics tools to reveal the distinct movements of β-CA genes among a wide variety of organisms. Our results identify the presence of β-CA genes in GIs of several medically and industrially relevant bacterial species, and phylogenetic analyses reveal multiple cases of likely horizontal transfer of β-CA genes from GIs of ancestral prokaryotes to protists. IMPORTANCE The evolutionary process is mediated by mobile genetic elements (MGEs), such as genomic islands (GIs). A gene or set of genes in the GIs are exchanged between and within various species through horizontal gene transfer (HGT). Based on the crucial role that GIs can play in bacterial survival and proliferation, they were introduced as the environmental- and pathogen-associated factors. Carbonic anhydrases (CAs) are involved in many critical

  7. Pleiotropic functions of magnetic nanoparticles for ex vivo gene transfer.

    Science.gov (United States)

    Kami, Daisuke; Kitani, Tomoya; Kishida, Tsunao; Mazda, Osam; Toyoda, Masashi; Tomitaka, Asahi; Ota, Satoshi; Ishii, Ryuga; Takemura, Yasushi; Watanabe, Masatoshi; Umezawa, Akihiro; Gojo, Satoshi

    2014-08-01

    Gene transfer technique has various applications, ranging from cellular biology to medical treatments for diseases. Although nonviral vectors, such as episomal vectors, have been developed, it is necessary to improve their gene transfer efficacy. Therefore, we attempted to develop a highly efficient gene delivery system combining an episomal vector with magnetic nanoparticles (MNPs). In comparison with the conventional method using transfection reagents, polyethylenimine-coated MNPs introduced episomal vectors more efficiently under a magnetic field and could express the gene in mammalian cells with higher efficiency and for longer periods. This novel in vitro separation method of gene-introduced cells utilizing the magnetic property of MNPs significantly facilitated the separation of cells of interest. Transplanted cells in vivo were detected using magnetic resonance. These results suggest that MNPs play multifunctional roles in ex vivo gene transfer, such as improvement of gene transfer efficacy, separation of cells, and detection of transplanted cells. This study convincingly demonstrates enhanced efficiency of gene transfer via magnetic nanoparticles. The method also enables magnetic sorting of cells positive for the transferred gene, and in vivo monitoring of the process with MRI. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Transcriptional reprogramming of gene expression in bovine somatic cell chromatin transfer embryos

    Directory of Open Access Journals (Sweden)

    Page Grier P

    2009-04-01

    Full Text Available Abstract Background Successful reprogramming of a somatic genome to produce a healthy clone by somatic cells nuclear transfer (SCNT is a rare event and the mechanisms involved in this process are poorly defined. When serial or successive rounds of cloning are performed, blastocyst and full term development rates decline even further with the increasing rounds of cloning. Identifying the "cumulative errors" could reveal the epigenetic reprogramming blocks in animal cloning. Results Bovine clones from up to four generations of successive cloning were produced by chromatin transfer (CT. Using Affymetrix bovine microarrays we determined that the transcriptomes of blastocysts derived from the first and the fourth rounds of cloning (CT1 and CT4 respectively have undergone an extensive reprogramming and were more similar to blastocysts derived from in vitro fertilization (IVF than to the donor cells used for the first and the fourth rounds of chromatin transfer (DC1 and DC4 respectively. However a set of transcripts in the cloned embryos showed a misregulated pattern when compared to IVF embryos. Among the genes consistently upregulated in both CT groups compared to the IVF embryos were genes involved in regulation of cytoskeleton and cell shape. Among the genes consistently upregulated in IVF embryos compared to both CT groups were genes involved in chromatin remodelling and stress coping. Conclusion The present study provides a data set that could contribute in our understanding of epigenetic errors in somatic cell chromatin transfer. Identifying "cumulative errors" after serial cloning could reveal some of the epigenetic reprogramming blocks shedding light on the reprogramming process, important for both basic and applied research.

  9. Effect of the environment on horizontal gene transfer between bacteria and archaea.

    Science.gov (United States)

    Fuchsman, Clara A; Collins, Roy Eric; Rocap, Gabrielle; Brazelton, William J

    2017-01-01

    Horizontal gene transfer, the transfer and incorporation of genetic material between different species of organisms, has an important but poorly quantified role in the adaptation of microbes to their environment. Previous work has shown that genome size and the number of horizontally transferred genes are strongly correlated. Here we consider how genome size confuses the quantification of horizontal gene transfer because the number of genes an organism accumulates over time depends on its evolutionary history and ecological context (e.g., the nutrient regime for which it is adapted). We investigated horizontal gene transfer between archaea and bacteria by first counting reciprocal BLAST hits among 448 bacterial and 57 archaeal genomes to find shared genes. Then we used the DarkHorse algorithm, a probability-based, lineage-weighted method (Podell & Gaasterland, 2007), to identify potential horizontally transferred genes among these shared genes. By removing the effect of genome size in the bacteria, we have identified bacteria with unusually large numbers of shared genes with archaea for their genome size. Interestingly, archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share unusually large numbers of genes. However, high salt was not found to significantly affect the numbers of shared genes. Numbers of shared (genome size-corrected, reciprocal BLAST hits) and transferred genes (identified by DarkHorse) were strongly correlated. Thus archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share horizontally transferred genes. These horizontally transferred genes are over-represented by genes involved in energy conversion as well as the transport and metabolism of inorganic ions and amino acids. Anaerobic and thermophilic bacteria share unusually large numbers of genes with archaea. This is mainly due to horizontal gene transfer of genes from the archaea to the bacteria. In

  10. Effect of the environment on horizontal gene transfer between bacteria and archaea

    Directory of Open Access Journals (Sweden)

    Clara A. Fuchsman

    2017-09-01

    Full Text Available Background Horizontal gene transfer, the transfer and incorporation of genetic material between different species of organisms, has an important but poorly quantified role in the adaptation of microbes to their environment. Previous work has shown that genome size and the number of horizontally transferred genes are strongly correlated. Here we consider how genome size confuses the quantification of horizontal gene transfer because the number of genes an organism accumulates over time depends on its evolutionary history and ecological context (e.g., the nutrient regime for which it is adapted. Results We investigated horizontal gene transfer between archaea and bacteria by first counting reciprocal BLAST hits among 448 bacterial and 57 archaeal genomes to find shared genes. Then we used the DarkHorse algorithm, a probability-based, lineage-weighted method (Podell & Gaasterland, 2007, to identify potential horizontally transferred genes among these shared genes. By removing the effect of genome size in the bacteria, we have identified bacteria with unusually large numbers of shared genes with archaea for their genome size. Interestingly, archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share unusually large numbers of genes. However, high salt was not found to significantly affect the numbers of shared genes. Numbers of shared (genome size-corrected, reciprocal BLAST hits and transferred genes (identified by DarkHorse were strongly correlated. Thus archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share horizontally transferred genes. These horizontally transferred genes are over-represented by genes involved in energy conversion as well as the transport and metabolism of inorganic ions and amino acids. Conclusions Anaerobic and thermophilic bacteria share unusually large numbers of genes with archaea. This is mainly due to horizontal gene transfer of

  11. Family Events and the Timing of Intergenerational Transfers

    Science.gov (United States)

    Leopold, Thomas; Schneider, Thorsten

    2011-01-01

    This research investigates how family events in adult children's lives influence the timing of their parents' financial transfers. We draw on retrospective data collected by the German Socio-Economic Panel Study and use event history models to study the effects of marriage, divorce and childbirth on the receipt of large gifts from parents. We find…

  12. Improvement Method of Gene Transfer in Kappaphycus Alvarezii

    OpenAIRE

    Triana, St. Hidayah; Alimuddin,; Widyastuti, Utut; Suharsono,; Suryati, Emma; Parenrengi, Andi

    2016-01-01

    Method of foreign gene transfer in red seaweed Kappaphycus alvarezii has been reported, however, li-mited number of transgenic F0 (broodstock) was obtained. This study was conducted to improve the method of gene transfer mediated by Agrobacterium tumefaciens in order to obtain high percentage of K. alvarezii transgenic. Superoxide dismutase gene from Melastoma malabatrichum (MmCu/Zn-SOD) was used as model towards increasing adaptability of K. alvarezii to environmental stress. The treat-ment...

  13. Trends and barriers to lateral gene transfer in prokaryotes.

    Science.gov (United States)

    Popa, Ovidiu; Dagan, Tal

    2011-10-01

    Gene acquisition by lateral gene transfer (LGT) is an important mechanism for natural variation among prokaryotes. Laboratory experiments show that protein-coding genes can be laterally transferred extremely fast among microbial cells, inherited to most of their descendants, and adapt to a new regulatory regime within a short time. Recent advance in the phylogenetic analysis of microbial genomes using networks approach reveals a substantial impact of LGT during microbial genome evolution. Phylogenomic networks of LGT among prokaryotes reconstructed from completely sequenced genomes uncover barriers to LGT in multiple levels. Here we discuss the kinds of barriers to gene acquisition in nature including physical barriers for gene transfer between cells, genomic barriers for the integration of acquired DNA, and functional barriers for the acquisition of new genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Gene Transfers Between Distantly Related Organisms

    Science.gov (United States)

    Doolittle, Russell F.

    2003-01-01

    With the completion of numerous microbial genome sequences, reports of individual gene transfers between distantly related prokaryotes have become commonplace. On the other hand, transfers between prokaryotes and eukaryotes still excite the imagination. Many of these claims may be premature, but some are certainly valid. In this chapter, the kinds of supporting data needed to propose transfers between distantly related organisms and cite some interesting examples are considered.

  15. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    Science.gov (United States)

    Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

    2009-01-01

    Australian origin for B. pseudomallei, characterized by a single introduction event into Southeast Asia during a recent glacial period, and variable levels of lateral gene transfer within populations. These patterns provide insights into mechanisms of genetic diversification in B. pseudomallei and its closest relatives, and provide a framework for integrating the traditionally separate fields of population genetics and phylogenetics for other bacterial species with high levels of lateral gene transfer. ?? 2009 Pearson et al; licensee BioMed Central Ltd.

  16. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    Directory of Open Access Journals (Sweden)

    Kaul Rajinder

    2009-11-01

    . Conclusion We describe an Australian origin for B. pseudomallei, characterized by a single introduction event into Southeast Asia during a recent glacial period, and variable levels of lateral gene transfer within populations. These patterns provide insights into mechanisms of genetic diversification in B. pseudomallei and its closest relatives, and provide a framework for integrating the traditionally separate fields of population genetics and phylogenetics for other bacterial species with high levels of lateral gene transfer.

  17. Stem cell collection and gene transfer in Fanconi anemia.

    Science.gov (United States)

    Kelly, Patrick F; Radtke, Susan; von Kalle, Christof; Balcik, Brenden; Bohn, Kimberley; Mueller, Robin; Schuesler, Todd; Haren, Moira; Reeves, Lilith; Cancelas, Jose A; Leemhuis, Thomas; Harris, Richard; Auerbach, Arleen D; Smith, Franklin O; Davies, Stella M; Williams, David A

    2007-01-01

    Fanconi anemia (FA) is a rare genetic syndrome characterized by progressive bone marrow failure (BMF), congenital anomalies, and a predisposition to malignancy. Successful gene transfer into hematopoietic stem cells (HSCs) could reverse BMF in this disease. We developed clinical trials to determine whether a sufficient number of CD34(+) stem cells could be collected for gene modification and to evaluate the safety and efficacy of HSC-corrective gene transfer in FA genotype A (FANCA) patients. Here, we report that FA patients have significant depletion of their BM CD34(+) cell compartment even before severe pancytopenia is present. However, oncoretroviral-mediated ex vivo gene transfer was efficient in clinical scale in FA-A cells, leading to reversal of the cellular phenotype in a significant percentage of CD34(+) cells. Re-infusion of gene-corrected products in two patients was safe and well tolerated and accompanied by transient improvements in hemoglobin and platelet counts. Gene correction was transient, likely owing to the low dose of gene-corrected cells infused. Our early experience shows that stem cell collection is well tolerated in FA patients and suggests that collection be considered as early as possible in patients who are potential candidates for future gene transfer trials.

  18. Horizontal gene transfer between Wolbachia and the mosquito Aedes aegypti

    Directory of Open Access Journals (Sweden)

    Walker Thomas

    2009-01-01

    Full Text Available Abstract Background The evolutionary importance of horizontal gene transfer (HGT from Wolbachia endosymbiotic bacteria to their eukaryotic hosts is a topic of considerable interest and debate. Recent transfers of genome fragments from Wolbachia into insect chromosomes have been reported, but it has been argued that these fragments may be on an evolutionary trajectory to degradation and loss. Results We have discovered a case of HGT, involving two adjacent genes, between the genomes of Wolbachia and the currently Wolbachia-uninfected mosquito Aedes aegypti, an important human disease vector. The lower level of sequence identity between Wolbachia and insect, the transcription of all the genes involved, and the fact that we have identified homologs of the two genes in another Aedes species (Ae. mascarensis, suggest that these genes are being expressed after an extended evolutionary period since horizontal transfer, and therefore that the transfer has functional significance. The association of these genes with Wolbachia prophage regions also provides a mechanism for the transfer. Conclusion The data support the argument that HGT between Wolbachia endosymbiotic bacteria and their hosts has produced evolutionary innovation.

  19. Effects of subtherapeutic concentrations of antimicrobials on gene acquisition events in Yersinia, Proteus, Shigella, and Salmonella recipient organisms in isolated ligated intestinal loops of swine.

    Science.gov (United States)

    Brewer, Matt T; Xiong, Nalee; Anderson, Kristi L; Carlson, Steve A

    2013-08-01

    To assess antimicrobial resistance and transfer of virulence genes facilitated by subtherapeutic concentrations of antimicrobials in swine intestines. 20 anesthetized pigs experimentally inoculated with donor and recipient bacteria. 4 recipient pathogenic bacteria (Salmonella enterica serotype Typhimurium, Yersinia enterocolitica, Shigella flexneri, or Proteus mirabilis) were incubated with donor bacteria in the presence of subinhibitory concentrations of 1 of 16 antimicrobials in isolated ligated intestinal loops in swine. Donor Escherichia coli contained transferrable antimicrobial resistance or virulence genes. After coincubations, intestinal contents were removed and assessed for pathogens that acquired new antimicrobial resistance or virulence genes following exposure to the subtherapeutic concentrations of antimicrobials. 3 antimicrobials (apramycin, lincomycin, and neomycin) enhanced transfer of an antimicrobial resistance plasmid from commensal E coli organisms to Yersinia and Proteus organisms, whereas 7 antimicrobials (florfenicol, hygromycin, penicillin G, roxarsone, sulfamethazine, tetracycline, and tylosin) exacerbated transfer of an integron (Salmonella genomic island 1) from Salmonella organisms to Yersinia organisms. Sulfamethazine induced the transfer of Salmonella pathogenicity island 1 from pathogenic to nonpathogenic Salmonella organisms. Six antimicrobials (bacitracin, carbadox, erythromycin, sulfathiazole, tiamulin, and virginiamycin) did not mediate any transfer events. Sulfamethazine was the only antimicrobial implicated in 2 types of transfer events. 10 of 16 antimicrobials at subinhibitory or subtherapeutic concentrations augmented specific antimicrobial resistance or transfer of virulence genes into pathogenic bacteria in isolated intestinal loops in swine. Use of subtherapeutic antimicrobials in animal feed may be associated with unwanted collateral effects.

  20. Transfer of engineered genes from crop to wild plants

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

    1996-01-01

    The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

  1. Design of radiopharmaceuticals for monitoring gene transfer therapy

    International Nuclear Information System (INIS)

    Lambrecht, R.M.; Staehler, P.; Kley, J.; Spiegel, M.; Gross, C.; Graepler, F.T.C.; Gregor, M.; Lauer, U.; Oberdorfer, F.

    1998-01-01

    The development of radiopharmaceuticals for monitoring gene transfer therapy with emission tomography is expected to lead to improved management of cancer by the year 2010. There are now only a few examples and approaches to the design of radiopharmaceuticals for gene transfer therapy. This paper introduces a novel concept for the monitoring of gene therapy. We present the optimisation of the labelling of recombinant human β-NGF ligands for in vitro studies prior to using 123 I for SPET and 124 I for PET studies. (author)

  2. A Preliminary List of Horizontally Transferred Genes in Prokaryotes Determined by Tree Reconstruction and Reconciliation

    Directory of Open Access Journals (Sweden)

    Hyeonsoo Jeong

    2017-08-01

    Full Text Available Genome-wide global detection of genes involved in horizontal gene transfer (HGT remains an active area of research in medical microbiology and evolutionary genomics. Utilizing the explicit evolutionary method of comparing topologies of a total of 154,805 orthologous gene trees against corresponding 16S rRNA “reference” trees, we previously detected a total of 660,894 candidate HGT events in 2,472 completely-sequenced prokaryotic genomes. Here, we report an HGT-index for each individual gene-reference tree pair reconciliation, representing the total number of detected HGT events on the gene tree divided by the total number of genomes (taxa member of that tree. HGT-index is thus a simple measure indicating the sensitivity of prokaryotic genes to participate (or not participate in HGT. Our preliminary list provides HGT-indices for a total of 69,365 genes (detected in >10 and <50% available prokaryotic genomes that are involved in a wide range of biological processes such as metabolism, information, and bacterial response to environment. Identification of horizontally-derived genes is important to combat antibiotic resistance and is a step forward toward reconstructions of improved phylogenies describing the history of life. Our effort is thus expected to benefit ongoing research in the fields of clinical microbiology and evolutionary biology.

  3. Pollen irradiation and possible gene transfer in Nicotiana species

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1985-01-01

    , and Petunia parodii with irradiated pollen from N. alata and Petunia hybrida showed no evidence of gene transfer, nor did experiments with irradiated mentor pollen. This indicates that gene transfer with irradiated pollen between non-crossing species or between species giving sterile hybrids is probably...

  4. LATERAL GENE TRANSFER AND THE HISTORY OF BACTERIAL GENOMES

    Energy Technology Data Exchange (ETDEWEB)

    Howard Ochman

    2006-02-22

    The aims of this research were to elucidate the role and extent of lateral transfer in the differentiation of bacterial strains and species, and to assess the impact of gene transfer on the evolution of bacterial genomes. The ultimate goal of the project is to examine the dynamics of a core set of protein-coding genes (i.e., those that are distributed universally among Bacteria) by developing conserved primers that would allow their amplification and sequencing in any bacterial taxa. In addition, we adopted a bioinformatic approach to elucidate the extent of lateral gene transfer in sequenced genome.

  5. Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

    Directory of Open Access Journals (Sweden)

    Keyhani Nemat O

    2004-06-01

    Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

  6. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Science.gov (United States)

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

  7. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  8. Gene transfer to the cerebellum.

    Science.gov (United States)

    Louboutin, Jean-Pierre; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

    2010-12-01

    There are several diseases for which gene transfer therapy to the cerebellum might be practicable. In these studies, we used recombinant Tag-deleted SV40-derived vectors (rSV40s) to study gene delivery targeting the cerebellum. These vectors transduce neurons and microglia very effectively in vitro and in vivo, and so we tested them to evaluate gene transfer to the cerebellum in vivo. Using a rSV40 vector carrying human immunodeficiency virus (HIV)-Nef with a C-terminal FLAG epitope, we characterized the distribution, duration, and cell types transduced. Rats received test and control vectors by stereotaxic injection into the cerebellum. Transgene expression was assessed 1, 2, and 4 weeks later by immunostaining of serial brain sections. FLAG epitope-expressing cells were seen, at all times after vector administration, principally detected in the Purkinje cells of the cerebellum, identified as immunopositive for calbindin. Occasional microglial cells were tranduced; transgene expression was not detected in astrocytes or oligodendrocytes. No inflammatory or other reaction was detected at any time. Thus, SV40-derived vectors can deliver effective, safe, and durable transgene expression to the cerebellum.

  9. Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.

    2007-12-20

    Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.

  10. Radiopharmaceuticals to monitor the expression of transferred genes in gene transfer therapy

    International Nuclear Information System (INIS)

    Wiebe, L. I.

    1997-01-01

    The development and application of radiopharmaceuticals has, in many instances, been based on the pharmacological properties of therapeutic agents. The molecular biology-biotechnology revolution has had an important impact on treatment of diseases, in part through the reduced toxicity of 'biologicals', in part because of their specificity for interaction at unique molecular sites and in part because of their selective delivery to the target site. Immunotherapeutic approaches include the use of monoclonal antibodies (MABs), MAB-fragments and chemotactic peptides. Such agents currently form the basis of both diagnostic and immunotherapeutic radiopharmaceuticals. More recently, gene transfer techniques have been advanced to the point that a new molecular approach, gene therapy, has become a reality. Gene therapy offers an opportunity to attack disease at its most fundamental level. The therapeutic mechanism is based on the expression of a specific gene or genes, the product of which will invoke immunological, receptor-based or enzyme-based therapeutic modalities. Several approaches to gene therapy of cancer have been envisioned, the most clinically-advanced concepts involving the introduction of genes that will encode for molecular targets nor normally found in healthy mammalian cells. A number of gene therapy clinical trials are based on the introduction of the Herpes simplex virus type-1 (HSV-1) gene that encodes for viral thymidine kinase (tk+). Once HSV-1 tk+ is expressed in the target (cancer) cell, therapy can be effected by the administration of a highly molecularly-targeted and systemically non-toxic antiviral drug such as ganciclovir. The development of radiodiagnostic imaging in gene therapy will be reviewed, using HSV-1 tk+ and radioiodinated IVFRU as a basis for development of the theme. Molecular targets that could be exploited in gene therapy, other than tk+, will be identified

  11. Radiopharmaceuticals to monitor the expression of transferred genes in gene transfer therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, L I [University of Alberta, Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-10-01

    The development and application of radiopharmaceuticals has, in many instances, been based on the pharmacological properties of therapeutic agents. The molecular biology-biotechnology revolution has had an important impact on treatment of diseases, in part through the reduced toxicity of `biologicals`, in part because of their specificity for interaction at unique molecular sites and in part because of their selective delivery to the target site. Immunotherapeutic approaches include the use of monoclonal antibodies (MABs), MAB-fragments and chemotactic peptides. Such agents currently form the basis of both diagnostic and immunotherapeutic radiopharmaceuticals. More recently, gene transfer techniques have been advanced to the point that a new molecular approach, gene therapy, has become a reality. Gene therapy offers an opportunity to attack disease at its most fundamental level. The therapeutic mechanism is based on the expression of a specific gene or genes, the product of which will invoke immunological, receptor-based or enzyme-based therapeutic modalities. Several approaches to gene therapy of cancer have been envisioned, the most clinically-advanced concepts involving the introduction of genes that will encode for molecular targets nor normally found in healthy mammalian cells. A number of gene therapy clinical trials are based on the introduction of the Herpes simplex virus type-1 (HSV-1) gene that encodes for viral thymidine kinase (tk+). Once HSV-1 tk+ is expressed in the target (cancer) cell, therapy can be effected by the administration of a highly molecularly-targeted and systemically non-toxic antiviral drug such as ganciclovir. The development of radiodiagnostic imaging in gene therapy will be reviewed, using HSV-1 tk+ and radioiodinated IVFRU as a basis for development of the theme. Molecular targets that could be exploited in gene therapy, other than tk+, will be identified

  12. Twenty Years of European Union Support to Gene Therapy and Gene Transfer.

    Science.gov (United States)

    Gancberg, David

    2017-11-01

    For 20 years and throughout its research programmes, the European Union has supported the entire innovation chain for gene transfer and gene therapy. The fruits of this investment are ripening as gene therapy products are reaching the European market and as clinical trials are demonstrating the safety of this approach to treat previously untreatable diseases.

  13. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces.

    Science.gov (United States)

    McDonald, Bradon R; Currie, Cameron R

    2017-06-06

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. Here, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genus Streptomyces Using a molecular clock, we estimate that the Streptomyces bacteria are ~380 million years old, indicating that this bacterial genus is as ancient as land vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span, Streptomyces accumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution. IMPORTANCE Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genus Streptomyces , with merely one gene acquired in Streptomyces lineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new

  14. The use of alien gene transfers

    International Nuclear Information System (INIS)

    Bhatia, C.R.

    1976-01-01

    The present status of the gene transfers from alien species belonging to the sub-tribe Triticanae into wheat is reviewed, and the advantages and disadvantages of the different methods available for such transfers are examined. In general, the alien genes provide a high degree of resistance against a notably wide range of physiological races of wheat rusts, powdery mildew and other diseases. The alien resistance, like other sources of resistance, is known to break down for certain new races. This may happen more often when alien genes of resistance are widely incorporated in commercial cultivars and grown over large areas. So far, few of the available induced translocation stocks have contributed to the development of agronomically superior commercial cultivars, mainly due to the associated undesirable effects of the translocations on agronomic characters of the recipient variety. The deleterious effects appear in some genetic backgrounds and not in others. Extensive hybridization of translocation stocks with different genotypes has been emphasized by most investigators. Such programmes have led to the release of three commercial cultivars - 2 in Australia and 1 in the USA. On the other hand, spontaneous wheat-rye translocations carrying gene(s) for disease resistance have been unconsciously incorporated into several wheat cultivars, some of them are widely cultivated and were top in ranking based on grain yield. (author)

  15. Gene transfer technology and genetic radioisotope targeting therapy

    International Nuclear Information System (INIS)

    Wang Jiaqiong; Wang Zizheng

    2004-01-01

    With deeper cognition about mechanisms of disease at the cellular and molecular level, gene therapy has become one of the most important research fields in medical molecular biology at present. Gene transfer technology plays an important role during the course of gene therapy, and further improvement should be made about vectors carrying target gene sequences. Also, gene survey is needed during gene therapy, and gene imaging is the most effective method. The combination of gene therapy and targeted radiotherapy, that is, 'Genetic Radioisotope Targeting Therapy', will be a novel approach to tumor gene therapy

  16. Gene transfer strategies for improving radiolabeled peptide imaging and therapy

    International Nuclear Information System (INIS)

    Rogers, B.E.; Buchsbaum, D.J.; Zinn, K.R.

    2000-01-01

    Utilization of molecular biology techniques offers attractive options in nuclear medicine for improving cancer imaging and therapy with radiolabeled peptides. Two of these options include utilization of phage-panning to identify novel tumor specific peptides or single chain antibodies and gene transfer techniques to increase the antibodies and gene transfer techniques to increase the number of antigen/receptor sites expressed on malignant cells. The group has focused on the latter approach for improving radiolabeled peptide imaging and therapy. The most widely used gene transfer vectors in clinical gene therapy trials include retrovirus, cationic lipids and adenovirus. It has been utilized adenovirus vectors for gene transfer because of their ability to accomplish efficient in vivo gene transfer. Adenovirus vectors encoding the genes for a variety of antigens/receptors (carcinoembryonic antigen, gastrin-releasing peptide receptor, somatostatin receptor subtype 2 (SSTr2) have all shown that their expression is increased on cancer cells both in vitro and in vivo following adenovirus infection. Of particular interest has been the adenovirus encoding for SSTr2 (AdCMVSSTr2). Various radioisotopes have been attached to somatostatin analogues for imaging and therapy of SSTr2-positive tumors both clinically and in animal models. The use of these analogues in combination with AdCMVSSTr2 is a promising approach for improving the detection sensitivity and therapeutic efficacy of these radiolabeled peptides against solid tumors. In addition, it has been proposed the use of SSTr2 as a marker for imaging the expression of another cancer therapeutic transgene (e.g. cytosine deaminase, thymidine kinase) encoded within the same vector. This would allow for non-invasive monitoring of gene delivery to tumor sites

  17. Complete genome sequence of Brachyspira intermedia reveals unique genomic features in Brachyspira species and phage-mediated horizontal gene transfer

    Science.gov (United States)

    2011-01-01

    Background Brachyspira spp. colonize the intestines of some mammalian and avian species and show different degrees of enteropathogenicity. Brachyspira intermedia can cause production losses in chickens and strain PWS/AT now becomes the fourth genome to be completed in the genus Brachyspira. Results 15 classes of unique and shared genes were analyzed in B. intermedia, B. murdochii, B. hyodysenteriae and B. pilosicoli. The largest number of unique genes was found in B. intermedia and B. murdochii. This indicates the presence of larger pan-genomes. In general, hypothetical protein annotations are overrepresented among the unique genes. A 3.2 kb plasmid was found in B. intermedia strain PWS/AT. The plasmid was also present in the B. murdochii strain but not in nine other Brachyspira isolates. Within the Brachyspira genomes, genes had been translocated and also frequently switched between leading and lagging strands, a process that can be followed by different AT-skews in the third positions of synonymous codons. We also found evidence that bacteriophages were being remodeled and genes incorporated into them. Conclusions The accessory gene pool shapes species-specific traits. It is also influenced by reductive genome evolution and horizontal gene transfer. Gene-transfer events can cross both species and genus boundaries and bacteriophages appear to play an important role in this process. A mechanism for horizontal gene transfer appears to be gene translocations leading to remodeling of bacteriophages in combination with broad tropism. PMID:21816042

  18. Gene Transfer in Eukaryotic Cells Using Activated Dendrimers

    Science.gov (United States)

    Dennig, Jörg

    Gene transfer into eukaryotic cells plays an important role in cell biology. Over the last 30 years a number of transfection methods have been developed to mediate gene transfer into eukaryotic cells. Classical methods include co-precipitation of DNA with calcium phosphate, charge-dependent precipitation of DNA with DEAE-dextran, electroporation of nucleic acids, and formation of transfection complexes between DNA and cationic liposomes. Gene transfer technologies based on activated PAMAM-dendrimers provide another class of transfection reagents. PAMAM-dendrimers are highly branched, spherical molecules. Activation of newly synthesized dendrimers involves hydrolytic removal of some of the branches, and results in a molecule with a higher degree of flexibility. Activated dendrimers assemble DNA into compact structures via charge interactions. Activated dendrimer - DNA complexes bind to the cell membrane of eukaryotic cells, and are transported into the cell by non-specific endocytosis. A structural model of the activated dendrimer - DNA complex and a potential mechanism for its uptake into cells will be discussed.

  19. Evaluation of biolistic gene transfer methods in vivo using non-invasive bioluminescent imaging techniques

    Directory of Open Access Journals (Sweden)

    Daniell Henry

    2011-06-01

    Full Text Available Abstract Background Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun" delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI methods. Results Plasmid DNA carrying the firefly luciferase (LUC reporter gene under the control of the human Cytomegalovirus (CMV promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter using different DNA Loading Ratios (DLRs, and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50 at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. Conclusions The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results

  20. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  1. Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-01-01

    Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

  2. Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

    Directory of Open Access Journals (Sweden)

    Byoung-Jun Kim

    Full Text Available Recent multi locus sequence typing (MLST and genome based studies indicate that lateral gene transfer (LGT events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas, we applied rpoB typing (711 bp to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp. The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60 genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46, showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41 PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

  3. The Agricultural Antibiotic Carbadox Induces Phage-mediated Gene Transfer in Salmonella

    Directory of Open Access Journals (Sweden)

    Bradley L. Bearson

    2014-02-01

    Full Text Available Antibiotics are used for disease therapeutic or preventative effects in humans and animals, as well as for enhanced feed conversion efficiency in livestock. Antibiotics can also cause undesirable effects in microbial populations, including selection for antibiotic resistance, enhanced pathogen invasion, and stimulation of horizontal gene transfer. Carbadox is a veterinary antibiotic used in the U.S. during the starter phase of swine production for improved feed efficiency and control of swine dysentery and bacterial swine enteritis. Carbadox has been shown in vitro to induce phage-encoded Shiga toxin in Shiga toxin-producing Escherichia coli and a phage-like element transferring antibiotic resistance genes in Brachyspira hyodysenteriae, but the effect of carbadox on prophages in other bacteria is unknown. This study examined carbadox exposure on prophage induction and genetic transfer in Salmonella enterica serovar Typhimurium, a human foodborne pathogen that frequently colonizes swine without causing disease. S. Typhimurium LT2 exposed to carbadox induced prophage production, resulting in bacterial cell lysis and release of virions that were visible by electron microscopy. Carbadox induction of phage-mediated gene transfer was confirmed by monitoring the transduction of a sodCIII::neo cassette in the Fels-1 prophage from LT2 to a recipient Salmonella strain. Furthermore, carbadox frequently induced generalized transducing phages in multidrug-resistant phage type DT104 and DT120 isolates, resulting in the transfer of chromosomal and plasmid DNA that included antibiotic resistance genes. Our research indicates that exposure of Salmonella to carbadox induces prophages that can transfer virulence and antibiotic resistance genes to susceptible bacterial hosts. Carbadox-induced, phage-mediated gene transfer could serve as a contributing factor in bacterial evolution during animal production, with prophages being a reservoir for bacterial fitness

  4. Myeloprotection by Cytidine Deaminase Gene Transfer in Antileukemic Therapy

    Directory of Open Access Journals (Sweden)

    Nico Lachmann

    2013-03-01

    Full Text Available Gene transfer of drug resistance (CTX-R genes can be used to protect the hematopoietic system from the toxicity of anticancer chemotherapy and this concept recently has been proven by overexpression of a mutant O6-methylguaninemethyltransferase in the hematopoietic system of glioblastoma patients treated with temozolomide. Given its protection capacity against such relevant drugs as cytosine arabinoside (ara-C, gemcitabine, decitabine, or azacytidine and the highly hematopoiesis-specific toxicity profile of several of these agents, cytidine deaminase (CDD represents another interesting candidate CTX-R gene and our group recently has established the myeloprotective capacity of CDD gene transfer in a number of murine transplant studies. Clinically, CDD overexpression appears particularly suited to optimize treatment strategies for acute leukemias and myelodysplasias given the efficacy of ara-C (and to a lesser degree decitabine and azacytidine in these disease entities. This article will review the current state of the art with regard to CDD gene transfer and point out potential scenarios for a clinical application of this strategy. In addition, risks and potential side effects associated with this approach as well as strategies to overcome these problems will be highlighted.

  5. UCP2 muscle gene transfer modifies mitochondrial membrane potential.

    Science.gov (United States)

    Marti, A; Larrarte, E; Novo, F J; Garcia, M; Martinez, J A

    2001-01-01

    The aim of this work was to evaluate the effect of uncoupling protein 2 (UCP2) muscle gene transfer on mitochondrial activity. Five week-old male Wistar rats received an intramuscular injection of plasmid pXU1 containing UCP2 cDNA in the right tibialis anterior muscles. Left tibialis anterior muscles were injected with vehicle as control. Ten days after DNA injection, tibialis anterior muscles were dissected and muscle mitochondria isolated and analyzed. There were two mitochondrial populations in the muscle after UCP2 gene transfer, one of low fluorescence and complexity and the other, showing high fluorescence and complexity. UCP2 gene transfer resulted in a 3.6 fold increase in muscle UCP2 protein levels compared to control muscles assessed by Western blotting. Furthermore, a significant reduction in mitochondria membrane potential assessed by spectrofluorometry and flow cytometry was observed. The mitochondria membrane potential reduction might account for a decrease in fluorescence of the low fluorescence mitochondrial subpopulation. It has been demonstrated that UCP2 muscle gene transfer in vivo is associated with a lower mitochondria membrane potential. Our results suggest the potential involvement of UCP2 in uncoupling respiration. International Journal of Obesity (2001) 25, 68-74

  6. Trans-kingdom horizontal DNA transfer from bacteria to yeast is highly plastic due to natural polymorphisms in auxiliary nonessential recipient genes.

    Directory of Open Access Journals (Sweden)

    Kazuki Moriguchi

    Full Text Available With the rapid accumulation of genomic information from various eukaryotes in the last decade, genes proposed to have been derived from recent horizontal gene transfer (HGT events have been reported even in non-phagotrophic unicellular and multicellular organisms, but the molecular pathways underlying HGT remain to be explained. The development of in vitro HGT detection systems, which permit the molecular and genetic analyses of donor and recipient organisms and quantify HGT, are helpful in order to gain insight into mechanisms that may contribute to contemporary HGT events or may have contributed to past HGT events. We applied a horizontal DNA transfer system model based on conjugal gene transfer called trans-kingdom conjugation (TKC from the prokaryote Escherichia coli to the eukaryote Saccharomyces cerevisiae, and assessed whether and to what extent genetic variations in the eukaryotic recipient affect its receptivity to TKC. Strains from a collection of 4,823 knock-out mutants of S. cerevisiae MAT-α haploids were tested for their individual TKC receptivity. Two types of mutants, an ssd1 mutant and respiratory mutants, which are also found in experimental strains and in nature widely, were identified as highly receptive mutants. The TKC efficiency for spontaneously accrued petite (rho (-/0 mutants of the functional allele (SSD1-V strain showed increased receptivity. The TKC efficiency of the ssd1Δ mutant was 36% for bacterial conjugation, while that of the petite/ssd1Δ double mutants was even higher (220% in average compared to bacterial conjugation. This increased TKC receptivity was also observed when other conjugal transfer systems were applied and the donor bacterium was changed to Agrobacterium tumefaciens. These results support the idea that the genomes of certain eukaryotes have been exposed to exogenous DNA more frequently and continuously than previously thought.

  7. Cellular automata-based artificial life system of horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Ji-xin Liu

    2016-02-01

    Full Text Available Mutation and natural selection is the core of Darwin's idea about evolution. Many algorithms and models are based on this idea. However, in the evolution of prokaryotes, more and more researches have indicated that horizontal gene transfer (HGT would be much more important and universal than the authors had imagined. Owing to this mechanism, the prokaryotes not only become adaptable in nearly any environment on Earth, but also form a global genetic bank and a super communication network with all the genes of the prokaryotic world. Under this background, they present a novel cellular automata model general gene transfer to simulate and study the vertical gene transfer and HGT in the prokaryotes. At the same time, they use Schrodinger's life theory to formulate some evaluation indices and to discuss the intelligence and cognition of prokaryotes which is derived from HGT.

  8. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Directory of Open Access Journals (Sweden)

    Palmer Jeffrey D

    2006-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and

  9. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Science.gov (United States)

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  10. Horizontal gene transfers with or without cell fusions in all categories of the living matter.

    Science.gov (United States)

    Sinkovics, Joseph G

    2011-01-01

    This article reviews the history of widespread exchanges of genetic segments initiated over 3 billion years ago, to be part of their life style, by sphero-protoplastic cells, the ancestors of archaea, prokaryota, and eukaryota. These primordial cells shared a hostile anaerobic and overheated environment and competed for survival. "Coexist with, or subdue and conquer, expropriate its most useful possessions, or symbiose with it, your competitor" remain cellular life's basic rules. This author emphasizes the role of viruses, both in mediating cell fusions, such as the formation of the first eukaryotic cell(s) from a united crenarchaeon and prokaryota, and the transfer of host cell genes integrated into viral (phages) genomes. After rising above the Darwinian threshold, rigid rules of speciation and vertical inheritance in the three domains of life were established, but horizontal gene transfers with or without cell fusions were never abolished. The author proves with extensive, yet highly selective documentation, that not only unicellular microorganisms, but the most complex multicellular entities of the highest ranks resort to, and practice, cell fusions, and donate and accept horizontally (laterally) transferred genes. Cell fusions and horizontally exchanged genetic materials remain the fundamental attributes and inherent characteristics of the living matter, whether occurring accidentally or sought after intentionally. These events occur to cells stagnating for some 3 milliard years at a lower yet amazingly sophisticated level of evolution, and to cells achieving the highest degree of differentiation, and thus functioning in dependence on the support of a most advanced multicellular host, like those of the human brain. No living cell is completely exempt from gene drains or gene insertions.

  11. Environmental factors influencing gene transfer agent (GTA mediated transduction in the subtropical ocean.

    Directory of Open Access Journals (Sweden)

    Lauren D McDaniel

    Full Text Available Microbial genomic sequence analyses have indicated widespread horizontal gene transfer (HGT. However, an adequate mechanism accounting for the ubiquity of HGT has been lacking. Recently, high frequencies of interspecific gene transfer have been documented, catalyzed by Gene Transfer Agents (GTAs of marine α-Proteobacteria. It has been proposed that the presence of bacterial genes in highly purified viral metagenomes may be due to GTAs. However, factors influencing GTA-mediated gene transfer in the environment have not yet been determined. Several genomically sequenced strains containing complete GTA sequences similar to Rhodobacter capsulatus (RcGTA, type strain were screened to ascertain if they produced putative GTAs, and at what abundance. Five of nine marine strains screened to date spontaneously produced virus-like particles (VLP's in stationary phase. Three of these strains have demonstrated gene transfer activity, two of which were documented by this lab. These two strains Roseovarius nubinhibens ISM and Nitratireductor 44B9s, were utilized to produce GTAs designated RnGTA and NrGTA and gene transfer activity was verified in culture. Cell-free preparations of purified RnGTA and NrGTA particles from marked donor strains were incubated with natural microbial assemblages to determine the level of GTA-mediated gene transfer. In conjunction, several ambient environmental parameters were measured including lysogeny indicated by prophage induction. GTA production in culture systems indicated that approximately half of the strains produced GTA-like particles and maximal GTA counts ranged from 10-30% of host abundance. Modeling of GTA-mediated gene transfer frequencies in natural samples, along with other measured environmental variables, indicated a strong relationship between GTA mediated gene transfer and the combined factors of salinity, multiplicity of infection (MOI and ambient bacterial abundance. These results indicate that GTA

  12. Algorithms for computing parsimonious evolutionary scenarios for genome evolution, the last universal common ancestor and dominance of horizontal gene transfer in the evolution of prokaryotes

    Directory of Open Access Journals (Sweden)

    Galperin Michael Y

    2003-01-01

    Full Text Available Abstract Background Comparative analysis of sequenced genomes reveals numerous instances of apparent horizontal gene transfer (HGT, at least in prokaryotes, and indicates that lineage-specific gene loss might have been even more common in evolution. This complicates the notion of a species tree, which needs to be re-interpreted as a prevailing evolutionary trend, rather than the full depiction of evolution, and makes reconstruction of ancestral genomes a non-trivial task. Results We addressed the problem of constructing parsimonious scenarios for individual sets of orthologous genes given a species tree. The orthologous sets were taken from the database of Clusters of Orthologous Groups of proteins (COGs. We show that the phyletic patterns (patterns of presence-absence in completely sequenced genomes of almost 90% of the COGs are inconsistent with the hypothetical species tree. Algorithms were developed to reconcile the phyletic patterns with the species tree by postulating gene loss, COG emergence and HGT (the latter two classes of events were collectively treated as gene gains. We prove that each of these algorithms produces a parsimonious evolutionary scenario, which can be represented as mapping of loss and gain events on the species tree. The distribution of the evolutionary events among the tree nodes substantially depends on the underlying assumptions of the reconciliation algorithm, e.g. whether or not independent gene gains (gain after loss after gain are permitted. Biological considerations suggest that, on average, gene loss might be a more likely event than gene gain. Therefore different gain penalties were used and the resulting series of reconstructed gene sets for the last universal common ancestor (LUCA of the extant life forms were analysed. The number of genes in the reconstructed LUCA gene sets grows as the gain penalty increases. However, qualitative examination of the LUCA versions reconstructed with different gain penalties

  13. Expression of a transferred nuclear gene in a mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Yichun Qiu

    2014-08-01

    Full Text Available Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements. In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer to the mitochondrial genome and become expressed. Here we show that the orf164 gene in the mitochondrial genome of several Brassicaceae species, including Arabidopsis, is derived from the nuclear ARF17 gene that codes for an auxin responsive protein and is present across flowering plants. Orf164 corresponds to a portion of ARF17, and the nucleotide and amino acid sequences are 79% and 81% identical, respectively. Orf164 is transcribed in several organ types of Arabidopsis thaliana, as detected by RT-PCR. In addition, orf164 is transcribed in five other Brassicaceae within the tribes Camelineae, Erysimeae and Cardamineae, but the gene is not present in Brassica or Raphanus. This study shows that nuclear genes can be transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between the genomes of subcellular compartments.

  14. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  15. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  16. Center for Fetal Monkey Gene Transfer for Heart, Lung, and Blood Diseases: An NHLBI Resource for the Gene Therapy Community

    Science.gov (United States)

    Skarlatos, Sonia I.

    2012-01-01

    Abstract The goals of the National Heart, Lung, and Blood Institute (NHLBI) Center for Fetal Monkey Gene Transfer for Heart, Lung, and Blood Diseases are to conduct gene transfer studies in monkeys to evaluate safety and efficiency; and to provide NHLBI-supported investigators with expertise, resources, and services to actively pursue gene transfer approaches in monkeys in their research programs. NHLBI-supported projects span investigators throughout the United States and have addressed novel approaches to gene delivery; “proof-of-principle”; assessed whether findings in small-animal models could be demonstrated in a primate species; or were conducted to enable new grant or IND submissions. The Center for Fetal Monkey Gene Transfer for Heart, Lung, and Blood Diseases successfully aids the gene therapy community in addressing regulatory barriers, and serves as an effective vehicle for advancing the field. PMID:22974119

  17. Rifkin strikes against gene transfer experiments.

    Science.gov (United States)

    Beardsley, T

    Jeremy Rifkin's lobbying organization, the Foundation on Economic Trends, has brought suit in U.S. District Court, together with the Humane Society of the U.S., to halt gene transfer experiments being carried out in livestock by the Department of Agriculture. The plaintiffs allege that the experiments--which entail injecting fusion genes that include the DNA structural sequence of the human growth hormone into the fertilized eggs of sheep and pigs--are morally objectionable, a potential threat to the biological stability of animal species, and likely to have undesirable economic and environmental consequences.

  18. Modeling horizontal gene transfer (HGT in the gut of the Chagas disease vector Rhodnius prolixus

    Directory of Open Access Journals (Sweden)

    Durvasula Ravi V

    2011-05-01

    Full Text Available Abstract Background Paratransgenesis is an approach to reducing arthropod vector competence using genetically modified symbionts. When applied to control of Chagas disease, the symbiont bacterium Rhodococcus rhodnii, resident in the gut lumen of the triatomine vector Rhodnius prolixus (Hemiptera: Reduviidae, is transformed to export cecropin A, an insect immune peptide. Cecropin A is active against Trypanosoma cruzi, the causative agent of Chagas disease. While proof of concept has been achieved in laboratory studies, a rigorous and comprehensive risk assessment is required prior to consideration of field release. An important part of this assessment involves estimating probability of transgene horizontal transfer to environmental organisms (HGT. This article presents a two-part risk assessment methodology: a theoretical model predicting HGT in the gut of R. prolixus from the genetically transformed symbiont R. rhodnii to a closely related non-target bacterium, Gordona rubropertinctus, in the absence of selection pressure, and a series of laboratory trials designed to test the model. Results The model predicted an HGT frequency of less than 1.14 × 10-16 per 100,000 generations at the 99% certainty level. The model was iterated twenty times, with the mean of the ten highest outputs evaluated at the 99% certainty level. Laboratory trials indicated no horizontal gene transfer, supporting the conclusions of the model. Conclusions The model treats HGT as a composite event, the probability of which is determined by the joint probability of three independent events: gene transfer through the modalities of transformation, transduction, and conjugation. Genes are represented in matrices and Monte Carlo method and Markov chain analysis are used to simulate and evaluate environmental conditions. The model is intended as a risk assessment instrument and predicts HGT frequency of less than 1.14 × 10-16 per 100,000 generations. With laboratory studies that

  19. Gene doping detection: evaluation of approach for direct detection of gene transfer using erythropoietin as a model system.

    Science.gov (United States)

    Baoutina, A; Coldham, T; Bains, G S; Emslie, K R

    2010-08-01

    As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.

  20. MMS Observations of the Evolution of Ion-Scale Flux Transfer Events

    Science.gov (United States)

    Zhao, C.; Russell, C. T.; Strangeway, R. J.; Paterson, W.; Petrinec, S.; Zhou, M.; Anderson, B. J.; Baumjohann, W.; Bromund, K. R.; Chutter, M.; Fischer, D.; Gershman, D. J.; Giles, B. L.; Le, G.; Nakamura, R.; Plaschke, F.; Slavin, J. A.; Torbert, R. B.

    2017-12-01

    Flux transfer events are key processes in the solar wind-magnetosphere interaction. Previously, the observed flux transfer events have had scale sizes of 10,000 km radius in the cross-section and connect about 2 MWb magnetic flux from solar wind to the terrestrial magnetosphere. Recently, from the high-temporal resolution MMS magnetic field data, many ion-scale FTEs have been found. These FTEs contains only about 2 kWb magnetic flux and are believed to be in an early stage of FTE evolution. With the help of the well-calibrated MMS data, we are also able to determine the velocity profile and forces within the FTE events. We find that some ion-scale FTEs are expanding as we expect, but there are also contracting FTEs. We examine the differences between the two classes of FTEs and their differences with the larger previously studied class of FTE.

  1. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  2. Follistatin allows efficient retroviral-mediated gene transfer into rat liver

    International Nuclear Information System (INIS)

    Borgnon, Josephine; Djamouri, Fatima; Lorand, Isabelle; Rico, Virginie Di; Loux, Nathalie; Pages, Jean-Christophe; Franco, Dominique; Capron, Frederique; Weber, Anne

    2005-01-01

    Retroviral vectors are widely used tools for gene therapy. However, in vivo gene transfer is only effective in dividing cells, which, in liver, requires a regenerative stimulus. Follistatin is effective in promoting liver regeneration after 90% and 70% hepatectomy in rats. We studied its efficacy on liver regeneration and retroviral-mediated gene delivery in 50% hepatectomized rats. When human recombinant follistatin was infused into the portal vein immediately after 50% hepatectomy, hepatocyte proliferation was significantly higher than in control 50% hepatectomized rats. A single injection of virus particles administered 23 h after follistatin infusion resulted in more than 20% gene transduction efficiency in hepatocytes compared to 3% in control rats. It is concluded that a single injection of follistatin induces onset of proliferation in 50% hepatectomized rats and allows efficient retroviral-mediated gene transfer to the liver

  3. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  4. IMPROVEMENT METHOD OF GENE TRANSFER IN Kappaphycus alvarezii

    Directory of Open Access Journals (Sweden)

    St. Hidayah Triana

    2016-11-01

    Full Text Available Method of foreign gene transfer in red seaweed Kappaphycus alvarezii has been reported, however, li-mited number of transgenic F0 (broodstock was obtained. This study was conducted to improve the method of gene transfer mediated by Agrobacterium tumefaciens in order to obtain high percentage of K. alvarezii transgenic. Superoxide dismutase gene from Melastoma malabatrichum (MmCu/Zn-SOD was used as model towards increasing adaptability of K. alvarezii to environmental stress. The treat-ments were the culture media and recovery duration, and each treatment consisted of three replica-tions. The best method was co-cultivation using liquid media, then recovery was conducted in liquid media for 10 days. That treatment allowed higher transformation percentage (90%, regeneration effi-ciency (90%, putative bud efficiency (100%, number of buds and explants sprouted (100% and transgenic explants (100%. The transgenic explants showed an amplification PCR product of Mm-Cu/Zn-SOD gene fragment, whereas the non-transgenic explants showed no amplification product.  All results revealed that suitable method of transgenesis for K. alvarezii has been developed. Keywords:       Agrobacterium tumefaciens, culture media, Kappaphycus alvarezii, recovery duration, transformation

  5. No evidence of inhibition of horizontal gene transfer by CRISPR-Cas on evolutionary timescales.

    Science.gov (United States)

    Gophna, Uri; Kristensen, David M; Wolf, Yuri I; Popa, Ovidiu; Drevet, Christine; Koonin, Eugene V

    2015-09-01

    The CRISPR (clustered, regularly, interspaced, short, palindromic repeats)-Cas (CRISPR-associated genes) systems of archaea and bacteria provide adaptive immunity against viruses and other selfish elements and are believed to curtail horizontal gene transfer (HGT). Limiting acquisition of new genetic material could be one of the sources of the fitness cost of CRISPR-Cas maintenance and one of the causes of the patchy distribution of CRISPR-Cas among bacteria, and across environments. We sought to test the hypothesis that the activity of CRISPR-Cas in microbes is negatively correlated with the extent of recent HGT. Using three independent measures of HGT, we found no significant dependence between the length of CRISPR arrays, which reflects the activity of the immune system, and the estimated number of recent HGT events. In contrast, we observed a significant negative dependence between the estimated extent of HGT and growth temperature of microbes, which could be explained by the lower genetic diversity in hotter environments. We hypothesize that the relevant events in the evolution of resistance to mobile elements and proclivity for HGT, to which CRISPR-Cas systems seem to substantially contribute, occur on the population scale rather than on the timescale of species evolution.

  6. Fundamental study on gene transfer utilizing magnetic force and jet injector

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, T.; Nakagami, H.; Akiyama, Y.; Nishjima, S. [Osaka University, Osaka (Japan)

    2017-03-15

    Recently, DNA vaccination is attracting attentions as a new therapeutic method for lifestyle diseases and autoimmune diseases. However, its clinical applications are limited because a safe and efficient gene transfer method has not been established yet. In this study, a new method of gene transfer was proposed which utilizes the jet injection and the magnetic transfection. The jet injection is a method to inject medical liquid by momentary high pressure without needle. The injected liquid diffuses in the bio tissue and the endocytosis is considered to be improved by the diffusion. The magnetic transfection is a method to deliver the conjugates of plasmid DNA and magnetic particles to the desired site by external magnetic field. It is expected that jet injection of the conjugates causes slight membrane disruptions and the traction of the conjugates by magnetic field induces the efficient gene transfer. In conclusion, the possibility of improvement of the gene expression by the combination of jet injection and magnetic transfection was confirmed.

  7. Fundamental study on gene transfer utilizing magnetic force and jet injector

    International Nuclear Information System (INIS)

    Hasegawa, T.; Nakagami, H.; Akiyama, Y.; Nishjima, S.

    2017-01-01

    Recently, DNA vaccination is attracting attentions as a new therapeutic method for lifestyle diseases and autoimmune diseases. However, its clinical applications are limited because a safe and efficient gene transfer method has not been established yet. In this study, a new method of gene transfer was proposed which utilizes the jet injection and the magnetic transfection. The jet injection is a method to inject medical liquid by momentary high pressure without needle. The injected liquid diffuses in the bio tissue and the endocytosis is considered to be improved by the diffusion. The magnetic transfection is a method to deliver the conjugates of plasmid DNA and magnetic particles to the desired site by external magnetic field. It is expected that jet injection of the conjugates causes slight membrane disruptions and the traction of the conjugates by magnetic field induces the efficient gene transfer. In conclusion, the possibility of improvement of the gene expression by the combination of jet injection and magnetic transfection was confirmed

  8. Preliminary studies on gene therapy with TGF β1 antisense gene/liposome complexes and adenovirus transfer vector in RPF rats

    International Nuclear Information System (INIS)

    Liu Chunjie; Wang Dewen; Zhang Zhaoshan; Gao Yabing; Xiong Chengqi; Long Jianyin; Wang Huixin; Peng Ruiyun; Cui Xuemei

    2001-01-01

    Objective: To observed the efficiency of gene therapy with TGF β1 antisense gene/liposome complexes and adenovirus transfer vector in RPF rats. Methods: TGFβ1 sense and antisense gene expression vectors and adenovirus transfer vector were introduced into rat bronchus by way of intratracheal instillation. Results: At day 1.5 after TGFβ1 sense and antisense gene transfer, PCR amplification using neo gene-specific primer from lung tissue DNA was all positive. After day 5.5, 67% (2/3) of lung tissue DNA was positive. RNA dot blot hybridization indicated that TGFβ1 mRNA content of lung tissue transfected with pMAMneo-antiTGFβ1 gene decreased. Detection of lung hydroxyproline (Hyp) content after day 35 of gene transfer showed that even in lung of rats received pMAMneo-AntiTGFβ1 lipid complexes it raised remarkably (P 9 pfu/ml were instilled into bronchus at 0.5 ml per rat. After day 2 day 6, the lung tissues of all six rats (three per each group )expressed the transfected luciferase gene by luminometer. Conclusion: Cationic lipid-mediated TGFβ1 antisense gene therapy was a simple and easy method. It can slow down the course of pathogenesis of lung fibrosis. Replication-deficient recombinant adenovirus-mediated gene therapy of lung diseases is a good and efficient method

  9. Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents.

    Science.gov (United States)

    Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

    2015-12-08

    The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications.

  10. Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

    OpenAIRE

    Podsakoff, G; Wong, K K; Chatterjee, S

    1994-01-01

    Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthe...

  11. Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island.

    Science.gov (United States)

    Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun

    2016-11-29

    Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.

  12. Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.

    Science.gov (United States)

    Raftopoulos, H; Ward, M; Leboulch, P; Bank, A

    1997-11-01

    Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.

  13. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  14. Evolutionary change and phylogenetic relationships in light of horizontal gene transfer.

    Science.gov (United States)

    Boto, Luis

    2015-06-01

    Horizontal gene transfer has, over the past 25 years, become a part of evolutionary thinking. In the present paper I discuss horizontal gene transfer (HGT) in relation to contingency, natural selection, evolutionary change speed and the Tree-of-Life endeavour, with the aim of contributing to the understanding of the role of HGT in evolutionary processes. In addition, the challenges that HGT imposes on the current view of evolution are emphasized.

  15. DNA-mediated gene transfer into ataxia-telangiectasia cells

    International Nuclear Information System (INIS)

    Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.

    1986-01-01

    The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA

  16. Horizontal Gene Transfers in Mycoplasmas (Mollicutes).

    Science.gov (United States)

    Citti, C; Dordet-Frisoni, E; Nouvel, L X; Kuo, C H; Baranowski, E

    2018-04-12

    The class Mollicutes (trivial name "mycoplasma") is composed of wall-less bacteria with reduced genomes whose evolution was long thought to be only driven by gene losses. Recent evidences of massive horizontal gene transfer (HGT) within and across species provided a new frame to understand the successful adaptation of these minimal bacteria to a broad range of hosts. Mobile genetic elements are being identified in a growing number of mycoplasma species, but integrative and conjugative elements (ICEs) are emerging as pivotal in HGT. While sharing common traits with other bacterial ICEs, such as their chromosomal integration and the use of a type IV secretion system to mediate horizontal dissemination, mycoplasma ICEs (MICEs) revealed unique features: their chromosomal integration is totally random and driven by a DDE recombinase related to the Mutator-like superfamily. Mycoplasma conjugation is not restricted to ICE transmission, but also involves the transfer of large chromosomal fragments that generates progenies with mosaic genomes, nearly every position of chromosome being mobile. Mycoplasmas have thus developed efficient ways to gain access to a considerable reservoir of genetic resources distributed among a vast number of species expanding the concept of minimal cell to the broader context of flowing information.

  17. Co-evolution of secondary metabolite gene clusters and their host

    DEFF Research Database (Denmark)

    Kjærbølling, Inge; Vesth, Tammi Camilla; Frisvad, Jens Christian

    Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of speci....... We investigate the dynamic evolutionary relationship between the cluster and the host by examining the genes within the cluster and the number of homologous genes found within the host and in closely related species.......Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of species...

  18. Electron Transfer in Chemistry and Biology – The Primary Events

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 12. Electron Transfer in Chemistry and Biology – The Primary Events in Photosynthesis. V Krishnan. General Article Volume 2 Issue 12 December 1997 pp 77-86. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  20. Bursts of Pc 1-2 related to flux transfer events

    International Nuclear Information System (INIS)

    Arnoldy, R.L.; Cahill, L.J. Jr.; Engebretson, M.J.

    1987-01-01

    Instances of sporadic reconnection of geomagnetic and interplanetary magnetic field lines have been measured by space-craft passing through the dayside magnetopause region (Russell and Elphic 1979; Rijnbeek et al. 1984). The ionospheric signature of the reconnection events (flux transfer events) is a topic of current interest in that if one is evident then ground magnetic field data can be used to monitor the rate of dayside reconnection and conditions under which it occurs in a manner not possible with rapidly moving spacecraft. The proposed ground magnetic signature of a flux transfer event (FTE) is a large amplitude one-cycle Pc 5 (150-600 second period) pulse produced by a large vortex of ionospheric Hall current generated by the field-aligned current in the helical flux tube that has reconnected (Lee 1986). The intent of this article is to provide further data on the possible ground magnetic signatures of FTE (Lanzerotti el al. 1986) as measured by the induction antennas that the University of New Hampshire and the University of Minnesota have operated at high latitudes in the Antarctic and Greenland. With a high-frequency cut-off of 5 hertz, the induction magnetometers can measure Pc 1-2 waves (0.1-5.0 hertz) which cannot be seen by fluxgate instruments. Indeed, Pc 1-2 waves are frequently observed on the ground coincident with the Pc 5 FTE signature which provides some interesting new perspectives on these events

  1. Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance

    Science.gov (United States)

    Ensminger, Stephan M.; Spriewald, Bernd M.

    2012-01-01

    Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401

  2. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2007-06-01

    Full Text Available Abstract Background Horizontal or lateral transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial and archaeal genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood. In particular, gene flow from eukaryotes to prokaryotes is rarely documented with strong support, which is unusual since prokaryotic genomes appear to readily accept foreign genes. Results Here, we show that abundant marine cyanobacteria in the related genera Synechococcus and Prochlorococcus acquired a key Calvin cycle/glycolytic enzyme from a eukaryote. Two non-homologous forms of fructose bisphosphate aldolase (FBA are characteristic of eukaryotes and prokaryotes respectively. However, a eukaryotic gene has been inserted immediately upstream of the ancestral prokaryotic gene in several strains (ecotypes of Synechococcus and Prochlorococcus. In one lineage this new gene has replaced the ancestral gene altogether. The eukaryotic gene is most closely related to the plastid-targeted FBA from red algae. This eukaryotic-type FBA once replaced the plastid/cyanobacterial type in photosynthetic eukaryotes, hinting at a possible functional advantage in Calvin cycle reactions. The strains that now possess this eukaryotic FBA are scattered across the tree of Synechococcus and Prochlorococcus, perhaps because the gene has been transferred multiple times among cyanobacteria, or more likely because it has been selectively retained only in certain lineages. Conclusion A gene for plastid-targeted FBA has been transferred from red algae to cyanobacteria, where it has inserted itself beside its non-homologous, functional analogue. Its current distribution in Prochlorococcus and Synechococcus is punctate, suggesting a complex history since its introduction to this group.

  3. Polybrene increases the efficiency of gene transfer by lipofection.

    Science.gov (United States)

    Abe, A; Miyanohara, A; Friedmann, T

    1998-05-01

    Lipofection involves the introduction of foreign genetic information into mammalian cells through the use of lipophilic reagents that enhance cellular uptake of polynucleotides. Despite the use of currently optimized lipofection conditions, including the use of serum-depleted media, the efficiency of gene transfer is often low. We show here that, in a variety of cell lines, polybrene markedly enhances the efficiency of lipofection under standardized conditions and also compensates the serum-mediated inhibition of lipofection. Although the degree of the polybrene effect depends on the nature of the cell line, these results indicate that individually optimized concentrations of polybrene can be useful for increasing the efficiency of lipofectin-mediated gene transfer in vitro.

  4. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  6. In vivo tyrosinase mini-gene transfer enhances killing effect of BNCT on amelanotic melanoma

    International Nuclear Information System (INIS)

    Kondoh, H.; Mishima, Y.; Hiratsuka, J.; Iwakura, M.

    2000-01-01

    Using accentuated melanogenesis principally occurring within melanoma cells, we have successfully treated human malignant melanoma (Mm) with 10 B-BPA BNCT. Despite this success, there are still remaining issues for poorly melanogenic Mm and further non-pigment cell tumors. We found the selective accumulation of 10 B-BPA to Mm is primarily due to the complex formation of BPA and melanin-monomers activity synthesized within Mm cells. Then, we succeeded in transferring the tyrosinase gene into amelanotic to substantially produce melanin monomers. These cells has demonstrated increased boron accumulation and enhanced killing effect of BNCT. Further, transfection of TRP-2 (DOPAchrome tautomerase) gene into poorly eumelanotic and slightly phenomelanotic Mm cells in culture cell systems also led to increased BPA accumulation. Thereafter, we studied in vivo gene transfer. We transferred the tyrosinase mini-gene by intra-tumor injection into poorly melanotic Mm proliferating subcutaneously in hamster skin, and performed BNCT. Compared to control tumors, gene-transferred tumors showed increased BPA accumulation leading to enhanced killing effect. (author)

  7. Inferring duplications, losses, transfers and incomplete lineage sorting with nonbinary species trees.

    Science.gov (United States)

    Stolzer, Maureen; Lai, Han; Xu, Minli; Sathaye, Deepa; Vernot, Benjamin; Durand, Dannie

    2012-09-15

    Gene duplication (D), transfer (T), loss (L) and incomplete lineage sorting (I) are crucial to the evolution of gene families and the emergence of novel functions. The history of these events can be inferred via comparison of gene and species trees, a process called reconciliation, yet current reconciliation algorithms model only a subset of these evolutionary processes. We present an algorithm to reconcile a binary gene tree with a nonbinary species tree under a DTLI parsimony criterion. This is the first reconciliation algorithm to capture all four evolutionary processes driving tree incongruence and the first to reconcile non-binary species trees with a transfer model. Our algorithm infers all optimal solutions and reports complete, temporally feasible event histories, giving the gene and species lineages in which each event occurred. It is fixed-parameter tractable, with polytime complexity when the maximum species outdegree is fixed. Application of our algorithms to prokaryotic and eukaryotic data show that use of an incomplete event model has substantial impact on the events inferred and resulting biological conclusions. Our algorithms have been implemented in Notung, a freely available phylogenetic reconciliation software package, available at http://www.cs.cmu.edu/~durand/Notung. mstolzer@andrew.cmu.edu.

  8. Optimized Data Transfers Based on the OpenCL Event Management Mechanism

    Directory of Open Access Journals (Sweden)

    Hiroyuki Takizawa

    2015-01-01

    Full Text Available In standard OpenCL programming, hosts are supposed to control their compute devices. Since compute devices are dedicated to kernel computation, only hosts can execute several kinds of data transfers such as internode communication and file access. These data transfers require one host to simultaneously play two or more roles due to the need for collaboration between the host and devices. The codes for such data transfers are likely to be system-specific, resulting in low portability. This paper proposes an OpenCL extension that incorporates such data transfers into the OpenCL event management mechanism. Unlike the current OpenCL standard, the main thread running on the host is not blocked to serialize dependent operations. Hence, an application can easily use the opportunities to overlap parallel activities of hosts and compute devices. In addition, the implementation details of data transfers are hidden behind the extension, and application programmers can use the optimized data transfers without any tricky programming techniques. The evaluation results show that the proposed extension can use the optimized data transfer implementation and thereby increase the sustained data transfer performance by about 18% for a real application accessing a big data file.

  9. Innate Functions of Immunoglobulin M Lessen Liver Gene Transfer with Helper-Dependent Adenovirus

    Science.gov (United States)

    Unzu, Carmen; Morales-Kastresana, Aizea; Sampedro, Ana; Serrano-Mendioroz, Irantzu; Azpilikueta, Arantza; Ochoa, María Carmen; Dubrot, Juan; Martínez-Ansó, Eduardo

    2014-01-01

    The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA) vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors. PMID:24465560

  10. Innate functions of immunoglobulin M lessen liver gene transfer with helper-dependent adenovirus.

    Directory of Open Access Journals (Sweden)

    Carmen Unzu

    Full Text Available The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors.

  11. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  12. Efficient gene transfer into lymphoma cells using adenoviral vectors combined with lipofection.

    Science.gov (United States)

    Buttgereit, P; Weineck, S; Röpke, G; Märten, A; Brand, K; Heinicke, T; Caselmann, W H; Huhn, D; Schmidt-Wolf, I G

    2000-08-01

    Tumor cells, such as lymphoma cells, are possible targets for gene therapy. In general, gene therapeutic approaches require efficient gene transfer to host cells and sufficient transgene expression. However, lymphoma cells previously have been demonstrated to be resistant to most of the currently available gene transfer methods. The aim of this study was to analyze various methods for transfection of lymphoma cells and to improve the efficiency of gene delivery. In accordance with previously published reports, lymphoma cells were demonstrated to be resistant to lipofection and electroporation. In contrast, we present an improved adenoviral protocol leading to highly efficient gene transfer to lymphoma cell lines derived from B cells as well as primary lymphoma cells being achieved with an adenoviral vector system encoding the beta-galactosidase protein. At a multiplicity of infection of 200, up to 100% of Daudi cells and Raji cells and 70% of OCI-Ly8-LAM53 cells could be transfected. Even at high adenoviral concentrations, no marked toxicity was observed, and the growth characteristics of the lymphoma cell lines were not impaired. The transfection rates in primary cells derived from six patients with non-Hodgkin's lymphoma were 30-65%, respectively. Transfection efficiency could be further increased by addition of cationic liposomes to adenoviral gene transfer. Furthermore, we examined the expression of the Coxsackie-adenoviral receptor (CAR) and the integrin receptors on the lymphoma cell surface. Flow cytometric analysis showed that 88% of Daudi cells, 69% of Raji cells, and 6% of OCI-Ly8-LAM53 cells expressed CAR on the cell surface. According to our data, adenoviral infection of lymphoma cells seems to be mediated by CAR. In contrast, integrin receptors are unlikely to play a major role, because lymphoma cells were negative for alphavbeta3-integrins and negative for alphavbeta5-integrins. In conclusion, this study demonstrates that B-lymphoma cell lines and

  13. Use of γ-irradiated pollen for the gene transfer in Petunia

    International Nuclear Information System (INIS)

    Andrejchenko, S.V.; Grodzinskij, D.M.

    1986-01-01

    Possibility of using gamma-irradiated pollen for the gene transfer in Petunia is shown. Occurrence of gametic transformation provided not only the gene integration and expression but also their transfer to the daughter generations. The described methodical approach to construction of the plant eucariotic cell genome is based not only on its simplicity but also on the fact that gamma-radiation doses of 1000 Gy and higher have no desorganizing effect on the chromatine structure in such a degree that its transcription activity is completely lost. Besides, selective inactivation of the locus radiation in the pollen genome is much assisted by their different radioresistance. Though the gene transfer by gametic transformation is mostly irregular but its probability may be increased by the correct selection of the pollen irradiation dose in a range in which the growth of pollen tube before ovary is conserved and reparation of one-strand and two-strand DNA breaks preventing chromatine fragmentation is suppressed

  14. Transferring alien genes to wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1987-01-01

    In broad terms an alien gene can be considered to be any gene transferred to wheat from a related species. As described above by Maan (section 7D) the genus Triticum contains a broad range of species, some of which cross readily with the cultivated tetraploid (T. Turgidum L.) or hexaploid (T. aestivum L.) wheats, and others only with great difficulty. In addition, wheat will also cross with species in a number of other genera including Agropyron, Elymus, Elytrigia (=Agropyron), Haynaldia, Hordeum, and Secale (Riley and Kimber, 1966; Knobloch, 1968; Feldman and Sears, 1981). In discussing the Triticum and Aegilops spp., the classification by Kimber and Sears, section SA-I, above, will be followed. For the Agropyron and related species the classification described by Dewey (1983) will be used. To avoid confusion, in referring to the literature the designations used by the authors will be given, followed by the new designation. The wild relatives of wheat are adapted to a broad range of environments and carry a large reservoir of useful genes (Zohary et al., 1969; Kerber and Dyck, 1973; Brezhnev, 1977; Feldman and Sears, 1981; Limin and Fowler, 1981; Sharma et aI., 1981; McGuire and Dvorak, 1981). Initially they were considered to be primarily sources of disease resistance, but more recently they have been recognized as potential sources of genes for high protein, cold tolerance, salt tolerance, drought tolerance, lodging resistance, early maturity, and even yield. Extensive screening of the wild relatives of wheat needs to be done before their useful genes can be fully utilized

  15. Transferring alien genes to wheat

    Energy Technology Data Exchange (ETDEWEB)

    Knott, D. R.

    1987-07-01

    In broad terms an alien gene can be considered to be any gene transferred to wheat from a related species. As described above by Maan (section 7D) the genus Triticum contains a broad range of species, some of which cross readily with the cultivated tetraploid (T. Turgidum L.) or hexaploid (T. aestivum L.) wheats, and others only with great difficulty. In addition, wheat will also cross with species in a number of other genera including Agropyron, Elymus, Elytrigia (=Agropyron), Haynaldia, Hordeum, and Secale (Riley and Kimber, 1966; Knobloch, 1968; Feldman and Sears, 1981). In discussing the Triticum and Aegilops spp., the classification by Kimber and Sears, section SA-I, above, will be followed. For the Agropyron and related species the classification described by Dewey (1983) will be used. To avoid confusion, in referring to the literature the designations used by the authors will be given, followed by the new designation. The wild relatives of wheat are adapted to a broad range of environments and carry a large reservoir of useful genes (Zohary et al., 1969; Kerber and Dyck, 1973; Brezhnev, 1977; Feldman and Sears, 1981; Limin and Fowler, 1981; Sharma et aI., 1981; McGuire and Dvorak, 1981). Initially they were considered to be primarily sources of disease resistance, but more recently they have been recognized as potential sources of genes for high protein, cold tolerance, salt tolerance, drought tolerance, lodging resistance, early maturity, and even yield. Extensive screening of the wild relatives of wheat needs to be done before their useful genes can be fully utilized.

  16. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  17. Calculating the Motion and Direction of Flux Transfer Events with Cluster

    Science.gov (United States)

    Collado-Vega, Y. M.; Sibeck, D. G.

    2012-01-01

    For many years now, the interactions of the solar wind plasma with the Earth's magnetosphere has been one of the most important problems for Space Physics. It is very important that we understand these processes because the high-energy particles and also the solar wind energy that cross the magneto sphere could be responsible for serious damage to our technological systems. The solar wind is inherently a dynamic medium, and the particles interaction with the Earth's magnetosphere can be steady or unsteady. Unsteady interaction include transient processes like bursty magnetic reconnection. Flux Transfer Events (FTEs) are magnetopause signatures that usually occur during transient times of reconnection. They exhibit bipolar signatures in the normal component of the magnetic field. We use multi-point timing analysis to determine the orientation and motion of ux transfer events (FTEs) detected by the four Cluster spacecraft on the high-latitude dayside and flank magnetopause during 2002 and 2003. During these years, the distances between the Cluster spacecraft were greater than 1000 km, providing the tetrahedral configuration needed to select events and determine velocities. Each velocity and location will be examined in detail and compared to the velocities and locations determined by the predictions of the component and antiparallel reconnection models for event formation, orientation, motion, and acceleration for a wide range of spacecraft locations and solar wind conditions.

  18. On the topology of flux transfer events

    Science.gov (United States)

    Hesse, Michael; Birn, Joachim; Schindler, Karl

    1990-01-01

    A topological analysis is made of a simple model magnetic field of a perturbation at the magnetopause that shares magnetic properties with flux transfer events. The aim is to clarify a number of topological aspects that arise in the case of fully three-dimensional magnetic fields. It is shown that a localized perturbation at the magnetopause can in principle open a closed magnetosphere by establishing magnetic connections across the magnetopause by the formation of a ropelike magnetic field structure. For this purpose a global topological model of a closed magnetosphere is considered as the unperturbed state. The topological substructure of the model flux rope is discussed in detail.

  19. Role of horizontal gene transfer as a control on the coevolution of ribosomal proteins and the genetic code

    Energy Technology Data Exchange (ETDEWEB)

    Woese, Carl R.; Goldenfeld, Nigel; Luthey-Schulten, Zaida

    2011-03-31

    Our main goal is to develop the conceptual and computational tools necessary to understand the evolution of the universal processes of translation and replication and to identify events of horizontal gene transfer that occurred within the components. We will attempt to uncover the major evolutionary transitions that accompanied the development of protein synthesis by the ribosome and associated components of the translation apparatus. Our project goes beyond standard genomic approaches to explore homologs that are represented at both the structure and sequence level. Accordingly, use of structural phylogenetic analysis allows us to probe further back into deep evolutionary time than competing approaches, permitting greater resolution of primitive folds and structures. Specifically, our work focuses on the elements of translation, ranging from the emergence of the canonical genetic code to the evolution of specific protein folds, mediated by the predominance of horizontal gene transfer in early life. A unique element of this study is the explicit accounting for the impact of phenotype selection on translation, through a coevolutionary control mechanism. Our work contributes to DOE mission objectives through: (1) sophisticated computer simulation of protein dynamics and evolution, and the further refinement of techniques for structural phylogeny, which complement sequence information, leading to improved annotation of genomic databases; (2) development of evolutionary approaches to exploring cellular function and machinery in an integrated way; and (3) documentation of the phenotype interaction with translation over evolutionary time, reflecting the system response to changing selection pressures through horizontal gene transfer.

  20. Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

    2007-06-01

    Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

  1. Collective evolution of cyanobacteria and cyanophages mediated by horizontal gene transfer

    Science.gov (United States)

    Shih, Hong-Yan; Rogers, Tim; Goldenfeld, Nigel

    We describe a model for how antagonistic predator-prey coevolution can lead to mutualistic adaptation to an environment, as a result of horizontal gene transfer. Our model is a simple description of ecosystems such as marine cyanobacteria and their predator cyanophages, which carry photosynthesis genes. These genes evolve more rapidly in the virosphere than the bacterial pan-genome, and thus the bacterial population could potentially benefit from phage predation. By modeling both the barrier to predation and horizontal gene transfer, we study this balance between individual sacrifice and collective benefits. The outcome is an emergent mutualistic coevolution of improved photosynthesis capability, benefiting both bacteria and phage. This form of multi-level selection can contribute to niche stratification in the cyanobacteria-phage ecosystem. This work is supported in part by a cooperative agreement with NASA, Grant NNA13AA91A/A0018.

  2. Leu452His mutation in lipoprotein lipase gene transfer associated with hypertriglyceridemia in mice in vivo.

    Directory of Open Access Journals (Sweden)

    Kaiyue Sun

    Full Text Available Mutated mouse lipoprotein lipase (LPL containing a leucine (L to histidine (H substitution at position 452 was transferred into mouse liver by hydrodynamics-based gene delivery (HD. Mutated-LPL (MLPL gene transfer significantly increased the concentrations of plasma MLPL and triglyceride (TG but significantly decreased the activity of plasma LPL. Moreover, the gene transfer caused adiposis hepatica and significantly increased TG content in mouse liver. To understand the effects of MLPL gene transfer on energy metabolism, we investigated the expression of key functional genes related to energy metabolism in the liver, epididymal fat, and leg muscles. The mRNA contents of hormone-sensitive lipase (HSL, adipose triglyceride lipase (ATGL, fatty acid-binding protein (FABP, and uncoupling protein (UCP were found to be significantly reduced. Furthermore, we investigated the mechanism by which MLPL gene transfer affected fat deposition in the liver, fat tissue, and muscle. The gene expression and protein levels of forkhead Box O3 (FOXO3, AMP-activated protein kinase (AMPK, and peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α were found to be remarkably decreased in the liver, fat and muscle. These results suggest that the Leu452His mutation caused LPL dysfunction and gene transfer of MLPL in vivo produced resistance to the AMPK/PGC-1α signaling pathway in mice.

  3. In vivo tyrosinase mini-gene transfer enhances killing effect of BNCT on amelanotic melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Kondoh, H.; Mishima, Y. [Mishima Institute for Dermatological Research, Kobe, Hyogo (Japan); Hiratsuka, J. [Kawasaki Medical School, Dept. of Radiation Oncology, Kurashiki, Okayama (Japan); Iwakura, M. [Kobe Univ. (Japan). School of Medicine

    2000-10-01

    Using accentuated melanogenesis principally occurring within melanoma cells, we have successfully treated human malignant melanoma (Mm) with {sup 10}B-BPA BNCT. Despite this success, there are still remaining issues for poorly melanogenic Mm and further non-pigment cell tumors. We found the selective accumulation of {sup 10}B-BPA to Mm is primarily due to the complex formation of BPA and melanin-monomers activity synthesized within Mm cells. Then, we succeeded in transferring the tyrosinase gene into amelanotic to substantially produce melanin monomers. These cells has demonstrated increased boron accumulation and enhanced killing effect of BNCT. Further, transfection of TRP-2 (DOPAchrome tautomerase) gene into poorly eumelanotic and slightly phenomelanotic Mm cells in culture cell systems also led to increased BPA accumulation. Thereafter, we studied in vivo gene transfer. We transferred the tyrosinase mini-gene by intra-tumor injection into poorly melanotic Mm proliferating subcutaneously in hamster skin, and performed BNCT. Compared to control tumors, gene-transferred tumors showed increased BPA accumulation leading to enhanced killing effect. (author)

  4. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers

    Directory of Open Access Journals (Sweden)

    Céline Brochier-Armanet

    2006-01-01

    Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  5. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers.

    Science.gov (United States)

    Brochier-Armanet, Céline; Forterre, Patrick

    2007-05-01

    Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT) to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 degrees C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  6. Gene ontology based transfer learning for protein subcellular localization

    Directory of Open Access Journals (Sweden)

    Zhou Shuigeng

    2011-02-01

    Full Text Available Abstract Background Prediction of protein subcellular localization generally involves many complex factors, and using only one or two aspects of data information may not tell the true story. For this reason, some recent predictive models are deliberately designed to integrate multiple heterogeneous data sources for exploiting multi-aspect protein feature information. Gene ontology, hereinafter referred to as GO, uses a controlled vocabulary to depict biological molecules or gene products in terms of biological process, molecular function and cellular component. With the rapid expansion of annotated protein sequences, gene ontology has become a general protein feature that can be used to construct predictive models in computational biology. Existing models generally either concatenated the GO terms into a flat binary vector or applied majority-vote based ensemble learning for protein subcellular localization, both of which can not estimate the individual discriminative abilities of the three aspects of gene ontology. Results In this paper, we propose a Gene Ontology Based Transfer Learning Model (GO-TLM for large-scale protein subcellular localization. The model transfers the signature-based homologous GO terms to the target proteins, and further constructs a reliable learning system to reduce the adverse affect of the potential false GO terms that are resulted from evolutionary divergence. We derive three GO kernels from the three aspects of gene ontology to measure the GO similarity of two proteins, and derive two other spectrum kernels to measure the similarity of two protein sequences. We use simple non-parametric cross validation to explicitly weigh the discriminative abilities of the five kernels, such that the time & space computational complexities are greatly reduced when compared to the complicated semi-definite programming and semi-indefinite linear programming. The five kernels are then linearly merged into one single kernel for

  7. THE RISK OF TRANSFER OF GENES IN THE INSURANCE PROTECTION OF AGRICULTURAL PRODUCERS

    Directory of Open Access Journals (Sweden)

    Henrikh Hudz

    2017-09-01

    Full Text Available The paper deals with the risk of transfer of genes, its impact, and possible consequences for agricultural producers; the possibility of creating an insurance service, to address this risk. The purpose of the paper is to disclose the results of a study of the risk of transfer of genes in agriculture when organizing insurance coverage. The tasks of this paper are: to clarify the essence of genetic engineering as an object of providing insurance services; to define the concept of risk of transfer of genes, its specific features, impact, and possible consequences for agricultural producers; carry out a description of the possibility of creating an insurance service about the risk of transfer of genes. The object of the study is the risk of transfer of genes in insurance protection. The subject of the study is theoretical and methodological approaches to optimizing the risk of transfer of genes in insurance protection. Methodology. This work requires attracting a large number of scientists from different fields. Legal Aspects covered in the EU Regulation Terms №1829/2003 and 1830/2003 of the European Parliament and Council. A considerable attention to the legislative regulation of genetic engineering and risks in the use of genetic modification is given to the Cartagena Protocol on Biosafety. It should be noted that at present, economic literature and especially publications related to agricultural insurance protection do not pay attention to the risks associated with the transfer of transgenic organisms and the possibility of taking this risk to insurance. The work uses the experience of the US Department of Agriculture and the European Center for Insurance Legislation. The results of the study showed that the introduction of the insurance mechanism has the main difference in the fact that this operation takes into account as a person who suffered a loss, could get more profit than the fact of causing damage to another farmer. In this regard, the

  8. Transfer of Chinese hamster DNA repair gene(s) into repair-deficient human cells (Xeroderma pigmentosum)

    International Nuclear Information System (INIS)

    Karentz, D.; Cleaver, J.E.

    1985-01-01

    Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells

  9. Lateral gene transfer between prokaryotes and multicellular eukaryotes: ongoing and significant?

    NARCIS (Netherlands)

    Ros, V.I.D.; Hurst, G.D.D.

    2009-01-01

    The expansion of genome sequencing projects has produced accumulating evidence for lateral transfer of genes between prokaryotic and eukaryotic genomes. However, it remains controversial whether these genes are of functional importance in their recipient host. Nikoh and Nakabachi, in a recent paper

  10. THE RISK OF GENE TRANSFERRING IN THE INSURANCE PROTECTION OF AGRICULTERE

    Directory of Open Access Journals (Sweden)

    M. Malik

    2016-03-01

    Full Text Available The paper justified essence of genetic engineering as the object of insurance services. Defines the concept of risk gene transferring. The character features of this specific risk. The influence and consequences for agricultural producers. The description of the possible creation of the concept of insurance services that cover risk of gene transferring. The study reveals of the use of GMOs in agriculture, due to issues of economic security of a particular region or country as a whole. To determined the impact of risks and control for developing and developed countries that are important aspects of farming. Changes in weather, climate, productivity, price values, public policy, the situation on global markets can cause large fluctuations in agricultural production, and consequently affecting the income of agricultural producers. Risk management includes a range of strategies that reduce the social and financial implications of possible changes affecting the production and income of farmers. There is a need for an in-depth study of the theoretical and practical aspects of the impact of the risk of gene transferring in the context of insurance protection.

  11. A study of flux transfer events at different planets

    Science.gov (United States)

    Russell, C. T.

    1995-01-01

    Flux transfer events (FTEs) are disturbances in and near the magnetopause current layer that cause a characteristic signature in the component of the magnetic field parallel to the average boundary normal. These disturbances have been observed at Mercury, Earth and Jupiter but not at Saturn, Uranus or Neptune. At Earth, FTEs last about 1 minute and repeat about every 8 but at Mercury, a much smaller magnetosphere, the events last seconds and are tens of seconds apart. These features have been interpreted in terms of magnetospheric flux ropes connected to the interplanetary magnetic field, arising as the result of reconnection. An analogous phenomenon occurs at Venus where magnetic flux ropes arise at the ionosphere, a boundary between a very strongly magnetized one. However, here the flux ropes do not appear to be due to reconnection.

  12. In vitro study for laser gene transfer in BHK-21 fibroblast cell line

    Science.gov (United States)

    Abdel Aziz, M.; Salem, D. S.; Salama, M. S.; Badr, Y.

    2009-02-01

    Modifications to our previously introduced system for laser microbeam cell surgery were carried out in the present work to match animal cells. These modifications included: 1- Using other laser system that used before, Excimer laser with 193 and 308 nm wavelengths. The used laser here, is He-Cd with low power and 441.5 nm wavelength in the visible region. 2- Instead of using pulsed laser, we used here CW He-Cd chopped by electrical chopper, which is synchronized with the mechanical motion of the mobile stage with step 40 microns, according to cell dimensions to avoid puncturing the same cell twice. The advantages of the modified here laser setup for gene transfer is: it is less damaging to the sensitive animal cell which has thin cell membrane. The present work aimed to: 1- Design a modified laser microbeam cell surgery, applicable to animal cells, such as fibroblast cells 2- To examine the efficiency of such system. 3- To assure gene transfer and its expression in the used cells. 4- To evaluate the ultra damages produced from using the laser beam as a modality for gene transfer. On the other wards, to introduce: safe, efficient and less damaging modality for gene transfer in animal cells. To achieve these goals, we applied the introduced here home-made laser setup with its synchronized parameters to introduce pBK-CMV phagemid, containing LacZ and neomycin resistance (neor )genes into BHK-21 fibroblast cell line. The results of the present work showed that: 1- Our modified laser microbeam cell surgery setup proved to be useful and efficient tool for gene transfer into fibroblast cells. 2- The presence and expression of LacZ gene was achieved using histochemical LacZ assay. 3- Selection of G418 antibiotic sensitivity assay confirmed the presence and expression towards stability of neor gene with time. 4- Presence of LacZ and neor genes in the genomic DNA of transfected fibroblast cells was indicated using PCR analysis. 5- Transmission electron microscopy indicated

  13. Tolerance induction to cytoplasmic beta-galactosidase by hepatic AAV gene transfer: implications for antigen presentation and immunotoxicity.

    Directory of Open Access Journals (Sweden)

    Ashley T Martino

    2009-08-01

    Full Text Available Hepatic gene transfer, in particular using adeno-associated viral (AAV vectors, has been shown to induce immune tolerance to several protein antigens. This approach has been exploited in animal models of inherited protein deficiency for systemic delivery of therapeutic proteins. Adequate levels of transgene expression in hepatocytes induce a suppressive T cell response, thereby promoting immune tolerance. This study addresses the question of whether AAV gene transfer can induce tolerance to a cytoplasmic protein.AAV-2 vector-mediated hepatic gene transfer for expression of cytoplasmic beta-galactosidase (beta-gal was performed in immune competent mice, followed by a secondary beta-gal gene transfer with E1/E3-deleted adenoviral Ad-LacZ vector to provoke a severe immunotoxic response. Transgene expression from the AAV-2 vector in approximately 2% of hepatocytes almost completely protected from inflammatory T cell responses against beta-gal, eliminated antibody formation, and significantly reduced adenovirus-induced hepatotoxicity. Consequently, approximately 10% of hepatocytes continued to express beta-gal 45 days after secondary Ad-LacZ gene transfer, a time point when control mice had lost all Ad-LacZ derived expression. Suppression of inflammatory T cell infiltration in the liver and liver damage was linked to specific transgene expression and was not seen for secondary gene transfer with Ad-GFP. A combination of adoptive transfer studies and flow cytometric analyses demonstrated induction of Treg that actively suppressed CD8(+ T cell responses to beta-gal and that was amplified in liver and spleen upon secondary Ad-LacZ gene transfer.These data demonstrate that tolerance induction by hepatic AAV gene transfer does not require systemic delivery of the transgene product and that expression of a cytoplasmic neo-antigen in few hepatocytes can induce Treg and provide long-term suppression of inflammatory responses and immunotoxicity.

  14. Graphene materials as 2D non-viral gene transfer vector platforms.

    Science.gov (United States)

    Vincent, M; de Lázaro, I; Kostarelos, K

    2017-03-01

    Advances in genomics and gene therapy could offer solutions to many diseases that remain incurable today, however, one of the critical reasons halting clinical progress is due to the difficulty in designing efficient and safe delivery vectors for the appropriate genetic cargo. Safety and large-scale production concerns counter-balance the high gene transfer efficiency achieved with viral vectors, while non-viral strategies have yet to become sufficiently efficient. The extraordinary physicochemical, optical and photothermal properties of graphene-based materials (GBMs) could offer two-dimensional components for the design of nucleic acid carrier systems. We discuss here such properties and their implications for the optimization of gene delivery. While the design of such vectors is still in its infancy, we provide here an exhaustive and up-to-date analysis of the studies that have explored GBMs as gene transfer vectors, focusing on the functionalization strategies followed to improve vector performance and on the biological effects attained.

  15. High-level transfer and long-term expression of the human beta-globin gene in a mouse transplant model.

    Science.gov (United States)

    Raftopoulos, H; Ward, M; Bank, A

    1998-06-30

    Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.

  16. Dual effects of adenovirus-mediated thrombopoietin gene transfer on hepatic oval cell proliferation and platelet counts

    International Nuclear Information System (INIS)

    Ichiba, Miho; Shimomura, Takashi; Murai, Rie; Hashiguchi, Koichi; Saeki, Toshiya; Yoshida, Yoko; Kanbe, Takamasa; Tanabe, Naotada; Tsuchiya, Hiroyuki; Miura, Norimasa; Tajima, Fumihito; Kurimasa, Akihiro; Hamada, Hirofumi; Shiota, Goshi

    2005-01-01

    Thrombopoietin (TPO) is the growth factor for megakaryocytes and platelets, however, it also acts as a potent regulator of stem cell proliferation. To examine the significance of TPO expression in proliferation of hepatic oval cells, the effect of adenovirus-mediated TPO gene transfer into livers of the Solt-Farber model, which mimics the condition where liver regeneration is impaired, was examined. Hepatic TPO mRNA peaked its expression at 2 days after gene transduction and then gradually decreased. The peripheral platelet number began to increase at 4 days (P < 0.05) and reached its plateau at 9 days (P < 0.01). Oval cells expressed c-Mpl, a receptor for TPO as well as immature hematopoietic and hepatocytic surface markers such as CD34 and AFP. The proliferating cell nuclear antigen-positive oval cells in rats into which adenovirus-TPO gene was transferred at 7 and 9 days were significantly greater than those in adenovirus-LacZ gene transferred (P < 0.05, each), and the total numbers of oval cells in the adenovirus-TPO gene transferred at 9 and 13 days were also significantly greater than those in adenovirus-LacZ gene transferred (P < 0.05, each). Expression of SCF protein was increased at 4, 7, and 9 days by TPO gene administration and that of c-Kit was increased at 4 and 7 days. These data suggest that adenovirus-mediated TPO gene transfer stimulated oval cell proliferation in liver as well as increasing peripheral platelet counts, emphasizing the significance of the TPO/c-Mpl system in proliferation of hepatic oval cells

  17. Horizontal gene transfer of an entire metabolic pathway between a eukaryotic alga and its DNA virus

    Science.gov (United States)

    Monier, Adam; Pagarete, António; de Vargas, Colomban; Allen, Michael J.; Read, Betsy; Claverie, Jean-Michel; Ogata, Hiroyuki

    2009-01-01

    Interactions between viruses and phytoplankton, the main primary producers in the oceans, affect global biogeochemical cycles and climate. Recent studies are increasingly revealing possible cases of gene transfers between cyanobacteria and phages, which might have played significant roles in the evolution of cyanobacteria/phage systems. However, little has been documented about the occurrence of horizontal gene transfer in eukaryotic phytoplankton/virus systems. Here we report phylogenetic evidence for the transfer of seven genes involved in the sphingolipid biosynthesis pathway between the cosmopolitan eukaryotic microalga Emiliania huxleyi and its large DNA virus EhV. PCR assays indicate that these genes are prevalent in E. huxleyi and EhV strains isolated from different geographic locations. Patterns of protein and gene sequence conservation support that these genes are functional in both E. huxleyi and EhV. This is the first clear case of horizontal gene transfer of multiple functionally linked enzymes in a eukaryotic phytoplankton–virus system. We examine arguments for the possible direction of the gene transfer. The virus-to-host direction suggests the existence of ancient viruses that controlled the complex metabolic pathway in order to infect primitive eukaryotic cells. In contrast, the host-to-virus direction suggests that the serial acquisition of genes involved in the same metabolic pathway might have been a strategy for the ancestor of EhVs to stay ahead of their closest relatives in the great evolutionary race for survival. PMID:19451591

  18. Peripheral blood aspirates overexpressing IGF-I via rAAV gene transfer undergo enhanced chondrogenic differentiation processes.

    Science.gov (United States)

    Frisch, Janina; Orth, Patrick; Rey-Rico, Ana; Venkatesan, Jagadeesh Kumar; Schmitt, Gertrud; Madry, Henning; Kohn, Dieter; Cucchiarini, Magali

    2017-11-01

    Implantation of peripheral blood aspirates induced towards chondrogenic differentiation upon genetic modification in sites of articular cartilage injury may represent a powerful strategy to enhance cartilage repair. Such a single-step approach may be less invasive than procedures based on the use of isolated or concentrated MSCs, simplifying translational protocols in patients. In this study, we provide evidence showing the feasibility of overexpressing the mitogenic and pro-anabolic insulin-like growth factor I (IGF-I) in human peripheral blood aspirates via rAAV-mediated gene transfer, leading to enhanced proliferative and chondrogenic differentiation (proteoglycans, type-II collagen, SOX9) activities in the samples relative to control (reporter rAAV-lacZ) treatment over extended periods of time (at least 21 days, the longest time-point evaluated). Interestingly, IGF-I gene transfer also triggered hypertrophic, osteo- and adipogenic differentiation processes in the aspirates, suggesting that careful regulation of IGF-I expression may be necessary to contain these events in vivo. Still, the current results demonstrate the potential of targeting human peripheral blood aspirates via therapeutic rAAV transduction as a novel, convenient tool to treat articular cartilage injuries. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  19. Horizontal Gene Transfer Contributes to the Evolution of Arthropod Herbivory.

    Science.gov (United States)

    Wybouw, Nicky; Pauchet, Yannick; Heckel, David G; Van Leeuwen, Thomas

    2016-06-27

    Within animals, evolutionary transition toward herbivory is severely limited by the hostile characteristics of plants. Arthropods have nonetheless counteracted many nutritional and defensive barriers imposed by plants and are currently considered as the most successful animal herbivores in terrestrial ecosystems. We gather a body of evidence showing that genomes of various plant feeding insects and mites possess genes whose presence can only be explained by horizontal gene transfer (HGT). HGT is the asexual transmission of genetic information between reproductively isolated species. Although HGT is known to have great adaptive significance in prokaryotes, its impact on eukaryotic evolution remains obscure. Here, we show that laterally transferred genes into arthropods underpin many adaptations to phytophagy, including efficient assimilation and detoxification of plant produced metabolites. Horizontally acquired genes and the traits they encode often functionally diversify within arthropod recipients, enabling the colonization of more host plant species and organs. We demonstrate that HGT can drive metazoan evolution by uncovering its prominent role in the adaptations of arthropods to exploit plants. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Intravascular local gene transfer mediated by protein-coated metallic stent.

    Science.gov (United States)

    Yuan, J; Gao, R; Shi, R; Song, L; Tang, J; Li, Y; Tang, C; Meng, L; Yuan, W; Chen, Z

    2001-10-01

    To assess the feasibility, efficiency and selectivity of adenovirus-mediated gene transfer to local arterial wall by protein-coated metallic stent. A replication-defective recombinant adenovirus carrying the Lac Z reporter gene for nuclear-specific beta-galactosidase (Ad-beta gal) was used in this study. The coating for metallic stent was made by immersing it in a gelatin solution containing crosslinker. The coated stents were mounted on a 4.0 or 3.0 mm percutaneous transluminal coronary angioplasty (PTCA) balloon and submersed into a high-titer Ad-beta gal viral stock (2 x 10(10) pfu/ml) for 3 min, and then implanted into the carotid arteries in 4 mini-swines and into the left anterior descending branch of the coronary artery in 2 mini-swines via 8F large lumen guiding catheters. The animals were sacrificed 7 (n = 4), 14 (n = 1) and 21 (n = 1) days after implantation, respectively. The beta-galactosidase expression was assessed by X-gal staining. The results showed that the expression of transgene was detected in all animal. In 1 of carotid artery with an intact intima, the beta-gal expression was limited to endothelial cells. In vessels with denuded endothelium, gene expression was found in the sub-intima, media and adventitia. The transfection efficiency of medial smooth muscle cells was 38.6%. In 2 animals sacrificed 7 days after transfection, a microscopic examination of X-gal-stained samples did not show evidence of transfection in remote organs and arterial segments adjacent to the treated arterial site. Adenovirus-mediated arterial gene transfer to endothelial, smooth muscle cells and adventitia by protein-coated metallic stent is feasible. The transfection efficiency is higher. The coated stent may act as a good carrier of adenovirus-mediated gene transfer and have a potential to prevent restenosis following PTCA.

  1. Ex-Vivo Gene Therapy Using Lentiviral Mediated Gene Transfer Into Umbilical Cord Blood Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Hanieh Jalali

    2016-02-01

    Full Text Available Background Introduction of therapeutic genes into the injured site of nervous system can be achieved using transplantation of cellular vehicles containing desired gene. To transfer exogenous genes into the cellular vehicles, lentiviral vectors are one of interested vectors because of advantages such high transduction efficiency of dividing and non-dividing cells. Unrestricted somatic stem cells are subclasses of umbilical cord blood derived stem cells which are appreciate candidates to use as cellular vehicles for ex vivo gene therapy of nervous system. Objectives In current study we investigated the effect of lentiviral vector transduction on the neuronal related features of unrestricted somatic stem cells to indicate the probable and unwanted changes related to transduction procedure. Materials and Methods In this experimental study, lentiviral vector containing green fluorescent protein (GFP were transduced into unrestricted somatic stem cells and its effect was investigated with using MTT assay, qPCR and immunohistochemistry techniques. For statistical comparison of real time PCR results, REST software (2009, Qiagen was used. Results Obtained results showed lentiviral vector transduction did not have cytotoxic effects on unrestricted somatic stem cells and did not change neuronal differentiation capacity of them as well the expression of some neuronal related genes and preserved them in multilineage situation. Conclusions In conclusion, we suggested that lentiviral vectors could be proper vectors to transfer therapeutic gene into unrestricted somatic stem cells to provide a cellular vehicle for ex vivo gene therapy of nervous system disorders.

  2. Area-Specific Cell Stimulation via Surface-Mediated Gene Transfer Using Apatite-Based Composite Layers

    Directory of Open Access Journals (Sweden)

    Yushin Yazaki

    2015-04-01

    Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.

  3. Gene conversion and reversion events in Saccharomyces cerevisiae. Model for study of gamma radiation damage

    International Nuclear Information System (INIS)

    Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia

    2004-01-01

    Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper

  4. Phylogeographic support for horizontal gene transfer involving sympatric bruchid species

    Directory of Open Access Journals (Sweden)

    Grill Andrea

    2006-07-01

    Full Text Available Abstract Background We report on the probable horizontal transfer of a mitochondrial gene, cytb, between species of Neotropical bruchid beetles, in a zone where these species are sympatric. The bruchid beetles Acanthoscelides obtectus, A. obvelatus, A. argillaceus and Zabrotes subfasciatus develop on various bean species in Mexico. Whereas A. obtectus and A. obvelatus develop on Phaseolus vulgaris in the Mexican Altiplano, A. argillaceus feeds on P. lunatus in the Pacific coast. The generalist Z. subfasciatus feeds on both bean species, and is sympatric with A. obtectus and A. obvelatus in the Mexican Altiplano, and with A. argillaceus in the Pacific coast. In order to assess the phylogenetic position of these four species, we amplified and sequenced one nuclear (28S rRNA and two mitochondrial (cytb, COI genes. Results Whereas species were well segregated in topologies obtained for COI and 28S rRNA, an unexpected pattern was obtained in the cytb phylogenetic tree. In this tree, individuals from A. obtectus and A. obvelatus, as well as Z. subfasciatus individuals from the Mexican Altiplano, clustered together in a unique little variable monophyletic unit. In contrast, A. argillaceus and Z. subfasciatus individuals from the Pacific coast clustered in two separated clades, identically to the pattern obtained for COI and 28S rRNA. An additional analysis showed that Z. subfasciatus individuals from the Mexican Altiplano also possessed the cytb gene present in individuals of this species from the Pacific coast. Zabrotes subfasciatus individuals from the Mexican Altiplano thus demonstrated two cytb genes, an "original" one and an "infectious" one, showing 25% of nucleotide divergence. The "infectious" cytb gene seems to be under purifying selection and to be expressed in mitochondria. Conclusion The high degree of incongruence of the cytb tree with patterns for other genes is discussed in the light of three hypotheses: experimental contamination

  5. Phylogeographic support for horizontal gene transfer involving sympatric bruchid species.

    Science.gov (United States)

    Alvarez, Nadir; Benrey, Betty; Hossaert-McKey, Martine; Grill, Andrea; McKey, Doyle; Galtier, Nicolas

    2006-07-27

    We report on the probable horizontal transfer of a mitochondrial gene, cytb, between species of Neotropical bruchid beetles, in a zone where these species are sympatric. The bruchid beetles Acanthoscelides obtectus, A. obvelatus, A. argillaceus and Zabrotes subfasciatus develop on various bean species in Mexico. Whereas A. obtectus and A. obvelatus develop on Phaseolus vulgaris in the Mexican Altiplano, A. argillaceus feeds on P. lunatus in the Pacific coast. The generalist Z. subfasciatus feeds on both bean species, and is sympatric with A. obtectus and A. obvelatus in the Mexican Altiplano, and with A. argillaceus in the Pacific coast. In order to assess the phylogenetic position of these four species, we amplified and sequenced one nuclear (28S rRNA) and two mitochondrial (cytb, COI) genes. Whereas species were well segregated in topologies obtained for COI and 28S rRNA, an unexpected pattern was obtained in the cytb phylogenetic tree. In this tree, individuals from A. obtectus and A. obvelatus, as well as Z. subfasciatus individuals from the Mexican Altiplano, clustered together in a unique little variable monophyletic unit. In contrast, A. argillaceus and Z. subfasciatus individuals from the Pacific coast clustered in two separated clades, identically to the pattern obtained for COI and 28S rRNA. An additional analysis showed that Z. subfasciatus individuals from the Mexican Altiplano also possessed the cytb gene present in individuals of this species from the Pacific coast. Zabrotes subfasciatus individuals from the Mexican Altiplano thus demonstrated two cytb genes, an "original" one and an "infectious" one, showing 25% of nucleotide divergence. The "infectious" cytb gene seems to be under purifying selection and to be expressed in mitochondria. The high degree of incongruence of the cytb tree with patterns for other genes is discussed in the light of three hypotheses: experimental contamination, hybridization, and pseudogenisation. However, none of these

  6. Reducible cationic lipids for gene transfer.

    Science.gov (United States)

    Wetzer, B; Byk, G; Frederic, M; Airiau, M; Blanche, F; Pitard, B; Scherman, D

    2001-01-01

    One of the main challenges of gene therapy remains the increase of gene delivery into eukaryotic cells. We tested whether intracellular DNA release, an essential step for gene transfer, could be facilitated by using reducible cationic DNA-delivery vectors. For this purpose, plasmid DNA was complexed with cationic lipids bearing a disulphide bond. This reduction-sensitive linker is expected to be reduced and cleaved in the reducing milieu of the cytoplasm, thus potentially improving DNA release and consequently transfection. The DNA--disulphide-lipid complexation was monitored by ethidium bromide exclusion, and the size of complexes was determined by dynamic light scattering. It was found that the reduction kinetics of disulphide groups in DNA--lipid complexes depended on the position of the disulphide linker within the lipid molecule. Furthermore, the internal structure of DNA--lipid particles was examined by small-angle X-ray scattering before and after lipid reduction. DNA release from lipid complexes was observed after the reduction of disulphide bonds of several lipids. Cell-transfection experiments suggested that complexes formed with selected reducible lipids resulted in up to 1000-fold higher reporter-gene activity, when compared with their analogues without disulphide bonds. In conclusion, reduction-sensitive groups introduced into cationic lipid backbones potentially allow enhanced DNA release from DNA--lipid complexes after intracellular reduction and represent a tool for improved vectorization. PMID:11389682

  7. Nucleofection: A New Method for Cutaneous Gene Transfer?

    Directory of Open Access Journals (Sweden)

    Frank Jacobsen

    2006-01-01

    Full Text Available Background. Transfection efficacy after nonviral gene transfer in primary epithelial cells is limited. The aim of this study was to compare transfection efficacy of the recently available method of nucleofection with the established transfection reagent FuGENE6. Methods. Primary human keratinocytes (HKC, primary human fibroblasts (HFB, and a human keratinocyte cell line (HaCaT were transfected with reporter gene construct by FuGENE6 or Amaxa Nucleofector device. At corresponding time points, β-galactosidase expression, cell proliferation (MTT-Test, transduction efficiency (X-gal staining, cell morphology, and cytotoxicity (CASY were determined. Results. Transgene expression after nucleofection was significantly higher in HKC and HFB and detected earlier (3 h vs. 24 h than in FuGENE6. After lipofection 80%–90% of the cells remained proliferative without any influence on cell morphology. In contrast, nucleofection led to a decrease in keratinocyte cell size, with only 20%–42% proliferative cells. Conclusion. Related to the method-dependent increase of cytotoxicity, transgene expression after nucleofection was earlier and higher than after lipofection.

  8. Nucleofection: A New Method for Cutaneous Gene Transfer?

    Science.gov (United States)

    Jacobsen, Frank; Mertens-Rill, Janine; Beller, Juergen; Hirsch, Tobias; Daigeler, Adrien; Langer, Stefan; Lehnhardt, Marcus; Steinau, Hans-Ulrich; Steinstraesser, Lars

    2006-01-01

    Background. Transfection efficacy after nonviral gene transfer in primary epithelial cells is limited. The aim of this study was to compare transfection efficacy of the recently available method of nucleofection with the established transfection reagent FuGENE6. Methods. Primary human keratinocytes (HKC), primary human fibroblasts (HFB), and a human keratinocyte cell line (HaCaT) were transfected with reporter gene construct by FuGENE6 or Amaxa Nucleofector device. At corresponding time points, β-galactosidase expression, cell proliferation (MTT-Test), transduction efficiency (X-gal staining), cell morphology, and cytotoxicity (CASY) were determined. Results. Transgene expression after nucleofection was significantly higher in HKC and HFB and detected earlier (3 h vs. 24 h) than in FuGENE6. After lipofection 80%–90% of the cells remained proliferative without any influence on cell morphology. In contrast, nucleofection led to a decrease in keratinocyte cell size, with only 20%–42% proliferative cells. Conclusion. Related to the method-dependent increase of cytotoxicity, transgene expression after nucleofection was earlier and higher than after lipofection. PMID:17489014

  9. Analysis of bone marrow stromal cell transferred bacterial {beta}-galactosidase gene by PIXE

    Energy Technology Data Exchange (ETDEWEB)

    Kumakawa, Toshiro [Tokyo Metropolitan Geriatric Hospital, Tokyo (Japan). Dept. of Blood Transfusion and Hematology; Hibino, Hitoshi; Tani, Kenzaburo; Asano, Shigetaka; Futatugawa, Shouji; Sera, Kouichiro

    1997-12-31

    PIXE, Particle Induced X-ray Emission, is a powerful, multi-elemental analysis method which has many distinguishing features and has been used in varies research fields. Recently the method of applying baby cyclotrons for nuclear medicine to PIXE has been developed. This enables us to study biomedical phenomena from the physical point of view. Mouse bone marrow stromal cells were transferred bacterial {beta}-galactosidase gene (LacZ gene) by murine retroviral vectors. Analysis of the bone marrow stromal cells with the LacZ gene by PIXE revealed remarkable changes of intracellular trace elements compared with the normal control cells. These results indicate that gene transfer by retroviral vectors may bring about a dynamic change of intracellular circumstances of the target cell. (author)

  10. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  11. Homologous recombination mediates functional recovery of dysferlin deficiency following AAV5 gene transfer.

    Directory of Open Access Journals (Sweden)

    William E Grose

    Full Text Available The dysferlinopathies comprise a group of untreatable muscle disorders including limb girdle muscular dystrophy type 2B, Miyoshi myopathy, distal anterior compartment syndrome, and rigid spine syndrome. As with other forms of muscular dystrophy, adeno-associated virus (AAV gene transfer is a particularly auspicious treatment strategy, however the size of the DYSF cDNA (6.5 kb negates packaging into traditional AAV serotypes known to express well in muscle (i.e. rAAV1, 2, 6, 8, 9. Potential advantages of a full cDNA versus a mini-gene include: maintaining structural-functional protein domains, evading protein misfolding, and avoiding novel epitopes that could be immunogenic. AAV5 has demonstrated unique plasticity with regards to packaging capacity and recombination of virions containing homologous regions of cDNA inserts has been implicated in the generation of full-length transcripts. Herein we show for the first time in vivo that homologous recombination following AAV5.DYSF gene transfer leads to the production of full length transcript and protein. Moreover, gene transfer of full-length dysferlin protein in dysferlin deficient mice resulted in expression levels sufficient to correct functional deficits in the diaphragm and importantly in skeletal muscle membrane repair. Intravascular regional gene transfer through the femoral artery produced high levels of transduction and enabled targeting of specific muscle groups affected by the dysferlinopathies setting the stage for potential translation to clinical trials. We provide proof of principle that AAV5 mediated delivery of dysferlin is a highly promising strategy for treatment of dysferlinopathies and has far-reaching implications for the therapeutic delivery of other large genes.

  12. Phylogenetic detection of horizontal gene transfer during the step-wise genesis of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Turenne Christine

    2009-08-01

    Full Text Available Abstract Background In the past decade, the availability of complete genome sequence data has greatly facilitated comparative genomic research aimed at addressing genetic variability within species. More recently, analysis across species has become feasible, especially in genera where genome sequencing projects of multiple species have been initiated. To understand the genesis of the pathogen Mycobacterium tuberculosis within a genus where the majority of species are harmless environmental organisms, we have used genome sequence data from 16 mycobacteria to look for evidence of horizontal gene transfer (HGT associated with the emergence of pathogenesis. First, using multi-locus sequence analysis (MLSA of 20 housekeeping genes across these species, we derived a phylogeny that serves as the basis for HGT assignments. Next, we performed alignment searches for the 3989 proteins of M. tuberculosis H37Rv against 15 other mycobacterial genomes, generating a matrix of 59835 comparisons, to look for genetic elements that were uniquely found in M. tuberculosis and closely-related pathogenic mycobacteria. To assign when foreign genes were likely acquired, we designed a bioinformatic program called mycoHIT (mycobacterial homologue investigation tool to analyze these data in conjunction with the MLSA-based phylogeny. Results The bioinformatic screen predicted that 137 genes had been acquired by HGT at different phylogenetic strata; these included genes coding for metabolic functions and modification of mycobacterial lipids. For the majority of these genes, corroborating evidence of HGT was obtained, such as presence of phage or plasmid, and an aberrant GC%. Conclusion M. tuberculosis emerged through vertical inheritance along with the step-wise addition of genes acquired via HGT events, a process that may more generally describe the evolution of other pathogens.

  13. The interconnection between biofilm formation and horizontal gene transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenløkke; Burmølle, Mette; Hansen, Lars H.

    2012-01-01

    Recent research has revealed that horizontal gene transfer and biofilm formation are connected processes. Although published research investigating this interconnectedness is still limited, we will review this subject in order to highlight the potential of these observations because....... Biofilms, furthermore, promote plasmid stability and may enhance the host range of mobile genetic elements that are transferred horizontally. Plasmids, on the other hand, are very well suited to promote the evolution of social traits such as biofilm formation. This, essentially, transpires because plasmids...... of their believed importance in the understanding of the adaptation and subsequent evolution of social traits in bacteria. Here, we discuss current evidence for such interconnectedness centred on plasmids. Horizontal transfer rates are typically higher in biofilm communities compared with those in planktonic states...

  14. Gene transfer to primary corneal epithelial cells with an integrating lentiviral vector

    Directory of Open Access Journals (Sweden)

    Lauro Augusto de Oliveira

    2010-10-01

    Full Text Available PURPOSE: To evaluate the transfer of heterologous genes carrying a Green Fluorescent Protein (GFP reporter cassette to primary corneal epithelial cells ex vivo. METHODS: Freshly enucleated rabbit corneoscleral tissue was used to obtain corneal epithelial cell suspension via enzymatic digestion. Cells were plated at a density of 5×10³ cells/cm² and allowed to grow for 5 days (to 70-80% confluency prior to transduction. Gene transfer was monitored using fluorescence microscopy and fluorescence activated cell sorter (FACS. We evaluated the transduction efficiency (TE over time and the dose-response effect of different lentiviral particles. One set of cells were dual sorted by fluorescence activated cell sorter for green fluorescent protein expression as well as Hoechst dye exclusion to evaluate the transduction of potentially corneal epithelial stem cells (side-population phenotypic cells. RESULTS: Green fluorescent protein expressing lentiviral vectors were able to effectively transduce rabbit primary epithelial cells cultured ex vivo. Live cell imaging post-transduction demonstrated GFP-positive cells with normal epithelial cell morphology and growth. The transduction efficiency over time was higher at the 5th post-transduction day (14.1% and tended to stabilize after the 8th day. The number of transduced cells was dose-dependent, and at the highest lentivirus concentrations approached 7%. When double sorted by fluorescence activated cell sorter to isolate both green fluorescent protein positive and side population cells, transduced side population cells were identified. CONCLUSIONS: Lentiviral vectors can effectively transfer heterologous genes to primary corneal epithelial cells expanded ex vivo. Genes were stably expressed over time, transferred in a dose-dependence fashion, and could be transferred to mature corneal cells as well as presumable putative stem cells.

  15. Increased accumulation of cuticular wax and expression of lipid transfer protein in response to periodic drying events in leaves of tree tobacco.

    Science.gov (United States)

    Cameron, Kimberly D; Teece, Mark A; Smart, Lawrence B

    2006-01-01

    Cuticular wax deposition and composition affects drought tolerance and yield in plants. We examined the relationship between wax and dehydration stress by characterizing the leaf cuticular wax of tree tobacco (Nicotiana glauca L. Graham) grown under periodic dehydration stress. Total leaf cuticular wax load increased after each of three periods of dehydration stress using a CH2Cl2 extraction process. Overall, total wax load increased 1.5- to 2.5-fold, but composition of the wax was not altered. Homologous series of wax components were classified into organic groups; n-hentriacontane was the largest component (>75%) with alcohols and fatty acids representing drying event. Leaves excised from plants subjected to multiple drying events were more resistant to water loss compared to leaves excised from well-watered plants, indicating that there is a negative relationship between total wax load and epidermal conductance. Lipid transfer proteins (LTPs) are thought to be involved in the transfer of lipids through the extracellular matrix for the formation of cuticular wax. Using northern analysis, a 6-fold increase of tree tobacco LTP gene transcripts was observed after three drying events, providing further evidence that LTP is involved in cuticle deposition. The simplicity of wax composition and the dramatic wax bloom displayed by tree tobacco make this an excellent species in which to study the relationship between leaf wax deposition and drought tolerance.

  16. Dynamic evolution of Geranium mitochondrial genomes through multiple horizontal and intracellular gene transfers.

    Science.gov (United States)

    Park, Seongjun; Grewe, Felix; Zhu, Andan; Ruhlman, Tracey A; Sabir, Jamal; Mower, Jeffrey P; Jansen, Robert K

    2015-10-01

    The exchange of genetic material between cellular organelles through intracellular gene transfer (IGT) or between species by horizontal gene transfer (HGT) has played an important role in plant mitochondrial genome evolution. The mitochondrial genomes of Geraniaceae display a number of unusual phenomena including highly accelerated rates of synonymous substitutions, extensive gene loss and reduction in RNA editing. Mitochondrial DNA sequences assembled for 17 species of Geranium revealed substantial reduction in gene and intron content relative to the ancestor of the Geranium lineage. Comparative analyses of nuclear transcriptome data suggest that a number of these sequences have been functionally relocated to the nucleus via IGT. Evidence for rampant HGT was detected in several Geranium species containing foreign organellar DNA from diverse eudicots, including many transfers from parasitic plants. One lineage has experienced multiple, independent HGT episodes, many of which occurred within the past 5.5 Myr. Both duplicative and recapture HGT were documented in Geranium lineages. The mitochondrial genome of Geranium brycei contains at least four independent HGT tracts that are absent in its nearest relative. Furthermore, G. brycei mitochondria carry two copies of the cox1 gene that differ in intron content, providing insight into contrasting hypotheses on cox1 intron evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  17. Targeted in vitro and in vivo gene transfer into T Lymphocytes: potential of direct inhibition of allo-immune activation

    Directory of Open Access Journals (Sweden)

    Mehra Mandeep R

    2006-11-01

    Full Text Available Abstract Background Successful inhibition of alloimmune activation in organ transplantation remains one of the key events in achieving a long-term graft survival. Since T lymphocytes are largely responsible for alloimmune activation, targeted gene transfer of gene of cyclin kinase inhibitor p21 into T cells might inhibit their aberrant proliferation. A number of strategies using either adenoviral or lentiviral vectors linked to mono or bispecific antibodies directed against T cell surface markers/cytokines did not yield the desired results. Therefore, this study was designed to test if a CD3promoter-p21 chimeric construct would in vitro and in vivo transfer p21 gene to T lymphocytes and result in inhibition of proliferation. CD3 promoter-p21 chimeric constructs were prepared with p21 in the sense and antisense orientation. For in vitro studies EL4-IL-2 thyoma cells were used and for in vivo studies CD3p21 sense and antisense plasmid DNA was injected intramuscularly in mice. Lymphocyte proliferation was quantified by 3H-thymidine uptake assay; IL-2 mRNA expression was studied by RT-PCR and using Real Time PCR assay, we monitored the CD3, p21, TNF-α and IFN-γ mRNA expression. Results Transfection of CD3p21 sense and antisense in mouse thyoma cell line (EL4-IL-2 resulted in modulation of mitogen-induced proliferation. The intramuscular injection of CD3p21 sense and antisense plasmid DNA into mice also modulated lymphocyte proliferation and mRNA expression of pro-inflammatory cytokines. Conclusion These results demonstrate a novel strategy of in vitro and in vivo transfer of p21 gene to T cells using CD3-promoter to achieve targeted inhibition of lymphocyte proliferation and immune activation.

  18. Agrobacterium-mediated gene transfer in plants and biosafety considerations.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2012-12-01

    Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

  19. On the feasibility of using satellite gravity observations for detecting large-scale solid mass transfer events

    Science.gov (United States)

    Peidou, Athina C.; Fotopoulos, Georgia; Pagiatakis, Spiros

    2017-10-01

    The main focus of this paper is to assess the feasibility of utilizing dedicated satellite gravity missions in order to detect large-scale solid mass transfer events (e.g. landslides). Specifically, a sensitivity analysis of Gravity Recovery and Climate Experiment (GRACE) gravity field solutions in conjunction with simulated case studies is employed to predict gravity changes due to past subaerial and submarine mass transfer events, namely the Agulhas slump in southeastern Africa and the Heart Mountain Landslide in northwestern Wyoming. The detectability of these events is evaluated by taking into account the expected noise level in the GRACE gravity field solutions and simulating their impact on the gravity field through forward modelling of the mass transfer. The spectral content of the estimated gravity changes induced by a simulated large-scale landslide event is estimated for the known spatial resolution of the GRACE observations using wavelet multiresolution analysis. The results indicate that both the Agulhas slump and the Heart Mountain Landslide could have been detected by GRACE, resulting in {\\vert }0.4{\\vert } and {\\vert }0.18{\\vert } mGal change on GRACE solutions, respectively. The suggested methodology is further extended to the case studies of the submarine landslide in Tohoku, Japan, and the Grand Banks landslide in Newfoundland, Canada. The detectability of these events using GRACE solutions is assessed through their impact on the gravity field.

  20. Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

    Science.gov (United States)

    Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

    2010-01-01

    Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

  1. Phylogenetic evidence for lateral gene transfer in the intestine of marine iguanas.

    Directory of Open Access Journals (Sweden)

    David M Nelson

    Full Text Available BACKGROUND: Lateral gene transfer (LGT appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. CONCLUSION: Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas.

  2. Phylogenetic evidence for lateral gene transfer in the intestine of marine iguanas.

    Science.gov (United States)

    Nelson, David M; Cann, Isaac K O; Altermann, Eric; Mackie, Roderick I

    2010-05-24

    Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas.

  3. Kidney-specific Sonoporation-mediated Gene Transfer.

    Science.gov (United States)

    Ishida, Ryo; Kami, Daisuke; Kusaba, Tetsuro; Kirita, Yuhei; Kishida, Tsunao; Mazda, Osam; Adachi, Takaomi; Gojo, Satoshi

    2016-02-01

    Sonoporation can deliver agents to target local organs by systemic administration, while decreasing the associated risk of adverse effects. Sonoporation has been used for a variety of materials and in a variety of organs. Herein, we demonstrated that local sonoporation to the kidney can offer highly efficient transfer of oligonucleotides, which were systemically administrated to the tubular epithelium with high specificity. Ultrasonic wave irradiation to the kidney collapsed the microbubbles and transiently affected the glomerular filtration barrier and increased glomerular permeability. Oligonucleotides were passed through the barrier all at once and were absorbed throughout the tubular epithelium. Tumor necrosis factor alpha (TNFα), which plays a central role in renal ischemia-reperfusion injury, was targeted using small interfering RNA (siRNA) with renal sonoporation in a murine model. The reduction of TNFα expression after single gene transfer significantly inhibited the expression of kidney injury markers, suggesting that systemic administration of siRNA under temporary and local sonoporation could be applicable in the clinical setting of ischemic acute kidney injury.

  4. A first glimpse into the pattern and scale of gene transfer in the Apicomplexa

    DEFF Research Database (Denmark)

    Huang, J.L.; Mullapudi, N.; Sicheritz-Pontén, Thomas

    2004-01-01

    with a phylogenomic approach to detect potential gene transfers in four apicomplexan genomes. We have detected genes of algal nuclear, chloroplast (cyanobacterial) and proteobacterial origin. Plant-like genes were detected in species not currently harbouring a plastid (e.g. Cryptosporidium parvum) and putatively...

  5. Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

    Science.gov (United States)

    Podsakoff, G; Wong, K K; Chatterjee, S

    1994-09-01

    Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.

  6. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    OpenAIRE

    Chang, Keejong; Qian, Jin; Jiang, MeiSheng; Liu, Yi-Hsin; Wu, Ming-Che; Chen, Chi-Dar; Lai, Chao-Kuen; Lo, Hsin-Lung; Hsiao, Chin-Ton; Brown, Lucy; Bolen, James; Huang, Hsiao-I; Ho, Pei-Yu; Shih, Ping Yao; Yao, Chen-Wen

    2002-01-01

    Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal ...

  7. Optimization of cationic lipid mediated gene transfer: structure-function, physico-chemical, and cellular studies.

    Science.gov (United States)

    Carrière, Marie; Tranchant, Isabelle; Niore, Pierre-Antoine; Byk, Gerardo; Mignet, Nathalie; Escriou, Virginie; Scherman, Daniel; Herscovici, Jean

    2002-01-01

    The rationale design aimed at the enhancement of cationic lipid mediated gene transfer is discussed. These improvements are based on the straight evaluation of the structure-activity relationship and on the introduction of new structures. Much attention have been given to the supramolecular structures of the lipid/DNA complexes, to the effect of serum on gene transfer and to the intracellular trafficking of the lipoplexes. Finally new avenue using reducible cationic lipids has been discussed.

  8. Use of electroporation for high-molecular-weight DNA-mediated gene transfer.

    Science.gov (United States)

    Jastreboff, M M; Ito, E; Bertino, J R; Narayanan, R

    1987-08-01

    Electroporation was used to introduce high-molecular-weight DNA into murine hematopoietic cells and NIH3T3 cells. CCRF-CEM cells were stably transfected with SV2NEO plasmid and the genomic DNA from G-418-resistant clones (greater than 65 kb) was introduced into mouse bone marrow and NIH3T3 cells by electroporation. NEO sequences and expression were detected in the hematopoietic tissues of lethally irradiated mice, with 24% of individual spleen colonies expressing NEO. The frequency of genomic DNA transfer into NIH3T3 cells was 0.25 X 10(-3). Electroporation thus offers a powerful mode of gene transfer not only of cloned genes but also of high-molecular-weight DNA into cells.

  9. Extensive horizontal transfer of core genome genes between two Lactobacillus species found in the gastrointestinal tract

    Directory of Open Access Journals (Sweden)

    Maguin Emmanuelle

    2007-08-01

    Full Text Available Abstract Background While genes that are conserved between related bacterial species are usually thought to have evolved along with the species, phylogenetic trees reconstructed for individual genes may contradict this picture and indicate horizontal gene transfer. Individual trees are often not resolved with high confidence, however, and in that case alternative trees are generally not considered as contradicting the species tree, although not confirming it either. Here we conduct an in-depth analysis of 401 protein phylogenetic trees inferred with varying levels of confidence for three lactobacilli from the acidophilus complex. At present the relationship between these bacteria, isolated from environments as diverse as the gastrointestinal tract (Lactobacillus acidophilus and Lactobacillus johnsonii and yogurt (Lactobacillus delbrueckii ssp. bulgaricus, is ambiguous due to contradictory phenotypical and 16S rRNA based classifications. Results Among the 401 phylogenetic trees, those that could be reconstructed with high confidence support the 16S-rRNA tree or one alternative topology in an astonishing 3:2 ratio, while the third possible topology is practically absent. Lowering the confidence threshold for trees to be taken into consideration does not significantly affect this ratio, and therefore suggests that gene transfer may have affected as much as 40% of the core genome genes. Gene function bias suggests that the 16S rRNA phylogeny of the acidophilus complex, which indicates that L. acidophilus and L. delbrueckii ssp. bulgaricus are the closest related of these three species, is correct. A novel approach of comparison of interspecies protein divergence data employed in this study allowed to determine that gene transfer most likely took place between the lineages of the two species found in the gastrointestinal tract. Conclusion This case-study reports an unprecedented level of phylogenetic incongruence, presumably resulting from extensive

  10. Investigating rate-limiting barriers to nanoscale nonviral gene transfer with nanobiophotonics

    Science.gov (United States)

    Chen, Hunter H.

    Nucleic acids are a novel class of therapeutics poised to address many unmet clinical needs. Safe and efficient delivery remains a significant challenge that has delayed the realization of the full therapeutic potential of nucleic acids. Nanoscale nonviral vectors offer an attractive alternative to viral vectors as natural and synthetic polymers or polypeptides may be rationally designed to meet the unique demands of individual applications. A mechanistic understanding of cellular barriers is necessary to develop guidelines for designing custom gene carriers which are expected to greatly impact this delivery challenge. The work herein focused on the relationships among nanocomplex stability, intracellular trafficking and unpacking kinetics, and DNA degradation. Ultrasensitive nanosensors based on QD-FRET were developed to characterize the biophysical properties of nanocomplexes and study these rate-limiting steps. Quantitative image analysis enabled the distributions of the subpopulation of condensed or released DNA to be determined within the major cellular compartments encountered during gene transfer. The steady state stability and unpacking kinetics within these compartments were found to impact transgene expression, elucidating multiple design strategies to achieve efficient gene transfer. To address enzymatic barriers, a novel two-step QD-FRET nanosensor was developed to analyze unpacking and DNA degradation simultaneously, which has not been accomplished previously. Bioresponsive strategies such as disulfide crosslinking and thermosensitivity were evaluated by QD-FRET and quantitative compartmental analysis as case studies to determine appropriate design specifications for thiolated polymers and thermoresponsive polypeptides. Relevant nanobiophotonic tools were developed as a platform to study major rate-limiting barriers to nanomedicine and demonstrated the feasibility of using mechanistic information gained from these tools to guide the rational design of

  11. Alterations in radioresistance of eucaryotic cells after the transfer of genomic wildtype DNA and metallothionein genes

    International Nuclear Information System (INIS)

    Lohrer, H.

    1987-01-01

    The presented paper describes experiments concerning the alteration of radiosensitivity of eucaryotic cells after gene transfer. Ionizing radiation (γ- or X-ray) induces DNA single- or double strand breaks, which are religated by an unknown repair system. Repair deficient cells are highly sensitive to ionizing radiation. In the experiments described, cells from a patient with the heritable disease Ataxia telangiectasia were used as well as two X-ray sensitive CHO mutant cell lines. After gene transfer of an intact human DNA repair gene or a metallothionein gene the cells should regain radioresistance. (orig.) [de

  12. Highly efficient retrograde gene transfer into motor neurons by a lentiviral vector pseudotyped with fusion glycoprotein.

    Directory of Open Access Journals (Sweden)

    Miyabi Hirano

    Full Text Available The development of gene therapy techniques to introduce transgenes that promote neuronal survival and protection provides effective therapeutic approaches for neurological and neurodegenerative diseases. Intramuscular injection of adenoviral and adeno-associated viral vectors, as well as lentiviral vectors pseudotyped with rabies virus glycoprotein (RV-G, permits gene delivery into motor neurons in animal models for motor neuron diseases. Recently, we developed a vector with highly efficient retrograde gene transfer (HiRet by pseudotyping a human immunodeficiency virus type 1 (HIV-1-based vector with fusion glycoprotein B type (FuG-B or a variant of FuG-B (FuG-B2, in which the cytoplasmic domain of RV-G was replaced by the corresponding part of vesicular stomatitis virus glycoprotein (VSV-G. We have also developed another vector showing neuron-specific retrograde gene transfer (NeuRet with fusion glycoprotein C type, in which the short C-terminal segment of the extracellular domain and transmembrane/cytoplasmic domains of RV-G was substituted with the corresponding regions of VSV-G. These two vectors afford the high efficiency of retrograde gene transfer into different neuronal populations in the brain. Here we investigated the efficiency of the HiRet (with FuG-B2 and NeuRet vectors for retrograde gene transfer into motor neurons in the spinal cord and hindbrain in mice after intramuscular injection and compared it with the efficiency of the RV-G pseudotype of the HIV-1-based vector. The main highlight of our results is that the HiRet vector shows the most efficient retrograde gene transfer into both spinal cord and hindbrain motor neurons, offering its promising use as a gene therapeutic approach for the treatment of motor neuron diseases.

  13. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    International Nuclear Information System (INIS)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references

  14. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.

  15. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  16. Paths of lateral gene transfer of lysyl-aminoacyl-tRNA synthetases with a unique evolutionary transition stage of prokaryotes coding for class I and II varieties by the same organisms

    Directory of Open Access Journals (Sweden)

    Nussinov Ruth

    2006-03-01

    Full Text Available Abstract Background While the premise that lateral gene transfer (LGT is a dominant evolutionary force is still in considerable dispute, the case for widespread LGT in the family of aminoacyl-tRNA synthetases (aaRS is no longer contentious. aaRSs are ancient enzymes, guarding the fidelity of the genetic code. They are clustered in two structurally unrelated classes. Only lysine aminoacyl-tRNA synthetase (LysRS is found both as a class 1 and a class 2 enzyme (LysRS1-2. Remarkably, in several extant prokaryotes both classes of the enzyme coexist, a unique phenomenon that has yet to receive its due attention. Results We applied a phylogenetic approach for determining the extent and origin of LGT in prokaryotic LysRS. Reconstructing species trees for Archaea and Bacteria, and inferring that their last common ancestors encoded LysRS1 and LysRS2, respectively, we studied the gains and losses of both classes. A complex pattern of LGT events emerged. In specific groups of organisms LysRS1 was replaced by LysRS2 (and vice versa. In one occasion, within the alpha proteobacteria, a LysRS2 to LysRS1 LGT was followed by reversal to LysRS2. After establishing the most likely LGT paths, we studied the possible origins of the laterally transferred genes. To this end, we reconstructed LysRS gene trees and evaluated the likely origins of the laterally transferred genes. While the sources of LysRS1 LGTs were readily identified, those for LysRS2 remain, for now, uncertain. The replacement of one LysRS by another apparently transits through a stage simultaneously coding for both synthetases, probably conferring a selective advantage to the affected organisms. Conclusion The family of LysRSs features complex LGT events. The currently available data were sufficient for identifying unambiguously the origins of LysRS1 but not of LysRS2 gene transfers. A selective advantage is suggested to organisms encoding simultaneously LysRS1-2.

  17. Correction of Fanconi Anemia Group C Hematopoietic Stem Cells Following Intrafemoral Gene Transfer

    Directory of Open Access Journals (Sweden)

    Ouassila Habi

    2010-01-01

    Full Text Available The main cause of morbidity and mortality in Fanconi anemia patients is the development of bone marrow (BM failure; thus correction of hematopoietic stem cells (HSCs through gene transfer approaches would benefit FA patients. However, gene therapy trials for FA patients using ex vivo transduction protocols have failed to provide long-term correction. In addition, ex vivo cultures have been found to be hazardous for FA cells. To circumvent negative effects of ex vivo culture in FA stem cells, we tested the corrective ability of direct injection of recombinant lentiviral particles encoding FancC-EGFP into femurs of FancC−/− mice. Using this approach, we show that FancC−/− HSCs were efficiently corrected. Intrafemoral gene transfer of the FancC gene prevented the mitomycin C-induced BM failure. Moreover, we show that intrafemoral gene delivery into aplastic marrow restored the bone marrow cellularity and corrected the remaining HSCs. These results provide evidence that targeting FA-deficient HSCs directly in their environment enables efficient and long-term correction of BM defects in FA.

  18. Quality of Interhospital Transfer Communication Practices and Association With Adverse Events on an Internal Medicine Hospitalist Service.

    Science.gov (United States)

    Borofsky, Jennifer S; Bartsch, Jason C; Howard, Alan B; Repp, Allen B

    Communication practices around interhospital transfer have not been rigorously assessed in adult medicine patients. Furthermore, the clinical implications of such practices have not been reported. This case-control study was designed to assess the quality of communication between clinicians during interhospital transfer and to determine if posttransfer adverse events (PTAEs) are associated with suboptimal communication. Cases included patients transferred to a Medicine Hospitalist Service from an outside hospital who subsequently experienced a PTAE, defined as unplanned transfer to an intensive care unit or death within 24 hours of transfer. Control patients also underwent interhospital transfer but did not experience a PTAE. A blinded investigator retrospectively reviewed the recorded pretransfer phone conversations between sending and receiving clinicians for adherence to a set of 13 empiric best practice communication elements. The primary outcome was the mean communication score, on a scale of 0-13. Mean scores between PTAE (8.3; 95% confidence interval [CI], 7.6-8.9) and control groups (7.9; 95% CI, 7.1-8.8) did not differ significantly (p = .50), although suboptimal communication on a subset of these elements was associated with increased PTAEs. Communication around interhospital transfer appears suboptimal compared with an empiric set of standard communication elements. Posttransfer adverse events were not associated with aggregate adherence to these standards.

  19. Light-controlled inhibition of malignant glioma by opsin gene transfer

    Science.gov (United States)

    Yang, F; Tu, J; Pan, J-Q; Luo, H-L; Liu, Y-H; Wan, J; Zhang, J; Wei, P-F; Jiang, T; Chen, Y-H; Wang, L-P

    2013-01-01

    Glioblastomas are aggressive cancers with low survival rates and poor prognosis because of their highly proliferative and invasive capacity. In the current study, we describe a new optogenetic strategy that selectively inhibits glioma cells through light-controlled membrane depolarization and cell death. Transfer of the engineered opsin ChETA (engineered Channelrhodopsin-2 variant) gene into primary human glioma cells or cell lines, but not normal astrocytes, unexpectedly decreased cell proliferation and increased mitochondria-dependent apoptosis, upon light stimulation. These optogenetic effects were mediated by membrane depolarization-induced reductions in cyclin expression and mitochondrial transmembrane potential. Importantly, the ChETA gene transfer and light illumination in mice significantly inhibited subcutaneous and intracranial glioma growth and increased the survival of the animals bearing the glioma. These results uncover an unexpected effect of opsin ion channels on glioma cells and offer the opportunity for the first time to treat glioma using a light-controllable optogenetic approach. PMID:24176851

  20. Gene transfer device utilizing micron-spiked electrodes produced by the self-organization phenomenon of Fe-alloy.

    Science.gov (United States)

    Miyano, Naoki; Inoue, Yuuki; Teramura, Yuji; Fujii, Keisuke; Tsumori, Fujio; Iwata, Hiroo; Kotera, Hidetoshi

    2008-07-01

    In the diffusional phase transformation of two-phase alloys, the new phase precipitates form the matrix phase at specific temperatures, followed by the formation of a mixed microstructure comprising the precipitate and the matrix. It has been found that by specific chemical-etching treatment, the precipitate in Fe-25Cr-6Ni alloy projects substantially and clusters at the surface. The configuration of the precipitate has an extremely high aspect ratio: it is several microns in width and several tens of microns in length (known as micron-spiked). This study targets the development of a gene transfer device with a micro-spike produced based on the self-organization phenomenon of the Fe-25Cr-6Ni alloy. With this spike-projected device, we tried to efficiently transfer plasmid DNA into adherent cells by electric pulse-triggered gene transfer using a plasmid-loaded electrode (electroporation-based reverse transfection). The spiked structure was applied to a substrate of the device to allow efficient gene transfer into adherent cells, although the general substrate was flat and had a smooth surface. The results suggest that this unique spike-projected device has potential applications in gene transfer devices for the analysis of the human genome in the post-genome period.

  1. Efficient gene transfer into silkworm larval tissues by a combination of sonoporation and lipofection.

    Science.gov (United States)

    Lee, Jae Man; Takahashi, Masateru; Mon, Hiroaki; Koga, Katsumi; Kawaguchi, Yutaka; Kusakabe, Takahiro

    2005-11-01

    Sonoporation (ultrasound treatment) provides a new and attractive nonviral way of in vivo gene transfer. To access the applicability of this method to the silkworm, Bombyx mori, we have compared the efficiencies of gene transfer by means of lipofection (using an appropriate agent, PDD111), sonoporation (ditto, FluoroGene), and lipofection followed by sonoporation. By these methods, a luciferase expression plasmid was found to be markedly transferred into the haemocoel of newly ecdysed fifth instar silkworm larvae, and also into other tissues although with lower rates compared with the haemocoel. In terms of luciferase activity, the efficiencies of transgene by lipofection plus sonoporation were approximately 6 (hemocytes), 20 (silk glands), 8 (mid-gut), 38 (fat body), 10 (Malpighian tubules), 33 (ovaries), and 16 (testes) times as high as those by lipofection or sonoporation alone. These results demonstrated that the present method is useful to introduce the exogenous DNA into insect organs in vivo.

  2. Gene Transfer Enhancement by Alkylcarboxylation of Poly(propylenimine

    Directory of Open Access Journals (Sweden)

    Maryam Hashemi

    2013-01-01

    Full Text Available Abstract Among synthetic carriers, dendrimers with the more flexible structure have attracted a great deal of researchers’ attention in the field of gene delivery. Followed by the promising results upon hydrophobic modification on polymeric structures in our laboratory, alkylcarboxylated poly (propylenimine-based carriers were synthesized by nucleophilic substitution of amines with alkyl moieties and were further characterized for their physicochemical and biological characteristics for plasmid DNA delivery. Although not noticeably effective gene transfer activity for hexanoate- and hexadecanoate-modified series was observed, but alkylation by decanoic acid significantly improved the transfection efficiency of the final constructs up to 60 fold in comparison with unmodified poly(propylenimine (PPI. PPI modified by 10-bromodecanoic acid at 50% grafting, showed significantly higher gene expression at c/p ratio of 2 compared to Superfect as positive control.  Overall, modification of PPI with 50% primary amines grafting with 10-bromodecanoic acid could increase the transfection efficiency which is occurred at lower c/p ratio when compared to Superfect, i.e. less amount of modified vector is required to exhibit the same efficiency as Superfect. Therefore, the obtained constructs seem to be safer carriers for long-term gene therapy applications.

  3. Plasmid transfer by conjugation as a possible route of horizontal gene transfer and recombination in Xylella fastidiosa

    Science.gov (United States)

    Horizontal gene transfer is an important component of evolution and adaptation of bacterial species. Xylella fastidiosa has the ability to incorporate exogenous DNA into its genome by homologous recombination at relatively high rates. This genetic recombination is believed to play a role in adaptati...

  4. An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.

    Directory of Open Access Journals (Sweden)

    Julius W Kim

    Full Text Available Vectors based on human adenovirus serotype 5 (HAdV-5 continue to show promise as delivery vehicles for cancer gene therapy. Nevertheless, it has become clear that therapeutic benefit is directly linked to tumor-specific vector localization, highlighting the need for tumor-targeted gene delivery. Aberrant glycosylation of cell surface glycoproteins and glycolipids is a central feature of malignant transformation, and tumor-associated glycoforms are recognized as cancer biomarkers. On this basis, we hypothesized that cancer-specific cell-surface glycans could be the basis of a novel paradigm in HAdV-5-based vector targeting.As a first step toward this goal, we constructed a novel HAdV-5 vector encoding a unique chimeric fiber protein that contains the tandem carbohydrate binding domains of the fiber protein of the NADC-1 strain of porcine adenovirus type 4 (PAdV-4. This glycan-targeted vector displays augmented CAR-independent gene transfer in cells with low CAR expression. Further, we show that gene transfer is markedly decreased in cells with genetic glycosylation defects and by inhibitors of glycosylation in normal cells.These data provide the initial proof-of-concept for HAdV-5 vector-mediated gene delivery based on the presence of cell-surface carbohydrates. Further development of this new targeting paradigm could provide targeted gene delivery based on vector recognition of disease-specific glycan biomarkers.

  5. Proton transfer events in GFP

    NARCIS (Netherlands)

    Di Donato, M.; van Wilderen, L.J.G.W.; van Stokkum, I.H.M.; Cohen Stuart, T.A.; Kennis, J.T.M.; Hellingwerf, K.J.; van Grondelle, R.; Groot, M.L.

    2011-01-01

    Proton transfer is one of the most important elementary processes in biology. Green fluorescent protein (GFP) serves as an important model system to elucidate the mechanistic details of this reaction, because in GFP proton transfer can be induced by light absorption. Illumination initiates proton

  6. Adventitial gene transfer of catalase attenuates angiotensin II-induced vascular remodeling.

    Science.gov (United States)

    Liu, Cun-Fei; Zhang, Jia; Shen, Kai; Gao, Ping-Jin; Wang, Hai-Ya; Jin, Xin; Meng, Chao; Fang, Ning-Yuan

    2015-04-01

    Vascular adventitia and adventitia‑derived reactive oxygen species (ROS) contribute to vascular remodeling following vascular injury. A previous ex vivo study in adventitial fibroblasts showed that catalase, one of most important anti‑oxide enzymes, was downregulated by angiotensin II (AngII). The aim of the present study was to investigate whether adventitial gene transfer of catalase affects AngII‑induced vascular remodeling in vivo. Adenoviruses co‑expressing catalase and enhanced green fluorescent protein (eGFP) or expressing eGFP only were applied to the adventitial surface of common carotid arteries of Sprague‑Dawley rats. Alzet minipumps administering AngII (0.75 mg/kg/day) were then implanted subcutaneously for 14 days. Systolic blood pressure and biological parameters of vascular remodeling were measured in each group. Adventitial fibroblasts were cultured and p38 mitogen‑activated protein kinase (MAPK) phosphorylation was measured using western blot analysis. The results showed that adventitial gene transfer of catalase had no effect on AngII‑induced systolic blood pressure elevation. However, catalase adenovirus transfection significantly inhibited AngII‑induced media hypertrophy compared with that of the control virus (Padventitial α‑smooth muscle actin expression. Furthermore, catalase transfection significantly inhibited the AngII‑induced increase in p38MAPK phosphorylation. In conclusion, the results of the present study demonstrated that adventitial gene transfer of catalase significantly attenuated AngII‑induced vascular remodeling in rats via inhibition of adventitial p38MAPK phosphorylation.

  7. Retroviral-mediated gene transfer and expression of human phenylalanine hydroxylase in primary mouse hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Peng, H.; Armentano, D.; Mackenzie-Graham, L.; Shen, R.F.; Darlington, G.; Ledley, F.D.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (USA))

    1988-11-01

    Genetic therapy for phenylketonuria (severe phenylalanine hydroxylase deficiency) may require introduction of a normal phenylalanine hydroxylase gene into hepatic cells of patients. The authors report development of a recombinant retrovirus based on the N2 vector for gene transfer and expression of human phenylalanine hydroxylase cDNA in primary mouse hepatocytes. This construct contains an internal promoter of the human {alpha}{sub 1}-antitrypsin gene driving transcription of the phenylalanine hydroxylase cDNA. Primary mouse hepatocytes were isolated from newborn mice, infected with the recombinant virus, and selected for expression of the neomycin-resistance gene. Hepatocytes transformed with the recombinant virus contained high levels of human phenylalanine hydroxylase mRNA transcripts originating from the retroviral and internal promoters. These results demonstrate that the transcriptional regulatory elements of the {alpha}{sub 1} antitrypsin gene retain their tissue-specific function in the recombinant provirus and establish a method for efficient transfer and high-level expression of human phenylalanine hydroxylase in primary hepatocytes.

  8. Retroviral-mediated gene transfer and expression of human phenylalanine hydroxylase in primary mouse hepatocytes

    International Nuclear Information System (INIS)

    Peng, H.; Armentano, D.; Mackenzie-Graham, L.; Shen, R.F.; Darlington, G.; Ledley, F.D.; Woo, S.L.C.

    1988-01-01

    Genetic therapy for phenylketonuria (severe phenylalanine hydroxylase deficiency) may require introduction of a normal phenylalanine hydroxylase gene into hepatic cells of patients. The authors report development of a recombinant retrovirus based on the N2 vector for gene transfer and expression of human phenylalanine hydroxylase cDNA in primary mouse hepatocytes. This construct contains an internal promoter of the human α 1 -antitrypsin gene driving transcription of the phenylalanine hydroxylase cDNA. Primary mouse hepatocytes were isolated from newborn mice, infected with the recombinant virus, and selected for expression of the neomycin-resistance gene. Hepatocytes transformed with the recombinant virus contained high levels of human phenylalanine hydroxylase mRNA transcripts originating from the retroviral and internal promoters. These results demonstrate that the transcriptional regulatory elements of the α 1 antitrypsin gene retain their tissue-specific function in the recombinant provirus and establish a method for efficient transfer and high-level expression of human phenylalanine hydroxylase in primary hepatocytes

  9. Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.

    Science.gov (United States)

    Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W

    2017-11-01

    Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. The qacC Gene Has Recently Spread between Rolling Circle Plasmids of Staphylococcus, Indicative of a Novel Gene Transfer Mechanism

    DEFF Research Database (Denmark)

    Wassenaar, Trudy M; Ussery, David W; Ingmer, Hanne

    2016-01-01

    and transferred to acceptor RC-plasmids without assistance of other genes, by means of its location in between the Double Strand replication Origin (DSO) and the Single-Strand replication Origin (SSO). The proposed mobilization model of this DSO-qacC-SSO element represents a novel mechanism of gene mobilization...

  12. Updated clusters of orthologous genes for Archaea: a complex ancestor of the Archaea and the byways of horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2012-12-01

    Full Text Available Abstract Background Collections of Clusters of Orthologous Genes (COGs provide indispensable tools for comparative genomic analysis, evolutionary reconstruction and functional annotation of new genomes. Initially, COGs were made for all complete genomes of cellular life forms that were available at the time. However, with the accumulation of thousands of complete genomes, construction of a comprehensive COG set has become extremely computationally demanding and prone to error propagation, necessitating the switch to taxon-specific COG collections. Previously, we reported the collection of COGs for 41 genomes of Archaea (arCOGs. Here we present a major update of the arCOGs and describe evolutionary reconstructions to reveal general trends in the evolution of Archaea. Results The updated version of the arCOG database incorporates 91% of the pangenome of 120 archaea (251,032 protein-coding genes altogether into 10,335 arCOGs. Using this new set of arCOGs, we performed maximum likelihood reconstruction of the genome content of archaeal ancestral forms and gene gain and loss events in archaeal evolution. This reconstruction shows that the last Common Ancestor of the extant Archaea was an organism of greater complexity than most of the extant archaea, probably with over 2,500 protein-coding genes. The subsequent evolution of almost all archaeal lineages was apparently dominated by gene loss resulting in genome streamlining. Overall, in the evolution of Archaea as well as a representative set of bacteria that was similarly analyzed for comparison, gene losses are estimated to outnumber gene gains at least 4 to 1. Analysis of specific patterns of gene gain in Archaea shows that, although some groups, in particular Halobacteria, acquire substantially more genes than others, on the whole, gene exchange between major groups of Archaea appears to be largely random, with no major ‘highways’ of horizontal gene transfer. Conclusions The updated collection

  13. CRISPR-cas-mediated phage resistance enhances horizontal gene transfer by transduction

    NARCIS (Netherlands)

    Watson, Bridget N.J.; Staals, Raymond H.J.; Fineran, Peter C.

    2018-01-01

    A powerful contributor to prokaryotic evolution is horizontal gene transfer (HGT) through transformation, conjugation, and transduction, which can be advantageous, neutral, or detrimental to fitness. Bacteria and archaea control HGT and phage infection through CRISPR-Cas (clustered regularly

  14. Using complementary approaches to identify trans-domain nuclear gene transfers in the extremophile Galdieria sulphuraria (Rhodophyta).

    Science.gov (United States)

    Pandey, Ravi S; Saxena, Garima; Bhattacharya, Debashish; Qiu, Huan; Azad, Rajeev K

    2017-02-01

    Identification of horizontal gene transfers (HGTs) has primarily relied on phylogenetic tree based methods, which require a rich sampling of sequenced genomes to ensure a reliable inference. Because the success of phylogenetic approaches depends on the breadth and depth of the database, researchers usually apply stringent filters to detect only the most likely gene transfers in the genomes of interest. One such study focused on a highly conservative estimate of trans-domain gene transfers in the extremophile eukaryote, Galdieria sulphuraria (Galdieri) Merola (Rhodophyta), by applying multiple filters in their phylogenetic pipeline. This led to the identification of 75 inter-domain acquisitions from Bacteria or Archaea. Because of the evolutionary, ecological, and potential biotechnological significance of foreign genes in algae, alternative approaches and pipelines complementing phylogenetics are needed for a more comprehensive assessment of HGT. We present here a novel pipeline that uncovered 17 novel foreign genes of prokaryotic origin in G. sulphuraria, results that are supported by multiple lines of evidence including composition-based, comparative data, and phylogenetics. These genes encode a variety of potentially adaptive functions, from metabolite transport to DNA repair. © 2016 Phycological Society of America.

  15. Ocular gene transfer in the spotlight: implications of newspaper content for clinical communications.

    Science.gov (United States)

    Benjaminy, Shelly; Bubela, Tania

    2014-07-16

    Ocular gene transfer clinical trials are raising hopes for blindness treatments and attracting media attention. News media provide an accessible health information source for patients and the public, but are often criticized for overemphasizing benefits and underplaying risks of novel biomedical interventions. Overly optimistic portrayals of unproven interventions may influence public and patient expectations; the latter may cause patients to downplay risks and over-emphasize benefits, with implications for informed consent for clinical trials. We analyze the news media communications landscape about ocular gene transfer and make recommendations for improving communications between clinicians and potential trial participants in light of media coverage. We analyzed leading newspaper articles about ocular gene transfer (1990-2012) from United States (n = 55), Canada (n = 26), and United Kingdom (n = 77) from Factiva and Canadian Newsstand databases using pre-defined coding categories. We evaluated the content of newspaper articles about ocular gene transfer for hereditary retinopathies, exploring representations of framing techniques, research design, risks/benefits, and translational timelines. The dominant frame in 61% of stories was a celebration of progress, followed by human-interest in 30% of stories. Missing from the positive frames were explanations of research design; articles conflated clinical research with treatment. Conflicts-of-interest and funding sources were similarly omitted. Attention was directed to the benefits of gene transfer, while risks were only reported in 43% of articles. A range of visual outcomes was described from slowing vision loss to cure, but the latter was the most frequently represented even though it is clinically infeasible. Despite the prominence of visual benefit portrayals, 87% of the articles failed to provide timelines for the commencement of clinical trials or for clinical implementation. Our analysis confirms

  16. Horizontal Transfer of Tetracycline Resistance Genes in the Subsurface of a Poultry Farm

    Science.gov (United States)

    You, Y.; Ward, M.; Hilpert, M.

    2008-12-01

    Concentrated animal feeding operations (CAFOs) are considered to be important man-made reservoirs of antibiotic resistant bacteria and antibiotic resistance genes. At a poultry farm, we, together with Mr.~James Doolittle from USDA, measured the apparent subsurface electrical conductivity (ECa) using a EM38 meter. The resulting ECaR) associated with the poultry farm due to the fact that tetracycline (Tc) is one of the most frequently used antibiotics in food animal production and therefore is probably used at this farm. Soil and aquifer samples were taken from the farm. TcR bacteria were detected, with higher concentrations in the top layer of soil than in the aquifer. TcR bacteria were then enriched from a soil sample, and two classes of TcR genes were detected: tet(M) genes encoding ribosomal protection proteins and tet(L) genes encoding tet efflux pumps. Sequences of the PCR products were compared to known tet(M) and tet(L) genes in GenBank using BLASTN. Phylogenetic trees were also built based on the sequence information. The tet(M) genes found in our soil sample were highly similar to those located on transposons. In a soil microcosm experiment, we used the aforementioned soil sample as incubation medium as well as genetic donor (TcR soil bacteria), and a green fluorescent strain of E. coli as a model genetic recipient to study horizontal transfer of TcR genes from soil bacteria to naïve bacteria. Concentrations of inoculated E. coli were continuously monitored for 15 days, TcR E. coli isolated, and colony PCR performed. The tet(M) genes were found to be transferred to naïve E. coli. The highest horizontal transfer ratio, 0.62 transconjugant per recipient, was observed when Tc was supplemented to a soil microcosm at a concentration of 140 μg/kg soil. Modeling is also ongoing to obtain a better understanding of this complex phenomenon.

  17. Low cytotoxicity effect of dendrosome as an efficient carrier for rotavirus VP2 gene transferring into a human lung cell line : dendrosome, as a novel intranasally gene porter.

    Science.gov (United States)

    Pourasgari, Farzaneh; Ahmadian, Shahin; Salmanian, Ali Hatef; Sarbolouki, Mohammad Nabi; Massumi, Mohammad

    2009-01-01

    The efficiency of dendrosome (a gene porter) was assessed in transferring recombinant human rotavirus VP2 cDNA into A549, a human lung cell line. After gene transferring, transmission electron microscopy showed core-like particles (CLPs) formation in the transfected cells both with dendrosome and lipofectamine porters. In addition, western blotting analysis showed that the expression of VP2 gene was almost equal in the dendrosome and lipofectamine-transfected cells. Also, the cytotoxicity studies revealed that dendrosome had a lower cytotoxicity than lipofectamine. Therefore, our study may introduce dendrosome as a possible carrier for gene transferring into the human lung cell line, especially, for intranasally administration of DNA vaccines.

  18. Reconciliation of Gene and Species Trees

    Directory of Open Access Journals (Sweden)

    L. Y. Rusin

    2014-01-01

    Full Text Available The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree.

  19. Low-frequency ultrasound increases non-viral gene transfer to the mouse lung.

    Science.gov (United States)

    Xenariou, Stefania; Liang, Hai-Dong; Griesenbach, Uta; Zhu, Jie; Farley, Raymond; Somerton, Lucinda; Singh, Charanjit; Jeffery, Peter K; Scheule, Ronald K; Cheng, Seng H; Geddes, Duncan M; Blomley, Martin; Alton, Eric W F W

    2010-01-01

    The aim of the study was to assess if low-frequency ultrasound (US), in the range of 30-35 kHz, increases non-viral gene transfer to the mouse lung. US is greatly attenuated in the lung due to large energy losses at the air/tissue interfaces. The advantages of low-frequency US, compared with high-frequency US are: (i) increased cavitation (responsible for the formation of transient pores in the cell membrane) and (ii) reduced energy losses during lung penetration. Cationic lipid GL67/plasmid DNA (pDNA), polyethylenimine (PEI)/pDNA and naked pDNA were delivered via intranasal instillation and the animals were then exposed to US (sonoporation) at 0.07 or 0.1 MPa for 10 min. Under these conditions, US did not enhance GL67 or PEI-mediated transfection. It did, however, increase naked pDNA gene transfer by approximately 4 folds. Importantly, this was achieved in the absence of microbubbles, which are crucial for the commonly used high-frequency (1 MHz) sonoporation but may not be able to withstand nebulization in a clinically relevant setup. Lung hemorrhage was also assessed and shown to increase with US pressure in a dose-dependent manner. We have thus, established that low-frequency US can enhance lung gene transfer with naked pDNA and this enhancement is more effective than the previously reported 1 MHz US.

  20. Exploration of new perspectives and limitations in Agrobacterium mediated gene transfer technology. Progress report, [June 1, 1992-- May 31, 1994

    Energy Technology Data Exchange (ETDEWEB)

    Marton, L.

    1994-12-31

    This report describes progress aimed at constructing gene-transfer technology for Nicotiana plumbaginifolia. Most actual effort as described herein has so far been directed at exploring new perspectives and limitations in Agrobacterium mediated gene transfer. Accomplishments are described using a core homologous gene targeting vector.

  1. Transcriptional regulation of pWW0 transfer genes in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    Lambertsen, L.M.; Molin, Søren; Kroer, N.

    2004-01-01

    The conjugative IncP-9 plasmid pWW0 (TOL) carries transfer genes, many of whose functions can be predicted from sequence similarities to the well-studied IncW and IncP-1 plasmids, and that are clustered with the replication and maintenance genes of the plasmid core. In this study we show that the...

  2. Horizontal gene transfer and mobile genetic elements in marine systems.

    Science.gov (United States)

    Sobecky, Patricia A; Hazen, Tracy H

    2009-01-01

    The pool of mobile genetic elements (MGE) in microbial communities consists of viruses, plasmids, and associated elements (insertion sequences, transposons, and integrons) that are either self-transmissible or use mobile plasmids and viruses as vehicles for their dissemination. This mobilome facilitates the horizontal transfer of genes that promote the evolution and adaptation of microbial communities. Efforts to characterize MGEs from microbial populations resident in a variety of ecological habitats have revealed a surprisingly novel and seemingly untapped biodiversity. To better understand the impact of horizontal gene transfer (HGT), as well as the agents that promote HGT in marine ecosystems and to determine whether or not environmental parameters can effect the composition and structure of the mobilome in marine microbial communities, information on the distribution, diversity, and ecological traits of the marine mobilome is presented. In this chapter we discuss recent insights gained from different methodological approaches used to characterize the biodiversity and ecology of MGE in marine environments and their contributions to HGT. In addition, we present case studies that highlight specific HGT examples in coastal, open-ocean, and deep-sea marine ecosystems.

  3. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi.

    Science.gov (United States)

    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana

    2015-10-05

    Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making-P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13-15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Force Balance at the Magnetopause Determined with MMS: Application to Flux Transfer Events

    Science.gov (United States)

    Zhao, C.; Russell, C. T.; Strangeway, R. J.; Petrinec, S. M.; Paterson, W. R.; Zhou, M.; Anderson, B. J.; Baumjohann, W.; Bromund, K. R.; Chutter, M.; hide

    2016-01-01

    The Magnetospheric Multiscale mission (MMS) consists of four identical spacecraft forming a closely separated (less than or equal to 10 km) and nearly regular tetrahedron. This configuration enables the decoupling of spatial and temporal variations and allows the calculation of the spatial gradients of plasma and electromagnetic field quantities. We make full use of the well cross-calibrated MMS magnetometers and fast plasma instruments measurements to calculate both the magnetic and plasma forces in flux transfer events (FTEs) and evaluate the relative contributions of different forces to the magnetopause momentum variation. This analysis demonstrates that some but not all FTEs, consistent with previous studies, are indeed force-free structures in which the magnetic pressure force balances the magnetic curvature force. Furthermore, we contrast these events with FTE events that have non-force-free signatures.

  5. Two hAT transposon genes were transferred from Brassicaceae to broomrapes and are actively expressed in some recipients

    Science.gov (United States)

    Sun, Ting; Renner, Susanne S.; Xu, Yuxing; Qin, Yan; Wu, Jianqiang; Sun, Guiling

    2016-01-01

    A growing body of evidence is pointing to an important role of horizontal gene transfer (HGT) in the evolution of higher plants. However, reports of HGTs of transposable elements (TEs) in plants are still scarce, and only one case is known of a class II transposon horizontally transferred between grasses. To investigate possible TE transfers in dicots, we performed transcriptome screening in the obligate root parasite Phelipanche aegyptiaca (Orobanchaceae), data-mining in the draft genome assemblies of four other Orobanchaceae, gene cloning, gene annotation in species with genomic information, and a molecular phylogenetic analysis. We discovered that the broomrape genera Phelipanche and Orobanche acquired two related nuclear genes (christened BO transposase genes), a new group of the hAT superfamily of class II transposons, from Asian Sisymbrieae or a closely related tribe of Brassicaceae, by HGT. The collinearity of the flanking genes, lack of a classic border structure, and low expression levels suggest that BO transposase genes cannot transpose in Brassicaceae, whereas they are highly expressed in P. aegyptiaca. PMID:27452947

  6. Ethical perception of cross-species gene transfer in plant | Amin ...

    African Journals Online (AJOL)

    Plants can be genetically modified through a variety of methods in the hope that it will be improved in some way to increase the yield and quality of a crop, or to add nutritional value or shelf life. The development of genetically modified (GM) rice to enrich its nutritional value, such as Vitamin C might involve gene transfer ...

  7. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

    1988-01-01

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  8. High-time resolution measurements of upstream magnetic field and plasma conditions during flux transfer events at the Earth's dayside magnetopause

    International Nuclear Information System (INIS)

    Jacob, J.D.; Cattell, C.

    1993-01-01

    This paper presents preliminary analysis of six flux transfer events which were observed simultaneously by IRM and CCE. IRM was able to measure magnetic fields and pressures far from the earth, while CCE made observations at the earth's magnetopause. The objective is to better understand the coupling of energy and momentum into the earth's magnetosphere, by in this case trying to better understand the processes active in flux transfer events. For three of the events the observations were made on common field lines, and IRM observed fluctuations in B z large enough to cause a south to north swing in the interplanetary magnetic field (IMF). Pressure pulses were observed during two of these events. For the other three events there was no such consistent behavior of IMF direction or pressure pulses

  9. Non-viral ex vivo hepatic gene transfer by in situ lipofection of liver and intraperitoneal transplantation of hepatocytes.

    Science.gov (United States)

    Rangarajan, P N; Vatsala, P G; Ashok, M S; Srinivas, V K; Habibullah, C M; Padmanaban, G

    1997-04-29

    Perfusion of liver with plasmid DNA-lipofectin complexes via the portal vein results in efficient accumulation of the vector in hepatocytes. Such hepatocytes, when administered intraperitoneally into a hepatectomized rat, repopulate the liver and express the transgene efficiently. This procedure obviates the need for large-scale hepatocyte culture for ex vivo gene transfer. Further, intraperitoneal transplantation is a simple and cost-effective strategy of introducing genetically modified hepatocytes into liver. Thus, in situ lipofection of liver and intraperitoneal transfer of hepatocytes can be developed into a novel method of non-viral ex vivo gene transfer technique that has applications in the treatment of metabolic disorders of liver and hepatic gene therapy.

  10. Recombinant adenovirus-mediated gene transfer suppresses experimental arthritis

    Directory of Open Access Journals (Sweden)

    E. Quattrocchi

    2011-09-01

    Full Text Available Collagen Induced Arthritis (CIA is a widely studied animal model to develop and test novel therapeutic approaches for treating Rheumatoid Arthritis (RA in humans. Soluble Cytotoxic T-Lymphocyte Antigen 4 (CTLA4-Ig, which binds B7 molecule on antigen presenting cells and blocks CD28 mediated T-lymphocyte activation, has been shown to ameliorate experimental autoimmune diseases such as lupus, diabetes and CIA. Objective of our research was to investigate in vivo the effectiveness of blocking the B7/CD28 T-lymphocyte co-stimulatory pathway, utilizing a gene transfer technology, as a therapeutic strategy against CIA. Replication-deficient adenoviruses encoding a chimeric CTLA4-Ig fusion protein, or β-galactosidase as control, have been injected intravenously once at arthritis onset. Disease activity has been monitored by the assessment of clinical score, paw thickness and type II collagen (CII specific cellular and humoral immune responses for 21 days. The adenovirally delivered CTLA4-Ig fusion protein at a dose of 2×108 pfu suppressed established CIA, whereas the control β-galactosidase did not significantly affect the disease course. CII-specific lymphocyte proliferation, IFNg production and anti-CII antibodies were significantly reduced by CTLA4-Ig treatment. Our results demonstrate that blockade of the B7/CD28 co-stimulatory pathway by adenovirus-mediated CTLA4-Ig gene transfer is effective in treating established CIA suggesting its potential in treating RA.

  11. Probing energy transfer events in the light harvesting complex 2 (LH2) of Rhodobacter sphaeroides with two-dimensional spectroscopy.

    Science.gov (United States)

    Fidler, Andrew F; Singh, Ved P; Long, Phillip D; Dahlberg, Peter D; Engel, Gregory S

    2013-10-21

    Excitation energy transfer events in the photosynthetic light harvesting complex 2 (LH2) of Rhodobacter sphaeroides are investigated with polarization controlled two-dimensional electronic spectroscopy. A spectrally broadened pulse allows simultaneous measurement of the energy transfer within and between the two absorption bands at 800 nm and 850 nm. The phased all-parallel polarization two-dimensional spectra resolve the initial events of energy transfer by separating the intra-band and inter-band relaxation processes across the two-dimensional map. The internal dynamics of the 800 nm region of the spectra are resolved as a cross peak that grows in on an ultrafast time scale, reflecting energy transfer between higher lying excitations of the B850 chromophores into the B800 states. We utilize a polarization sequence designed to highlight the initial excited state dynamics which uncovers an ultrafast transfer component between the two bands that was not observed in the all-parallel polarization data. We attribute the ultrafast transfer component to energy transfer from higher energy exciton states to lower energy states of the strongly coupled B850 chromophores. Connecting the spectroscopic signature to the molecular structure, we reveal multiple relaxation pathways including a cyclic transfer of energy between the two rings of the complex.

  12. Probing energy transfer events in the light harvesting complex 2 (LH2) of Rhodobacter sphaeroides with two-dimensional spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Fidler, Andrew F.; Singh, Ved P.; Engel, Gregory S. [Department of Chemistry, The Institute for Biophysical Dynamics, and The James Franck Institute, The University of Chicago, Chicago, Illinois 60637 (United States); Long, Phillip D.; Dahlberg, Peter D. [Graduate Program in the Biophysical Sciences, The University of Chicago, Chicago, Illinois 60637 (United States)

    2013-10-21

    Excitation energy transfer events in the photosynthetic light harvesting complex 2 (LH2) of Rhodobacter sphaeroides are investigated with polarization controlled two-dimensional electronic spectroscopy. A spectrally broadened pulse allows simultaneous measurement of the energy transfer within and between the two absorption bands at 800 nm and 850 nm. The phased all-parallel polarization two-dimensional spectra resolve the initial events of energy transfer by separating the intra-band and inter-band relaxation processes across the two-dimensional map. The internal dynamics of the 800 nm region of the spectra are resolved as a cross peak that grows in on an ultrafast time scale, reflecting energy transfer between higher lying excitations of the B850 chromophores into the B800 states. We utilize a polarization sequence designed to highlight the initial excited state dynamics which uncovers an ultrafast transfer component between the two bands that was not observed in the all-parallel polarization data. We attribute the ultrafast transfer component to energy transfer from higher energy exciton states to lower energy states of the strongly coupled B850 chromophores. Connecting the spectroscopic signature to the molecular structure, we reveal multiple relaxation pathways including a cyclic transfer of energy between the two rings of the complex.

  13. Probing energy transfer events in the light harvesting complex 2 (LH2) of Rhodobacter sphaeroides with two-dimensional spectroscopy

    International Nuclear Information System (INIS)

    Fidler, Andrew F.; Singh, Ved P.; Engel, Gregory S.; Long, Phillip D.; Dahlberg, Peter D.

    2013-01-01

    Excitation energy transfer events in the photosynthetic light harvesting complex 2 (LH2) of Rhodobacter sphaeroides are investigated with polarization controlled two-dimensional electronic spectroscopy. A spectrally broadened pulse allows simultaneous measurement of the energy transfer within and between the two absorption bands at 800 nm and 850 nm. The phased all-parallel polarization two-dimensional spectra resolve the initial events of energy transfer by separating the intra-band and inter-band relaxation processes across the two-dimensional map. The internal dynamics of the 800 nm region of the spectra are resolved as a cross peak that grows in on an ultrafast time scale, reflecting energy transfer between higher lying excitations of the B850 chromophores into the B800 states. We utilize a polarization sequence designed to highlight the initial excited state dynamics which uncovers an ultrafast transfer component between the two bands that was not observed in the all-parallel polarization data. We attribute the ultrafast transfer component to energy transfer from higher energy exciton states to lower energy states of the strongly coupled B850 chromophores. Connecting the spectroscopic signature to the molecular structure, we reveal multiple relaxation pathways including a cyclic transfer of energy between the two rings of the complex

  14. Widespread and highly persistent gene transfer to the CNS by retrovirus vector in utero: implication for gene therapy to Krabbe disease.

    Science.gov (United States)

    Shen, Jin-Song; Meng, Xing-Li; Yokoo, Takashi; Sakurai, Ken; Watabe, Kazuhiko; Ohashi, Toya; Eto, Yoshikatsu

    2005-05-01

    Brain-directed prenatal gene therapy may benefit some lysosomal storage diseases that affect the central nervous system (CNS) before birth. Our previous study showed that intrauterine introduction of recombinant adenoviruses into cerebral ventricles results in efficient gene transfer to the CNS in the mouse. However, transgene expression decreased with time due to the non-integrative property of adenoviral vectors. In this study, in order to obtain permanent gene transduction, we investigated the feasibility of retrovirus-mediated in utero gene transduction. Concentrated retrovirus encoding the LacZ gene was injected into the cerebral ventricles of the embryos of normal and twitcher mice (a murine model of Krabbe disease) at embryonic day 12. The distribution and maintenance of the transgene expression in the recipient brain were analyzed histochemically, biochemically and by the quantitative polymerase chain reaction method pre- and postnatally. Efficient and highly persistent gene transduction to the brain was achieved both in normal and the twitcher mouse. Transduced neurons, astrocytes and oligodendrocytes were distributed throughout the brain. The transduced LacZ gene, its transcript and protein expression in the brain were maintained for 14 months without decrement. In addition, gene transduction to multiple tissues other than the brain was also detected at low levels. This study suggests that brain-directed in utero gene transfer using retrovirus vector may be beneficial to the treatment of lysosomal storage diseases with severe brain damage early in life, such as Krabbe disease. Copyright (c) 2005 John Wiley & Sons, Ltd.

  15. Gene therapy strategy for long-term myocardial protection using adeno-associated virus-mediated delivery of heme oxygenase gene.

    Science.gov (United States)

    Melo, Luis G; Agrawal, Reitu; Zhang, Lunan; Rezvani, Mojgan; Mangi, Abeel A; Ehsan, Afshin; Griese, Daniel P; Dell'Acqua, Giorgio; Mann, Michael J; Oyama, Junichi; Yet, Shaw-Fang; Layne, Matthew D; Perrella, Mark A; Dzau, Victor J

    2002-02-05

    Ischemia and oxidative stress are the leading mechanisms for tissue injury. An ideal strategy for preventive/protective therapy would be to develop an approach that could confer long-term transgene expression and, consequently, tissue protection from repeated ischemia/reperfusion injury with a single administration of a therapeutic gene. In the present study, we used recombinant adeno-associated virus (rAAV) as a vector for direct delivery of the cytoprotective gene heme oxygenase-1 (HO-1) into the rat myocardium, with the purpose of evaluating this strategy as a therapeutic approach for long-term protection from ischemia-induced myocardial injury. Human HO-1 gene (hHO-1) was delivered to normal rat hearts by intramyocardial injection. AAV-mediated transfer of the hHO-1 gene 8 weeks before acute coronary artery ligation and release led to a dramatic reduction (>75%) in left ventricular myocardial infarction. The reduction in infarct size was accompanied by decreases in myocardial lipid peroxidation and in proapoptotic Bax and proinflammatory interleukin-1beta protein abundance, concomitant with an increase in antiapoptotic Bcl-2 protein level. This suggested that the transgene exerts its cardioprotective effects in part by reducing oxidative stress and associated inflammation and apoptotic cell death. This study documents the beneficial therapeutic effect of rAAV-mediated transfer, before myocardial injury, of a cytoprotective gene that confers long-term myocardial protection from ischemia/reperfusion injury. Our data suggest that this novel "pre-event" gene transfer approach may provide sustained tissue protection from future repeated episodes of injury and may be beneficial as preventive therapy for patients with or at risk of developing coronary ischemic events.

  16. Single cell genomics indicates horizontal gene transfer and viral infections in a deep subsurface Firmicutes population

    Directory of Open Access Journals (Sweden)

    Jessica eLabonté

    2015-04-01

    Full Text Available A major fraction of Earth's prokaryotic biomass dwells in the deep subsurface, where cellular abundances per volume of sample are lower, metabolism is slower, and generation times are longer than those in surface terrestrial and marine environments. How these conditions impact biotic interactions and evolutionary processes is largely unknown. Here we employed single cell genomics to analyze cell-to-cell genome content variability and signatures of horizontal gene transfer (HGT and viral infections in five cells of Candidatus Desulforudis audaxviator, which were collected from a three km-deep fracture water in the 2.9 Ga-old Witwatersrand Basin of South Africa. Between 0 and 32 % of genes recovered from single cells were not present in the original, metagenomic assembly of Desulforudis, which was obtained from a neighboring subsurface fracture. We found a transposable prophage, a retron, multiple clustered regularly interspaced short palindromic repeats (CRISPRs and restriction-modification systems, and an unusually high frequency of transposases in the analyzed single cell genomes. This indicates that recombination, HGT and viral infections are prevalent evolutionary events in the studied population of microorganisms inhabiting a highly stable deep subsurface environment.

  17. Unusual loss of chymosin in mammalian lineages parallels neo-natal immune transfer strategies.

    Science.gov (United States)

    Lopes-Marques, Mónica; Ruivo, Raquel; Fonseca, Elza; Teixeira, Ana; Castro, L Filipe C

    2017-11-01

    Gene duplication and loss are powerful drivers of evolutionary change. The role of loss in phenotypic diversification is notably illustrated by the variable enzymatic repertoire involved in vertebrate protein digestion. Among these we find the pepsin family of aspartic proteinases, including chymosin (Cmy). Previous studies demonstrated that Cmy, a neo-natal digestive pepsin, is inactivated in some primates, including humans. This pseudogenization event was hypothesized to result from the acquisition of maternal immune immunoglobulin G (IgG) transfer. By investigating 94 mammalian subgenomes we reveal an unprecedented level of Cmy erosion in placental mammals, with numerous independent events of gene loss taking place in Primates, Dermoptera, Rodentia, Cetacea and Perissodactyla. Our findings strongly suggest that the recurrent inactivation of Cmy correlates with the evolution of the passive transfer of IgG and uncovers a noteworthy case of evolutionary cross-talk between the digestive and the immune system, modulated by gene loss. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Motion of flux transfer events: a test of the Cooling model

    Directory of Open Access Journals (Sweden)

    R. C. Fear

    2007-07-01

    Full Text Available The simple model of reconnected field line motion developed by Cooling et al. (2001 has been used in several recent case studies to explain the motion of flux transfer events across the magnetopause. We examine 213 FTEs observed by all four Cluster spacecraft under a variety of IMF conditions between November 2002 and June 2003, when the spacecraft tetrahedron separation was ~5000 km. Observed velocities were calculated from multi-spacecraft timing analysis, and compared with the velocities predicted by the Cooling model in order to check the validity of the model. After excluding three categories of FTEs (events with poorly defined velocities, a significant velocity component out of the magnetopause surface, or a scale size of less than 5000 km, we were left with a sample of 118 events. 78% of these events were consistent in both direction of motion and speed with one of the two model de Hoffmann-Teller (dHT velocities calculated from the Cooling model (to within 30° and a factor of two in the speed. We also examined the plasma signatures of several magnetosheath FTEs; the electron signatures confirm the hemisphere of connection indicated by the model in most cases. This indicates that although the model is a simple one, it is a useful tool for identifying the source regions of FTEs.

  19. Comparisons of Salmonella conjugation and virulence gene hyperexpression mediated by rumen protozoa from domestic and exotic ruminants.

    Science.gov (United States)

    Brewer, Matt T; Xiong, Nalee; Dier, Jeffery D; Anderson, Kristi L; Rasmussen, Mark A; Franklin, Sharon K; Carlson, Steve A

    2011-08-05

    Recent studies have identified a phenomenon in which ciliated protozoa engulf Salmonella and the intra-protozoal environment hyperactivates virulence gene expression and provides a venue for conjugal transfer of antibiotic resistance plasmids. The former observation is relegated to Salmonella bearing the SGI1 multiresistance integron while the latter phenomenon appears to be a more generalized event for recipient Salmonella. Our previous studies have assessed virulence gene hyperexpression only with protozoa from the bovine rumen while conjugal transfer has been demonstrated in rumen protozoa from cattle and goats. The present study examined virulence gene hyperexpression for Salmonella exposed to rumen protozoa obtained from cattle, sheep, goats, or two African ruminants (giraffe and bongo). Conjugal transfer was also assessed in these protozoa using Salmonella as the recipient. Virulence gene hyperexpression was only observed following exposure to the rumen protozoa from cattle and sheep while elevated virulence was also observed in these animals. Conjugal transfer events were, however, observed in all protozoa evaluated. It therefore appears that the protozoa-based hypervirulence is not universal to all ruminants while conjugal transfer is more ubiquitous. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Evolutionary maintenance of selfish homing endonuclease genes in the absence of horizontal transfer.

    Science.gov (United States)

    Yahara, Koji; Fukuyo, Masaki; Sasaki, Akira; Kobayashi, Ichizo

    2009-11-03

    Homing endonuclease genes are "selfish" mobile genetic elements whose endonuclease promotes the spread of its own gene by creating a break at a specific target site and using the host machinery to repair the break by copying and inserting the gene at this site. Horizontal transfer across the boundary of a species or population within which mating takes place has been thought to be necessary for their evolutionary persistence. This is based on the assumption that they will become fixed in a host population, where opportunities of homing will disappear, and become susceptible to degeneration. To test this hypothesis, we modeled behavior of a homing endonuclease gene that moves during meiosis through double-strand break repair. We mathematically explored conditions for persistence of the homing endonuclease gene and elucidated their parameter dependence as phase diagrams. We found that, if the cost of the pseudogene is lower than that of the homing endonuclease gene, the 2 forms can persist in a population through autonomous periodic oscillation. If the cost of the pseudogene is higher, 2 types of dynamics appear that enable evolutionary persistence: bistability dependent on initial frequency or fixation irrespective of initial frequency. The prediction of long persistence in the absence of horizontal transfer was confirmed by stochastic simulations in finite populations. The average time to extinction of the endonuclease gene was found to be thousands of meiotic generations or more based on realistic parameter values. These results provide a solid theoretical basis for an understanding of these and other extremely selfish elements.

  1. Et tu, Brute? Not Even Intracellular Mutualistic Symbionts Escape Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Sergio López-Madrigal

    2017-09-01

    Full Text Available Many insect species maintain mutualistic relationships with endosymbiotic bacteria. In contrast to their free-living relatives, horizontal gene transfer (HGT has traditionally been considered rare in long-term endosymbionts. Nevertheless, meta-omics exploration of certain symbiotic models has unveiled an increasing number of bacteria-bacteria and bacteria-host genetic transfers. The abundance and function of transferred loci suggest that HGT might play a major role in the evolution of the corresponding consortia, enhancing their adaptive value or buffering detrimental effects derived from the reductive evolution of endosymbionts’ genomes. Here, we comprehensively review the HGT cases recorded to date in insect-bacteria mutualistic consortia, and discuss their impact on the evolutionary success of these associations.

  2. Interferon-β gene transfer induces a strong cytotoxic bystander effect on melanoma cells.

    Science.gov (United States)

    Rossi, Úrsula A; Gil-Cardeza, María L; Villaverde, Marcela S; Finocchiaro, Liliana M E; Glikin, Gerardo C

    2015-05-01

    A local gene therapy scheme for the delivery of type I interferons could be an alternative for the treatment of melanoma. We evaluated the cytotoxic effects of interferon-β (IFNβ) gene lipofection on tumor cell lines derived from three human cutaneous and four canine mucosal melanomas. The cytotoxicity of human IFNβ gene lipofection resulted higher or equivalent to that of the corresponding addition of the recombinant protein (rhIFNβ) to human cells. IFNβ gene lipofection was not cytotoxic for only one canine melanoma cell line. When cultured as monolayers, three human and three canine IFNβ-lipofected melanoma cell lines displayed a remarkable bystander effect. As spheroids, the same six cell lines were sensitive to IFNβ gene transfer, two displaying a significant multicell resistance phenotype. The effects of conditioned IFNβ-lipofected canine melanoma cell culture media suggested the release of at least one soluble thermolabile cytotoxic factor that could not be detected in human melanoma cells. By using a secretion signal-free truncated human IFNβ, we showed that its intracellular expression was enough to induce cytotoxicity in two human melanoma cell lines. The lower cytoplasmatic levels of reactive oxygen species detected after intracellular IFNβ expression could be related to the resistance displayed by one human melanoma cell line. As IFNβ gene transfer was effective against most of the assayed melanomas in a way not limited by relatively low lipofection efficiencies, the clinical potential of this approach is strongly supported. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. An efficient marker-free vector for clean gene transfer into plants ...

    African Journals Online (AJOL)

    A marker-free vector, pBINMF, for clean gene transfer was constructed based on the binary vector pBINPLUS. Vector pBINMF, carrying only a multiple cloning site (MCS) between the left and the right T-DNA border, was suitable to directly generate marker-free transgenic plants (MFTPs) without any vector sequences ...

  4. Identification of the rctA Gene, Which Is Required for Repression of Conjugative Transfer of Rhizobial Symbiotic Megaplasmids†

    Science.gov (United States)

    Pérez-Mendoza, Daniel; Sepúlveda, Edgardo; Pando, Victoria; Muñoz, Socorro; Nogales, Joaquina; Olivares, José; Soto, Maria J.; Herrera-Cervera, José A.; Romero, David; Brom, Susana; Sanjuán, Juan

    2005-01-01

    An analysis of the conjugative transfer of pRetCFN42d, the symbiotic plasmid (pSym) of Rhizobium etli, has revealed a novel gene, rctA, as an essential element of a regulatory system for silencing the conjugative transfer of R. etli pSym by repressing the transcription of conjugal transfer genes in standard laboratory media. The rctA gene product lacks sequence conservation with other proteins of known function but may belong to the winged-helix DNA-binding subfamily of transcriptional regulators. Similar to that of many transcriptional repressors, rctA transcription seems to be positively autoregulated. rctA expression is greatly reduced upon overexpression of another gene, rctB, previously identified as a putative activator of R. etli pSym conjugal transfer. Thus, rctB seems to counteract the repressive action of rctA. rctA homologs are present in at least three other bacterial genomes within the order Rhizobiales, where they are invariably located adjacent to and divergently transcribed from putative virB-like operons. We show that similar to that of R. etli pSym, conjugative transfer of the 1.35-Mb symbiotic megaplasmid A of Sinorhizobium meliloti is also subjected to the inhibitory action of rctA. Our data provide strong evidence that the R. etli and S. meliloti pSym plasmids are indeed self-conjugative plasmids and that this property would only be expressed under optimal, as yet unknown conditions that entail inactivation of the rctA function. The rctA gene seems to represent novel but probably widespread regulatory systems controlling the transfer of conjugative elements within the order Rhizobiales. PMID:16237017

  5. Phylogenetic inference in Rafflesiales: the influence of rate heterogeneity and horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Vidal-Russell Romina

    2004-10-01

    Full Text Available Abstract Background The phylogenetic relationships among the holoparasites of Rafflesiales have remained enigmatic for over a century. Recent molecular phylogenetic studies using the mitochondrial matR gene placed Rafflesia, Rhizanthes and Sapria (Rafflesiaceae s. str. in the angiosperm order Malpighiales and Mitrastema (Mitrastemonaceae in Ericales. These phylogenetic studies did not, however, sample two additional groups traditionally classified within Rafflesiales (Apodantheaceae and Cytinaceae. Here we provide molecular phylogenetic evidence using DNA sequence data from mitochondrial and nuclear genes for representatives of all genera in Rafflesiales. Results Our analyses indicate that the phylogenetic affinities of the large-flowered clade and Mitrastema, ascertained using mitochondrial matR, are congruent with results from nuclear SSU rDNA when these data are analyzed using maximum likelihood and Bayesian methods. The relationship of Cytinaceae to Malvales was recovered in all analyses. Relationships between Apodanthaceae and photosynthetic angiosperms varied depending upon the data partition: Malvales (3-gene, Cucurbitales (matR or Fabales (atp1. The latter incongruencies suggest that horizontal gene transfer (HGT may be affecting the mitochondrial gene topologies. The lack of association between Mitrastema and Ericales using atp1 is suggestive of HGT, but greater sampling within eudicots is needed to test this hypothesis further. Conclusions Rafflesiales are not monophyletic but composed of three or four independent lineages (families: Rafflesiaceae, Mitrastemonaceae, Apodanthaceae and Cytinaceae. Long-branch attraction appears to be misleading parsimony analyses of nuclear small-subunit rDNA data, but model-based methods (maximum likelihood and Bayesian analyses recover a topology that is congruent with the mitochondrial matR gene tree, thus providing compelling evidence for organismal relationships. Horizontal gene transfer appears to

  6. Evolutionary Significance of Wolbachia-to-Animal Horizontal Gene Transfer: Female Sex Determination and the f Element in the Isopod Armadillidium vulgare.

    Science.gov (United States)

    Cordaux, Richard; Gilbert, Clément

    2017-07-21

    An increasing number of horizontal gene transfer (HGT) events from bacteria to animals have been reported in the past years, many of which involve Wolbachia bacterial endosymbionts and their invertebrate hosts. Most transferred Wolbachia genes are neutrally-evolving fossils embedded in host genomes. A remarkable case of Wolbachia HGT for which a clear evolutionary significance has been demonstrated is the " f element", a nuclear Wolbachia insert involved in female sex determination in the terrestrial isopod Armadillidium vulgare . The f element represents an instance of bacteria-to-animal HGT that has occurred so recently that it was possible to infer the donor (feminizing Wolbachia closely related to the w VulC Wolbachia strain of A. vulgare ) and the mechanism of integration (a nearly complete genome inserted by micro-homology-mediated recombination). In this review, we summarize our current knowledge of the f element and discuss arising perspectives regarding female sex determination, unstable inheritance, population dynamics and the molecular evolution of the f element. Overall, the f element unifies three major areas in evolutionary biology: symbiosis, HGT and sex determination. Its characterization highlights the tremendous impact sex ratio distorters can have on the evolution of sex determination mechanisms and sex chromosomes in animals and plants.

  7. Evolutionary Significance of Wolbachia-to-Animal Horizontal Gene Transfer: Female Sex Determination and the f Element in the Isopod Armadillidium vulgare

    Directory of Open Access Journals (Sweden)

    Richard Cordaux

    2017-07-01

    Full Text Available An increasing number of horizontal gene transfer (HGT events from bacteria to animals have been reported in the past years, many of which involve Wolbachia bacterial endosymbionts and their invertebrate hosts. Most transferred Wolbachia genes are neutrally-evolving fossils embedded in host genomes. A remarkable case of Wolbachia HGT for which a clear evolutionary significance has been demonstrated is the “f element”, a nuclear Wolbachia insert involved in female sex determination in the terrestrial isopod Armadillidium vulgare. The f element represents an instance of bacteria-to-animal HGT that has occurred so recently that it was possible to infer the donor (feminizing Wolbachia closely related to the wVulC Wolbachia strain of A. vulgare and the mechanism of integration (a nearly complete genome inserted by micro-homology-mediated recombination. In this review, we summarize our current knowledge of the f element and discuss arising perspectives regarding female sex determination, unstable inheritance, population dynamics and the molecular evolution of the f element. Overall, the f element unifies three major areas in evolutionary biology: symbiosis, HGT and sex determination. Its characterization highlights the tremendous impact sex ratio distorters can have on the evolution of sex determination mechanisms and sex chromosomes in animals and plants.

  8. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer.

    Science.gov (United States)

    Buchlis, George; Podsakoff, Gregory M; Radu, Antonetta; Hawk, Sarah M; Flake, Alan W; Mingozzi, Federico; High, Katherine A

    2012-03-29

    In previous work we transferred a human factor IX-encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer.

  9. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    Science.gov (United States)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  10. Large-scale event extraction from literature with multi-level gene normalization.

    Directory of Open Access Journals (Sweden)

    Sofie Van Landeghem

    Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from

  11. On flares, substorms and the theory of impulsive flux transfer events

    International Nuclear Information System (INIS)

    Bratenahl, A.; Baum, P.J.

    1976-01-01

    Solar flares and magnetospheric substorms are discussed in the context of a general theory of impulsive flux transfer events (IFTE). IFTE theory, derived from laboratory observations in the Double Inverse Pinch Device (DIPD), provides a quantitative extension of 'neutral sheet' theories to include nonsteady field line reconnection. Current flow along the reconnection line increases with magnetic flux storage. When flux build-up exceeds the level corresponding to a critical limit on the current, instabilities induce a sudden transition in the mode of conduction. The resulting IFTE, indifferent to the specific modes and instabilities involved, is the more energetic, the lower the initial resistivity. It is the more violent, the greater the resulting resistivity increase and the faster its growth. Violent events can develop very large voltage transients along the reconnection line. Persistent build-up promoting conditions produce relaxation oscillations in the quantity of flux and energy stored (build-up-IFTE cycles). It is difficult to avoid the conclusion: flares and substorms are examples of IFTE. (Auth.)

  12. Discrete event simulation for petroleum transfers involving harbors, refineries and pipelines

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Marcella S.R.; Lueders, Ricardo; Delgado, Myriam R.B.S. [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil)

    2009-07-01

    Nowadays a great effort has been spent by companies to improve their logistics in terms of programming of events that affect production and distribution of products. In this case, simulation can be a valuable tool for evaluating different behaviors. The objective of this work is to build a discrete event simulation model for scheduling of operational activities in complexes containing one harbor and two refineries interconnected by a pipeline infrastructure. The model was developed in Arena package, based on three sub-models that control pier allocation, loading of tanks, and transfers to refineries through pipelines. Preliminary results obtained for a given control policy, show that profit can be calculated by taking into account many parameters such as oil costs on ships, pier using, over-stay of ships and interface costs. Such problem has already been considered in the literature but using different strategies. All these factors should be considered in a real-world operation where decision making tools are necessary to obtain high returns. (author)

  13. A survey of flux transfer events observed in the dayside magnetopause

    Science.gov (United States)

    Silveira, M. D.; Sibeck, D. G.; Lee, S. H.; Gonzalez, W.; Koga, D.

    2017-12-01

    Flux transfer events (FTE) have been interpreted to be results from transient magnetic reconnection and can be observed in the vicinity of the Earth's magnetopause, as well in other planets. FTE acts as a flux tube connecting the magnetosheath to the magnetosphere allowing the transference of particles, energy and momentum in both sides magnetopause. Their main signatures in satellite data are bipolar variation in the magnetic field component normal to the magnetopause, centered in an enhanced magnetic field strength. Other signatures such as pressure imbalance, bulk flow jets, and particle anisotropy distribution can be observed inside the those structures. We surveyed FTEs observed by MMS on the vicinity of the magnetopause (from x = 0 to 13Re and y = -12 to 12Re). Taking advantage of the MMS tetrahedron configuration we will employed timing analysis to determine the FTEs direction of motion and scale lengths. We will present information about occurrence related with IMF clock angle and other parameters, amplitude of the perturbations induced by the FTEs in the environment magnetic field and plasma; characteristic time and structure scale size. Using data from ACE, Wind and Artemis we can evaluate which is the best solar wind monitor for each FTE observed and then employ the appropriated lag time corresponding to FTE location and magnetic field orientation. The objective is to investigate the mechanisms of generation of FTEs comparing characteristics of the events observed on the dayside region and on the magnetopause flanks determining the motion and speed of FTEs.

  14. Horizontal transfer of a nitrate assimilation gene cluster and ecological transitions in fungi: a phylogenetic study.

    Directory of Open Access Journals (Sweden)

    Jason C Slot

    Full Text Available High affinity nitrate assimilation genes in fungi occur in a cluster (fHANT-AC that can be coordinately regulated. The clustered genes include nrt2, which codes for a high affinity nitrate transporter; euknr, which codes for nitrate reductase; and NAD(PH-nir, which codes for nitrite reductase. Homologs of genes in the fHANT-AC occur in other eukaryotes and prokaryotes, but they have only been found clustered in the oomycete Phytophthora (heterokonts. We performed independent and concatenated phylogenetic analyses of homologs of all three genes in the fHANT-AC. Phylogenetic analyses limited to fungal sequences suggest that the fHANT-AC has been transferred horizontally from a basidiomycete (mushrooms and smuts to an ancestor of the ascomycetous mold Trichoderma reesei. Phylogenetic analyses of sequences from diverse eukaryotes and eubacteria, and cluster structure, are consistent with a hypothesis that the fHANT-AC was assembled in a lineage leading to the oomycetes and was subsequently transferred to the Dikarya (Ascomycota+Basidiomycota, which is a derived fungal clade that includes the vast majority of terrestrial fungi. We propose that the acquisition of high affinity nitrate assimilation contributed to the success of Dikarya on land by allowing exploitation of nitrate in aerobic soils, and the subsequent transfer of a complete assimilation cluster improved the fitness of T. reesei in a new niche. Horizontal transmission of this cluster of functionally integrated genes supports the "selfish operon" hypothesis for maintenance of gene clusters.

  15. DNA-mediated gene transfer into human diploid fibroblasts derived from normal and ataxia-telangiectasia donors: parameters for DNA transfer and properties of DNA transformants

    International Nuclear Information System (INIS)

    Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.

    1984-01-01

    An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)

  16. Status of therapeutic gene transfer to treat canine dilated cardiomyopathy in dogs.

    Science.gov (United States)

    Sleeper, Meg M; Bish, Lawrence T; Sweeney, H Lee

    2010-07-01

    Therapeutic gene transfer holds promise as a way to treat dilated cardiomyopathy from any underlying cause because the approach attempts to address metabolic disturbances that occur at the molecular level of the failing heart. Calcium-handling abnormalities and increased rates of apoptosis are abnormalities that occur in many types of heart disease, and gene therapies that target these metabolic defects have proven to be beneficial in numerous rodent models of heart disease. The authors are currently evaluating this approach to treat canine idiopathic dilated cardiomyopathy.

  17. Identification of a Divided Genome for VSH-1, the Prophage-Like Gene Transfer Agent of Brachyspira hyodysenteriae

    Science.gov (United States)

    The Brachyspira hyodysenteriae B204 genome sequence revealed three VSH-1 tail genes hvp31, hvp60, and hvp37, in a 3.6 kb cluster. The location and transcription direction of these genes relative to the previously described VSH-1 16.3 kb gene operon indicate that the gene transfer agent VSH-1 has a ...

  18. Niewirusowy transfer genów do komórek skóry – wybrane metody = Non-viral gene transfer into skin cells – selected methods

    Directory of Open Access Journals (Sweden)

    Ewelina Wędrowska

    2016-01-01

    3Department of Pathobiochemistry and Clinical Chemistry, Nicolaus Copernicus University Collegium Medicum, Bydgoszcz, Poland       Streszczenie   Wprowadzenie: Skóra jako największy i najłatwiej dostępny narząd stanowi atrakcyjny cel dla terapii genowej, która od wielu lat budzi ogromne nadzieje środowiska naukowego. Jednakże, próby terapii przeprowadzone z wykorzystaniem wektorów wirusowych wykazały szereg wad i ograniczeń m.in. obserwowano indukcję odpowiedzi immunologicznej, losową integrację transgenu z genomem gospodarza i/lub niską wydajność jego ekspresji. Dlatego, wciąż poszukuje się alternatywnych, skuteczniejszych i jednocześnie bezpieczniejszych metod transferu genów. Atrakcyjnej alternatywy upatruje się w metodach niewirusowych. Cel pracy: Przedstawienie wybranych metod niewirusowego transferu genów wykorzystywanych w terapii genowej chorób skóry. Skrócony opis stanu wiedzy: Terapia genowa chorób skóry obejmuje wykorzystanie wektorów plazmidowych jako nośnika genów terapeutycznych, a także metod ich dostarczania do komórek takich jak: elektroporacja, mikroiniekcja, sonikacja, wykorzystanie nośników lipidowych i polimerów kationowych. Podsumowanie: Niewirusowe metody transferu genów oferują pewne zalety włączając niską toksyczność, brak infekcyjności oraz łatwość i niskie koszty produkcji w porównaniu z technikami wirusowymi. Niewirusowe metody wydają się być obiecującym narzędziem terapii genowej chorób skóry w szczególności nowotworów tego narządu.   Słowa kluczowe: plazmid, transfer genów, skóra, wirus, terapia genowa.     Summary Introduction: Skin, the largest and most accessible organ of the human body is considered as an ideal gene therapy target. However, various types of viral vectors used in classical gene therapy have a number of disadvantages, such as possibility of immune response induction, random integration of inserts into the host genome or low expression efficiency

  19. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  20. Complementation of a threonine dehydratase-deficient Nicotiana plumbaginifolia mutant after Agrobacterium tumefaciens-mediated transfer of the Saccharomyces cerevisiae ILV1 gene.

    OpenAIRE

    Colau, D; Negrutiu, I; Van Montagu, M; Hernalsteens, J P

    1987-01-01

    The Saccharomyces cerevisiae ILV1 gene, encoding threonine dehydratase (EC 4.2.1.16) was fused to the transferred DNA nopaline synthase promoter and the 3' noncoding region of the octopine synthase gene. It was introduced, by Agrobacterium tumefaciens-mediated gene transfer, into an isoleucine-requiring Nicotiana plumbaginifolia auxotroph deficient in threonine dehydratase. Functional complementation by the ILV1 gene product was demonstrated by the selection of several transformed lines on a ...

  1. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  2. Modifier Genes for Mouse Phosphatidylinositol Transfer Protein alpha (vibrator) That Bypass Juvenile Lethality

    NARCIS (Netherlands)

    Concepcion, Dorothy; Johannes, Frank; Lo, Yuan Hung; Yao, Jay; Fong, Jerry; Hamilton, Bruce A.

    Phosphatidylinositol transfer proteins (PITPs) mediate lipid signaling and membrane trafficking in eukaryotic cells. Loss-of-function mutations of the gene encoding PITP alpha in mice result in a range of dosage-sensitive phenotypes, including neurological dysfunction, neurodegeneration, and

  3. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    Directory of Open Access Journals (Sweden)

    Bradon R. McDonald

    2017-06-01

    Full Text Available Lateral gene transfer (LGT profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. Here, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genus Streptomyces. Using a molecular clock, we estimate that the Streptomyces bacteria are ~380 million years old, indicating that this bacterial genus is as ancient as land vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span, Streptomyces accumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution.

  4. Improving the Safety of Cell Therapy Products by Suicide Gene Transfer

    Directory of Open Access Journals (Sweden)

    Antonio eDi Stasi

    2014-11-01

    Full Text Available Adoptive T-cell therapy can involve donor lymphocyte infusion (DLI after allogeneic hematopoietic stem cell transplantation, the administration of tumor infiltrating lymphocyte (TILs expanded ex-vivo, or more recently the use of T cell receptor (TCR or chimeric antigen receptor (CAR redirected T cells. However cellular therapies can pose significant risks, including graft-versus-host-disease and other on and off-target effects, and therefore strategies need to be implemented to permanently reverse any sign of toxicity. A suicide gene is a genetically encoded molecule that allows selective destruction of adoptively transferred cells. Suicide gene addition to cellular therapeutic products can lead to selective ablation of gene-modified cells, preventing collateral damage to contiguous cells and/or tissues. The ‘ideal’ suicide gene would ensure the safety of gene modified cellular applications by granting irreversible elimination of ‘all’ and ‘only’ the cells responsible for the unwanted toxicity. This review presents the suicide gene safety systems reported to date, with a focus on the state-of-the-art and potential applications regarding two of the most extensively validated suicide genes, including the clinical setting: herpes-simplex-thymidine-kinase (HSV-TK and inducible-caspase-9 (iCasp9.

  5. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Choi, Seong-Jun [Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Shim, Hosup, E-mail: shim@dku.edu [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Department of Physiology, Dankook University School of Medicine, Cheonan (Korea, Republic of)

    2014-10-03

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.

  6. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    International Nuclear Information System (INIS)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung; Choi, Seong-Jun; Shim, Hosup

    2014-01-01

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies

  7. Topology of magnetic flux ropes and formation of fossil flux transfer events and boundary layer plasmas

    Science.gov (United States)

    Lee, L. C.; Ma, Z. W.; Fu, Z. F.; Otto, A.

    1993-01-01

    A mechanism for the formation of fossil flux transfer events and the low-level boundary layer within the framework of multiple X-line reconnection is proposed. Attention is given to conditions for which the bulk of magnetic flux in a flux rope of finite extent has a simple magnetic topology, where the four possible connections of magnetic field lines are: IMF to MSP, MSP to IMF, IMF to IMF, and MSP to MSP. For a sufficient relative shift of the X lines, magnetic flux may enter a flux rope from the magnetosphere and exit into the magnetosphere. This process leads to the formation of magnetic flux ropes which contain a considerable amount of magnetosheath plasma on closed magnetospheric field lines. This process is discussed as a possible explanation for the formation of fossil flux transfer events in the magnetosphere and the formation of the low-latitude boundary layer.

  8. Enhanced Gene Transfer with Fusogenic Liposomes Containing Vesicular Stomatitis Virus G Glycoprotein

    Science.gov (United States)

    Abe, Akihiro; Miyanohara, Atsushi; Friedmann, Theodore

    1998-01-01

    Exposure of Lipofectin-DNA complexes to the partially purified G glycoprotein of the vesicular stomatitis virus envelope (VSV-G) results in loss of serum-mediated inhibition and in enhanced efficiency of gene transfer. Sucrose density gradient sedimentation analysis indicated that the VSV-G associates physically with the DNA-lipid complex to produce a VSV-G liposome. The ability to incorporate surrogate viral or cellular envelope components such as VSV-G into liposomes may allow more-efficient and possibly targeted gene delivery by lipofection, both in vitro and in vivo. PMID:9621082

  9. The Extent and Regulation of Lateral Gene Transfer in Natural Microbial Ecosystems

    DEFF Research Database (Denmark)

    Aminov, Rustam I.

    2012-01-01

    of bacteria through lateral gene exchange is the history of antibiotic use by humans. Within a very brief period of the 'antibiotic era' many bacterial pathogens were able to acquire the mechanisms allowing them to withstand the selective pressure of antibiotics. And, finally, field and microcosm studies......The importance of horizontal gene transfer (HGT) in bacterial evolution is evident from the retrospective analyses of bacterial genomes, which suggest that a substantial part of bacterial genomes is of foreign origin. Another line of evidence that supports the possibility of rapid adaptation...

  10. On the quasi-periodic nature of magnetopause flux transfer events

    International Nuclear Information System (INIS)

    Lockwood, M.; Wild, M.N.

    1993-01-01

    The authors look at the interpretation of magnetopause flux transfer events (FTE), which claims to show that these events are quasi periodic with a mean period of about 8 minutes. FTE are characteristic signatures in the magnetic field observed by satellites in or near the magnetopause. They are mainly observed when the interplanetary magnetic field is southward, as is supported by a wide range of experimental evidence. There are several theoretical models which try to explain these events. The most successful to date is based upon a suggestion made by Saunders and Biernat, et al. This model has the advantage of accounting for some of the ground based observations of these events. It has been suggested that FTE represent bursts of enhanced magnetic reconnection, and may be the dominant mechanism of this solar wind-magnetosphere coupling. The authors also look at the variability of the IMF B z component as a potential source of the periodic FTE. Data from the ISEE 1 and 2 spacecraft taken during 1977 to 1979 were statistically surveyed for this report. The spacecraft crossed the magnetopause more than 172 times, and could observe FTE for typically 1 hr per pass. Data for the IMF came from the IMP8 spacecraft. Little data was available for the period of interest, but for the subsequent phase of the solar cycle there was considerable coverage. The data analysis shows a highly skewed recurrence period, with a mode of 3 min., and a lower and upper decile of 1.5 and 18.5 min. No significant peak is observed at 8 minutes. The shape of the distribution does not lend itself to any natural period of the magnetosphere-ionosphere system. There may be a correlation with the B z component of the IMF, but the correlation suffers most from the variability of the IMF dataset

  11. Global modeling of flux transfer events: generation mechanism and spacecraft signatures

    Science.gov (United States)

    Raeder, J.

    2003-04-01

    Magnetic reconnection is a fundamental mode of energy and momentum transfer from the solar wind to the magnetosphere. It is known to occur in different forms depending on solar wind and magnetospheric conditions. In particular, steady reconnection can be distinguished from pulse-like reconnection events which are also known as Flux Transfer Events (FTEs). The formation mechanism of FTEs and their contolling factors remain controversial. We use global MHD simulations of Earth's magnetosphere to show that for southward IMF conditions: a) steady reconnection preferentially occurs without FTEs when the stagnation flow line nearly coincides with the X-line location, which requires small dipole tilt and nearly due southward IMF, b) FTEs occur when the flow/field symmetry is broken, which requires either a large dipole tilt and/or a substantial east-west component of the IMF, c) the predicted spacecraft signature and the repetition frequency of FTEs in the simulations agrees very well with typical observations, lending credibility to the the model, d) the fundamental process that leads to FTE formation is multiple X-line formation caused by the flow and field patterns in the magnetosheath and requires no intrinsic plasma property variations like variable resistivity, e) if the dipole tilt breaks the symmetry FTEs occur only in the winter hemisphere whereas the reconnection signatures in the summer hemisphere are steady with no bipolar FTE-like signatures, f) if the IMF east-west field component breaks the symmetry FTEs occur in both hemispheres, and g) FTE formation depends on sufficient resolution and low diffusion in the model -- coarse resolution and/or high diffusivity lead to flow-through reconnection signatures that appear unphysical given the frequent observation of FTEs.

  12. Unraveling the Nature of Steady Magnetopause Reconnection Versus Flux Transfer Events

    Science.gov (United States)

    Raeder, J.

    2002-12-01

    Magnetic reconnection is a fundamental mode of energy and momentum transfer from the solar wind to the magnetosphere. It is known to occur in different forms depending on solar wind and magnetospheric conditions. In particular, steady reconnection can be distinguished from pulse-like reconnection events which are also known as Flux Transfer Events (FTEs). The formation mechanism of FTEs and their contolling factors remain controversial. We use global MHD simulations of Earth's magnetosphere to show that for southward IMF conditions: a) steady reconnection preferentially occurs without FTEs when the stagnation flow line nearly coincides with the X-line location, which requires small dipole tilt and nearly due southward IMF, b) FTEs occur when the flow/field symmetry is broken, which requires either a large dipole tilt and/or a substantial east-west component of the IMF, c) the predicted spacecraft signature and the repetition frequency of FTEs in the simulations agrees very well with typical observations, lending credibility to the the model, d) the fundamental process that leads to FTE formation is multiple X-line formation caused by the flow and field patterns in the magnetosheath and requires no intrinsic plasma property variations like variable resistivity, e) if the dipole tilt breaks the symmetry FTEs occur only in the winter hemisphere whereas the reconnection signatures in the summer hemisphere are steady with no bipolar FTE-like signatures, f) if the IMF east-west field component breaks the symmetry FTEs occur in both hemispheres, and g) FTE formation depends on sufficient resolution and low diffusion in the model -- coarse resolution and/or high diffusivity lead to flow-through reconnection signatures that appear unphysical given the frequent observation of FTEs.

  13. Proton transfer events in GFP.

    Science.gov (United States)

    Di Donato, Mariangela; van Wilderen, Luuk J G W; Van Stokkum, Ivo H M; Stuart, Thomas Cohen; Kennis, John T M; Hellingwerf, Klaas J; van Grondelle, Rienk; Groot, Marie Louise

    2011-09-28

    Proton transfer is one of the most important elementary processes in biology. Green fluorescent protein (GFP) serves as an important model system to elucidate the mechanistic details of this reaction, because in GFP proton transfer can be induced by light absorption. Illumination initiates proton transfer through a 'proton-wire', formed by the chromophore (the proton donor), water molecule W22, Ser205 and Glu222 (the acceptor), on a picosecond time scale. To obtain a more refined view of this process, we have used a combined approach of time resolved mid-infrared spectroscopy and visible pump-dump-probe spectroscopy to resolve with atomic resolution how and how fast protons move through this wire. Our results indicate that absorption of light by GFP induces in 3 ps (10 ps in D(2)O) a shift of the equilibrium positions of all protons in the H-bonded network, leading to a partial protonation of Glu222 and to a so-called low barrier hydrogen bond (LBHB) for the chromophore's proton, giving rise to dual emission at 475 and 508 nm. This state is followed by a repositioning of the protons on the wire in 10 ps (80 ps in D(2)O), ultimately forming the fully deprotonated chromophore and protonated Glu222.

  14. Transferability of microsatellite markers located in candidate genes for wood properties between Eucalyptus species

    Directory of Open Access Journals (Sweden)

    Cintia V. Acuña

    2014-12-01

    Full Text Available Aim of study:  To analyze the feasibility of extrapolating conclusions on wood quality genetic control between different Eucalyptus species, particularly from species with better genomic information, to those less characterized. For this purpose, the first step is to analyze the conservation and cross-transferability of microsatellites markers (SSRs located in candidate genes.Area of study: Eucalyptus species implanted in Argentina coming from different Australian origins.Materials and methods: Twelve validated and polymorphic SSRs in candidate genes (SSR-CGs for wood quality in E. globulus were selected for cross species amplification in six species: E. grandis, E. saligna, E. dunnii, E. viminalis, E. camaldulensis and E. tereticornis.Main results: High cross-species transferability (92% to 100% was found for the 12 polymorphic SSRs detected in E. globulus. These markers revealed allelic diversity in nine important candidate genes: cinnamoyl CoA reductase (CCR, cellulose synthase 3 (CesA3, the transcription factor LIM1, homocysteine S-methyltransferase (HMT, shikimate kinase (SK, xyloglucan endotransglycosylase 2 (XTH2, glutathione S-transferase (GST, glutamate decarboxylase (GAD and peroxidase (PER.Research highlights: The markers described are potentially suitable for comparative QTL mapping, molecular marker assisted breeding (MAB and for population genetic studies across different species within the subgenus Symphyomyrtus.Keywords: validation; cross-transferability; SSR; functional markers; eucalypts; Symphyomyrtus.

  15. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.

    Science.gov (United States)

    Hatemi, Peter K

    2013-10-01

    The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.

  16. Horizontal transfer of a subtilisin gene from plants into an ancestor of the plant pathogenic fungal genus Colletotrichum.

    Science.gov (United States)

    Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R

    2013-01-01

    The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.

  17. Subthalamic hGAD65 Gene Therapy and Striatum TH Gene Transfer in a Parkinson’s Disease Rat Model

    Science.gov (United States)

    Zheng, Deyu; Jiang, Xiaohua; Zhao, Junpeng; Duan, Deyi; Zhao, Huanying; Xu, Qunyuan

    2013-01-01

    The aim of the present study is to detect a combination method to utilize gene therapy for the treatment of Parkinson’s disease (PD). Here, a PD rat model is used for the in vivo gene therapy of a recombinant adeno-associated virus (AAV2) containing a human glutamic acid decarboxylase 65 (rAAV2-hGAD65) gene delivered to the subthalamic nucleus (STN). This is combined with the ex vivo gene delivery of tyrosine hydroxylase (TH) by fibroblasts injected into the striatum. After the treatment, the rotation behavior was improved with the greatest efficacy in the combination group. The results of immunohistochemistry showed that hGAD65 gene delivery by AAV2 successfully led to phenotypic changes of neurons in STN. And the levels of glutamic acid and GABA in the internal segment of the globus pallidus (GPi) and substantia nigra pars reticulata (SNr) were obviously lower than the control groups. However, hGAD65 gene transfer did not effectively protect surviving dopaminergic neurons in the SNc and VTA. This study suggests that subthalamic hGAD65 gene therapy and combined with TH gene therapy can alleviate symptoms of the PD model rats, independent of the protection the DA neurons from death. PMID:23738148

  18. Optimizing viral and non-viral gene transfer methods for genetic modification of porcine mesenchymal stem cells

    DEFF Research Database (Denmark)

    Stiehler, Maik; Duch, Mogens; Mygind, Tina

    2006-01-01

    INTRODUCTION: Mesenchymal stem cells (MSCs) provide an excellent source of pluripotent progenitor cells for tissue-engineering applications due to their proliferation capacity and differentiation potential. Genetic modification of MSCs with genes encoding tissue-specific growth factors...... viral and non-viral ex vivo gene delivery systems with respect to gene transfer efficiency, maintenance of transgene expression, and safety issues using primary porcine MSCs as target cells. MATERIALS AND METHODS: MSCs were purified from bone marrow aspirates from the proximal tibiae of four 3-month......-old Danish landrace pigs by Ficoll step gradient separation and polystyrene adherence technique. Vectors expressing enhanced green fluorescent protein (eGFP) and human bone morphogenetic protein-2 (BMP-2) were transferred to the cells by different non-viral methods and by use of recombinant adeno...

  19. Gene transfer of heterologous G protein-coupled receptors to cardiomyocytes: differential effects on contractility.

    Science.gov (United States)

    Laugwitz, K L; Weig, H J; Moretti, A; Hoffmann, E; Ueblacker, P; Pragst, I; Rosport, K; Schömig, A; Ungerer, M

    2001-04-13

    In heart failure, reduced cardiac contractility is accompanied by blunted cAMP responses to beta-adrenergic stimulation. Parathyroid hormone (PTH)-related peptide and arginine vasopressin are released from the myocardium in response to increased wall stress but do not stimulate contractility or adenylyl cyclase at physiological concentrations. To bypass the defective beta-adrenergic signaling cascade, recombinant P1 PTH/PTH-related peptide receptors (rPTH1-Rs) and V(2) vasopressin receptors (rV(2)-Rs), which are normally not expressed in the myocardium and which are both strongly coupled to adenylyl cyclase, and recombinant beta(2)-adrenergic receptors (rbeta(2)-ARs) were overexpressed in cardiomyocytes by viral gene transfer. The capacity of endogenous hormones to increase contractility via the heterologous, recombinant receptors was compared. Whereas V(2)-Rs are uniquely coupled to Gs, PTH1-Rs and beta(2)-ARs are also coupled to other G proteins. Gene transfer of rPTH1-Rs or rbeta(2)-ARs to adult cardiomyocytes resulted in maximally increased basal contractility, which could not be further stimulated by adding receptor agonists. Agonists at rPTH1-Rs induced increased cAMP formation and phospholipase C activity. In contrast, healthy or failing rV(2)-R-expressing cardiomyocytes showed unaltered basal contractility. Their contractility and cAMP formation increased only at agonist exposure, which did not activate phospholipase C. In summary, we found that gene transfer of PTH1-Rs to cardiomyocytes results in constitutive activity of the transgene, as does that of beta(2)-ARS: In the absence of receptor agonists, rPTH1-Rs and rbeta(2)-ARs increase basal contractility, coupling to 2 G proteins simultaneously. In contrast, rV(2)-Rs are uniquely coupled to Gs and are not constitutively active, retaining their property to be activated exclusively on agonist stimulation. Therefore, gene transfer of V(2)-Rs might be more suited to test the effects of c

  20. Stable gene transfer of CCR5 and CXCR4 siRNAs by sleeping beauty transposon system to confer HIV-1 resistance

    Directory of Open Access Journals (Sweden)

    Akkina Ramesh

    2008-07-01

    Full Text Available Abstract Background Thus far gene therapy strategies for HIV/AIDS have used either conventional retroviral vectors or lentiviral vectors for gene transfer. Although highly efficient, their use poses a certain degree of risk in terms of viral mediated oncogenesis. Sleeping Beauty (SB transposon system offers a non-viral method of gene transfer to avoid this possible risk. With respect to conferring HIV resistance, stable knock down of HIV-1 coreceptors CCR5 and CXCR4 by the use of lentiviral vector delivered siRNAs has proved to be a promising strategy to protect cells from HIV-1 infection. In the current studies our aim is to evaluate the utility of SB system for stable gene transfer of CCR5 and CXCR4 siRNA genes to derive HIV resistant cells as a first step towards using this system for gene therapy. Results Two well characterized siRNAs against the HIV-1 coreceptors CCR5 and CXCR4 were chosen based on their previous efficacy for the SB transposon gene delivery. The siRNA transgenes were incorporated individually into a modified SB transfer plasmid containing a FACS sortable red fluorescence protein (RFP reporter and a drug selectable neomycin resistance gene. Gene transfer was achieved by co-delivery with a construct expressing a hyperactive transposase (HSB5 into the GHOST-R3/X4/R5 cell line, which expresses the major HIV receptor CD4 and and the co-receptors CCR5 and CXCR4. SB constructs expressing CCR5 or CXCR4 siRNAs were also transfected into MAGI-CCR5 or MAGI-CXCR4 cell lines, respectively. Near complete downregulation of CCR5 and CXCR4 surface expression was observed in transfected cells. During viral challenge with X4-tropic (NL4.3 or R5-tropic (BaL HIV-1 strains, the respective transposed cells showed marked viral resistance. Conclusion SB transposon system can be used to deliver siRNA genes for stable gene transfer. The siRNA genes against HIV-1 coreceptors CCR5 and CXCR4 are able to downregulate the respective cell surface proteins

  1. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  2. Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment

    Directory of Open Access Journals (Sweden)

    Takenaka Akio

    2006-02-01

    Full Text Available Abstract Background The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants was studied using ciliate Expressed Sequence Tags (ESTs. More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and Epidinium ecaudatum and the order Vestibuliferida, previously called Holotricha (Isotricha prostoma, Isotricha intestinalis and Dasytricha ruminantium. Results A comparison of the sequences with the completely sequenced genomes of Eukaryotes and Prokaryotes, followed by large-scale construction and analysis of phylogenies, identified 148 ciliate genes that specifically cluster with genes from the Bacteria and Archaea. The phylogenetic clustering with bacterial genes, coupled with the absence of close relatives of these genes in the Ciliate Tetrahymena thermophila, indicates that they have been acquired via Horizontal Gene Transfer (HGT after the colonization of the gut by the rumen Ciliates. Conclusion Among the HGT candidates, we found an over-representation (>75% of genes involved in metabolism, specifically in the catabolism of complex carbohydrates, a rich food source in the rumen. We propose that the acquisition of these genes has greatly facilitated the Ciliates' colonization of the rumen providing evidence for the role of HGT in the adaptation to new niches.

  3. Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment.

    Science.gov (United States)

    Ricard, Guénola; McEwan, Neil R; Dutilh, Bas E; Jouany, Jean-Pierre; Macheboeuf, Didier; Mitsumori, Makoto; McIntosh, Freda M; Michalowski, Tadeusz; Nagamine, Takafumi; Nelson, Nancy; Newbold, Charles J; Nsabimana, Eli; Takenaka, Akio; Thomas, Nadine A; Ushida, Kazunari; Hackstein, Johannes H P; Huynen, Martijn A

    2006-02-10

    The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and Epidinium ecaudatum) and the order Vestibuliferida, previously called Holotricha (Isotricha prostoma, Isotricha intestinalis and Dasytricha ruminantium). A comparison of the sequences with the completely sequenced genomes of Eukaryotes and Prokaryotes, followed by large-scale construction and analysis of phylogenies, identified 148 ciliate genes that specifically cluster with genes from the Bacteria and Archaea. The phylogenetic clustering with bacterial genes, coupled with the absence of close relatives of these genes in the Ciliate Tetrahymena thermophila, indicates that they have been acquired via Horizontal Gene Transfer (HGT) after the colonization of the gut by the rumen Ciliates. Among the HGT candidates, we found an over-representation (>75%) of genes involved in metabolism, specifically in the catabolism of complex carbohydrates, a rich food source in the rumen. We propose that the acquisition of these genes has greatly facilitated the Ciliates' colonization of the rumen providing evidence for the role of HGT in the adaptation to new niches.

  4. Role of Horizontal Gene Transfer in the Evolution of Plant Parasitism Among Nematodes

    NARCIS (Netherlands)

    Mitreva, M.; Smant, G.; Helder, J.

    2009-01-01

    Horizontal gene transfer (HGT) implies the non-sexual exchange of genetic material between species ¿ in some cases even across kingdoms. Although common among Bacteria and Archaea, HGTs from pro- to eukaryotes and between eukaryotes were thought to be extremely rare. Recent studies on intracellular

  5. Evolution of Phototrophy in the Chloroflexi Phylum Driven by Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Lewis M. Ward

    2018-02-01

    Full Text Available The evolutionary mechanisms behind the extant distribution of photosynthesis is a point of substantial contention. Hypotheses range from the presence of phototrophy in the last universal common ancestor and massive gene loss in most lineages, to a later origin in Cyanobacteria followed by extensive horizontal gene transfer into the extant phototrophic clades, with intermediate scenarios that incorporate aspects of both end-members. Here, we report draft genomes of 11 Chloroflexi: the phototrophic Chloroflexia isolate Kouleothrix aurantiaca as well as 10 genome bins recovered from metagenomic sequencing of microbial mats found in Japanese hot springs. Two of these metagenome bins encode photrophic reaction centers and several of these bins form a metabolically diverse, monophyletic clade sister to the Anaerolineae class that we term Candidatus Thermofonsia. Comparisons of organismal (based on conserved ribosomal and phototrophy (reaction center and bacteriochlorophyll synthesis protein phylogenies throughout the Chloroflexi demonstrate that two new lineages acquired phototrophy independently via horizontal gene transfer (HGT from different ancestral donors within the classically phototrophic Chloroflexia class. These results illustrate a complex history of phototrophy within this group, with metabolic innovation tied to HGT. These observations do not support simple hypotheses for the evolution of photosynthesis that require massive character loss from many clades; rather, HGT appears to be the defining mechanic for the distribution of phototrophy in many of the extant clades in which it appears.

  6. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.

  7. Real-time PCR detection of Fe-type nitrile hydratase genes from environmental isolates suggests horizontal gene transfer between multiple genera.

    Science.gov (United States)

    Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine

    2010-11-01

    Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.

  8. Effective in vivo and ex vivo gene transfer to intestinal mucosa by VSV-G-pseudotyped lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kasahara Noriyuki

    2010-05-01

    Full Text Available Abstract Background Gene transfer to the gastrointestinal (GI mucosa is a therapeutic strategy which could prove particularly advantageous for treatment of various hereditary and acquired intestinal disorders, including inflammatory bowel disease (IBD, GI infections, and cancer. Methods We evaluated vesicular stomatitis virus glycoprotein envelope (VSV-G-pseudotyped lentiviral vectors (LV for efficacy of gene transfer to both murine rectosigmoid colon in vivo and human colon explants ex vivo. LV encoding beta-galactosidase (LV-β-Gal or firefly-luciferase (LV-fLuc reporter genes were administered by intrarectal instillation in mice, or applied topically for ex vivo transduction of human colorectal explant tissues from normal individuals. Macroscopic and histological evaluations were performed to assess any tissue damage or inflammation. Transduction efficiency and systemic biodistribution were evaluated by real-time quantitative PCR. LV-fLuc expression was evaluated by ex vivo bioluminescence imaging. LV-β-Gal expression and identity of transduced cell types were examined by histochemical and immunofluorescence staining. Results Imaging studies showed positive fLuc signals in murine distal colon; β-Gal-positive cells were found in both murine and human intestinal tissue. In the murine model, β-Gal-positive epithelial and lamina propria cells were found to express cytokeratin, CD45, and CD4. LV-transduced β-Gal-positive cells were also seen in human colorectal explants, consisting mainly of CD45, CD4, and CD11c-positive cells confined to the LP. Conclusions We have demonstrated the feasibility of LV-mediated gene transfer into colonic mucosa. We also identified differential patterns of mucosal gene transfer dependent on whether murine or human tissue was used. Within the limitations of the study, the LV did not appear to induce mucosal damage and were not distributed beyond the distal colon.

  9. Temporal variability in phosphorus transfers: classifying concentration–discharge event dynamics

    Directory of Open Access Journals (Sweden)

    P. Haygarth

    2004-01-01

    Full Text Available The importance of temporal variability in relationships between phosphorus (P concentration (Cp and discharge (Q is linked to a simple means of classifying the circumstances of Cp–Q relationships in terms of functional types of response. New experimental data at the upstream interface of grassland soil and catchment systems at a range of scales (lysimeters to headwaters in England and Australia are used to demonstrate the potential of such an approach. Three types of event are defined as Types 1–3, depending on whether the relative change in Q exceeds the relative change in Cp (Type 1, whether Cp and Q are positively inter-related (Type 2 and whether Cp varies yet Q is unchanged (Type 3. The classification helps to characterise circumstances that can be explained mechanistically in relation to (i the scale of the study (with a tendency towards Type 1 in small scale lysimeters, (ii the form of P with a tendency for Type 1 for soluble (i.e., p–Q relationships that can be developed further to contribute to future models of P transfer and delivery from slope to stream. Studies that evaluate the temporal dynamics of the transfer of P are currently grossly under-represented in comparison with models based on static/spatial factors. Keywords: phosphorus, concentration, discharge, lysimeters, temporal dynamics, overland flow

  10. Therapeutic misconception in early phase gene transfer trials.

    Science.gov (United States)

    Henderson, Gail E; Easter, Michele M; Zimmer, Catherine; King, Nancy M P; Davis, Arlene M; Rothschild, Barbra Bluestone; Churchill, Larry R; Wilfond, Benjamin S; Nelson, Daniel K

    2006-01-01

    Many subjects in early phase clinical trials expect to benefit in some way from the research intervention. It is understandable that people hope for improvement in their condition, no matter what the evidence. Yet unreasonable expectation of medical benefit may reflect problems with informed consent: Investigators may not disclose clearly that direct medical benefit from an early phase experimental intervention is unlikely or impossible, or subjects may not appreciate the differences between treatment and research. This paper presents findings from recent interviews with researchers and subjects and analysis of consent forms in early phase gene transfer research, a cutting-edge technology often called 'gene therapy'. We use three variables to construct a composite measure of therapeutic misconception TM, tapping misconceptions about the purposes of early phase research and the potential for direct medical benefit in these trials. Our multivariate model demonstrates the importance of both subject- and study-level factors as predictors of this TM index: education, disease type, and communication by study personnel about the likelihood of benefit. We hope that this work will deepen the discussion of how to define and measure TM, and refine the specification of factors that are related to subjects' TM.

  11. Fetal muscle gene transfer is not enhanced by an RGD capsid modification to high-capacity adenoviral vectors.

    Science.gov (United States)

    Bilbao, R; Reay, D P; Hughes, T; Biermann, V; Volpers, C; Goldberg, L; Bergelson, J; Kochanek, S; Clemens, P R

    2003-10-01

    High levels of alpha(v) integrin expression by fetal muscle suggested that vector re-targeting to integrins could enhance adenoviral vector-mediated transduction, thereby increasing safety and efficacy of muscle gene transfer in utero. High-capacity adenoviral (HC-Ad) vectors modified by an Arg-Gly-Asp (RGD) peptide motif in the HI loop of the adenoviral fiber (RGD-HC-Ad) have demonstrated efficient gene transfer through binding to alpha(v) integrins. To test integrin targeting of HC-Ad vectors for fetal muscle gene transfer, we compared unmodified and RGD-modified HC-Ad vectors. In vivo, unmodified HC-Ad vector transduced fetal mouse muscle with four-fold higher efficiency compared to RGD-HC-Ad vector. Confirming that the difference was due to muscle cell autonomous factors and not mechanical barriers, transduction of primary myogenic cells isolated from murine fetal muscle in vitro demonstrated a three-fold better transduction by HC-Ad vector than by RGD-HC-Ad vector. We hypothesized that the high expression level of coxsackievirus and adenovirus receptor (CAR), demonstrated in fetal muscle cells both in vitro and in vivo, was the crucial variable influencing the relative transduction efficiencies of HC-Ad and RGD-HC-Ad vectors. To explore this further, we studied transduction by HC-Ad and RGD-HC-Ad vectors in paired cell lines that expressed alpha(v) integrins and differed only by the presence or absence of CAR expression. The results increase our understanding of factors that will be important for retargeting HC-Ad vectors to enhance gene transfer to fetal muscle.

  12. Eliminating HIV-1 Packaging Sequences from Lentiviral Vector Proviruses Enhances Safety and Expedites Gene Transfer for Gene Therapy.

    Science.gov (United States)

    Vink, Conrad A; Counsell, John R; Perocheau, Dany P; Karda, Rajvinder; Buckley, Suzanne M K; Brugman, Martijn H; Galla, Melanie; Schambach, Axel; McKay, Tristan R; Waddington, Simon N; Howe, Steven J

    2017-08-02

    Lentiviral vector genomic RNA requires sequences that partially overlap wild-type HIV-1 gag and env genes for packaging into vector particles. These HIV-1 packaging sequences constitute 19.6% of the wild-type HIV-1 genome and contain functional cis elements that potentially compromise clinical safety. Here, we describe the development of a novel lentiviral vector (LTR1) with a unique genomic structure designed to prevent transfer of HIV-1 packaging sequences to patient cells, thus reducing the total HIV-1 content to just 4.8% of the wild-type genome. This has been achieved by reconfiguring the vector to mediate reverse-transcription with a single strand transfer, instead of the usual two, and in which HIV-1 packaging sequences are not copied. We show that LTR1 vectors offer improved safety in their resistance to remobilization in HIV-1 particles and reduced frequency of splicing into human genes. Following intravenous luciferase vector administration to neonatal mice, LTR1 sustained a higher level of liver transgene expression than an equivalent dose of a standard lentivirus. LTR1 vectors produce reverse-transcription products earlier and start to express transgenes significantly quicker than standard lentiviruses after transduction. Finally, we show that LTR1 is an effective lentiviral gene therapy vector as demonstrated by correction of a mouse hemophilia B model. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event

    Directory of Open Access Journals (Sweden)

    Gheysen Godelieve

    2008-11-01

    Full Text Available Abstract Background Endo-1,4-beta-glucanases or cellulases from the glycosyl hydrolase family 5 (GHF5 have been found in numerous bacteria and fungi, and recently also in higher eukaryotes, particularly in plant-parasitic nematodes (PPN. The origin of these genes has been attributed to horizontal gene transfer from bacteria, although there still is a lot of uncertainty about the origin and structure of the ancestral GHF5 PPN endoglucanase. It is not clear whether this ancestral endoglucanase consisted of the whole gene cassette, containing a catalytic domain and a carbohydrate-binding module (CBM, type 2 in PPN and bacteria or only of the catalytic domain while the CBM2 was retrieved by domain shuffling later in evolution. Previous studies on the evolution of these genes have focused primarily on data of sedentary nematodes, while in this study, extra data from migratory nematodes were included. Results Two new endoglucanases from the migratory nematodes Pratylenchus coffeae and Ditylenchus africanus were included in this study. The latter one is the first gene isolated from a PPN of a different superfamily (Sphaerularioidea; all previously known nematode endoglucanases belong to the superfamily Tylenchoidea (order Rhabditida. Phylogenetic analyses were conducted with the PPN GHF5 endoglucanases and homologous endoglucanases from bacterial and other eukaryotic lineages such as beetles, fungi and plants. No statistical incongruence between the phylogenetic trees deduced from the catalytic domain and the CBM2 was found, which could suggest that both domains have evolved together. Furthermore, based on gene structure data, we inferred a model for the evolution of the GHF5 endoglucanase gene structure in plant-parasitic nematodes. Our data confirm a close relationship between Pratylenchus spp. and the root knot nematodes, while some Radopholus similis endoglucanases are more similar to cyst nematode genes. Conclusion We conclude that the ancestral

  14. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event.

    Science.gov (United States)

    Kyndt, Tina; Haegeman, Annelies; Gheysen, Godelieve

    2008-11-03

    Endo-1,4-beta-glucanases or cellulases from the glycosyl hydrolase family 5 (GHF5) have been found in numerous bacteria and fungi, and recently also in higher eukaryotes, particularly in plant-parasitic nematodes (PPN). The origin of these genes has been attributed to horizontal gene transfer from bacteria, although there still is a lot of uncertainty about the origin and structure of the ancestral GHF5 PPN endoglucanase. It is not clear whether this ancestral endoglucanase consisted of the whole gene cassette, containing a catalytic domain and a carbohydrate-binding module (CBM, type 2 in PPN and bacteria) or only of the catalytic domain while the CBM2 was retrieved by domain shuffling later in evolution. Previous studies on the evolution of these genes have focused primarily on data of sedentary nematodes, while in this study, extra data from migratory nematodes were included. Two new endoglucanases from the migratory nematodes Pratylenchus coffeae and Ditylenchus africanus were included in this study. The latter one is the first gene isolated from a PPN of a different superfamily (Sphaerularioidea); all previously known nematode endoglucanases belong to the superfamily Tylenchoidea (order Rhabditida). Phylogenetic analyses were conducted with the PPN GHF5 endoglucanases and homologous endoglucanases from bacterial and other eukaryotic lineages such as beetles, fungi and plants. No statistical incongruence between the phylogenetic trees deduced from the catalytic domain and the CBM2 was found, which could suggest that both domains have evolved together. Furthermore, based on gene structure data, we inferred a model for the evolution of the GHF5 endoglucanase gene structure in plant-parasitic nematodes. Our data confirm a close relationship between Pratylenchus spp. and the root knot nematodes, while some Radopholus similis endoglucanases are more similar to cyst nematode genes. We conclude that the ancestral PPN GHF5 endoglucanase gene most probably consisted of

  15. Immunobiologic effects of cytokine gene transfer of the B16-BL6 melanoma.

    Science.gov (United States)

    Strome, S E; Krauss, J C; Cameron, M J; Forslund, K; Shu, S; Chang, A E

    1993-12-01

    The genetic modification of tumors offers an approach to modulate the host immune response to relatively weak native tumor antigens. We examined the immunobiologic effects of various cytokine genes transferred into the poorly immunogenic B16-BL6 murine melanoma. Retroviral expression vectors containing cDNAs for interleukin 2, interleukin 4, interferon gamma, or a neomycin-resistant control were electroporated into a B16-BL6 tumor clone. Selected transfected clones were examined for in vitro cytokine secretion and in vivo tumorigenicity. When cells from individual clones were injected intradermally into syngeneic mice, the interleukin 4-secreting clone grew significantly slower than did the neomycin-resistant transfected control, while the growth of the interleukin 2- and interferon gamma-expressing clones was not affected. Despite minimal cytokine secretion by interferon gamma-transfected cells, these cells expressed upregulated major histocompatibility class I antigen and were more susceptible to lysis by allosensitized cytotoxic T lymphocytes compared with parental or neomycin-resistant transfected tumor targets. We observed diverse immunobiologic effects associated with cytokine gene transfer into the B16-BL6 melanoma. Interleukin 4 transfection of tumor resulted in decreased in vivo tumorigenicity that may be related to a host immune response. Further studies to evaluate the host T-cell response to these gene-modified tumors are being investigated.

  16. Lentiviral Vector Gene Transfer to Porcine Airways

    Directory of Open Access Journals (Sweden)

    Patrick L Sinn

    2012-01-01

    Full Text Available In this study, we investigated lentiviral vector development and transduction efficiencies in well-differentiated primary cultures of pig airway epithelia (PAE and wild-type pigs in vivo. We noted gene transfer efficiencies similar to that observed for human airway epithelia (HAE. Interestingly, feline immunodeficiency virus (FIV-based vectors transduced immortalized pig cells as well as pig primary cells more efficiently than HIV-1–based vectors. PAE express TRIM5α, a well-characterized species-specific lentiviral restriction factor. We contrasted the restrictive properties of porcine TRIM5α against FIV- and HIV-based vectors using gain and loss of function approaches. We observed no effect on HIV-1 or FIV conferred transgene expression in response to porcine TRIM5α overexpression or knockdown. To evaluate the ability of GP64-FIV to transduce porcine airways in vivo, we delivered vector expressing mCherry to the tracheal lobe of the lung and the ethmoid sinus of 4-week-old pigs. One week later, epithelial cells expressing mCherry were readily detected. Our findings indicate that pseudotyped FIV vectors confer similar tropisms in porcine epithelia as observed in human HAE and provide further support for the selection of GP64 as an appropriate envelope pseudotype for future preclinical gene therapy studies in the porcine model of cystic fibrosis (CF.

  17. Gene transfer preferentially selects MHC class I positive tumour cells and enhances tumour immunogenicity.

    Science.gov (United States)

    Hacker, Ulrich T; Schildhauer, Ines; Barroso, Margarita Céspedes; Kofler, David M; Gerner, Franz M; Mysliwietz, Josef; Buening, Hildegard; Hallek, Michael; King, Susan B S

    2006-05-01

    The modulated expression of MHC class I on tumour tissue is well documented. Although the effect of MHC class I expression on the tumorigenicity and immunogenicity of MHC class I negative tumour cell lines has been rigorously studied, less is known about the validity of gene transfer and selection in cell lines with a mixed MHC class I phenotype. To address this issue we identified a C26 cell subline that consists of distinct populations of MHC class I (H-2D/K) positive and negative cells. Transient transfection experiments using liposome-based transfer showed a lower transgene expression in MHC class I negative cells. In addition, MHC class I negative cells were more sensitive to antibiotic selection. This led to the generation of fully MHC class I positive cell lines. In contrast to C26 cells, all transfectants were rejected in vivo and induced protection against the parental tumour cells in rechallenge experiments. Tumour cell specificity of the immune response was demonstrated in in vitro cytokine secretion and cytotoxicity assays. Transfectants expressing CD40 ligand and hygromycin phosphotransferase were not more immunogenic than cells expressing hygromycin resistance alone. We suggest that the MHC class I positive phenotype of the C26 transfectants had a bearing on their immunogenicity, because selected MHC class I positive cells were more immunogenic than parental C26 cells and could induce specific anti-tumour immune responses. These data demonstrate that the generation of tumour cell transfectants can lead to the selection of subpopulations that show an altered phenotype compared to the parental cell line and display altered immunogenicity independent of selection marker genes or other immune modulatory genes. Our results show the importance of monitoring gene transfer in the whole tumour cell population, especially for the evaluation of in vivo therapies targeted to heterogeneous tumour cell populations.

  18. Effect of genomic location on horizontal transfer of a recombinant gene cassette between Pseudomonas strains in the rhizosphere and spermosphere of barley seedlings

    DEFF Research Database (Denmark)

    Sengelov, G.; Kristensen, K. J.; Sørensen, Anders Morten Hay

    2001-01-01

    , horizontal transfer of a recombinant gene cassette inserted into the chromosome of a Pseudomonas strutzeri strain, into a mobilizable plasmid (pAGM42), and into a conjugative plasmid (pKJK5) isolated from barley rhizosphere was investigated. Horizontal transfer efficiencies of the gene cassette inserted...... efficiencies were up to 4.36 x 10(-3) transconjugants/(donors x recipients)(1/2). Transfer of chromosomal encoded genes could not be detected in the microcosms by conjugation or transformation. However, transformation did occur by using the same bacterial strains under laboratory conditions. The rhizosphere...

  19. Transient gene transfer to neurons and glia : analysis of adenoviral vector performance in the CNS and PNS

    NARCIS (Netherlands)

    Hermens, W.T.J.M.C.; Giger, Roman J; Holtmaat, Anthony J D G; Dijkhuizen, Paul A; Houweling, D A; Verhaagen, J

    In this paper a detailed protocol is presented for neuroscientists planning to start work on first generation recombinant adenoviral vectors as gene transfer agents for the nervous system. The performance of a prototype adenoviral vector encoding the bacterial lacZ gene as a reporter was studied,

  20. S1 nuclease analysis of α-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells

    International Nuclear Information System (INIS)

    Helder, J.; Deisseroth, A.

    1987-01-01

    The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients

  1. Stable genetic transformation of Jatropha curcas via Agrobacterium tumefaciens-mediated gene transfer using leaf explants

    KAUST Repository

    Kumar, Nitish

    2010-07-01

    Jatropha curcas is an oil bearing species with multiple uses and considerable economic potential as a biofuel crop. A simple and reproducible protocol was developed for Agrobacterium tumefaciens-mediated stable genetic transformation of J. curcas using leaf explains. Agrobacterium strain LBA 4404 harbouring the binary vector pCAMBIA 1304 having sense-dehydration responsive element binding (S-DREB2A), beta-glucuronidase (gus), and hygromycin-phosphotransferase (hpt) genes were used for gene transfer. A number of parameters such as preculture of explains, wounding of leaf explants, Agrobacterium growth phase (OD), infection duration, co-cultivation period, co-cultivation medium pH, and acetosyringone, were studied to optimized transformation efficiency. The highest transformation efficiency was achieved using 4-day precultured, non-wounded leaf explants infected with Agrobacterium culture corresponding to OD(600)=0.6 for 20 min, followed by co-cultivation for 4 days in a co-cultivation medium containing 100 mu M acetosyringone, pH 5.7. Co-cultivated leaf explants were initially cultured on Murashige and Skoog (MS) medium supplemented with 2.27 mu M thidiazuron (TDZ) for regeneration of shoot buds, followed by selection on same medium with 5 mu g ml(-1) hygromycin. Selected shoot buds were transferred to MS medium containing 10 mu M kinetin (Kn), 4.5 mu M 6-benzyl aminopurine (BA), and 5.5 mu M alpha-naphthaleneacetic acid (NAA) for proliferation. The proliferated shoots were elongated on MS medium supplemented with 2.25 mu M BA and 8.5 mu M indole-3-acetic acid (IAA). The elongated shoots were rooted on half strength MS medium supplemented with 15 mu M indole-3-butyric acid (IBA), 5.7 mu M IAA, 5.5 mu M NAA, and 0.25 mg l(-1) activated charcoal. GUS histochemical analysis of the transgenic tissues further confirmed the transformation event. PCR and DNA gel blot hybridization were performed to confirm the presence of transgene. A transformation efficiency of 29% was

  2. Stable genetic transformation of Jatropha curcas via Agrobacterium tumefaciens-mediated gene transfer using leaf explants

    KAUST Repository

    Kumar, Nitish; Vijay Anand, K.G.; Pamidimarri, D.V.N. Sudheer; Sarkar, Tanmoy; Reddy, Muppala P.; Radhakrishnan, T.; Kaul, Tanushri; Reddy, M.K.; Sopori, Sudhir K.

    2010-01-01

    Jatropha curcas is an oil bearing species with multiple uses and considerable economic potential as a biofuel crop. A simple and reproducible protocol was developed for Agrobacterium tumefaciens-mediated stable genetic transformation of J. curcas using leaf explains. Agrobacterium strain LBA 4404 harbouring the binary vector pCAMBIA 1304 having sense-dehydration responsive element binding (S-DREB2A), beta-glucuronidase (gus), and hygromycin-phosphotransferase (hpt) genes were used for gene transfer. A number of parameters such as preculture of explains, wounding of leaf explants, Agrobacterium growth phase (OD), infection duration, co-cultivation period, co-cultivation medium pH, and acetosyringone, were studied to optimized transformation efficiency. The highest transformation efficiency was achieved using 4-day precultured, non-wounded leaf explants infected with Agrobacterium culture corresponding to OD(600)=0.6 for 20 min, followed by co-cultivation for 4 days in a co-cultivation medium containing 100 mu M acetosyringone, pH 5.7. Co-cultivated leaf explants were initially cultured on Murashige and Skoog (MS) medium supplemented with 2.27 mu M thidiazuron (TDZ) for regeneration of shoot buds, followed by selection on same medium with 5 mu g ml(-1) hygromycin. Selected shoot buds were transferred to MS medium containing 10 mu M kinetin (Kn), 4.5 mu M 6-benzyl aminopurine (BA), and 5.5 mu M alpha-naphthaleneacetic acid (NAA) for proliferation. The proliferated shoots were elongated on MS medium supplemented with 2.25 mu M BA and 8.5 mu M indole-3-acetic acid (IAA). The elongated shoots were rooted on half strength MS medium supplemented with 15 mu M indole-3-butyric acid (IBA), 5.7 mu M IAA, 5.5 mu M NAA, and 0.25 mg l(-1) activated charcoal. GUS histochemical analysis of the transgenic tissues further confirmed the transformation event. PCR and DNA gel blot hybridization were performed to confirm the presence of transgene. A transformation efficiency of 29% was

  3. Accounting for horizontal gene transfers explains conflicting hypotheses regarding the position of aquificales in the phylogeny of Bacteria

    Directory of Open Access Journals (Sweden)

    Gouy Manolo

    2008-10-01

    Full Text Available Abstract Background Despite a large agreement between ribosomal RNA and concatenated protein phylogenies, the phylogenetic tree of the bacterial domain remains uncertain in its deepest nodes. For instance, the position of the hyperthermophilic Aquificales is debated, as their commonly observed position close to Thermotogales may proceed from horizontal gene transfers, long branch attraction or compositional biases, and may not represent vertical descent. Indeed, another view, based on the analysis of rare genomic changes, places Aquificales close to epsilon-Proteobacteria. Results To get a whole genome view of Aquifex relationships, all trees containing sequences from Aquifex in the HOGENOM database were surveyed. This study revealed that Aquifex is most often found as a neighbour to Thermotogales. Moreover, informational genes, which appeared to be less often transferred to the Aquifex lineage than non-informational genes, most often placed Aquificales close to Thermotogales. To ensure these results did not come from long branch attraction or compositional artefacts, a subset of carefully chosen proteins from a wide range of bacterial species was selected for further scrutiny. Among these genes, two phylogenetic hypotheses were found to be significantly more likely than the others: the most likely hypothesis placed Aquificales as a neighbour to Thermotogales, and the second one with epsilon-Proteobacteria. We characterized the genes that supported each of these two hypotheses, and found that differences in rates of evolution or in amino-acid compositions could not explain the presence of two incongruent phylogenetic signals in the alignment. Instead, evidence for a large Horizontal Gene Transfer between Aquificales and epsilon-Proteobacteria was found. Conclusion Methods based on concatenated informational proteins and methods based on character cladistics led to different conclusions regarding the position of Aquificales because this lineage

  4. Partnering Events | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  5. Transferability of a tetracycline resistance gene from probiotic Lactobacillus reuteri to bacteria in the gastrointestinal tract of humans.

    Science.gov (United States)

    Egervärn, Maria; Lindmark, Hans; Olsson, Johan; Roos, Stefan

    2010-02-01

    The potential of Lactobacillus reuteri as a donor of antibiotic resistance genes in the human gut was investigated by studying the transferability of the tetracycline resistance gene tet(W) to faecal enterococci, bifidobacteria and lactobacilli. In a double-blind clinical study, seven subjects consumed L. reuteri ATCC 55730 harbouring a plasmid-encoded tet(W) gene (tet(W)-reuteri) and an equal number of subjects consumed L. reuteri DSM 17938 derived from the ATCC 55730 strain by the removal of two plasmids, one of which contained the tet(W) gene. Faecal samples were collected before, during and after ingestion of 5 x 10(8) CFU of L. reuteri per day for 14 days. Both L. reuteri strains were detectable at similar levels in faeces after 14 days of intake but neither was detected after a two-week wash-out period. After enrichment and isolation of tetracycline resistant enterococci, bifidobacteria and lactobacilli from each faecal sample, DNA was extracted and analysed for presence of tet(W)-reuteri using a real-time PCR allelic discrimination method developed in this study. No tet(W)-reuteri signal was produced from any of the DNA samples and thus gene transfer to enterococci, bifidobacteria and lactobacilli during intestinal passage of the probiotic strain was non-detectable under the conditions tested, although transfer at low frequencies or to the remaining faecal bacterial population cannot be excluded.

  6. Inhibition by TNF-alpha and IL-4 of cationic lipid mediated gene transfer in cystic fibrosis tracheal gland cells.

    Science.gov (United States)

    Bastonero, Sonia; Gargouri, Myriem; Ortiou, Sandrine; Guéant, Jean-Louis; Merten, Marc D

    2005-11-01

    In vivo, tracheal gland serous cells highly express the cystic fibrosis transmembrane conductance regulator (cftr) gene. This gene is mutated in the lethal monogenic disease cystic fibrosis (CF). Clinical trials in which the human CFTR cDNA was delivered to the respiratory epithelia of CF patients have resulted in weak and transient gene expression. As CF is characterized by mucus inspissation, airway infection, and severe inflammation, we tested the hypothesis that inflammation and especially two cytokines involved in the Th1/Th2 inflammatory response, interleukin 4 (IL-4) and TNFalpha, could inhibit gene transfer efficiency using a model of human CF tracheal gland cells (CF-KM4) and Lipofectamine reagent as a transfection reagent. The specific secretory defects of CF-KM4 cells were corrected by Lipofectamine-mediated human CFTR gene transfer. However, this was altered when cells were pre-treated with IL-4 and TNFalpha. Inhibition of luciferase reporter gene expression by IL-4 and TNFalpha pre-treated CF-KM4 cells was measured by activity and real-time RT-PCR. Both cytokines induced similar and synergistic inhibition of transgene expression and activity. This cytokine-mediated inhibition could be prevented by anti-inflammatory agents such as glucocorticoids but not by non-steroidal (NSAI) agents. This data suggests that an inflammatory context generated by IL-4 and TNFalpha can inhibit human CFTR gene transfer in CF tracheal gland cells and that glucocorticoids may have a protecting action. Copyright (c) 2005 John Wiley & Sons, Ltd.

  7. Influence of cloning by chromatin transfer on placental gene expression at Day 45 of pregnancy in cattle.

    Science.gov (United States)

    Mesquita, Fernando S; Machado, Sergio A; Drnevich, Jenny; Borowicz, Pawel; Wang, Zhongde; Nowak, Romana A

    2013-01-30

    Poor success rates in somatic cell cloning are often attributed to abnormal early embryonic development as well as late abnormal fetal growth and placental development. Although promising results have been reported following chromatin transfer (CT), a novel cloning method that includes the remodeling of the donor nuclei in vitro prior to their transfer into enucleated oocytes, animals cloned by CT show placental abnormalities similar to those observed following conventional nuclear transfer. We hypothesized that the placental gene expression pattern from cloned fetuses was ontologically related to the frequently observed placental phenotype. The aim of the present study was to compare global gene expression by microarray analysis of Day 44-47 cattle placentas derived from CT cloned fetuses with those derived from in vitro fertilization (i.e. control), and confirm the altered mRNA and protein expression of selected molecules by qRT-PCR and immunohistochemistry, respectively. The differentially expressed genes identified in the present study are known to be involved in a range of activities associated with cell adhesion, cell cycle control, intracellular transport and proteolysis. Specifically, an imprinted gene, involved with cell proliferation and placentomegaly in humans (CDKN1C) and a peptidase that serves as a marker for non-invasive trophoblast cells in human placentas (DPP4), had mRNA and protein altered in CT placentas. It was concluded that the altered pattern of gene expression observed in CT samples may contribute to the abnormal placental development phenotypes commonly identified in cloned offspring, and that expression of imprinted as well as trophoblast invasiveness-related genes is altered in cattle cloned by CT. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Effects of blood-activating and stasis-removing drugs combined with VEGF gene transfer on angiogenesis in ischemic necrosis of the femoral head.

    Science.gov (United States)

    Li, Jun-Hui; Wu, Ya-Ling; Ye, Jian-Hong; Ning, Ya-Gong; Yu, Hai-Ying; Peng, Zhong-Jie; Luan, Xiao-Wen

    2009-09-01

    To observe the promoting effects of blood-activating and stasis-removing Chinese drugs combined with vascular endothelial growth factor (VEGF) gene transfer on angiogenesis in ischemic necrosis of the femoral head. Forty Japanese giant-ear rabbits were randomly divided into a control group, a model group, a Chinese drug group, a gene group, and a combined group. After 8 weeks of treatment, the rate of VEGF positive cell expression in the synovium of the femoral head was measured using the immunohistochemical method, and the number of blood vessels in the femoral head was measured by digital subtraction angiography. The rate of VEGF positive cell expression in the model group was significantly lower than that in the Chinese drug group (P 0.05). Either the blood-activating and stasis-removing Chinese drugs or VEGF gene transfer can promote the angiogenesis and building of collateral circulation for femoral head ischemic necrosis, and the combined therapy with Chinese drugs or VEGF gene transfer may show a better therapeutic effect. The present study provides an experimental basis for clinical application of the combined therapy with the blood-activating and stasis-removing Chinese drugs and VEGF gene transfer.

  9. Baculovirus-mediated gene transfer in butterfly wings in vivo: an efficient expression system with an anti-gp64 antibody.

    Science.gov (United States)

    Dhungel, Bidur; Ohno, Yoshikazu; Matayoshi, Rie; Otaki, Joji M

    2013-03-25

    Candidate genes for color pattern formation in butterfly wings have been known based on gene expression patterns since the 1990s, but their functions remain elusive due to a lack of a functional assay. Several methods of transferring and expressing a foreign gene in butterfly wings have been reported, but they have suffered from low success rates or low expression levels. Here, we developed a simple, practical method to efficiently deliver and express a foreign gene using baculovirus-mediated gene transfer in butterfly wings in vivo. A recombinant baculovirus containing a gene for green fluorescent protein (GFP) was injected into pupae of the blue pansy butterfly Junonia orithya (Nymphalidae). GFP fluorescence was detected in the pupal wings and other body parts of the injected individuals three to five days post-injection at various degrees of fluorescence. We obtained a high GFP expression rate at relatively high virus titers, but it was associated with pupal death before color pattern formation in wings. To reduce the high mortality rate caused by the baculovirus treatment, we administered an anti-gp64 antibody, which was raised against baculovirus coat protein gp64, to infected pupae after the baculovirus injection. This treatment greatly reduced the mortality rate of the infected pupae. GFP fluorescence was observed in pupal and adult wings and other body parts of the antibody-treated individuals at various degrees of fluorescence. Importantly, we obtained completely developed wings with a normal color pattern, in which fluorescent signals originated directly from scales or the basal membrane after the removal of scales. GFP fluorescence in wing tissues spatially coincided with anti-GFP antibody staining, confirming that the fluorescent signals originated from the expressed GFP molecules. Our baculovirus-mediated gene transfer system with an anti-gp64 antibody is reasonably efficient, and it can be an invaluable tool to transfer, express, and functionally

  10. Gene Therapy in Fanconi Anemia: A Matter of Time, Safety and Gene Transfer Tool Efficiency.

    Science.gov (United States)

    Verhoeyen, Els; Roman-Rodriguez, Francisco Jose; Cosset, Francois-Loic; Levy, Camille; Rio, Paula

    2017-01-01

    Fanconi anemia (FA) is a rare genetic syndrome characterized by progressive marrow failure. Gene therapy by infusion of FA-corrected autologous hematopoietic stem cells (HSCs) may offer a potential cure since it is a monogenetic disease with mutations in the FANC genes, coding for DNA repair enzymes [1]. However, the collection of hCD34+-cells in FA patients implies particular challenges because of the reduced numbers of progenitor cells present in their bone marrow (BM) [2] or mobilized peripheral blood [3-5]. In addition, the FA genetic defect fragilizes the HSCs [6]. These particular features might explain why the first clinical trials using murine leukemia virus derived retroviral vectors conducted for FA failed to show engraftment of corrected cells. The gene therapy field is now moving towards the use of lentiviral vectors (LVs) evidenced by recent succesful clinical trials for the treatment of patients suffering from adrenoleukodystrophy (ALD) [7], β-thalassemia [8], metachromatic leukodystrophy [9] and Wiskott-Aldrich syndrome [10]. LV trials for X-linked severe combined immunodificiency and Fanconi anemia (FA) defects were recently initiated [11, 12]. Fifteen years of preclinical studies using different FA mouse models and in vitro research allowed us to find the weak points in the in vitro culture and transduction conditions, which most probably led to the initial failure of FA HSC gene therapy. In this review, we will focus on the different obstacles, unique to FA gene therapy, and how they have been overcome through the development of optimized protocols for FA HSC culture and transduction and the engineering of new gene transfer tools for FA HSCs. These combined advances in the field hopefully will allow the correction of the FA hematological defect in the near future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. The interaction of combined effects of the BDNF and PRKCG genes and negative life events in major depressive disorder.

    Science.gov (United States)

    Yang, Chunxia; Sun, Ning; Liu, Zhifen; Li, Xinrong; Xu, Yong; Zhang, Kerang

    2016-03-30

    Major depressive disorder (MDD) is a mental disorder that results from complex interplay between multiple and partially overlapping sets of susceptibility genes and environmental factors. The brain derived neurotrophic factor (BDNF) and Protein kinase C gamma type (PRKCG) are logical candidate genes in MDD. Among diverse environmental factors, negative life events have been suggested to exert a crucial impact on brain development. In the present study, we hypothesized that interactions between genetic variants in BDNF and PRKCG and negative life events may play an important role in the development of MDD. We recruited a total of 406 patients with MDD and 391 age- and gender-matched control subjects. Gene-environment interactions were analyzed using generalized multifactor dimensionality reduction (GMDR). Under a dominant model, we observed a significant three-way interaction among BDNF rs6265, PRKCG rs3745406, and negative life events. The gene-environment combination of PRKCG rs3745406 C allele, BDNF rs6265 G allele and high level of negative life events (C-G-HN) was significantly associated with MDD (OR, 5.97; 95% CI, 2.71-13.15). To our knowledge, this is the first report of evidence that the BDNF-PRKCG interaction may modify the relationship between negative life events and MDD in the Chinese population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. The fosfomycin resistance gene fosB3 is located on a transferable, extrachromosomal circular intermediate in clinical Enterococcus faecium isolates.

    Directory of Open Access Journals (Sweden)

    Xiaogang Xu

    Full Text Available Some VanM-type vancomycin-resistant Enterococcus faecium isolates from China are also resistant to fosfomycin. To investigate the mechanism of fosfomycin resistance in these clinical isolates, antimicrobial susceptibility testing, filter-mating, Illumina/Solexa sequencing, inverse PCR and fosfomycin resistance gene cloning were performed. Three E. faecium clinical isolates were highly resistant to fosfomycin and vancomycin with minimal inhibitory concentrations (MICs >1024 µg/ml and >256 µg/ml, respectively. The fosfomycin and vancomycin resistance of these strains could be co-transferred by conjugation. They carried a fosfomycin resistance gene fosB encoding a protein differing by one or two amino acids from FosB, which is encoded on staphylococcal plasmids. Accordingly, the gene was designated fosB3. The fosB3 gene was cloned into pMD19-T, and transformed into E. coli DH5α. The fosfomycin MIC for transformants with fosB3 was 750-fold higher than transformants without fosB3. The fosB3 gene could be transferred by an extrachromosomal circular intermediate. The results indicate that the fosB3 gene is transferable, can mediate high level fosfomycin resistance in both Gram-positive and Gram-negative bacteria, and can be located on a circular intermediate.

  13. Fusion and retrotransposition events in the evolution of the sea anemone Anemonia viridis neurotoxin genes.

    Science.gov (United States)

    Moran, Yehu; Weinberger, Hagar; Lazarus, Nimrod; Gur, Maya; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael

    2009-08-01

    Sea anemones are sessile predators that use a variety of toxins to paralyze prey and foe. Among these toxins, Types I, II and III are short peptides that affect voltage-gated sodium channels. Anemonia viridis is the only sea anemone species that produces both Types I and III neurotoxin. Although the two toxin types are unrelated in sequence and three-dimensional structure, cloning and comparative analysis of their loci revealed a highly similar sequence at the 5' region, which encodes a signal peptide. This similarity was likely generated by gene fusion and could be advantageous in transcript stability and intracellular trafficking and secretion. In addition, these analyses identified the processed pseudogenes of the two gene families in the genome of A. viridis, probably resulting from retrotransposition events. As presence of processed pseudogenes in the genome requires transcription in germ-line cells, we analyzed oocyte-rich ovaries and found that indeed they contain Types I and III transcripts. This result raises questions regarding the role of toxin transcripts in these tissues. Overall, the retrotransposition and gene fusion events suggest that the genes of both Types I and III neurotoxins evolved in a similar fashion and share a partial common ancestry.

  14. What tangled web: barriers to rampant horizontal gene transfer.

    Science.gov (United States)

    Kurland, Charles G

    2005-07-01

    Dawkins in his The Selfish Gene(1) quite aptly applies the term "selfish" to parasitic repetitive DNA sequences endemic to eukaryotic genomes, especially vertebrates. Doolittle and Sapienza(2) as well as Orgel and Crick(3) enlivened this notion of selfish DNA with the identification of such repetitive sequences as remnants of mobile elements such as transposons. In addition, Orgel and Crick(3) associated parasitic DNA with a potential to outgrow their host genomes by propagating both vertically via conventional genome replication as well as infectiously by horizontal gene transfer (HGT) to other genomes. Still later, Doolittle(4) speculated that unchecked HGT between unrelated genomes so complicates phylogeny that the conventional representation of a tree of life would have to be replaced by a thicket or a web of life.(4) In contrast, considerable data now show that reconstructions based on whole genome sequences are consistent with the conventional "tree of life".(5-10) Here, we identify natural barriers that protect modern genome populations from the inroads of rampant HGT. Copyright (c) 2005 Wiley Periodicals, Inc.

  15. A survey of flux transfer events recorded by the UKS spacecraft magnetometer

    International Nuclear Information System (INIS)

    Southwood, D.J.; Saunders, M.A.; Dunlop, M.W.; Mier-Jedrzejowicz, W.A.C.; Rijnbeek, R.P.

    1986-01-01

    The UKS spacecraft operated from August 1984 through to January 1985. During that time, it made multiple crossings of the magnetopause in local time sectors extending from mid-afternoon to just behind the dawn meridian. We have surveyed the magnetometer records from these magnetopause encounters and have compiled a catalogue of flux transfer events. Using the catalogue, we find the FTE occurrence determined from the UKS data set is substantially less than that detected using data from the early ISEE 1/2 spacecraft orbits. The UKS data set shows a correlation between FTE occurrence and southward external magnetic field, but there are several instances of passes in which no FTEs are detected but for which the external field was unambiguously southward. The passes with the largest number of events are those for which the field outside the magnetopause has a large Bsub(M) component. We conclude that the lower latitude of the UKS encounters is responsible for the discrepancy with the ISEE occurrence. The most likely source region appears to be near the subsolar region. (author)

  16. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii

    Science.gov (United States)

    Da Silva, Gabriela Jorge; Domingues, Sara

    2016-01-01

    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen. PMID:27681923

  17. CysQ of , a Protozoa, May Have Been Acquired from Bacteria by Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Ji Young Lee

    2012-03-01

    Full Text Available Horizontal gene transfer (HGT is the movement of genetic material between kingdoms and is considered to play a positive role in adaptation. Cryptosporidium parvum is a parasitic protozoan that causes an infectious disease. Its genome sequencing reported 14 bacteria-like proteins in the nuclear genome. Among them, cgd2_1810, which has been annotated as CysQ, a sulfite synthesis pathway protein, is listed as one of the candidates of genes horizontally transferred from bacterial origin. In this report, we examined this issue using phylogenetic analysis. Our BLAST search showed that C. parvum CysQ protein had the highest similarity with that of proteobacteria. Analysis with NCBI's Conserved Domain Tree showed phylogenetic incongruence, in that C. parvum CysQ protein was located within a branch of proteobacteria in the cd01638 domain, a bacterial member of the inositol monophosphatase family. According to Kyoto Encyclopedia of Genes and Genomes (KEGG pathway, the sulfate assimilation pathway, where CysQ plays an important role, is well conserved in most eukaryotes as well as prokaryotes. However, the Apicomplexa, including C. parvum, largely lack orthologous genes of the pathway, suggesting its loss in those protozoan lineages. Therefore, we conclude that C. parvum regained cysQ from proteobacteria by HGT, although its functional role is elusive.

  18. Lipid lowering and HDL raising gene transfer increase endothelial progenitor cells, enhance myocardial vascularity, and improve diastolic function.

    Directory of Open Access Journals (Sweden)

    Stephanie C Gordts

    Full Text Available BACKGROUND: Hypercholesterolemia and low high density lipoprotein (HDL cholesterol contribute to coronary heart disease but little is known about their direct effects on myocardial function. Low HDL and raised non-HDL cholesterol levels carried increased risk for heart failure development in the Framingham study, independent of any association with myocardial infarction. The objective of this study was to test the hypothesis that increased endothelial progenitor cell (EPC number and function after lipid lowering or HDL raising gene transfer in C57BL/6 low density lipoprotein receptor deficient (LDLr(-/- mice may be associated with an enhanced relative vascularity in the myocardium and an improved cardiac function. METHODOLOGY/PRINCIPAL FINDINGS: Lipid lowering and HDL raising gene transfer were performed using the E1E3E4-deleted LDLr expressing adenoviral vector AdLDLr and the human apolipoprotein A-I expressing vector AdA-I, respectively. AdLDLr transfer in C57BL/6 LDLr(-/- mice resulted in a 2.0-fold (p<0.05 increase of the circulating number of EPCs and in an improvement of EPC function as assessed by ex vivo EPC migration and EPC adhesion. Capillary density and relative vascularity in the myocardium were 28% (p<0.01 and 22% (p<0.05 higher, respectively, in AdLDLr mice compared to control mice. The peak rate of isovolumetric relaxation was increased by 12% (p<0.05 and the time constant of isovolumetric relaxation was decreased by 14% (p<0.05 after AdLDLr transfer. Similarly, HDL raising gene transfer increased EPC number and function and raised both capillary density and relative vascularity in the myocardium by 24% (p<0.05. The peak rate of isovolumetric relaxation was increased by 16% (p<0.05 in AdA-I mice compared to control mice. CONCLUSIONS/SIGNIFICANCE: Both lipid lowering and HDL raising gene transfer have beneficial effects on EPC biology, relative myocardial vascularity, and diastolic function. These findings raise concerns over the

  19. Exploration of new perspectives and limitations in Agrobacterium-mediated gene transfer technology. Final report, June 1, 1992--May 31, 1995

    Energy Technology Data Exchange (ETDEWEB)

    Marton, L.

    1996-02-01

    Genetic manipulation of plants often involves the introduction of homologous or partly homologous genes. Ectropic introduction of homologous sequences into plant genomes may trigger epigenetic changes, making expression of the genes unpredictable. The main project objective was to examine the feasibility of using Agrobacterium-mediated gene transfer for homologous gene targeting in plants.

  20. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    International Nuclear Information System (INIS)

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

    1983-01-01

    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  1. Temporal variability in phosphorus transfers: classifying concentration-discharge event dynamics

    Science.gov (United States)

    Haygarth, P.; Turner, B. L.; Fraser, A.; Jarvis, S.; Harrod, T.; Nash, D.; Halliwell, D.; Page, T.; Beven, K.

    The importance of temporal variability in relationships between phosphorus (P) concentration (Cp) and discharge (Q) is linked to a simple means of classifying the circumstances of Cp-Q relationships in terms of functional types of response. New experimental data at the upstream interface of grassland soil and catchment systems at a range of scales (lysimeters to headwaters) in England and Australia are used to demonstrate the potential of such an approach. Three types of event are defined as Types 1-3, depending on whether the relative change in Q exceeds the relative change in Cp (Type 1), whether Cp and Q are positively inter-related (Type 2) and whether Cp varies yet Q is unchanged (Type 3). The classification helps to characterise circumstances that can be explained mechanistically in relation to (i) the scale of the study (with a tendency towards Type 1 in small scale lysimeters), (ii) the form of P with a tendency for Type 1 for soluble (i.e., <0.45 μm P forms) and (iii) the sources of P with Type 3 dominant where P availability overrides transport controls. This simple framework provides a basis for development of a more complex and quantitative classification of Cp-Q relationships that can be developed further to contribute to future models of P transfer and delivery from slope to stream. Studies that evaluate the temporal dynamics of the transfer of P are currently grossly under-represented in comparison with models based on static/spatial factors.

  2. Adenoviral vector-mediated gene transfer and neurotransplantation : possibilities and limitations in grafting of the fetal rat suprachiasmatic nucleus

    NARCIS (Netherlands)

    van Esseveldt, K E; Liu, R.; Hermens, W.T.J.M.C.; Verhaagen, J; Boer, G J

    Several studies have reported on the use of primary neural cells transduced by adenoviral vectors as donor cells in neurotransplantation. In the present investigation, we examined whether adenoviral vector-mediated gene transfer could be used to introduce and express a foreign gene in solid neural

  3. From gene trees to organismal phylogeny in prokaryotes: the case of the gamma-Proteobacteria.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Lerat

    2003-10-01

    Full Text Available The rapid increase in published genomic sequences for bacteria presents the first opportunity to reconstruct evolutionary events on the scale of entire genomes. However, extensive lateral gene transfer (LGT may thwart this goal by preventing the establishment of organismal relationships based on individual gene phylogenies. The group for which cases of LGT are most frequently documented and for which the greatest density of complete genome sequences is available is the gamma-Proteobacteria, an ecologically diverse and ancient group including free-living species as well as pathogens and intracellular symbionts of plants and animals. We propose an approach to multigene phylogeny using complete genomes and apply it to the case of the gamma-Proteobacteria. We first applied stringent criteria to identify a set of likely gene orthologs and then tested the compatibilities of the resulting protein alignments with several phylogenetic hypotheses. Our results demonstrate phylogenetic concordance among virtually all (203 of 205 of the selected gene families, with each of the exceptions consistent with a single LGT event. The concatenated sequences of the concordant families yield a fully resolved phylogeny. This topology also received strong support in analyses aimed at excluding effects of heterogeneity in nucleotide base composition across lineages. Our analysis indicates that single-copy orthologous genes are resistant to horizontal transfer, even in ancient bacterial groups subject to high rates of LGT. This gene set can be identified and used to yield robust hypotheses for organismal phylogenies, thus establishing a foundation for reconstructing the evolutionary transitions, such as gene transfer, that underlie diversity in genome content and organization.

  4. A gene transfer agent and a dynamic repertoire of secretion systems hold the keys to the explosive radiation of the emerging pathogen Bartonella.

    Directory of Open Access Journals (Sweden)

    Lionel Guy

    2013-03-01

    Full Text Available Gene transfer agents (GTAs randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes.

  5. Study on kinetic degradation in soil and horizontal transfer of bt gene by 35S isotopic tracing method

    International Nuclear Information System (INIS)

    Wang Haiyan; Zhang Yanfei; Ye Qingfu

    2012-01-01

    In this study, 35 S isotopic tracing method was applied to investigate kinetic degradation of bt gene from Bt transgenic rice TT51 in two different soil and possibility of its horizontal transfer into soil bacteria as well. Results showed that, during 30 d of aerobic incubation, it was indicated that 35 S-Bt gene was not horizontally transferred into soil microorganisms. The aerobic soil degradation dynamics significantly followed a first-order dissipation pattern for bt gene. After 30 d of incubation, the amount of bt gene reached 9.32% of applied radioactivity for the fluvio-marine yellow loamy soil and 9.92% for the fluvio-aquatic soil, respectively. The half-lives in two soils were 3.53 d for the former soil and 5. 77 d for the latter soil, which means that bt gene was more easily degradable in the weak acidic soil. The use of 35 S labeling proved to be valuable; it served the purpose of validating the rigorousness of experimental protocols, and provided insights into the soil environmental safety assessment for Bt transgenic rice. (authors)

  6. Improved in vivo gene transfer into tumor tissue by stabilization of pseudodendritic oligoethylenimine-based polyplexes.

    Science.gov (United States)

    Russ, Verena; Fröhlich, Thomas; Li, Yunqiu; Halama, Anna; Ogris, Manfred; Wagner, Ernst

    2010-02-01

    HD O is a low molecular weight pseudodendrimer containing oligoethylenimine and degradable hexanediol diacrylate diesters. DNA polyplexes display encouraging gene transfer efficiency in vitro and in vivo but also a limited stability under physiological conditions. This limitation must be overcome for further development into more sophisticated formulations. HD O polyplexes were laterally stabilized by crosslinking surface amines via bifunctional crosslinkers, bioreducible dithiobis(succimidyl propionate) (DSP) or the nonreducible analog disuccinimidyl suberate (DSS). Optionally, in a subsequent step, the targeting ligand transferrin (Tf) was attached to DSP-linked HD O polyplexes via Schiff base formation between HD O amino groups and Tf aldehyde groups, which were introduced into Tf by periodate oxidation of the glycosylation sites. Crosslinked DNA polyplexes showed an increased stability against exchange reaction by salt or heparin. Disulfide bond containing DSP-linked polyplexes were susceptible to reducing conditions. These polyplexes displayed the highest gene expression levels in vitro and in vivo (upon intratumoral application in mice), and these were significantly elevated and prolonged over standard or DSS-stabilized HD O formulations. DSP-stabilized HD O polyplexes with or without Tf coating were well-tolerated after intravenous application. High gene expression levels were found in tumor tissue, with negligible gene expression in any other organ. Lateral stabilization of HD O polyplexes with DSP crosslinker enhanced gene transfer efficacy and was essential for the incorporation of a ligand (Tf) into a stable particle formulation.

  7. Horizontal gene transfer versus biostimulation: A strategy for bioremediation in Goa.

    Science.gov (United States)

    Pasumarthi, Rajesh; Mutnuri, Srikanth

    2016-12-15

    Bioaugmentation, Biostimulation and Horizontal gene transfer (HGT) of catabolic genes have been proven for their role in bioremediation of hydrocarbons. It also has been proved that selection of either biostimulation or bioremediation varies for every contaminated site. The reliability of HGT compared to biostimulation and bioremediation was not tested. The present study focuses on reliability of biostimulatiion, bioaugmentation and HGT during biodegradation of Diesel oil and Non aqueous phase liquids (NAPL). Pseudomonas aeruginosa (AEBBITS1) having alkB and NDO genes was used for bioaugmentation and the experiment was conducted using seawater as medium. Based on Gas chromatography results diesel was found to be degraded to 100% in both presence and absence of AEBBITS1. Denturing gradient gel electrophoresis result showed same pattern in presence and absence of AEBBITS1 indicating no HGT. NAPL degradation was found to be more by Biostimulated Bioaugmentation compared to biostimulation and bioaugmentation alone. This proves that biostimulated bioaugmentation is better strategy for oil contamination (tarabll) in Velsao beach, Goa. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  9. Reconnection at the earth's magnetopause - Magnetic field observations and flux transfer events

    Science.gov (United States)

    Russell, C. T.

    1984-01-01

    Theoretical models of plasma acceleration by magnetic-field-line reconnection at the earth magnetopause and the high-resolution three-dimensional plasma measurements obtained with the ISEE satellites are compared and illustrated with diagrams, graphs, drawings, and histograms. The history of reconnection theory and the results of early satellite observations are summarized; the thickness of the magnetopause current layer is discussed; problems in analyzing the polarization of current-layer rotation are considered; and the flux-transfer events responsible for periods of patchy reconnection are characterized in detail. The need for further observations and refinements of the theory to explain the initiation of reconnection and identify the mechanism determining whether it is patchy or steady-state is indicated.

  10. Bortezomib Enhances the Antitumor Effects of Interferon-β Gene Transfer on Melanoma Cells.

    Science.gov (United States)

    Rossi, Ursula A; Finocchiaro, Liliana M E; Glikin, Gerardo C

    2017-01-01

    Malignant melanoma is a fast growing form of skin cancer with increasing global incidence. Clinically, canine malignant melanoma and human melanoma share comparable treatment-resistances, metastatic phenotypes and site selectivity. Both interferon-β (IFNβ) and bortezomib (BTZ) display inhibitory activities on melanoma cells. Here, we evaluated the cytotoxic effects of the combination of BTZ and IFNβ gene lipofection on cultured melanoma cell lines. Cell viability determined by the acid phosphatase method, cell migration mesasured by the wound healing assay, DNA fragmentation and cell cycle by flow cytometry after propidium iodide staining and reactive oxygen species (ROS) production by H2DCF-DA fluorescence. Four canine mucosal (Ak, Br, Bk and Ol) and two human dermal (A375 and SB2) melanoma cell lines were assayed. BTZ sub-pharmacological concentrations (5 nM) enhanced the cytotoxic effects of IFNβ transgene expression on melanoma cells monolayers and spheroids. The combination was also more effective than the single treatments when assayed for clonogenic survival and cell migration. The combined treatment produced a significant raise of apoptosis evidenced by DNA fragmentation as compared to either BTZ or IFNβ gene lipofection single treatments. Furthermore, BTZ significantly increased the intracellular ROS generation induced by IFNβ gene transfer in melanoma cells, an effect that was reversed by the addition of the ROS inhibitor N-acetyl-L-cystein. The present work encourages further studies about the potential of the combination of interferon gene transfer with proteasome inhibitors as a new combined therapy for malignant melanoma, both in veterinary and/or human clinical settings. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. Microbial co-habitation and lateral gene transfer: what transposases can tell us

    Energy Technology Data Exchange (ETDEWEB)

    Hooper, Sean D.; Mavromatis, Konstantinos; Kyrpides, Nikos C.

    2009-03-01

    Determining the habitat range for various microbes is not a simple, straightforward matter, as habitats interlace, microbes move between habitats, and microbial communities change over time. In this study, we explore an approach using the history of lateral gene transfer recorded in microbial genomes to begin to answer two key questions: where have you been and who have you been with? All currently sequenced microbial genomes were surveyed to identify pairs of taxa that share a transposase that is likely to have been acquired through lateral gene transfer. A microbial interaction network including almost 800 organisms was then derived from these connections. Although the majority of the connections are between closely related organisms with the same or overlapping habitat assignments, numerous examples were found of cross-habitat and cross-phylum connections. We present a large-scale study of the distributions of transposases across phylogeny and habitat, and find a significant correlation between habitat and transposase connections. We observed cases where phylogenetic boundaries are traversed, especially when organisms share habitats; this suggests that the potential exists for genetic material to move laterally between diverse groups via bridging connections. The results presented here also suggest that the complex dynamics of microbial ecology may be traceable in the microbial genomes.

  12. High-efficiency gene transfer into skeletal muscle mediated by electric pulses

    DEFF Research Database (Denmark)

    Mir, L M; Bureau, M F; Gehl, J

    1999-01-01

    Gene delivery to skeletal muscle is a promising strategy for the treatment of muscle disorders and for the systemic secretion of therapeutic proteins. However, present DNA delivery technologies have to be improved with regard to both the level of expression and interindividual variability. We...... report very efficient plasmid DNA transfer in muscle fibers by using square-wave electric pulses of low field strength (less than 300 V/cm) and of long duration (more than 1 ms). Contrary to the electropermeabilization-induced uptake of small molecules into muscle fibers, plasmid DNA has to be present...... in the tissue during the electric pulses, suggesting a direct effect of the electric field on DNA during electrotransfer. This i.m. electrotransfer method increases reporter and therapeutic gene expression by several orders of magnitude in various muscles in mouse, rat, rabbit, and monkey. Moreover, i...

  13. Application of Adoptive T-Cell Therapy Using Tumor Antigen-Specific T-Cell Receptor Gene Transfer for the Treatment of Human Leukemia

    Directory of Open Access Journals (Sweden)

    Toshiki Ochi

    2010-01-01

    Full Text Available The last decade has seen great strides in the field of cancer immunotherapy, especially the treatment of melanoma. Beginning with the identification of cancer antigens, followed by the clinical application of anti-cancer peptide vaccination, it has now been proven that adoptive T-cell therapy (ACT using cancer antigen-specific T cells is the most effective option. Despite the apparent clinical efficacy of ACT, the timely preparation of a sufficient number of cancer antigen-specific T cells for each patient has been recognized as its biggest limitation. Currently, therefore, attention is being focused on ACT with engineered T cells produced using cancer antigen-specific T-cell receptor (TCR gene transfer. With regard to human leukemia, ACT using engineered T cells bearing the leukemia antigen-specific TCR gene still remains in its infancy. However, several reports have provided preclinical data on TCR gene transfer using Wilms' tumor gene product 1 (WT1, and also preclinical and clinical data on TCR gene transfer involving minor histocompatibility antigen, both of which have been suggested to provide additional clinical benefit. In this review, we examine the current status of anti-leukemia ACT with engineered T cells carrying the leukemia antigen-specific TCR gene, and discuss the existing barriers to progress in this area.

  14. Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes

    Directory of Open Access Journals (Sweden)

    Syahril Abdullah

    2010-01-01

    Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.

  15. Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.

    Directory of Open Access Journals (Sweden)

    Yue Huang

    Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.

  16. Lack of glyphosate resistance gene transfer from Roundup Ready soybean to Bradyrhizobium japonicum under field and laboratory conditions.

    Science.gov (United States)

    Isaza, Laura Arango; Opelt, Katja; Wagner, Tobias; Mattes, Elke; Bieber, Evi; Hatley, Elwood O; Roth, Greg; Sanjuán, Juan; Fischer, Hans-Martin; Sandermann, Heinrich; Hartmann, Anton; Ernst, Dieter

    2011-01-01

    A field study was conducted at the Russell E. Larson Agricultural Research Center to determine the effect of transgenic glyphosate-resistant soybean in combination with herbicide (Roundup) application on its endosymbiont Bradyrhizobium japonicum. DNA of bacteroids from isolated nodules was analysed for the presence of the transgenic 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) DNA sequence using polymerase chain reaction (PCR). To further assess the likelihood that the EPSPS gene may be transferred from the Roundup Ready (RR) soybean to B. japonicum, we have examined the natural transformation efficiency of B. japonicum strain 110spc4. Analyses of nodules showed the presence of the transgenic EPSPS DNA sequence. In bacteroids that were isolated from nodules of transgenic soybean plants and then cultivated in the presence of glyphosate this sequence could not be detected. This indicates that no stable horizontal gene transfer (HGT) of the EPSPS gene had occurred under field conditions. Under laboratory conditions, no natural transformation was detected in B. japonicum strain 110spc4 in the presence of various amounts of recombinant plasmid DNA. Our results indicate that no natural competence state exists in B. japonicum 110spc4. Results from field and laboratory studies indicate the lack of functional transfer of the CP4-EPSPS gene from glyphosate-tolerant soybean treated with glyphosate to root-associated B. japonicum.

  17. Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

    Science.gov (United States)

    Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L

    2015-01-01

    Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

  18. Adenovirus gene transfer to amelogenesis imperfecta ameloblast-like cells.

    Directory of Open Access Journals (Sweden)

    Anton V Borovjagin

    Full Text Available To explore gene therapy strategies for amelogenesis imperfecta (AI, a human ameloblast-like cell population was established from third molars of an AI-affected patient. These cells were characterized by expression of cytokeratin 14, major enamel proteins and alkaline phosphatase staining. Suboptimal transduction of the ameloblast-like cells by an adenovirus type 5 (Ad5 vector was consistent with lower levels of the coxsackie-and-adenovirus receptor (CAR on those cells relative to CAR-positive A549 cells. To overcome CAR -deficiency, we evaluated capsid-modified Ad5 vectors with various genetic capsid modifications including "pK7" and/or "RGD" motif-containing short peptides incorporated in the capsid protein fiber as well as fiber chimera with the Ad serotype 3 (Ad3 fiber "knob" domain. All fiber modifications provided an augmented transduction of AI-ameloblasts, revealed following vector dose normalization in A549 cells with a superior effect (up to 404-fold of pK7/RGD double modification. This robust infectivity enhancement occurred through vector binding to both α(vβ3/α(vβ5 integrins and heparan sulfate proteoglycans (HSPGs highly expressed by AI-ameloblasts as revealed by gene transfer blocking experiments. This work thus not only pioneers establishment of human AI ameloblast-like cell population as a model for in vitro studies but also reveals an optimal infectivity-enhancement strategy for a potential Ad5 vector-mediated gene therapy for AI.

  19. Comparative Screening of Digestion Tract Toxic Genes in Proteus mirabilis.

    Science.gov (United States)

    Shi, Xiaolu; Lin, Yiman; Qiu, Yaqun; Li, Yinghui; Jiang, Min; Chen, Qiongcheng; Jiang, Yixiang; Yuan, Jianhui; Cao, Hong; Hu, Qinghua; Huang, Shenghe

    2016-01-01

    Proteus mirabilis is a common urinary tract pathogen, and may induce various inflammation symptoms. Its notorious ability to resist multiple antibiotics and to form urinary tract stones makes its treatment a long and painful process, which is further challenged by the frequent horizontal gene transferring events in P. mirabilis genomes. Three strains of P. mirabilis C02011/C04010/C04013 were isolated from a local outbreak of a food poisoning event in Shenzhen, China. Our hypothesis is that new genes may have been acquired horizontally to exert the digestion tract infection and toxicity. The functional characterization of these three genomes shows that each of them independently acquired dozens of virulent genes horizontally from the other microbial genomes. The representative strain C02011 induces the symptoms of both vomit and diarrhea, and has recently acquired a complete type IV secretion system and digestion tract toxic genes from the other bacteria.

  20. The qacC gene has recently spread between rolling circle plasmids of Staphylococcus, indicative of a novel gene transfer mechanism

    Directory of Open Access Journals (Sweden)

    Trudy M. Wassenaar

    2016-09-01

    Full Text Available Resistance of Staphylococcus species to quaternary ammonium compounds, frequently used as disinfectants and biocides, can be attributed to qac genes. These qac gene products belong to the Small Multidrug Resistant (SMR protein family, and are often encoded by rolling-circle (RC replicating plasmids. Four classes of SMR-type qac gene families have been described in Staphylococcus species: qacC, qacG, qacJ and qacH. Within their class, these genes are highly conserved, but qacC genes are extremely conserved, although they are found in variable plasmid backgrounds. The lower degree of sequence identity of these plasmids compared to the strict nucleotide conservation of their qacC means that this gene has recently spread. In the absence of insertion sequences or other genetic elements explaining the mobility, we sought for an explanation of mobilization by sequence comparison. Publically available sequences of qac genes, their flanking genes and the replication gene that is invariably present in RC-plasmids were compared to reconstruct the evolutionary history of these plasmids and to explain the recent spread of qacC. Here we propose a new model that explains how qacC is mobilized and transferred to acceptor RC-plasmids without assistance of other genes, by means of its location in between the Double Strand replication Origin (DSO and the Single-Strand replication Origin (SSO. The proposed mobilization model of this DSO-qacC-SSO element represents a novel mechanism of gene mobilization in RC-plasmids, which has also been employed by other genes, such as lnuA (conferring lincomycin resistance. The proposed gene mobility has aided to the wide spread of clinically relevant resistance genes in Staphylococcus populations.

  1. Molecular cloning of L-methylmalonyl-CoA mutase: Gene transfer and analysis of mut cell lines

    International Nuclear Information System (INIS)

    Ledley, F.D.; Lumetta, M.; Nguyen, P.N.; Kolhouse, J.F.; Allen, R.H.

    1988-01-01

    L-Methylmalonyl-CoA mutase (MCM, EC 5.4.99.2) is a mitochondrial adenosylcobalamin-requiring enzyme that catalyzes the isomerization of L-methylmalonyl-CoA to succinyl-CoA. This enzyme is deficient in methylmalonic acidemia, an often fatal disorder of organic acid metabolism. Antibody against human placental MCM was used to screen human placenta and liver cDNA expression libraries for MCM cDNA clones. One clone expressed epitopes that could affinity-purify antibodies against MCM. A cDNA corresponding in length to the mRNA was obtained and introduced into COS cells by DNA-mediated gene transfer. Cells transformed with this clone expressed increased levels of MCM enzymatic activity. RNA blot analysis of cells genetically deficient in MCM indicates that several deficient cell lines have a specific decrease in the amount of hybridizable mRNA. These data confirm the authenticity of the MCM cDNA clone, establish the feasibility of constituting MCM activity by gene transfer for biochemical analysis and gene therapy, and provide a preliminary picture of the genotypic spectrum underlying MCM deficiency

  2. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  3. Evidence for the intense exchange of MazG in marine cyanophages by horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Michael J Bryan

    Full Text Available BACKGROUND: S-PM2 is a phage capable of infecting strains of unicellular cyanobacteria belonging to the genus Synechococcus. S-PM2, like other myoviruses infecting marine cyanobacteria, encodes a number of bacterial-like genes. Amongst these genes is one encoding a MazG homologue that is hypothesized to be involved in the adaption of the infected host for production of progeny phage. METHODOLOGY/PRINCIPAL FINDINGS: This study focuses on establishing the occurrence of mazG homologues in other cyanophages isolated from different oceanic locations. Degenerate PCR primers were designed using the mazG gene of S-PM2. The mazG gene was found to be widely distributed and highly conserved among Synechococcus myoviruses and podoviruses from diverse oceanic provinces. CONCLUSIONS/SIGNIFICANCE: This study provides evidence of a globally connected cyanophage gene pool, the cyanophage mazG gene having a small effective population size indicative of rapid lateral gene transfer despite being present in a substantial fraction of cyanophage. The Prochlorococcus and Synechococcus phage mazG genes do not cluster with the host mazG gene, suggesting that their primary hosts are not the source of the mazG gene.

  4. Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna

    Directory of Open Access Journals (Sweden)

    Christian Hinderer

    2014-01-01

    Full Text Available Adeno-associated virus serotype 9 (AAV9 vectors have recently been shown to transduce cells throughout the central nervous system of nonhuman primates when injected into the cerebrospinal fluid (CSF, a finding which could lead to a minimally invasive approach to treat genetic and acquired diseases affecting the entire CNS. We characterized the transduction efficiency of two routes of vector administration into the CSF of cynomolgus macaques—lumbar puncture, which is typically used in clinical practice, and suboccipital puncture, which is more commonly used in veterinary medicine. We found that delivery of vector into the cisterna magna via suboccipital puncture is up to 100-fold more efficient for achieving gene transfer to the brain. In addition, we evaluated the inflammatory response to AAV9-mediated GFP expression in the nonhuman primate CNS. We found that while CSF lymphocyte counts increased following gene transfer, there were no clinical or histological signs of immune toxicity. Together these data indicate that delivery of AAV9 into the cisterna magna is an effective method for achieving gene transfer in the CNS, and suggest that adapting this uncommon injection method for human trials could vastly increase the efficiency of gene delivery.

  5. Recovery and evolutionary analysis of complete integron gene cassette arrays from Vibrio

    Directory of Open Access Journals (Sweden)

    Gillings Michael R

    2006-01-01

    Full Text Available Abstract Background Integrons are genetic elements capable of the acquisition, rearrangement and expression of genes contained in gene cassettes. Gene cassettes generally consist of a promoterless gene associated with a recombination site known as a 59-base element (59-be. Multiple insertion events can lead to the assembly of large integron-associated cassette arrays. The most striking examples are found in Vibrio, where such cassette arrays are widespread and can range from 30 kb to 150 kb. Besides those found in completely sequenced genomes, no such array has yet been recovered in its entirety. We describe an approach to systematically isolate, sequence and annotate large integron gene cassette arrays from bacterial strains. Results The complete Vibrio sp. DAT722 integron cassette array was determined through the streamlined approach described here. To place it in an evolutionary context, we compare the DAT722 array to known vibrio arrays and performed phylogenetic analyses for all of its components (integrase, 59-be sites, gene cassette encoded genes. It differs extensively in terms of genomic context as well as gene cassette content and organization. The phylogenetic tree of the 59-be sites collectively found in the Vibrio gene cassette pool suggests frequent transfer of cassettes within and between Vibrio species, with slower transfer rates between more phylogenetically distant relatives. We also identify multiple cases where non-integron chromosomal genes seem to have been assembled into gene cassettes and others where cassettes have been inserted into chromosomal locations outside integrons. Conclusion Our systematic approach greatly facilitates the isolation and annotation of large integrons gene cassette arrays. Comparative analysis of the Vibrio sp. DAT722 integron obtained through this approach to those found in other vibrios confirms the role of this genetic element in promoting lateral gene transfer and suggests a high rate of gene

  6. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  7. GENE TRANSFER IN TOBACCO MITOCHONDRIA IN VITRO AND IN VIVO

    Directory of Open Access Journals (Sweden)

    Katyshev A.I.

    2012-08-01

    Full Text Available Earlier, we had showed that isolated mitochondria from different organisms can import DNA. Exploiting this mechanism, we assessed the possibility of genes transfer in tobacco mitochondria in vitro and in vivo. Whereas homologous recombination is a rare occasion in higher plant nuclei, recombination between the large direct repeats in plant mitochondrial genome generates its multipartite structure. Following transfection of isolated organelles with constructs composed of a partial gfp gene flanked by mitochondrial DNA fragments, we showed the homologous recombination of imported DNA with the resident DNA and the integration of the reporter gene. The recombination yielded an insertion of a continuous exogenous DNA fragment including the gfp sequence and at least the 0.5 kb of the flanking sequence on each side. Using of transfection constructs carrying multiple sequences homologous to mitochondrial DNA could be suitable for insertion of a target gene into any region of the mitochondrial genome, which turns this approach to be of a general and methodical importance. Usually mitochondrial reactive oxygen species (ROS level is under strict control of the antioxidant system including the Mn-containing superoxide dismutase (MnSOD. MnSOD is presented in multiple forms encoded by several genes in plants. Possibly, this enzyme, beside its catalytic function, fulfills as well some unknown biochemical functions. Thus, one of maize SOD enzymes (SOD3.4 could bind with mitochondrial DNA. Another SOD form (SOD3.1 is located in close proximity to mitochondrial respiratory complexes, where ROS are generated. To study possible physiological functions of this enzyme, we cloned the maize SOD3.1 gene. Compared to the SOD3.4, this enzyme didn't demonstrate DNA-binding activity. At the same time, SOD3.1 didn't show non-specific DNA-hydrolyzing activity as Cu/ZnSOD does. It means that this enzyme might have some DNA protective function. We made NtPcob-sod3.1-IGR

  8. Genetic modification of adeno-associated viral vector type 2 capsid enhances gene transfer efficiency in polarized human airway epithelial cells.

    Science.gov (United States)

    White, April F; Mazur, Marina; Sorscher, Eric J; Zinn, Kurt R; Ponnazhagan, Selvarangan

    2008-12-01

    Cystic fibrosis (CF) is a common genetic disease characterized by defects in the expression of the CF transmembrane conductance regulator (CFTR) gene. Gene therapy offers better hope for the treatment of CF. Adeno-associated viral (AAV) vectors are capable of stable expression with low immunogenicity. Despite their potential in CF gene therapy, gene transfer efficiency by AAV is limited because of pathophysiological barriers in these patients. Although a few AAV serotypes have shown better transduction compared with the AAV2-based vectors, gene transfer efficiency in human airway epithelium has still not reached therapeutic levels. To engineer better AAV vectors for enhanced gene delivery in human airway epithelium, we developed and characterized mutant AAV vectors by genetic capsid modification, modeling the well-characterized AAV2 serotype. We genetically incorporated putative high-affinity peptide ligands to human airway epithelium on the GH loop region of AAV2 capsid protein. Six independent mutant AAV were constructed, containing peptide ligands previously reported to bind with high affinity for known and unknown receptors on human airway epithelial cells. The vectors were tested on nonairway cells and nonpolarized and polarized human airway epithelial cells for enhanced infectivity. One of the mutant vectors, with the peptide sequence THALWHT, not only showed the highest transduction in undifferentiated human airway epithelial cells but also indicated significant transduction in polarized cells. Interestingly, this modified vector was also able to infect cells independently of the heparan sulfate proteoglycan receptor. Incorporation of this ligand on other AAV serotypes, which have shown improved gene transfer efficiency in the human airway epithelium, may enhance the application of AAV vectors in CF gene therapy.

  9. Radiosensitivity and genes

    Energy Technology Data Exchange (ETDEWEB)

    Qiyue, Hu; Mingyue, Lun [Suzhou Medical Coll., JS (China)

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G{sub 1} phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM{sub 9} cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation.

  10. Radiosensitivity and genes

    International Nuclear Information System (INIS)

    Hu Qiyue; Lun Mingyue

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G 1 phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM 9 cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation

  11. The advantages and disadvantages of horizontal gene transfer and the emergence of the first species

    Directory of Open Access Journals (Sweden)

    Higgs Paul G

    2011-01-01

    Full Text Available Abstract Background Horizontal Gene Transfer (HGT is beneficial to a cell if the acquired gene confers a useful function, but is detrimental if the gene has no function, if it is incompatible with existing genes, or if it is a selfishly replicating mobile element. If the balance of these effects is beneficial on average, we would expect cells to evolve high rates of acceptance of horizontally transferred genes, whereas if it is detrimental, cells should reduce the rate of HGT as far as possible. It has been proposed that the rate of HGT was very high in the early stages of prokaryotic evolution, and hence there were no separate lineages of organisms. Only when the HGT rate began to fall, would lineages begin to emerge with their own distinct sets of genes. Evolution would then become more tree-like. This phenomenon has been called the Darwinian Threshold. Results We study a model for genome evolution that incorporates both beneficial and detrimental effects of HGT. We show that if rate of gene loss during genome replication is high, as was probably the case in the earliest genomes before the time of the last universal common ancestor, then a high rate of HGT is favourable. HGT leads to the rapid spread of new genes and allows the build-up of larger, fitter genomes than could be achieved by purely vertical inheritance. In contrast, if the gene loss rate is lower, as in modern prokaryotes, then HGT is, on average, unfavourable. Conclusions Modern cells should therefore evolve to reduce HGT if they can, although the prevalence of independently replicating mobile elements and viruses may mean that cells cannot avoid HGT in practice. In the model, natural selection leads to gradual improvement of the replication accuracy and gradual decrease in the optimal rate of HGT. By clustering genomes based on gene content, we show that there are no separate lineages of organisms when the rate of HGT is high; however, as the rate of HGT decreases, a tree

  12. Transfer of alien genes by means of induced translocation in oats and other crop species

    International Nuclear Information System (INIS)

    Thomas, H.; Taing Aung

    1977-01-01

    Some of the best sources of resistance to mildew, which is the most important disease of the oat crop in the United Kingdom, occur in related weed species. The mildew resistance found in a genotype of the tetraploid species Avena barbata has been transferred into the germ plasm of the cultivated hexaploid species A. sativa by means of an induced translocation. The procedures adopted to isolate the desirable translocation and to determine its breeding behaviour are described. A number of alien genes have been transferred into wheat by means of induced translocations and genetic induction, but their successful introduction into commercial varieties has been limited. In this paper, the use and limitations of alien transfers as breeding material are discussed. (author)

  13. [Gene doping: gene transfer and possible molecular detection].

    Science.gov (United States)

    Argüelles, Carlos Francisco; Hernández-Zamora, Edgar

    2007-01-01

    The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

  14. Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes.

    Science.gov (United States)

    Rybarczyk-Mydłowska, Katarzyna; Maboreke, Hazel Ruvimbo; van Megen, Hanny; van den Elsen, Sven; Mooyman, Paul; Smant, Geert; Bakker, Jaap; Helder, Johannes

    2012-11-21

    Plant parasitic nematodes are unusual Metazoans as they are equipped with genes that allow for symbiont-independent degradation of plant cell walls. Among the cell wall-degrading enzymes, glycoside hydrolase family 5 (GHF5) cellulases are relatively well characterized, especially for high impact parasites such as root-knot and cyst nematodes. Interestingly, ancestors of extant nematodes most likely acquired these GHF5 cellulases from a prokaryote donor by one or multiple lateral gene transfer events. To obtain insight into the origin of GHF5 cellulases among evolutionary advanced members of the order Tylenchida, cellulase biodiversity data from less distal family members were collected and analyzed. Single nematodes were used to obtain (partial) genomic sequences of cellulases from representatives of the genera Meloidogyne, Pratylenchus, Hirschmanniella and Globodera. Combined Bayesian analysis of ≈ 100 cellulase sequences revealed three types of catalytic domains (A, B, and C). Represented by 84 sequences, type B is numerically dominant, and the overall topology of the catalytic domain type shows remarkable resemblance with trees based on neutral (= pathogenicity-unrelated) small subunit ribosomal DNA sequences. Bayesian analysis further suggested a sister relationship between the lesion nematode Pratylenchus thornei and all type B cellulases from root-knot nematodes. Yet, the relationship between the three catalytic domain types remained unclear. Superposition of intron data onto the cellulase tree suggests that types B and C are related, and together distinct from type A that is characterized by two unique introns. All Tylenchida members investigated here harbored one or multiple GHF5 cellulases. Three types of catalytic domains are distinguished, and the presence of at least two types is relatively common among plant parasitic Tylenchida. Analysis of coding sequences of cellulases suggests that root-knot and cyst nematodes did not acquire this gene directly

  15. Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes

    Directory of Open Access Journals (Sweden)

    Rybarczyk-Mydłowska Katarzyna

    2012-11-01

    Full Text Available Abstract Background Plant parasitic nematodes are unusual Metazoans as they are equipped with genes that allow for symbiont-independent degradation of plant cell walls. Among the cell wall-degrading enzymes, glycoside hydrolase family 5 (GHF5 cellulases are relatively well characterized, especially for high impact parasites such as root-knot and cyst nematodes. Interestingly, ancestors of extant nematodes most likely acquired these GHF5 cellulases from a prokaryote donor by one or multiple lateral gene transfer events. To obtain insight into the origin of GHF5 cellulases among evolutionary advanced members of the order Tylenchida, cellulase biodiversity data from less distal family members were collected and analyzed. Results Single nematodes were used to obtain (partial genomic sequences of cellulases from representatives of the genera Meloidogyne, Pratylenchus, Hirschmanniella and Globodera. Combined Bayesian analysis of ≈ 100 cellulase sequences revealed three types of catalytic domains (A, B, and C. Represented by 84 sequences, type B is numerically dominant, and the overall topology of the catalytic domain type shows remarkable resemblance with trees based on neutral (= pathogenicity-unrelated small subunit ribosomal DNA sequences. Bayesian analysis further suggested a sister relationship between the lesion nematode Pratylenchus thornei and all type B cellulases from root-knot nematodes. Yet, the relationship between the three catalytic domain types remained unclear. Superposition of intron data onto the cellulase tree suggests that types B and C are related, and together distinct from type A that is characterized by two unique introns. Conclusions All Tylenchida members investigated here harbored one or multiple GHF5 cellulases. Three types of catalytic domains are distinguished, and the presence of at least two types is relatively common among plant parasitic Tylenchida. Analysis of coding sequences of cellulases suggests that root

  16. Design and bioinformatics analysis of novel biomimetic peptides as nanocarriers for gene transfer

    Directory of Open Access Journals (Sweden)

    Asia Majidi

    2015-01-01

    Full Text Available Objective(s: The introduction of nucleic acids into cells for therapeutic objectives is significantly hindered by the size and charge of these molecules and therefore requires efficient vectors that assist cellular uptake. For several years great efforts have been devoted to the study of development of recombinant vectors based on biological domains with potential applications in gene therapy. Such vectors have been synthesized in genetically engineered approach, resulting in biomacromolecules with new properties that are not present in nature. Materials and Methods: In this study, we have designed new peptides using homology modeling with the purpose of overcoming the cell barriers for successful gene delivery through Bioinformatics tools. Three different carriers were designed and one of those with better score through Bioinformatics tools was cloned, expressed and its affinity for pDNA was monitored. Results: The resultszz demonstrated that the vector can effectively condense pDNAinto nanoparticles with the average sizes about 100 nm. Conclusion: We hope these peptides can overcome the biological barriers associated with gene transfer, and mediate efficient gene delivery.

  17. Collateral Effects of Antibiotics: Carbadox and Metronidazole Induce VSH-1 and Facilitate Gene Transfer among Brachyspira hyodysenteriae Strains▿

    Science.gov (United States)

    Stanton, Thaddeus B.; Humphrey, Samuel B.; Sharma, Vijay K.; Zuerner, Richard L.

    2008-01-01

    Brachyspira hyodysenteriae is an anaerobic spirochete and the etiologic agent of swine dysentery. The genome of this spirochete contains a mitomycin C-inducible, prophage-like gene transfer agent designated VSH-1. VSH-1 particles package random 7.5-kb fragments of the B. hyodysenteriae genome and transfer genes between B. hyodysenteriae cells. The chemicals and conditions inducing VSH-1 production are largely unknown. Antibiotics used in swine management and stressors inducing traditional prophages might induce VSH-1 and thereby stimulate lateral gene transfer between B. hyodysenteriae cells. In these studies, VSH-1 induction was initially detected by a quantitative real-time reverse transcriptase PCR assay evaluating increased transcription of hvp38 (VSH-1 head protein gene). VSH-1 induction was confirmed by detecting VSH-1-associated 7.5-kb DNA and VSH-1 particles in B. hyodysenteriae cultures. Nine antibiotics (chlortetracycline, lincomycin, tylosin, tiamulin, virginiamycin, ampicillin, ceftriaxone, vancomycin, and florfenicol) at concentrations affecting B. hyodysenteriae growth did not induce VSH-1 production. By contrast, VSH-1 was detected in B. hyodysenteriae cultures treated with mitomycin C (10 μg/ml), carbadox (0.5 μg/ml), metronidazole (0.5 μg/ml), and H2O2 (300 μM). Carbadox- and metronidazole-induced VSH-1 particles transmitted tylosin and chloramphenicol resistance determinants between B. hyodysenteriae strains. The results of these studies suggest that certain antibiotics may induce the production of prophage or prophage-like elements by intestinal bacteria and thereby impact intestinal microbial ecology. PMID:18359835

  18. Horizontal gene transfer from macrophages to ischemic muscles upon delivery of naked DNA with Pluronic block copolymers.

    Science.gov (United States)

    Mahajan, Vivek; Gaymalov, Zagit; Alakhova, Daria; Gupta, Richa; Zucker, Irving H; Kabanov, Alexander V

    2016-01-01

    Intramuscular administration of plasmid DNA (pDNA) with non-ionic Pluronic block copolymers increases gene expression in injected muscles and lymphoid organs. We studied the role of immune cells in muscle transfection upon inflammation. Local inflammation in murine hind limb ischemia model (MHLIM) drastically increased DNA, RNA and expressed protein levels in ischemic muscles injected with pDNA/Pluronic. The systemic inflammation (MHLIM or peritonitis) also increased expression of pDNA/Pluronic in the muscles. When pDNA/Pluronic was injected in ischemic muscles the reporter gene, Green Fluorescent Protein (GFP) co-localized with desmin(+) muscle fibers and CD11b(+) macrophages (MØs), suggesting transfection of MØs along with the muscle cells. P85 enhanced (∼ 4 orders) transfection of MØs with pDNA in vitro. Moreover, adoptively transferred MØs were shown to pass the transgene to inflamed muscle cells in MHLIM. Using a co-culture of myotubes (MTs) and transfected MØs expressing a reporter gene under constitutive (cmv-luciferase) or muscle specific (desmin-luciferase) promoter we demonstrated that P85 enhances horizontal gene transfer from MØ to MTs. Therefore, MØs can play an important role in muscle transfection with pDNA/Pluronic during inflammation, with both inflammation and Pluronic contributing to the increased gene expression. pDNA/Pluronic has potential for therapeutic gene delivery in muscle pathologies that involve inflammation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  20. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  1. Efficiency of RAFT-synthesized PDMAEMA in gene transfer to the retina.

    Science.gov (United States)

    Bitoque, Diogo B; Simão, Sónia; Oliveira, Ana V; Machado, Susana; Duran, Margarita R; Lopes, Eduardo; da Costa, Ana M Rosa; Silva, Gabriela A

    2017-01-01

    Gene therapy has long been heralded as the new hope to evolve from symptomatic care of genetic pathologies to a full cure. Recent successes in using gene therapy for treating several ocular and haematopoietic pathologies have shown the great potential of this approach that, in the early days, relied on the use of viral vectors, which were considered by many to be undesirable for human treatment. Therefore, there is considerable interest and effort in developing non-viral vectors, with efficiency close to that of viral vectors. The aim of this study was to develop suitable non-viral carriers for gene therapy to treat pathologies affecting the retina. In this study poly(2-(N,N-dimethylamino)ethyl methacrylate), PDMAEMA was synthesized by reversible addition-fragmentation chain transfer (RAFT) and the in vitro cytocompatibility and transfection efficiency of a range of polymer:DNA ratios evaluated using a retinal cell line; in vivo biocompatibility was evaluated by ocular injection in C57BL/6 mice. The results showed that through RAFT, it is possible to produce a defined-size polymer that is compatible with cell viability in vitro and capable of efficiently directing gene expression in a polymer-DNA ratio-dependent manner. When injected into the eyes of mice, these vectors induced a transient, mild inflammation, characteristic of the implantation of medical devices. These results form the basis of future studies where RAFT-synthesized PDMAEMA will be used to deliver gene expression systems to the retina of mouse models of retinal pathologies. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

  2. Intratumoral Immunization by p19Arf and Interferon-β Gene Transfer in a Heterotopic Mouse Model of Lung Carcinoma

    Directory of Open Access Journals (Sweden)

    João Paulo Portela Catani

    2016-12-01

    Full Text Available Therapeutic strategies that act by eliciting and enhancing antitumor immunity have been clinically validated as an effective treatment modality but may benefit from the induction of both cell death and immune activation as primary stimuli. Using our AdRGD-PG adenovector platform, we show here for the first time that in situ gene transfer of p19Arf and interferon-β (IFNβ in the LLC1 mouse model of lung carcinoma acts as an immunotherapy. Although p19Arf is sufficient to induce cell death, only its pairing with IFNβ significantly induced markers of immunogenic cell death. In situ gene therapy with IFNβ, either alone or in combination with p19Arf, could retard tumor progression, but only the combined treatment was associated with a protective immune response. Specifically in the case of combined intratumoral gene transfer, we identified 167 differentially expressed genes when using microarray to evaluate tumors that were treated in vivo and confirmed the activation of CCL3, CXCL3, IL1α, IL1β, CD274, and OSM, involved in immune response and chemotaxis. Histologic evaluation revealed significant tumor infiltration by neutrophils, whereas functional depletion of granulocytes ablated the antitumor effect of our approach. The association of in situ gene therapy with cisplatin resulted in synergistic elimination of tumor progression. In all, in situ gene transfer with p19Arf and IFNβ acts as an immunotherapy involving recruitment of neutrophils, a desirable but previously untested outcome, and this approach may be allied with chemotherapy, thus providing significant antitumor activity and warranting further development for the treatment of lung carcinoma.

  3. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    Science.gov (United States)

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  4. Plant–Agrobacterium interaction mediated by ethylene and super-Agrobacterium conferring efficient gene transfer

    OpenAIRE

    Nonaka, Satoko; Ezura, Hiroshi

    2014-01-01

    Agrobacterium tumefaciens has a unique ability to transfer genes into plant genomes. This ability has been utilized for plant genetic engineering. However, the efficiency is not sufficient for all plant species. Several studies have shown that ethylene decreased the Agrobacterium-mediated transformation frequency. Thus, A. tumefaciens with an ability to suppress ethylene evolution would increase the efficiency of Agrobacterium-mediated transformation. Some studies showed that plant growth-pro...

  5. New Markov Model Approaches to Deciphering Microbial Genome Function and Evolution: Comparative Genomics of Laterally Transferred Genes

    Energy Technology Data Exchange (ETDEWEB)

    Borodovsky, M.

    2013-04-11

    Algorithmic methods for gene prediction have been developed and successfully applied to many different prokaryotic genome sequences. As the set of genes in a particular genome is not homogeneous with respect to DNA sequence composition features, the GeneMark.hmm program utilizes two Markov models representing distinct classes of protein coding genes denoted "typical" and "atypical". Atypical genes are those whose DNA features deviate significantly from those classified as typical and they represent approximately 10% of any given genome. In addition to the inherent interest of more accurately predicting genes, the atypical status of these genes may also reflect their separate evolutionary ancestry from other genes in that genome. We hypothesize that atypical genes are largely comprised of those genes that have been relatively recently acquired through lateral gene transfer (LGT). If so, what fraction of atypical genes are such bona fide LGTs? We have made atypical gene predictions for all fully completed prokaryotic genomes; we have been able to compare these results to other "surrogate" methods of LGT prediction.

  6. Horizontal gene transfer: essentiality and evolvability in prokaryotes, and roles in evolutionary transitions [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Eugene V. Koonin

    2016-07-01

    Full Text Available The wide spread of gene exchange and loss in the prokaryotic world has prompted the concept of ‘lateral genomics’ to the point of an outright denial of the relevance of phylogenetic trees for evolution. However, the pronounced coherence congruence of the topologies of numerous gene trees, particularly those for (nearly universal genes, translates into the notion of a statistical tree of life (STOL, which reflects a central trend of vertical evolution. The STOL can be employed as a framework for reconstruction of the evolutionary processes in the prokaryotic world. Quantitatively, however, horizontal gene transfer (HGT dominates microbial evolution, with the rate of gene gain and loss being comparable to the rate of point mutations and much greater than the duplication rate. Theoretical models of evolution suggest that HGT is essential for the survival of microbial populations that otherwise deteriorate due to the Muller’s ratchet effect. Apparently, at least some bacteria and archaea evolved dedicated vehicles for gene transfer that evolved from selfish elements such as plasmids and viruses. Recent phylogenomic analyses suggest that episodes of massive HGT were pivotal for the emergence of major groups of organisms such as multiple archaeal phyla as well as eukaryotes. Similar analyses appear to indicate that, in addition to donating hundreds of genes to the emerging eukaryotic lineage, mitochondrial endosymbiosis severely curtailed HGT. These results shed new light on the routes of evolutionary transitions, but caution is due given the inherent uncertainty of deep phylogenies.

  7. Enhancement of anticancer effect of interferon-γ gene transfer against interferon-γ-resistant tumor by depletion of tumor-associated macrophages.

    Science.gov (United States)

    Kiyota, Tsuyoshi; Takahashi, Yuki; Watcharanurak, Kanitta; Nishikawa, Makiya; Ohara, Saori; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2014-05-05

    Tumor-associated macrophages (TAMs) negatively affect the therapeutic effects of anticancer agents. To examine the role of TAMs in interferon (IFN)-γ gene therapy, we selected two types of solid tumors, which varied in the number of TAMs, and investigated the effects of IFN-γ gene transfer on tumor growth. Many TAMs were detected in the solid tumors of murine adenocarcinoma colon-26 cells, whereas few TAMs were detected in murine melanoma B16-BL6 cells. IFN-γ gene transfer hardly suppressed the growth of colon-26 tumors, whereas it was effective in suppressing the growth of B16-BL6 tumors. The antiproliferative effects of IFN-γ on cultured colon-26 cells were similar to those on cultured B16-BL6 cells. To evaluate the role of TAMs, we injected clodronate liposomes (CLs) modified with poly(ethylene glycol) (PEG) to functionally deplete TAMs in tumor-bearing mice. Repeated injections of PEG-CLs significantly retarded the growth of colon-26 tumors and combination with IFN-γ gene transfer further inhibited the growth. In contrast, PEG-CLs hardly retarded the growth of B16-BL6 tumors. These results clearly indicate that TAM depletion is effective in enhancing the therapeutic effect of IFN-γ in TAM-repleted and IFN-γ-resistant tumors.

  8. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    Science.gov (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  9. Factors enhancing Agrobacterium tumefaciens-mediated gene transfer in peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Egnin, M.; Mora, A.; Prakash, C. S.; Mortley, D. G. (Principal Investigator)

    1998-01-01

    Parameters enhancing Agrobacterium-mediated transfer of foreign genes to peanut (Arachis hypogaea L.) cells were investigated. An intron-containing beta-glucuronidase uidA (gusA) gene under the transcriptional control of CaMV 35S promoter served as a reporter. Transformation frequency was evaluated by scoring the number of sectors expressing GUS activity on leaf and epicotyl explants. The 'Valencia Select' market type cv. New Mexico was more amenable to Agrobacterium transformation than the 'runner' market type cultivars tested (Florunner, Georgia Runner, Sunrunner, or South Runner). The disarmed Agrobacterium tumefaciens strain EHA101 was superior in facilitating the transfer of uidA gene to peanut cells compared to the disarmed strain C58. Rinsing of explants in half-strength Murashige-Skoog (MS) media prior to infection by Agrobacterium significantly increased the transformation efficiency. The use of cocultivation media containing high auxin [1.0 or 2.5 mg/l (4.53 micromolar or 11.31 micromolar) 2,4-D] and low cytokinin [0.25 or 0.5 mg/l (1.0 micromolar or 2.0 micromolar) BA] promoted higher transformation than either hormone-free or thidiazuron-containing medium. The polarity of the epicotyl during cocultivation was important; explants incubated in an inverted (vertically) manner followed by a vertically upright position resulted in improved transformation and shoot regeneration frequencies. Preculture of explants in MS basal medium or with 2.5 mg thidiazuron per l prior to infection drastically decreased the number of transformed zones. The optimized protocol was used to obtain transient transformation frequencies ranging from 12% to 36% for leaf explants, 15% to 42% for epicotyls. Initial evidence of transformation was obtained by polymerase chain reaction and subsequently confirmed by Southern analysis of regenerated plants.

  10. Correction of glucocerebrosidase deficiency after retroviral-mediated gene transfer into hematopoietic progenitor cells from patients with Gaucher disease

    International Nuclear Information System (INIS)

    Fink, J.K.; Correll, P.H.; Perry, L.K.; Brady, R.O.; Karlsson, S.

    1990-01-01

    Retroviral gene transfer has been used successfully to correct the glucocerebrosidase (GCase) deficiency in primary hematopoietic cells from patients with Gaucher disease. For this model of somatic gene therapy, the authors developed a high-titer, amphotropic retroviral vector designated NTG in which the human GCase gene was driven by the mutant polyoma virus enhancer/herpesvirus thymidine kinase gene (tk) promoter (Py + /Htk). NTG normalized GCase activity in transduced Gaucher fibroblasts and efficiently infected human monocytic and erythroleukemic cell lines. RNA blot-hybridization (Northern blot) analysis of these hemaptopoietic cell lines showed unexpectedly high-level expression from the Moloney murine leukemia virus long terminal repeat (Mo-MLV LTR) and levels of Py + /Htk enhancer/promoter-initiated human GCase RNA that approximated endogenous GCase RNA levels. Furthermore, NTG efficiently infected human hematopoietic progenitor cells. Detection of the provirus in approximately one-third of NTG-infected progenitor colonies that had not been selected in G418-containing medium indicates that relative resistance to G418 underestimated the actual gene transfer efficiency. Northern blot analysis of NTG-infected, progenitor-derived cells showed expression from both the Mo-MLV LTR and the Py + /Htk enhancer/promoter. NTG-transduced hematopoietic progenitor cells from patients with Gaucher disease generated progeny in which GCase activity has been normalized

  11. Correction of glucocerebrosidase deficiency after retroviral-mediated gene transfer into hematopoietic progenitor cells from patients with Gaucher disease

    Energy Technology Data Exchange (ETDEWEB)

    Fink, J.K.; Correll, P.H.; Perry, L.K.; Brady, R.O.; Karlsson, S. (National Institutes of Health, Bethesda, MD (USA))

    1990-03-01

    Retroviral gene transfer has been used successfully to correct the glucocerebrosidase (GCase) deficiency in primary hematopoietic cells from patients with Gaucher disease. For this model of somatic gene therapy, the authors developed a high-titer, amphotropic retroviral vector designated NTG in which the human GCase gene was driven by the mutant polyoma virus enhancer/herpesvirus thymidine kinase gene (tk) promoter (Py{sup +}/Htk). NTG normalized GCase activity in transduced Gaucher fibroblasts and efficiently infected human monocytic and erythroleukemic cell lines. RNA blot-hybridization (Northern blot) analysis of these hemaptopoietic cell lines showed unexpectedly high-level expression from the Moloney murine leukemia virus long terminal repeat (Mo-MLV LTR) and levels of Py{sup +}/Htk enhancer/promoter-initiated human GCase RNA that approximated endogenous GCase RNA levels. Furthermore, NTG efficiently infected human hematopoietic progenitor cells. Detection of the provirus in approximately one-third of NTG-infected progenitor colonies that had not been selected in G418-containing medium indicates that relative resistance to G418 underestimated the actual gene transfer efficiency. Northern blot analysis of NTG-infected, progenitor-derived cells showed expression from both the Mo-MLV LTR and the Py{sup +}/Htk enhancer/promoter. NTG-transduced hematopoietic progenitor cells from patients with Gaucher disease generated progeny in which GCase activity has been normalized.

  12. AAV-mediated gene transfer of the obesity-associated gene Etv5 in rat midbrain does not affect energy balance or motivated behavior.

    Directory of Open Access Journals (Sweden)

    Arjen J Boender

    Full Text Available Several genome-wide association studies have implicated the transcription factor E-twenty- six version 5 (Etv5 in the regulation of body mass index. Further substantiating the role of Etv5 in feeding behavior are the findings that targeted disruption of Etv5 in mice leads to decreased body weight gain and that expression of Etv5 is decreased in the ventral tegmental area and substantia nigra pars compacta (VTA/SNpc after food restriction. As Etv5 has been suggested to influence dopaminergic neurotransmission by driving the expression of genes that are responsible for the synthesis and release of dopamine, we investigated if expression levels of Etv5 are dependent on nutritional state and subsequently influence the expression levels of tyrosine hydroxylase. While it was shown that Etv5 expression in the VTA/SNpc increases after central administration of leptin and that Etv5 was able to drive expression of tyrosine hydroxylase in vitro, AAV-mediated gene transfer of Etv5 into the VTA/SNpc of rats did not alter expression of tyrosine hydroxylase in vivo. Moreover, AAV-mediated gene transfer of Etv5 in the VTA/SNpc did not affect measures of energy balance or performances in a progressive ratio schedule. Thus, these data do not support a role for increased expression of Etv5 in the VTA/SNpc in the regulation of feeding behavior.

  13. Thermal hydraulic characteristics of the pool-type FBR 'ARES' eliminating intermediate heat-transfer system. 2. Transient characteristics in representative events

    International Nuclear Information System (INIS)

    Nishi, Yoshihisa; Ueda, Nobuyuki; Kinoshita, Izumi; Yoshida, Kazuo

    1999-01-01

    An innovative plant concept (ARES), which eliminates intermediate heat-transfer system, was proposed in order to reduce the construction cost of the liquid metal cooled fast breeder reactor (LMFBR). In the present study, representative events of the ARES were picked up and plant transient analysis was conducted in order to reveal the thermal hydraulic characteristics of the ARES. The main results of the analysis are as follows: (1) The core was sufficiently cooled without sodium boiling in an event of mis-operation of the siphon break system. (2) The disturbances of the SG transfer to the core within about 30 seconds in a event of the feed water increasing. This transition period is less than half that of the conventional LMFBR. However, the transient characteristics of the ARES are very similar to those of the conventional LMFBR. Based on these results, it is only necessary to consider the short transition period in order to design the control system. (3) Based on the results of the calculation of a total blackout accident, it is concluded that the use of the SG-side cooling together is profitable in order to satisfy the design safety criteria in design basis events. In the case of full natural-circulation cooling, the use of the SG-side cooling together is profitable in order to satisfy the design safety criteria. (author)

  14. Generation of genic diversity among Streptococcus pneumoniae strains via horizontal gene transfer during a chronic polyclonal pediatric infection.

    Directory of Open Access Journals (Sweden)

    N Luisa Hiller

    2010-09-01

    Full Text Available Although there is tremendous interest in understanding the evolutionary roles of horizontal gene transfer (HGT processes that occur during chronic polyclonal infections, to date there have been few studies that directly address this topic. We have characterized multiple HGT events that most likely occurred during polyclonal infection among nasopharyngeal strains of Streptococcus pneumoniae recovered from a child suffering from chronic upper respiratory and middle-ear infections. Whole genome sequencing and comparative genomics were performed on six isolates collected during symptomatic episodes over a period of seven months. From these comparisons we determined that five of the isolates were genetically highly similar and likely represented a dominant lineage. We analyzed all genic and allelic differences among all six isolates and found that all differences tended to occur within contiguous genomic blocks, suggestive of strain evolution by homologous recombination. From these analyses we identified three strains (two of which were recovered on two different occasions that appear to have been derived sequentially, one from the next, each by multiple recombination events. We also identified a fourth strain that contains many of the genomic segments that differentiate the three highly related strains from one another, and have hypothesized that this fourth strain may have served as a donor multiple times in the evolution of the dominant strain line. The variations among the parent, daughter, and grand-daughter recombinant strains collectively cover greater than seven percent of the genome and are grouped into 23 chromosomal clusters. While capturing in vivo HGT, these data support the distributed genome hypothesis and suggest that a single competence event in pneumococci can result in the replacement of DNA at multiple non-adjacent loci.

  15. Quantitative assessment of human exposure to extended spectrum and AmpC β-lactamases bearing E. coli in lettuce attributable to irrigation water and subsequent horizontal gene transfer.

    Science.gov (United States)

    Njage, P M K; Buys, E M

    2017-01-02

    The contribution of the fresh produce production environment to human exposure with bacteria bearing extended spectrum β-lactamases and AmpC β-lactamases (ESBL/AmpC) has not been reported. High prevalence of ESBLs/AmpC bearing E. coli as well as a high gene transfer efficiency of lettuce and irrigation water E. coli isolates was previously reported. This stochastic modeling was aimed at quantitatively assessing human exposure to ESBL/AmpC bearing E. coli through lettuce attributable to irrigation water and subsequent horizontal gene transfer. Modular process risk approach was used for the quantitative exposure assessment and models were constructed in Ms. Excel spreadsheet with farm to consumption chain accounted for by primary production, processing, retail and consumer storage. Probability distributions were utilised to take into account the variability of the exposure estimates. Exposure resulting from ESBL/AmpC positive E. coli and gene transfer was taken into account. Monte Carlo simulation was carried out using @Risk software followed by sensitivity and scenario analysis to assess most effective single or combinations of mitigation strategies for the ESBL/AmpC positive E. coli events from farm to fork. Three percent of South African lettuce consumers are exposed to lettuce contaminated with about 10 6.4 ±10 6.7 (95% CI: 10 5.1 -10 7 ) cfu of ESBL/AmpC positive E. coli per serving. The contribution of originally positive isolates and conjugative genetic transfer was 10 6 ±10 6.7 (95% CI: 10 5 -10 7 ) and 10 5.2 ±10 5.6 (95% CI: 10 3.9 -10 5.8 ) cfu per serving respectively. Proportion of ESBL/AmpC positive E. coli (Spearman's correlation coefficient (ρ)=0.85), conjugative gene transfer (ρ=0.05-0.14), washing in chlorine water (ρ=0.18), further rinsing (ρ=0.15), and prevalence of E. coli in irrigation water (ρ=0.16) had highest influence on consumer exposure. The most effective single methods in reducing consumer exposure were reduction in irrigation

  16. Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk.

    Science.gov (United States)

    Vollrath, D; Feng, W; Duncan, J L; Yasumura, D; D'Cruz, P M; Chappelow, A; Matthes, M T; Kay, M A; LaVail, M M

    2001-10-23

    The Royal College of Surgeons (RCS) rat is a widely studied animal model of retinal degeneration in which the inability of the retinal pigment epithelium (RPE) to phagocytize shed photoreceptor outer segments leads to a progressive loss of rod and cone photoreceptors. We recently used positional cloning to demonstrate that the gene Mertk likely corresponds to the retinal dystrophy (rdy) locus of the RCS rat. In the present study, we sought to determine whether gene transfer of Mertk to a RCS rat retina would result in correction of the RPE phagocytosis defect and preservation of photoreceptors. We used subretinal injection of a recombinant replication-deficient adenovirus encoding rat Mertk to deliver the gene to the eyes of young RCS rats. Electrophysiological assessment of animals 30 days after injection revealed an increased sensitivity of treated eyes to low-intensity light. Histologic and ultrastructural assessment demonstrated substantial sparing of photoreceptors, preservation of outer segment structure, and correction of the RPE phagocytosis defect in areas surrounding the injection site. Our results provide definitive evidence that mutation of Mertk underlies the RCS retinal dystrophy phenotype, and that the phenotype can be corrected by treatment of juvenile animals. To our knowledge, this is the first demonstration of complementation of both a functional cellular defect (phagocytosis) and a photoreceptor degeneration by gene transfer to the RPE. These results, together with the recent discovery of MERTK mutations in individuals with retinitis pigmentosa, emphasize the importance of the RCS rat as a model for gene therapy of diseases that arise from RPE dysfunction.

  17. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  18. C-reactive protein gene C1444T polymorphism and risk of recurrent ischemic events in patients with symptomatic intracranial atherostenoses.

    Science.gov (United States)

    Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan

    2009-01-01

    High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.

  19. Smooth-muscle-specific gene transfer with the human maxi-k channel improves erectile function and enhances sexual behavior in atherosclerotic cynomolgus monkeys.

    Science.gov (United States)

    Christ, George J; Andersson, Karl-Erik; Williams, Koudy; Zhao, Weixin; D'Agostino, Ralph; Kaplan, Jay; Aboushwareb, Tamer; Yoo, James; Calenda, Giulia; Davies, Kelvin P; Sellers, Rani S; Melman, Arnold

    2009-12-01

    Despite the advent of effective oral therapies for erectile dysfunction (ED), many patients are not successfully treated, and side effects have been documented. To further evaluate the potential utility of naked DNA-based gene transfer as an attractive treatment option for ED. The effects of gene transfer on erectile function and sexual behavior were evaluated in eight male cynomolgus monkeys with ED secondary to moderately severe, diet-induced atherosclerosis. Following establishment of baseline characteristics, animals were subjected to intracavernous injection of a smooth-muscle-specific gene transfer vector (pSMAA-hSlo) encoding the pore-forming subunit of the human large-conductance, calcium-sensitive potassium channel (Maxi-K). For the sexual behavior studies, 2 wk of baseline data were obtained, and then animals were placed in the presence of estrogen-implanted females (n=2) three times per week for 30 min, and sexual behavior was recorded. The intracavernous pressure response to papaverine injection was also monitored. Dramatic changes in erectile function and sexual behavior were observed after intracorporal gene transfer. The frequency of partial (6±2 to 10±2) and full (2±1.5 to 5±1.4) erections were significantly increased, with a parallel 2-3-fold increase in the duration of the observed erections. The frequency and latency of ejaculation were increased and decreased, respectively. Frequency and duration of grooming by the female were increased, and the latency decreased. Increased latency and decreased frequency of body contact was also observed, and this is characteristic of the typical drop in consort intimacy that occurs after mating in most macaque species. In addition, an increased responsiveness to intracavernous papaverine injection was observed. The data indicate that intracorporal Maxi-K-channel gene transfer enhances erectile capacity and sexual behavior; the data imply that increased erectile function per se may lead to increased sexual

  20. Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

    Energy Technology Data Exchange (ETDEWEB)

    Chen Libo, E-mail: libochen888@hotmail.com [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China); Guo Guoying [Xinyuan Institute of Medicine and Biotechnology, School of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Liu Tianjing; Guo Lihe [Division of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Zhu Ruisen [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China)

    2011-07-15

    Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated {sup 125}I{sup -} up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T{sub 1/2eff} of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or {sup 131}I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%{+-}2.5%, 43.4%{+-}2.8% and 8.6%{+-}1.2% after exposure to {sup 131}I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

  1. Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

    International Nuclear Information System (INIS)

    Chen Libo; Guo Guoying; Liu Tianjing; Guo Lihe; Zhu Ruisen

    2011-01-01

    Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated 125 I - up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T 1/2eff of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or 131 I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%±2.5%, 43.4%±2.8% and 8.6%±1.2% after exposure to 131 I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

  2. Glutaric acidemia type II: gene structure and mutations of the electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) gene.

    Science.gov (United States)

    Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E

    2002-01-01

    Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.

  3. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Christian Johannes Hendrik Von Wintersdorff

    2016-02-01

    Full Text Available The emergence and spread of antibiotic resistance among pathogenic bacteria has been a rising problem for public health in recent decades. It is becoming increasingly recognized that not only antibiotic resistance genes (ARGs encountered in clinical pathogens are of relevance, but rather, all pathogenic, commensal as well as environmental bacteria – and also mobile genetic elements and bacteriophages – form a reservoir of ARGs (the resistome from which pathogenic bacteria can acquire resistance via horizontal gene transfer (HGT. HGT has caused antibiotic resistance to spread from commensal and environmental species to pathogenic ones, as has been shown for some clinically important ARGs. Of the three canonical mechanisms of HGT, conjugation is thought to have the greatest influence on the dissemination of ARGs. While transformation and transduction are deemed less important, recent discoveries suggest their role may be larger than previously thought. Understanding the extent of the resistome and how its mobilization to pathogenic bacteria takes place is essential for efforts to control the dissemination of these genes. Here, we will discuss the concept of the resistome, provide examples of HGT of clinically relevant ARGs and present an overview of the current knowledge of the contributions the various HGT mechanisms make to the spread of antibiotic resistance.

  4. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  5. Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment.

    NARCIS (Netherlands)

    Ricard, G.N.S.; McEwan, N.R.; Dutilh, B.E.; Jouany, J.P.; Macheboeuf, D.; Mitsumori, M.; McIntosh, F.M.; Michalowski, T.; Nagamine, T.; Nelson, N.; Newbold, C.J.; Nsabimana, E.; Takenaka, A; Thomas, N.A.; Ushida, K.; Hackstein, J.H.P.; Huynen, M.A.

    2006-01-01

    BACKGROUND: The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major

  6. Adenovirus-assisted lipofection: efficient in vitro gene transfer of luciferase and cytosine deaminase to human smooth muscle cells.

    Science.gov (United States)

    Kreuzer, J; Denger, S; Reifers, F; Beisel, C; Haack, K; Gebert, J; Kübler, W

    1996-07-01

    Smooth muscle cells (SMC) are a central cell type involved in multiple processes of coronary artery diseases including restenosis and therefore are major target cells for different aspects of gene transfer. Previous attempts to transfect primary arterial cells using different techniques like liposomes, CaPO4 and electroporation resulted in only low transfection efficiency. The development of recombinant adenoviruses dramatically improved the delivery of foreign genes into different cell types including SMC. However, cloning and identification of recombinants remain difficult and time-consuming techniques. The present study demonstrates that a complex consisting of reporter plasmid encoding firefly luciferase (pLUC), polycationic liposomes and replication-deficient adenovirus was able to yield very high in vitro transfection of primary human smooth muscle cells under optimized conditions. The technique of adenovirus-assisted lipofection (AAL) increases transfer and expression of plasmid DNA in human smooth muscle cells in vitro up to 1000-fold compared to lipofection. To verify the applicability of AAL for gene transfer into human smooth muscle cells we studied a gene therapy approach to suppress proliferation of SMC in vitro, using the prokaryotic cytosine deaminase gene (CD) which enables transfected mammalian cells to deaminate 5-fluorocytosine (5-FC) to the highly toxic 5-fluorouracil (5-FU). The effect of a transient CD expression on RNA synthesis was investigated by means of a cotransfection with a RSV-CD expression plasmid and the luciferase reporter plasmid. Western blot analysis demonstrated high expression of CD protein in transfected SMC. Cotransfected SMC demonstrated two-fold less luciferase activity in the presence of 5-FC (5 mmol/l) after 48 h compared to cells transfected with a non-CD coding plasmid. The data demonstrate that a transient expression of CD could be sufficient to reduce the capacity of protein synthesis in human SMC. This simple and

  7. Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

    International Nuclear Information System (INIS)

    Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun

    2007-01-01

    Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

  8. Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

  9. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    Science.gov (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  10. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

    2015-10-01

    Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

  11. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  12. Development of a high-titer retrovirus producer cell line capable of gene transfer into rhesus monkey hematopoietic stem cells

    International Nuclear Information System (INIS)

    Bodine, D.M.; McDonagh, K.T.; Brandt, S.J.; Ney, P.A.; Agricola, B.; Byrne, E.; Nienhuis, A.W.

    1990-01-01

    Retroviral-mediated gene transfer into primitive hematopoietic cells has been difficult to achieve in large-animal models. The authors have developed an amphotropic producer clone that generates >10 10 recombinant retroviral particles (colony-forming units) per ml of culture medium. Autologous rhesus monkey bone marrow cells were cocultured with either high or low titer producer clones for 4-6 days and reinfused into sublethally irradiated animals. The proviral genome was detected in blood and bone-marrow cells from all three animals reconstituted with cells cocultured with the high-titer producer cells. In contrast, three animals reconstituted with bone marrow cocultured with the low-titer producer clone exhibited no evidence of gene transfer

  13. Direct gene transfer in the Gottingen minipig CNS using stereotaxic lentiviral microinjections

    DEFF Research Database (Denmark)

    GLUD, AN; Hedegaard, Claus; Nielsen, Mette Slot

    2010-01-01

    We aim to induce direct viral mediated gene transfer in the substantia nigra (SN) of the Gottingen minipig using MRI guided stereotaxic injections of lentiviral vectors encoding enhanced green fluorescent protein (EGFP). Nine female Gottingen minipigs were injected unilaterally into the SN with 6...... per 2.5 microliters lentivirus capable of transducing cells and mediating expression of recombinant EGFP. The animals were euthanized after four (n=3) or twenty weeks (n=6). Fresh brain tissue from three animals was used for PCR. The remaining six brains were cryo- or paraffin...

  14. Lateral gene exchanges shape the genomes of amoeba-resisting microorganisms

    Directory of Open Access Journals (Sweden)

    Claire eBertelli

    2012-08-01

    Full Text Available Based on Darwin’s concept of the tree of life, vertical inheritance was thought to be dominant, and mutations, deletions and duplication were streaming the genomes of living organisms. In the current genomic era, increasing data indicated that both vertical and lateral gene inheritance interact in space and time to trigger genome evolution, particularly among microorganisms sharing a given ecological niche. As a paradigm to their diversity and their survival in a variety of cell types, intracellular microorganisms, and notably intracellular bacteria, were considered as less prone to lateral genetic exchanges. Such specialized microorganisms generally have a smaller gene repertoire because they do rely on their host’s factors for some basic regulatory and metabolic functions. Here we review events of lateral gene transfer (LGT that illustrate the genetic exchanges among intra-amoebal microorganisms or between the microorganism and its amoebal host. We tentatively investigate the functions of laterally transferred genes in the light of the interaction with their host as they should confer a selective advantage and success to the amoeba-resisting microorganisms.

  15. Highly efficient gene knockout by injection of TALEN mRNAs into oocytes and host transfer in Xenopus laevis

    Directory of Open Access Journals (Sweden)

    Keisuke Nakajima

    2015-01-01

    Full Text Available Zinc-finger nucleases, transcription activator-like effector nucleases (TALENs and the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins system are potentially powerful tools for producing tailor-made knockout animals. However, their mutagenic activity is not high enough to induce mutations at all loci of a target gene throughout an entire tadpole. In this study, we present a highly efficient method for introducing gene modifications at almost all target sequences in randomly selected embryos. The gene modification activity of TALEN is enhanced by adopting the host-transfer technique. In our method, the efficiency is further improved by injecting TALEN mRNAs fused to the 3′UTR of the Xenopus DEADSouth gene into oocytes, which are then transferred into a host female frog, where they are ovulated and fertilized. The addition of the 3′UTR of the DEADSouth gene promotes mRNA translation in the oocytes and increases the expression of TALEN proteins to near-maximal levels three hours post fertilization (hpf. In contrast, TALEN mRNAs without this 3′UTR are translated infrequently in oocytes. Our data suggest that genomic DNA is more sensitive to TALEN proteins from fertilization to the midblastula (MBT stage. Our method works by increasing the levels of TALEN proteins during the pre-MBT stages.

  16. Increased Abundance and Transferability of Resistance Genes after Field Application of Manure from Sulfadiazine-Treated Pigs

    Science.gov (United States)

    Jechalke, Sven; Kopmann, Christoph; Rosendahl, Ingrid; Groeneweg, Joost; Weichelt, Viola; Krögerrecklenfort, Ellen; Brandes, Nikola; Nordwig, Mathias; Ding, Guo-Chun; Siemens, Jan; Heuer, Holger

    2013-01-01

    Spreading manure containing antibiotics in agriculture is assumed to stimulate the dissemination of antibiotic resistance in soil bacterial populations. Plant roots influencing the soil environment and its microflora by exudation of growth substrates might considerably increase this effect. In this study, the effects of manure from pigs treated with sulfadiazine (SDZ), here called SDZ manure, on the abundance and transferability of sulfonamide resistance genes sul1 and sul2 in the rhizosphere of maize and grass were compared to the effects in bulk soil in a field experiment. In plots that repeatedly received SDZ manure, a significantly higher abundance of both sul genes was detected compared to that in plots where manure from untreated pigs was applied. Significantly lower abundances of sul genes relative to bacterial ribosomal genes were encountered in the rhizosphere than in bulk soil. However, in contrast to results for bulk soil, the sul gene abundance in the SDZ manure-treated rhizosphere constantly deviated from control treatments over a period of 6 weeks after manuring, suggesting ongoing antibiotic selection over this period. Transferability of sulfonamide resistance was analyzed by capturing resistance plasmids from soil communities into Escherichia coli. Increased rates of plasmid capture were observed in samples from SDZ manure-treated bulk soil and the rhizosphere of maize and grass. More than 97% of the captured plasmids belonged to the LowGC type (having low G+C content), giving further evidence for their important contribution to the environmental spread of antibiotic resistance. In conclusion, differences between bulk soil and rhizosphere need to be considered when assessing the risks associated with the spreading of antibiotic resistance. PMID:23315733

  17. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  18. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    NARCIS (Netherlands)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Rocha, Da Martine; Bajew, Simon; Neilson, Roy; Sokolova, Elena; Silva, Da Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Hans; Jones, John T.; Eves-van den Akker, Sebastian

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been

  19. Heat-transfer-based detection of SNPs in the PAH gene of PKU patients

    Directory of Open Access Journals (Sweden)

    Vanden Bon N

    2014-03-01

    Full Text Available Natalie Vanden Bon,1 Bart van Grinsven,2 Mohammed Sharif Murib,2 Weng Siang Yeap,2 Ken Haenen,2,3 Ward De Ceuninck,2,3 Patrick Wagner,2,3 Marcel Ameloot,1 Veronique Vermeeren,1 Luc Michiels11Biomedical Research Institute, Hasselt University, Diepenbeek, Belgium; 2Institute for Materials Research, Hasselt University, Diepenbeek, Belgium; 3IMOMEC, Diepenbeek, BelgiumAbstract: Conventional neonatal diagnosis of phenylketonuria is based on the presence of abnormal levels of phenylalanine in the blood. However, for carrier detection and prenatal diagnosis, direct detection of disease-correlated mutations is needed. To speed up and simplify mutation screening in genes, new technologies are developed. In this study, a heat-transfer method is evaluated as a mutation-detection technology in entire exons of the phenylalanine hydroxylase (PAH gene. This method is based on the change in heat-transfer resistance (Rth upon thermal denaturation of dsDNA (double-stranded DNA on nanocrystalline diamond. First, ssDNA (single-stranded DNA fragments that span the size range of the PAH exons were successfully immobilized on nanocrystalline diamond. Next, it was studied whether an Rth change could be observed during the thermal denaturation of these DNA fragments after hybridization to their complementary counterpart. A clear Rth shift during the denaturation of exon 5, exon 9, and exon 12 dsDNA was observed, corresponding to lengths of up to 123 bp. Finally, Rth was shown to detect prevalent single-nucleotide polymorphisms, c.473G>A (R158Q, c.932T>C (p.L311P, and c.1222C>T (R408W, correlated with phenylketonuria, displaying an effect related to the different melting temperatures of homoduplexes and heteroduplexes.Keywords: mutation detection, heat-transfer resistance, melting temperature, nanocrystalline diamond, persistence length

  20. Adenovirus-mediated interleukin-12 gene transfer combined with cytosine deaminase followed by 5-fluorocytosine treatment exerts potent antitumor activity in Renca tumor-bearing mice

    International Nuclear Information System (INIS)

    Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo

    2005-01-01

    Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers

  1. Separating the mechanism-based and off-target actions of cholesteryl ester transfer protein inhibitors with CETP gene polymorphisms

    NARCIS (Netherlands)

    Sofat, Reecha; Hingorani, Aroon D.; Smeeth, Liam; Humphries, Steve E.; Talmud, Philippa J.; Cooper, Jackie; Shah, Tina; Sandhu, Manjinder S.; Ricketts, Sally L.; Boekholdt, S. Matthijs; Wareham, Nicholas; Khaw, Kay Tee; Kumari, Meena; Kivimaki, Mika; Marmot, Michael; Asselbergs, Folkert W.; van der Harst, Pim; Dullaart, Robin P. F.; Navis, Gerjan; van Veldhuisen, Dirk J.; van Gilst, Wiek H.; Thompson, John F.; McCaskie, Pamela; Palmer, Lyle J.; Arca, Marcello; Quagliarini, Fabiana; Gaudio, Carlo; Cambien, François; Nicaud, Viviane; Poirer, Odette; Gudnason, Vilmundur; Isaacs, Aaron; Witteman, Jacqueline C. M.; van Duijn, Cornelia M.; Pencina, Michael; Vasan, Ramachandran S.; D'Agostino, Ralph B.; Ordovas, Jose; Li, Tricia Y.; Kakko, Sakari; Kauma, Heikki; Savolainen, Markku J.; Kesäniemi, Y. Antero; Sandhofer, Anton; Paulweber, Bernhard; Sorli, Jose V.; Goto, Akimoto; Yokoyama, Shinji; Okumura, Kenji; Horne, Benjamin D.; Packard, Chris; Freeman, Dilys; Ford, Ian; Sattar, Naveed; McCormack, Valerie; Lawlor, Debbie A.; Ebrahim, Shah; Smith, George Davey; Kastelein, John J. P.; Deanfield, John; Casas, Juan P.

    2010-01-01

    BACKGROUND: Cholesteryl ester transfer protein (CETP) inhibitors raise high-density lipoprotein (HDL) cholesterol, but torcetrapib, the first-in-class inhibitor tested in a large outcome trial, caused an unexpected blood pressure elevation and increased cardiovascular events. Whether the

  2. Microfluidic Transduction Harnesses Mass Transport Principles to Enhance Gene Transfer Efficiency.

    Science.gov (United States)

    Tran, Reginald; Myers, David R; Denning, Gabriela; Shields, Jordan E; Lytle, Allison M; Alrowais, Hommood; Qiu, Yongzhi; Sakurai, Yumiko; Li, William C; Brand, Oliver; Le Doux, Joseph M; Spencer, H Trent; Doering, Christopher B; Lam, Wilbur A

    2017-10-04

    Ex vivo gene therapy using lentiviral vectors (LVs) is a proven approach to treat and potentially cure many hematologic disorders and malignancies but remains stymied by cumbersome, cost-prohibitive, and scale-limited production processes that cannot meet the demands of current clinical protocols for widespread clinical utilization. However, limitations in LV manufacture coupled with inefficient transduction protocols requiring significant excess amounts of vector currently limit widespread implementation. Herein, we describe a microfluidic, mass transport-based approach that overcomes the diffusion limitations of current transduction platforms to enhance LV gene transfer kinetics and efficiency. This novel ex vivo LV transduction platform is flexible in design, easy to use, scalable, and compatible with standard cell transduction reagents and LV preparations. Using hematopoietic cell lines, primary human T cells, primary hematopoietic stem and progenitor cells (HSPCs) of both murine (Sca-1 + ) and human (CD34 + ) origin, microfluidic transduction using clinically processed LVs occurs up to 5-fold faster and requires as little as one-twentieth of LV. As an in vivo validation of the microfluidic-based transduction technology, HSPC gene therapy was performed in hemophilia A mice using limiting amounts of LV. Compared to the standard static well-based transduction protocols, only animals transplanted with microfluidic-transduced cells displayed clotting levels restored to normal. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. Fast transfer of shared data

    International Nuclear Information System (INIS)

    Timmer, C.; Abbott, D.J.; Heyes, W.G.; Jostizembski, E.; MacLeod, R.W.; Wolin, E.

    2000-01-01

    The Event Transfer system enables its users to produce events (data) and share them with other users by utilizing shared memory on either Solaris or Linux-based computers. Its design emphasizes speed, reliability, ease of use, and recoverability from crashes. In addition to fast local operation, the ET system allows network transfer of events. Using multi-threaded code based on POSIX threades and mutexes, a successful implementation was developed which allowed passing events over 500 kHz on a 4 cpu Sun workstation and 150 kHz on a dual cpu PC

  4. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  5. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    Directory of Open Access Journals (Sweden)

    Zanatta Daniela B

    2010-06-01

    Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

  6. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    International Nuclear Information System (INIS)

    Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

    2010-01-01

    Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

  7. Separating the Mechanism-Based and Off-Target Actions of Cholesteryl Ester Transfer Protein Inhibitors With CETP Gene Polymorphisms

    NARCIS (Netherlands)

    Sofat, Reecha; Hingorani, Aroon D.; Smeeth, Liam; Humphries, Steve E.; Talmud, Philippa J.; Cooper, Jackie; Shah, Tina; Sandhu, Manjinder S.; Ricketts, Sally L.; Boekholdt, S. Matthijs; Wareham, Nicholas; Khaw, Kay Tee; Kumari, Meena; Kivimaki, Mika; Marmot, Michael; Asselbergs, Folkert W.; van der Harst, Pim; Dullaart, Robin P. F.; Navis, Gerjan; van Veldhuisen, Dirk J.; Van Gilst, Wiek H.; Thompson, John F.; McCaskie, Pamela; Palmer, Lyle J.; Arca, Marcello; Quagliarini, Fabiana; Gaudio, Carlo; Cambien, Francois; Nicaud, Viviane; Poirer, Odette; Gudnason, Vilmundur; Isaacs, Aaron; Witteman, Jacqueline C. M.; van Duijn, Cornelia M.; Pencina, Michael; Vasan, Ramachandran S.; D'Agostino, Ralph B.; Ordovas, Jose; Li, Tricia Y.; Kakko, Sakari; Kauma, Heikki; Savolainen, Markku J.; Kesaniemi, Y. Antero; Sandhofer, Anton; Paulweber, Bernhard; Sorli, Jose V.; Goto, Akimoto; Yokoyama, Shinji; Okumura, Kenji; Horne, Benjamin D.; Packard, Chris; Freeman, Dilys; Ford, Ian; Sattar, Naveed; McCormack, Valerie; Lawlor, Debbie A.; Ebrahim, Shah; Smith, George Davey; Kastelein, John J. P.; Deanfield, John; Casas, Juan P.

    2010-01-01

    Background-Cholesteryl ester transfer protein (CETP) inhibitors raise high-density lipoprotein (HDL) cholesterol, but torcetrapib, the first-in-class inhibitor tested in a large outcome trial, caused an unexpected blood pressure elevation and increased cardiovascular events. Whether the hypertensive

  8. Exercise-Induced Rhabdomyolysis and Stress-Induced Malignant Hyperthermia Events, Association with Malignant Hyperthermia Susceptibility, and RYR1 Gene Sequence Variations

    Directory of Open Access Journals (Sweden)

    Antonella Carsana

    2013-01-01

    Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.

  9. Comparison of lentiviral and sleeping beauty mediated αβ T cell receptor gene transfer.

    Directory of Open Access Journals (Sweden)

    Anne-Christine Field

    Full Text Available Transfer of tumour antigen-specific receptors to T cells requires efficient delivery and integration of transgenes, and currently most clinical studies are using gamma retroviral or lentiviral systems. Whilst important proof-of-principle data has been generated for both chimeric antigen receptors and αβ T cell receptors, the current platforms are costly, time-consuming and relatively inflexible. Alternative, more cost-effective, Sleeping Beauty transposon-based plasmid systems could offer a pathway to accelerated clinical testing of a more diverse repertoire of recombinant high affinity T cell receptors. Nucleofection of hyperactive SB100X transposase-mediated stable transposition of an optimised murine-human chimeric T cell receptor specific for Wilm's tumour antigen from a Sleeping Beauty transposon plasmid. Whilst transfer efficiency was lower than that mediated by lentiviral transduction, cells could be readily enriched and expanded, and mediated effective target cells lysis in vitro and in vivo. Integration sites of transposed TCR genes in primary T cells were almost randomly distributed, contrasting the predilection of lentiviral vectors for transcriptionally active sites. The results support exploitation of the Sleeping Beauty plasmid based system as a flexible and adaptable platform for accelerated, early-phase assessment of T cell receptor gene therapies.

  10. The Substructure of a Flux Transfer Event Observed by the MMS Spacecraft

    Science.gov (United States)

    Hwang, K.-J.; Sibeck, D. G.; Giles, B. L.; Pollock, C. J.; Gershman, D.; Avanov, L.; Paterson, W. R.; Dorelli, J. C.; Ergun, R. E.; Russel, C. T.; hide

    2016-01-01

    On 15 August 2015, MMS (Magnetospheric Multiscale mission), skimming the dusk magnetopause, detected an isolated region of an increased magnetic strength and bipolar Bn, indicating a flux transfer event (FTE). The four spacecraft in a tetrahedron allowed for investigations of the shape and motion of the FTE. In particular, high-resolution particle data facilitated our exploration of FTE substructures and their magnetic connectivity inside and surrounding the FTE. Combined field and plasma observations suggest that the core fields are open, magnetically connected to the northern magnetosphere from which high-energy particles leak; ion "D" distributions characterize the axis of flux ropes that carry old-opened field lines; counter streaming electrons superposed by parallel-heated components populate the periphery surrounding the FTE; and the interface between the core and draped regions contains a separatrix of newlyopened magnetic field lines that emanate from the X line above the FTE.

  11. Transfer and expression of the rabbit defensin NP-1 gene in lettuce (Lactuca sativa).

    Science.gov (United States)

    Song, D; Xiong, X; Tu, W F; Yao, W; Liang, H W; Chen, F J; He, Z Q

    2017-01-23

    Lettuce (Lactuca sativa L.) is an annual plant of the daisy family, Asteraceae, with high food and medicinal value. However, the crop is susceptible to several viruses that are transmitted by aphids and is highly vulnerable to post-harvest diseases, as well as insect and mammal pests and fungal and bacterial diseases. Here, the rabbit defensin gene NP-1 was transferred into lettuce by Agrobacterium-mediated transformation to obtain a broad-spectrum disease-resistant lettuce. Transgenic lettuce plants were selected and regenerated on selective media. The presence of the NP-1 gene in these plants was confirmed by western blot analyses. Resistance tests revealed native defensin NP-1 expression conferred partial resistance to Bacillus subtilis and Pseudomonas aeruginosa, which suggests new possibilities for lettuce disease resistance.

  12. Mechanisms of Ectopic Gene Conversion

    Directory of Open Access Journals (Sweden)

    P.J. Hastings

    2010-11-01

    Full Text Available Gene conversion (conversion, the unidirectional transfer of DNA sequence information, occurs as a byproduct of recombinational repair of broken or damaged DNA molecules. Whereas excision repair processes replace damaged DNA by copying the complementary sequence from the undamaged strand of duplex DNA, recombinational mechanisms copy similar sequence, usually in another molecule, to replace the damaged sequence. In mitotic cells the other molecule is usually a sister chromatid, and the repair does not lead to genetic change. Less often a homologous chromosome or homologous sequence in an ectopic position is used. Conversion results from repair in two ways. First, if there was a double-strand gap at the site of a break, homologous sequence will be used as the template for synthesis to fill the gap, thus transferring sequence information in both strands. Second, recombinational repair uses complementary base pairing, and the heteroduplex molecule so formed is a source of conversion, both as heteroduplex and when donor (undamaged template information is retained after correction of mismatched bases in heteroduplex. There are mechanisms that favour the use of sister molecules that must fail before ectopic homology can be used. Meiotic recombination events lead to the formation of crossovers required in meiosis for orderly segregation of pairs of homologous chromosomes. These events result from recombinational repair of programmed double-strand breaks, but in contrast with mitotic recombination, meiotic recombinational events occur predominantly between homologous chromosomes, so that transfer of sequence differences by conversion is very frequent. Transient recombination events that do not form crossovers form both between homologous chromosomes and between regions of ectopic homology, and leave their mark in the occurrence of frequent non-crossover conversion, including ectopic conversion.

  13. Metagenomic Analyses Reveal That Energy Transfer Gene Abundances Can Predict the Syntrophic Potential of Environmental Microbial Communities

    Directory of Open Access Journals (Sweden)

    Lisa Oberding

    2016-01-01

    Full Text Available Hydrocarbon compounds can be biodegraded by anaerobic microorganisms to form methane through an energetically interdependent metabolic process known as syntrophy. The microorganisms that perform this process as well as the energy transfer mechanisms involved are difficult to study and thus are still poorly understood, especially on an environmental scale. Here, metagenomic data was analyzed for specific clusters of orthologous groups (COGs related to key energy transfer genes thus far identified in syntrophic bacteria, and principal component analysis was used in order to determine whether potentially syntrophic environments could be distinguished using these syntroph related COGs as opposed to universally present COGs. We found that COGs related to hydrogenase and formate dehydrogenase genes were able to distinguish known syntrophic consortia and environments with the potential for syntrophy from non-syntrophic environments, indicating that these COGs could be used as a tool to identify syntrophic hydrocarbon biodegrading environments using metagenomic data.

  14. Measurement of event shapes at large momentum transfer with the ATLAS detector in pp collisions at $\\sqrt{s}$ = 7 TeV

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdelalim, Ahmed Ali; Abdinov, Ovsat; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Acerbi, Emilio; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Addy, Tetteh; Adelman, Jahred; Adomeit, Stefanie; Adragna, Paolo; Adye, Tim; Aefsky, Scott; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Aharrouche, Mohamed; Ahlen, Steven; Ahles, Florian; Ahmad, Ashfaq; Ahsan, Mahsana; Aielli, Giulio; Akdogan, Taylan; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alam, Mohammad; Alam, Muhammad Aftab; Albert, Justin; Albrand, Solveig; Aleksa, Martin; Aleksandrov, Igor; Alessandria, Franco; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alison, John; Allbrooke, Benedict; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alon, Raz; Alonso, Alejandro; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amelung, Christoph; Ammosov, Vladimir; Amorim, Antonio; Amram, Nir; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoun, Sahar; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Arce, Ayana; Arfaoui, Samir; Arguin, Jean-Francois; Arik, Engin; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnault, Christian; Artamonov, Andrei; Artoni, Giacomo; Arutinov, David; Asai, Shoji; Asfandiyarov, Ruslan; Ask, Stefan; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astbury, Alan; Aubert, Bernard; Auge, Etienne; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Avramidou, Rachel Maria; Axen, David; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baccaglioni, Giuseppe; Bacci, Cesare; Bach, Andre; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Badescu, Elisabeta; Bagnaia, Paolo; Bahinipati, Seema; Bai, Yu; Bailey, David; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Mark; Baker, Sarah; Banas, Elzbieta; Banerjee, Piyali; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barbaro Galtieri, Angela; Barber, Tom; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Bardin, Dmitri; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Barrillon, Pierre; Bartoldus, Rainer; Barton, Adam Edward; Bartsch, Valeria; Bates, Richard; Batkova, Lucia; Batley, Richard; Battaglia, Andreas; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beale, Steven; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becks, Karl-Heinz; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Begel, Michael; Behar Harpaz, Silvia; Beimforde, Michael; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellina, Francesco; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Benoit, Mathieu; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernat, Pauline; Bernhard, Ralf; Bernius, Catrin; Berry, Tracey; Bertella, Claudia; Bertin, Antonio; Bertolucci, Federico; Besana, Maria Ilaria; Besjes, Geert-Jan; Besson, Nathalie; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biscarat, Catherine; Bitenc, Urban; Black, Kevin; Blair, Robert; Blanchard, Jean-Baptiste; Blanchot, Georges; Blazek, Tomas; Blocker, Craig; Blocki, Jacek; Blondel, Alain; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boelaert, Nele; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Bolnet, Nayanka Myriam; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Booth, Chris; Bordoni, Stefania; Borer, Claudia; Borisov, Anatoly; Borissov, Guennadi; Borjanovic, Iris; Borri, Marcello; Borroni, Sara; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Botterill, David; Bouchami, Jihene; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Branchini, Paolo; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Bremer, Johan; Brendlinger, Kurt; Brenner, Richard; Bressler, Shikma; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brodet, Eyal; Broggi, Francesco; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brown, Gareth; Brown, Heather; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchanan, James; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Budick, Burton; Büscher, Volker; Bugge, Lars; Bulekov, Oleg; Bundock, Aaron Colin; Bunse, Moritz; Buran, Torleiv; Burckhart, Helfried; Burdin, Sergey; Burgess, Thomas; Burke, Stephen; Busato, Emmanuel; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Buttar, Craig; Butterworth, Jonathan; Buttinger, William; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Caloi, Rita; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarri, Paolo; Cameron, David; Caminada, Lea Michaela; Campana, Simone; Campanelli, Mario; Canale, Vincenzo; Canelli, Florencia; Canepa, Anadi; Cantero, Josu; Cantrill, Robert; Capasso, Luciano; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capriotti, Daniele; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Bryan; Caron, Sascha; Carquin, Edson; Carrillo Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Cascella, Michele; Caso, Carlo; Castaneda Hernandez, Alfredo Martin; Castaneda-Miranda, Elizabeth; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Cataldi, Gabriella; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cavalleri, Pietro; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Kevin; Chapleau, Bertrand; Chapman, John Derek; Chapman, John Wehrley; Chareyre, Eve; Charlton, Dave; Chavda, Vikash; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Shenjian; Chen, Xin; Chen, Yujiao; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Cheung, Sing-Leung; Chevalier, Laurent; Chiefari, Giovanni; Chikovani, Leila; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Choudalakis, Georgios; Chouridou, Sofia; Christidi, Illectra-Athanasia; Christov, Asen; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocca, Claudia; Ciocio, Alessandra; Cirilli, Manuela; Cirkovic, Predrag; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Benoit; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Cogan, Joshua Godfrey; Coggeshall, James; Cogneras, Eric; Colas, Jacques; Colijn, Auke-Pieter; Collins, Neil; Collins-Tooth, Christopher; Collot, Johann; Colombo, Tommaso; Colon, German; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Costin, Tudor; Côté, David; Courneyea, Lorraine; Cowan, Glen; Cowden, Christopher; Cox, Brian; Cranmer, Kyle; Crescioli, Francesco; Cristinziani, Markus; Crosetti, Giovanni; Crupi, Roberto; Crépé-Renaudin, Sabine; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Curatolo, Maria; Curtis, Chris; Cuthbert, Cameron; Cwetanski, Peter; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; D'Orazio, Alessia; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dallapiccola, Carlo; Dam, Mogens; Dameri, Mauro; Damiani, Daniel; Danielsson, Hans Olof; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Davey, Will; Davidek, Tomas; Davidson, Nadia; Davidson, Ruth; Davies, Eleanor; Davies, Merlin; Davison, Adam; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; de Graat, Julien; De Groot, Nicolo; de Jong, Paul; De La Taille, Christophe; De la Torre, Hector; De Lorenzi, Francesco; de Mora, Lee; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; De Zorzi, Guido; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Degenhardt, James; Del Papa, Carlo; Del Peso, Jose; Del Prete, Tarcisio; Delemontex, Thomas; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demirkoz, Bilge; Deng, Jianrong; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Devetak, Erik; Deviveiros, Pier-Olivier; Dewhurst, Alastair; DeWilde, Burton; Dhaliwal, Saminder; Dhullipudi, Ramasudhakar; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Luise, Silvestro; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dindar Yagci, Kamile; Dingfelder, Jochen; Dinut, Florin; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobbs, Matt; Dobinson, Robert; Dobos, Daniel; Dobson, Ellie; Dodd, Jeremy; Doglioni, Caterina; Doherty, Tom; Doi, Yoshikuni; Dolejsi, Jiri; Dolenc, Irena; Dolezal, Zdenek; Dolgoshein, Boris; Dohmae, Takeshi; Donadelli, Marisilvia; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dotti, Andrea; Dova, Maria-Teresa; Doxiadis, Alexander; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Duchovni, Ehud; Duckeck, Guenter; Dudarev, Alexey; Dudziak, Fanny; Dührssen, Michael; Duerdoth, Ian; Duflot, Laurent; Dufour, Marc-Andre; Dunford, Monica; Duran Yildiz, Hatice; Duxfield, Robert; Dwuznik, Michal; Dydak, Friedrich; Düren, Michael; Ebke, Johannes; Eckweiler, Sebastian; Edmonds, Keith; Edwards, Clive; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Eisenhandler, Eric; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Katherine; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Engelmann, Roderich; Engl, Albert; Epp, Brigitte; Eppig, Andrew; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Espinal Curull, Xavier; Esposito, Bellisario; Etienne, Francois; Etienvre, Anne-Isabelle; Etzion, Erez; Evangelakou, Despoina; Evans, Hal; Fabbri, Laura; Fabre, Caroline; Fakhrutdinov, Rinat; Falciano, Speranza; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farley, Jason; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassnacht, Patrick; Fassouliotis, Dimitrios; Fatholahzadeh, Baharak; Favareto, Andrea; Fayard, Louis; Fazio, Salvatore; Febbraro, Renato; Federic, Pavol; Fedin, Oleg; Fedorko, Woiciech; Fehling-Kaschek, Mirjam; Feligioni, Lorenzo; Fellmann, Denis; Feng, Cunfeng; Feng, Eric; Fenyuk, Alexander; Ferencei, Jozef; Fernando, Waruna; Ferrag, Samir; Ferrando, James; Ferrara, Valentina; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filthaut, Frank; Fincke-Keeler, Margret; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Gordon; Fisher, Matthew; Flechl, Martin; Fleck, Ivor; Fleckner, Johanna; Fleischmann, Philipp; Fleischmann, Sebastian; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Fonseca Martin, Teresa; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Francavilla, Paolo; Franchino, Silvia; Francis, David; Frank, Tal; Franz, Sebastien; Fraternali, Marco; Fratina, Sasa; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froeschl, Robert; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gadfort, Thomas; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Gan, KK; Gao, Yongsheng; Gaponenko, Andrei; Garberson, Ford; Garcia-Sciveres, Maurice; García, Carmen; García Navarro, José Enrique; Gardner, Robert; Garelli, Nicoletta; Garitaonandia, Hegoi; Garonne, Vincent; Garvey, John; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerlach, Peter; Gershon, Avi; Geweniger, Christoph; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giakoumopoulou, Victoria; Giangiobbe, Vincent; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Adam; Gibson, Stephen; Gillberg, Dag; Gillman, Tony; Gingrich, Douglas; Ginzburg, Jonatan; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giovannini, Paola; Giraud, Pierre-Francois; Giugni, Danilo; Giunta, Michele; Giusti, Paolo; Gjelsten, Børge Kile; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glazov, Alexandre; Glitza, Karl-Walter; Glonti, George; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goebel, Martin; Göpfert, Thomas; Goeringer, Christian; Gössling, Claus; Goldfarb, Steven; Golling, Tobias; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gonzalez, Saul; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goodson, Jeremiah Jet; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Gosdzik, Bjoern; Goshaw, Alfred; Gosselink, Martijn; Gostkin, Mikhail Ivanovitch; Gough Eschrich, Ivo; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Grancagnolo, Francesco; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Grau, Nathan; Gray, Heather; Gray, Julia Ann; Graziani, Enrico; Grebenyuk, Oleg; Greenshaw, Timothy; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grinstein, Sebastian; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Gross, Eilam; Grosse-Knetter, Joern; Groth-Jensen, Jacob; Grybel, Kai; Guest, Daniel; Guicheney, Christophe; Guida, Angelo; Guindon, Stefan; Gul, Umar; Guler, Hulya; Gunther, Jaroslav; Guo, Bin; Guo, Jun; Gutierrez, Phillip; Guttman, Nir; Gutzwiller, Olivier; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haas, Stefan; Haber, Carl; Hadavand, Haleh Khani; Hadley, David; Haefner, Petra; Hahn, Ferdinand; Haider, Stefan; Hajduk, Zbigniew; Hakobyan, Hrachya; Hall, David; Haller, Johannes; Hamacher, Klaus; Hamal, Petr; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Handel, Carsten; Hanke, Paul; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hansson, Per; Hara, Kazuhiko; Hare, Gabriel; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Hartert, Jochen; Hartjes, Fred; Haruyama, Tomiyoshi; Harvey, Alex; Hasegawa, Satoshi; Hasegawa, Yoji; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hawkins, Donovan; Hayakawa, Takashi; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; He, Mao; Head, Simon; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heinemann, Beate; Heisterkamp, Simon; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, Robert; Henke, Michael; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Henß, Tobias; Medina Hernandez, Carlos; Hernández Jiménez, Yesenia; Herrberg, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Higón-Rodriguez, Emilio; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirsch, Florian; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holder, Martin; Holmgren, Sven-Olof; Holy, Tomas; Holzbauer, Jenny; Hong, Tae Min; Hooft van Huysduynen, Loek; Horn, Claus; Horner, Stephan; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huettmann, Antje; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hurwitz, Martina; Husemann, Ulrich; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibbotson, Michael; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Idarraga, John; Iengo, Paolo; Igonkina, Olga; Ikegami, Yoichi; Ikeno, Masahiro; Iliadis, Dimitrios; Ilic, Nikolina; Ince, Tayfun; Inigo-Golfin, Joaquin; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Jantsch, Andreas; Janus, Michel; Jarlskog, Göran; Jeanty, Laura; Jen-La Plante, Imai; Jenni, Peter; Jeremie, Andrea; Jež, Pavel; Jézéquel, Stéphane; Jha, Manoj Kumar; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinnouchi, Osamu; Joergensen, Morten Dam; Joffe, David; Johansen, Marianne; Johansson, Erik; Johansson, Per; Johnert, Sebastian; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Joram, Christian; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Jovin, Tatjana; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Juranek, Vojtech; Jussel, Patrick; Juste Rozas, Aurelio; Kabana, Sonja; Kaci, Mohammed; Kaczmarska, Anna; Kadlecik, Peter; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalinin, Sergey; Kalinovskaya, Lidia; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kaplon, Jan; Kar, Deepak; Karagounis, Michael; Karakostas, Konstantinos; Karnevskiy, Mikhail; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Mayuko; Kataoka, Yousuke; Katsoufis, Elias; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kayl, Manuel; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keil, Markus; Kekelidze, George; Keller, John; Kenyon, Mike; Kepka, Oldrich; Kerschen, Nicolas; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharchenko, Dmitri; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kittelmann, Thomas; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klemetti, Miika; Klier, Amit; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klinkby, Esben; Klioutchnikova, Tatiana; Klok, Peter; Klous, Sander; Kluge, Eike-Erik; Kluge, Thomas; Kluit, Peter; Kluth, Stefan; Knecht, Neil; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Ko, Byeong Rok; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Köneke, Karsten; König, Adriaan; Koenig, Sebastian; Köpke, Lutz; Koetsveld, Folkert; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohn, Fabian; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolachev, Guennady; Kolanoski, Hermann; Kolesnikov, Vladimir; Koletsou, Iro; Koll, James; Kollefrath, Michael; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kono, Takanori; Kononov, Anatoly; Konoplich, Rostislav; Konstantinidis, Nikolaos; Koperny, Stefan; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, James; Kraus, Jana; Kreiss, Sven; Krejci, Frantisek; Kretzschmar, Jan; Krieger, Nina; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruth, Andre; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Thorsten; Kuhn, Dietmar; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kummer, Christian; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurata, Masakazu; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwee, Regina; La Rosa, Alessandro; La Rotonda, Laura; Labarga, Luis; Labbe, Julien; Lablak, Said; Lacasta, Carlos; Lacava, Francesco; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laisne, Emmanuel; Lamanna, Massimo; Lambourne, Luke; Lampen, Caleb; Lampl, Walter; Lancon, Eric; Landgraf, Ulrich; Landon, Murrough; Lane, Jenna; Lang, Valerie Susanne; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Larner, Aimee; Lassnig, Mario; Laurelli, Paolo; Lavorini, Vincenzo; Lavrijsen, Wim; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Maner, Christophe; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Michel; Legendre, Marie; Legger, Federica; Leggett, Charles; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Lendermann, Victor; Leney, Katharine; Lenz, Tatiana; Lenzen, Georg; Lenzi, Bruno; Leonhardt, Kathrin; Leontsinis, Stefanos; Lepold, Florian; Leroy, Claude; Lessard, Jean-Raphael; Lester, Christopher; Lester, Christopher Michael; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bo; Li, Haifeng; Li, Shu; Li, Xuefei; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lichtnecker, Markus; Lie, Ki; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Limper, Maaike; Lin, Simon; Linde, Frank; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Chuanlei; Liu, Dong; Liu, Hao; Liu, Jianbei; Liu, Lulu; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lo Sterzo, Francesco; Losty, Michael; Lou, Xinchou; Lounis, Abdenour; Loureiro, Karina; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Ludwig, Andreas; Ludwig, Dörthe; Ludwig, Inga; Ludwig, Jens; Luehring, Frederick; Luijckx, Guy; Lukas, Wolfgang; Lumb, Debra; Luminari, Lamberto; Lund, Esben; Lund-Jensen, Bengt; Lundberg, Björn; Lundberg, Johan; Lundberg, Olof; Lundquist, Johan; Lungwitz, Matthias; Lynn, David; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Maček, Boštjan; Machado Miguens, Joana; Mackeprang, Rasmus; Madaras, Ronald; Mader, Wolfgang; Maenner, Reinhard; Maeno, Tadashi; Mättig, Peter; Mättig, Stefan; Magnoni, Luca; Magradze, Erekle; Mahboubi, Kambiz; Mahmoud, Sara; Mahout, Gilles; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Malecki, Piotr; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mameghani, Raphael; Mamuzic, Judita; Manabe, Atsushi; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Mangeard, Pierre-Simon; Manhaes de Andrade Filho, Luciano; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mapelli, Alessandro; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchese, Fabrizio; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marroquim, Fernando; Marshall, Zach; Martens, Kalen; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Jean-Pierre; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martin-Haugh, Stewart; Martinez, Mario; Martinez Outschoorn, Verena; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massaro, Graziano; Massol, Nicolas; Mastroberardino, Anna; Masubuchi, Tatsuya; Matricon, Pierre; Matsunaga, Hiroyuki; Matsushita, Takashi; Mattravers, Carly; Maurer, Julien; Maxfield, Stephen; Mayne, Anna; Mazini, Rachid; Mazur, Michael; Mazzaferro, Luca; Mazzanti, Marcello; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; McGlone, Helen; Mchedlidze, Gvantsa; Mclaughlan, Tom; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Mechtel, Markus; Medinnis, Mike; Meera-Lebbai, Razzak; Meguro, Tatsuma; Mehdiyev, Rashid; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mendoza Navas, Luis; Meng, Zhaoxia; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer, Joerg; Meyer, Thomas Christian; Meyer, W Thomas; Miao, Jiayuan; Michal, Sebastien; Micu, Liliana; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Miller, Robert; Mills, Bill; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Moeller, Victoria; Mönig, Klaus; Möser, Nicolas; Mohapatra, Soumya; Mohr, Wolfgang; Moles-Valls, Regina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Montesano, Simone; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Moorhead, Gareth; Mora Herrera, Clemencia; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Morello, Gianfranco; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Mueller, Felix; Mueller, James; Mueller, Klemens; Müller, Thomas; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murray, Bill; Mussche, Ido; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nadal, Jordi; Nagai, Koichi; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Nanava, Gizo; Napier, Austin; Narayan, Rohin; Nash, Michael; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neusiedl, Andrea; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen Thi Hong, Van; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Niedercorn, Francois; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsen, Henrik; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nordberg, Markus; Norton, Peter; Novakova, Jana; Nozaki, Mitsuaki; Nozka, Libor; Nugent, Ian Michael; Nuncio-Quiroz, Adriana-Elizabeth; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; O'Brien, Brendan Joseph; O'Neale, Steve; O'Neil, Dugan; O'Shea, Val; Oakes, Louise Beth; Oakham, Gerald; Oberlack, Horst; Ocariz, Jose; Ochi, Atsuhiko; Oda, Susumu; Odaka, Shigeru; Odier, Jerome; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohshima, Takayoshi; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira, Miguel Alfonso; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olivito, Dominick; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Orlov, Iliya; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Osuna, Carlos; Otero y Garzon, Gustavo; Ottersbach, John; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Simon; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganis, Efstathios; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Paleari, Chiara; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Papadelis, Aras; Papadopoulou, Theodora; Paramonov, Alexander; Paredes Hernandez, Daniela; Park, Woochun; Parker, Andy; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pashapour, Shabnaz; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pecsy, Martin; Pedraza Morales, Maria Isabel; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penson, Alexander; Penwell, John; Perantoni, Marcelo; Perez, Kerstin; Perez Cavalcanti, Tiago; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Perrodo, Pascal; Peshekhonov, Vladimir; Peters, Krisztian; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petschull, Dennis; Petteni, Michele; Pezoa, Raquel; Phan, Anna; Phillips, Peter William; Piacquadio, Giacinto; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piec, Sebastian Marcin; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pinto, Belmiro; Pizio, Caterina; Plamondon, Mathieu; Pleier, Marc-Andre; Plotnikova, Elena; Poblaguev, Andrei; Poddar, Sahill; Podlyski, Fabrice; Poggioli, Luc; Poghosyan, Tatevik; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polini, Alessandro; Poll, James; Polychronakos, Venetios; Pomeroy, Daniel; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospelov, Guennady; Pospisil, Stanislav; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Prabhu, Robindra; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Pretzl, Klaus Peter; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Prudent, Xavier; Przybycien, Mariusz; Przysiezniak, Helenka; Psoroulas, Serena; Ptacek, Elizabeth; Pueschel, Elisa; Purdham, John; Purohit, Milind; Puzo, Patrick; Pylypchenko, Yuriy; Qian, Jianming; Quadt, Arnulf; Quarrie, David; Quayle, William; Quinonez, Fernando; Raas, Marcel; Radescu, Voica; Radloff, Peter; Rador, Tonguc; Ragusa, Francesco; Rahal, Ghita; Rahimi, Amir; Rahm, David; Rajagopalan, Srinivasan; Rammensee, Michael; Rammes, Marcus; Randle-Conde, Aidan Sean; Randrianarivony, Koloina; Rauscher, Felix; Rave, Tobias Christian; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Reinherz-Aronis, Erez; Reinsch, Andreas; Reisinger, Ingo; Rembser, Christoph; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter-Was, Elzbieta; Ridel, Melissa; Rijpstra, Manouk; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Rios, Ryan Randy; Riu, Imma; Rivoltella, Giancesare; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Rocha de Lima, Jose Guilherme; Roda, Chiara; Roda Dos Santos, Denis; Roe, Adam; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romeo, Gaston; Romero Adam, Elena; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Anthony; Rose, Matthew; Rosenbaum, Gabriel; Rosenberg, Eli; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rosselet, Laurent; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexander; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Ruckert, Benjamin; Ruckstuhl, Nicole; Rud, Viacheslav; Rudolph, Christian; Rudolph, Gerald; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rumyantsev, Leonid; Rurikova, Zuzana; Rusakovich, Nikolai; Rutherfoord, John; Ruwiedel, Christoph; Ruzicka, Pavel; Ryabov, Yury; Ryan, Patrick; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Samset, Björn Hallvard; Sanchez, Arturo; Sanchez Martinez, Victoria; Sandaker, Heidi; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santamarina Rios, Cibran; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Saraiva, João; Sarangi, Tapas; Sarkisyan-Grinbaum, Edward; Sarri, Francesca; Sartisohn, Georg; Sasaki, Osamu; Sasao, Noboru; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Sauvan, Jean-Baptiste; Savard, Pierre; Savinov, Vladimir; Savu, Dan Octavian; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scallon, Olivia; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schäfer, Uli; Schaepe, Steffen; Schaetzel, Sebastian; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Schamov, Andrey; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitz, Martin; Schneider, Basil; Schnoor, Ulrike; Schöning, André; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schroeder, Christian; Schroer, Nicolai; Schultens, Martin Johannes; Schultes, Joachim; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwemling, Philippe; Schwienhorst, Reinhard; Schwierz, Rainer; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciolla, Gabriella; Scott, Bill; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellden, Bjoern; Sellers, Graham; Seman, Michal; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Seuster, Rolf; Severini, Horst; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Sherman, Daniel; Sherwood, Peter; Shibata, Akira; Shimizu, Shima; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Maria; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Sicho, Petr; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silbert, Ohad; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinnari, Louise Anastasia; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Ben Campbell; Smith, Douglas; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snow, Steve; Snow, Joel; Snyder, Scott; Sobie, Randall; Sodomka, Jaromir; Soffer, Abner; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Soni, Nitesh; Sopko, Vit; Sopko, Bruno; Sosebee, Mark; Soualah, Rachik; Soukharev, Andrey; Spagnolo, Stefania; Spanò, Francesco; Spighi, Roberto; Spigo, Giancarlo; Spila, Federico; Spiwoks, Ralf; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Staude, Arnold; Stavina, Pavel; Steele, Genevieve; Steinbach, Peter; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoerig, Kathrin; Stoicea, Gabriel; Stonjek, Stefan; Strachota, Pavel; Stradling, Alden; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strang, Michael; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Strong, John; Stroynowski, Ryszard; Strube, Jan; Stugu, Bjarne; Stumer, Iuliu; Stupak, John; Sturm, Philipp; Styles, Nicholas Adam; Soh, Dart-yin; Su, Dong; Subramania, Halasya Siva; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Suzuki, Yuta; Svatos, Michal; Swedish, Stephen; Sykora, Ivan; Sykora, Tomas; Sánchez, Javier; Ta, Duc; Tackmann, Kerstin; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tamsett, Matthew; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tapprogge, Stefan; Tardif, Dominique; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tassi, Enrico; Tatarkhanov, Mous; Tayalati, Yahya; Taylor, Christopher; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teinturier, Marthe; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Terada, Susumu; Terashi, Koji; Terron, Juan; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thoma, Sascha; Thomas, Juergen; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tic, Tomáš; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tique Aires Viegas, Florbela De Jes; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tonoyan, Arshak; Topfel, Cyril; Topilin, Nikolai; Torchiani, Ingo; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alesandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiakiris, Menelaos; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsung, Jieh-Wen; Tsuno, Soshi; Tsybychev, Dmitri; Tua, Alan; Tudorache, Alexandra; Tudorache, Valentina; Tuggle, Joseph; Turala, Michal; Turecek, Daniel; Turk Cakir, Ilkay; Turlay, Emmanuel; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Tzanakos, George; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ugland, Maren; Uhlenbrock, Mathias; Uhrmacher, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Unno, Yoshinobu; Urbaniec, Dustin; Usai, Giulio; Uslenghi, Massimiliano; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Vahsen, Sven; Valenta, Jan; Valente, Paolo; Valentinetti, Sara; Valero, Alberto; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; van der Graaf, Harry; van der Kraaij, Erik; Van Der Leeuw, Robin; van der Poel, Egge; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; van Vulpen, Ivo; Vanadia, Marco; Vandelli, Wainer; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vari, Riccardo; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vazquez Schroeder, Tamara; Vegni, Guido; Veillet, Jean-Jacques; Veloso, Filipe; Veness, Raymond; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinek, Elisabeth; Vinogradov, Vladimir; Virchaux, Marc; Virzi, Joseph; Vitells, Ofer; Viti, Michele; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; Volpini, Giovanni; von der Schmitt, Hans; von Loeben, Joerg; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorwerk, Volker; Vos, Marcel; Voss, Rudiger; Voss, Thorsten Tobias; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Wagner, Wolfgang; Wagner, Peter; Wahlen, Helmut; Wahrmund, Sebastian; Wakabayashi, Jun; Walch, Shannon; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Wang, Chiho; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Rui; Wang, Song-Ming; Wang, Tan; Warburton, Andreas; Ward, Patricia; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Anthony; Waugh, Ben; Weber, Marc; Weber, Michele; Weber, Pavel; Weidberg, Anthony; Weigell, Philipp; Weingarten, Jens; Weiser, Christian; Wellenstein, Hermann; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Werth, Michael; Wessels, Martin; Wetter, Jeffrey; Weydert, Carole; Whalen, Kathleen; Wheeler-Ellis, Sarah Jane; White, Andrew; White, Martin; White, Sebastian; Whitehead, Samuel Robert; Whiteson, Daniel; Whittington, Denver; Wicek, Francois; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilhelm, Ivan; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Eric; Williams, Hugh; Willis, William; Willocq, Stephane; Wilson, John; Wilson, Michael Galante; Wilson, Alan; Wingerter-Seez, Isabelle; Winkelmann, Stefan; Winklmeier, Frank; Wittgen, Matthias; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Wei-Cheng; Wooden, Gemma; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wraight, Kenneth; Wright, Catherine; Wright, Michael; Wrona, Bozydar; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xie, Song; Xu, Chao; Xu, Da; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamaoka, Jared; Yamazaki, Takayuki; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Un-Ki; Yang, Yi; Yang, Zhaoyu; Yanush, Serguei; Yao, Liwen; Yao, Yushu; Yasu, Yoshiji; Ybeles Smit, Gabriel Valentijn; Ye, Jingbo; Ye, Shuwei; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Riktura; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, Dantong; Yu, Jaehoon; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zajacova, Zuzana; Zanello, Lucia; Zaytsev, Alexander; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zendler, Carolin; Zenin, Oleg; Ženiš, Tibor; Zinonos, Zinonas; Zenz, Seth; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhan, Zhichao; Zhang, Dongliang; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Long; Zhao, Tianchi; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Ning; Zhou, Yue; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhuravlov, Vadym; Zieminska, Daria; Zimin, Nikolai; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Ziolkowski, Michael; Zitoun, Robert; Živković, Lidija; Zmouchko, Viatcheslav; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zutshi, Vishnu; Zwalinski, Lukasz

    2012-11-20

    A measurement of event shape variables is presented for large momentum transfer proton-proton collisions using the ATLAS detector at the Large Hadron Collider. Six event shape variables calculated using hadronic jets are studied in inclusive multi-jet events in 35 pb$^{-1}$ of integrated luminosity at a center-of-mass energy of $\\sqrt{s}$ = 7 TeV. These measurements are compared to predictions by three Monte Carlo event generators containing leading-logarithmic parton showers matched to leading order matrix elements for 2 $\\to$ 2 and 2 $\\to$ n (n=2,...6) scattering. Measurements of the third-jet resolution parameter, aplanarity, thrust, sphericity, and transverse sphericity are generally well described. The mean value of each event shape variable is evaluated as a function of the average momentum of the two leading jets pT1 and pT2, with a mean pT approaching 1 TeV.

  15. Sequence diversities of serine-aspartate repeat genes among Staphylococcus aureus isolates from different hosts presumably by horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Huping Xue

    Full Text Available BACKGROUND: Horizontal gene transfer (HGT is recognized as one of the major forces for bacterial genome evolution. Many clinically important bacteria may acquire virulence factors and antibiotic resistance through HGT. The comparative genomic analysis has become an important tool for identifying HGT in emerging pathogens. In this study, the Serine-Aspartate Repeat (Sdr family has been compared among different sources of Staphylococcus aureus (S. aureus to discover sequence diversities within their genomes. METHODOLOGY/PRINCIPAL FINDINGS: Four sdr genes were analyzed for 21 different S. aureus strains and 218 mastitis-associated S. aureus isolates from Canada. Comparative genomic analyses revealed that S. aureus strains from bovine mastitis (RF122 and mastitis isolates in this study, ovine mastitis (ED133, pig (ST398, chicken (ED98, and human methicillin-resistant S. aureus (MRSA (TCH130, MRSA252, Mu3, Mu50, N315, 04-02981, JH1 and JH9 were highly associated with one another, presumably due to HGT. In addition, several types of insertion and deletion were found in sdr genes of many isolates. A new insertion sequence was found in mastitis isolates, which was presumably responsible for the HGT of sdrC gene among different strains. Moreover, the sdr genes could be used to type S. aureus. Regional difference of sdr genes distribution was also indicated among the tested S. aureus isolates. Finally, certain associations were found between sdr genes and subclinical or clinical mastitis isolates. CONCLUSIONS: Certain sdr gene sequences were shared in S. aureus strains and isolates from different species presumably due to HGT. Our results also suggest that the distributional assay of virulence factors should detect the full sequences or full functional regions of these factors. The traditional assay using short conserved regions may not be accurate or credible. These findings have important implications with regard to animal husbandry practices that may

  16. Horizontal gene transfer confers adaptive advantages to phytopathogenic fungi: a case study of catalase-peroxidase in Fusarium verticillioides

    Science.gov (United States)

    Horizontal gene transfer (HGT), the exchange and stable integration of genetic material between different evolutionary lineages, is widely observed in fungi. We hypothesize that successful stabilization of HGT elements provides adaptive advantages (e.g., virulence). Catalase/peroxidases (KatGs) are ...

  17. AS3MT-mediated tolerance to arsenic evolved by multiple independent horizontal gene transfers from bacteria to eukaryotes

    DEFF Research Database (Denmark)

    Palmgren, Michael; Engström, Karin; Hallström, Björn M.

    2017-01-01

    the evolutionary origin of AS3MT and assessed the ability of different genotypes to produce methylated arsenic metabolites. Phylogenetic analysis suggests that multiple, independent horizontal gene transfers between different bacteria, and from bacteria to eukaryotes, increased tolerance to environmental arsenic...

  18. Constraints on genome dynamics revealed from gene distribution among the Ralstonia solanacearum species.

    Directory of Open Access Journals (Sweden)

    Pierre Lefeuvre

    Full Text Available Because it is suspected that gene content may partly explain host adaptation and ecology of pathogenic bacteria, it is important to study factors affecting genome composition and its evolution. While recent genomic advances have revealed extremely large pan-genomes for some bacterial species, it remains difficult to predict to what extent gene pool is accessible within or transferable between populations. As genomes bear imprints of the history of the organisms, gene distribution pattern analyses should provide insights into the forces and factors at play in the shaping and maintaining of bacterial genomes. In this study, we revisited the data obtained from a previous CGH microarrays analysis in order to assess the genomic plasticity of the R. solanacearum species complex. Gene distribution analyses demonstrated the remarkably dispersed genome of R. solanacearum with more than half of the genes being accessory. From the reconstruction of the ancestral genomes compositions, we were able to infer the number of gene gain and loss events along the phylogeny. Analyses of gene movement patterns reveal that factors associated with gene function, genomic localization and ecology delineate gene flow patterns. While the chromosome displayed lower rates of movement, the megaplasmid was clearly associated with hot-spots of gene gain and loss. Gene function was also confirmed to be an essential factor in gene gain and loss dynamics with significant differences in movement patterns between different COG categories. Finally, analyses of gene distribution highlighted possible highways of horizontal gene transfer. Due to sampling and design bias, we can only speculate on factors at play in this gene movement dynamic. Further studies examining precise conditions that favor gene transfer would provide invaluable insights in the fate of bacteria, species delineation and the emergence of successful pathogens.

  19. In Vivo Production of Monoclonal Antibodies by Gene Transfer via Electroporation Protects against Lethal Influenza and Ebola Infections

    Directory of Open Access Journals (Sweden)

    Chasity D. Andrews

    2017-12-01

    Full Text Available Monoclonal antibodies (mAbs have wide clinical utility, but global access is limited by high costs and impracticalities associated with repeated passive administration. Here, we describe an optimized electroporation-based DNA gene transfer platform technology that can be utilized for production of functional mAbs in vivo, with the potential to reduce costs and administration burdens. We demonstrate that multiple mAbs can be simultaneously expressed at protective concentrations for a protracted period of time using DNA doses and electroporation conditions that are feasible clinically. The expressed mAbs could also protect mice against lethal influenza or Ebola virus challenges. Our findings suggest that this DNA gene transfer platform technology could be a game-changing advance that expands access to effective mAb therapeutics globally.

  20. RNA interference screen to identify pathways that enhance or reduce nonviral gene transfer during lipofection.

    Science.gov (United States)

    Barker, Gregory A; Diamond, Scott L

    2008-09-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

  1. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  2. Human gene therapy: novel approaches to improve the current gene delivery systems.

    Science.gov (United States)

    Cucchiarini, Magali

    2016-06-01

    Even though gene therapy made its way through the clinics to treat a number of human pathologies since the early years of experimental research and despite the recent approval of the first gene-based product (Glybera) in Europe, the safe and effective use of gene transfer vectors remains a challenge in human gene therapy due to the existence of barriers in the host organism. While work is under active investigation to improve the gene transfer systems themselves, the use of controlled release approaches may offer alternative, convenient tools of vector delivery to achieve a performant gene transfer in vivo while overcoming the various physiological barriers that preclude its wide use in patients. This article provides an overview of the most significant contributions showing how the principles of controlled release strategies may be adapted for human gene therapy.

  3. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer

    OpenAIRE

    Buchlis, George; Podsakoff, Gregory M.; Radu, Antonetta; Hawk, Sarah M.; Flake, Alan W.; Mingozzi, Federico; High, Katherine A.

    2012-01-01

    In previous work we transferred a human factor IX–encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier ...

  4. Cellular Immune Response Against Firefly Luciferase After Sleeping Beauty–Mediated Gene Transfer In Vivo

    Science.gov (United States)

    Podetz-Pedersen, Kelly M.; Vezys, Vaiva; Somia, Nikunj V.; Russell, Stephen J.

    2014-01-01

    Abstract The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I–luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression. PMID:25093708

  5. Adenovirus-mediated heme oxygenase-1 gene transfer into rabbit ocular tissues.

    Science.gov (United States)

    Abraham, N G; da Silva, J L; Lavrovsky, Y; Stoltz, R A; Kappas, A; Dunn, M W; Schwartzman, M L

    1995-10-01

    Heme oxygenase-1 (HO-1) is a stress protein induced up to 100-fold within a few hours after exposure to oxidative stress, and it has been shown to counteract oxidative injury induced by ultraviolet light or free radicals. The current study was undertaken to determine whether the HO-1 gene can be introduced into adult rabbit ocular tissues by microinjection of a recombinant replication-deficient adenovirus human HO-1 cDNA (Adv-HHO). Human HO-1 gene was used for transfection studies to differentiate endogenous from transfected HO. The purified Adv-HHO construct (10(8) pfu/ml) was mixed with lipofectamine and microinjected into the anterior chamber, vitreous cavity, and subretinal space of New Zealand rabbit eyes. After 2 weeks, total RNA was extracted from different ocular tissues, reverse transcription-polymerase chain reaction was performed using specific human HO-1 primers, and amplification products were subjected to Southern hybridization. Transfection with the Adv-HHO construct into rabbit corneal epithelial cells in culture resulted in a functional expression of the human HO-1 gene; the human HO-1 mRNA was detected, and enzyme activity increased threefold. Human HO-1 mRNA was detected in the retina after microinjection of the Adv-HHO construct into the subretinal space. Microinjection into the vitreous resulted in HO-1 mRNA expression in the corneal endothelium, iris, lens, and retina; after intracameral injection of the Adv-HHO construct, human HO-1 mRNA was detected in corneal epithelium and endothelium, ciliary body, lens, and iris. Regardless of the injection site, transfected human HO-1 mRNA was undetectable in tissues outside the eye, that is, brain, liver, and kidney. These results demonstrated a tissue-selective functional transfer of the human HO-1 gene into rabbit ocular tissues in vivo. This technique may be a promising means for delivering HO-1 gene in vivo as a protective mechanism against oxidative stress that contributes to the pathogenesis of

  6. Liposome-mediated transfer of IL-1 receptor antagonist gene to dispersed islet cells does not prevent recurrence of disease in syngeneically transplanted NOD mice

    DEFF Research Database (Denmark)

    Saldeen, J; Sandler, S; Bendtzen, K

    2000-01-01

    transplanted non-obese diabetic (NOD) mice. NOD mouse islet cells were transfected using liposome-mediated gene transfer with a human IL-1ra cDNA construct and transplanted two days later to prediabetic NOD mice. Graft infiltration and destruction were monitored three, five and eight days posttransplantation...... by histology and determination of insulin and cytokine content. IL-1ra gene transfer resulted in transient expression of IL-1ra protein in islet cells in vitro as assessed by ELISA and of IL-1ra mRNA in transplanted islets as revealed by RT-PCR. However, both control and IL-1ra transfected NOD grafts exhibited......IL-1beta is cytotoxic to pancreatic beta-cells in vitro but its role in the vicinity of beta-cells in vivo is unknown. We explored whether liposome-mediated transfer of the interleukin 1 receptor antagonist (IL-1ra) gene to islet cells might prevent recurrence of disease in syngeneically...

  7. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  8. Cocaine Hydrolase Gene Transfer Demonstrates Cardiac Safety and Efficacy against Cocaine-Induced QT Prolongation in Mice

    OpenAIRE

    Murthy, Vishakantha; Reyes, Santiago; Geng, Liyi; Gao, Yang; Brimijoin, Stephen

    2016-01-01

    Cocaine addiction is associated with devastating medical consequences, including cardiotoxicity and risk-conferring prolongation of the QT interval. Viral gene transfer of cocaine hydrolase engineered from butyrylcholinesterase offers therapeutic promise for treatment-seeking drug users. Although previous preclinical studies have demonstrated benefits of this strategy without signs of toxicity, the specific cardiac safety and efficacy of engineered butyrylcholinesterase viral delivery remains...

  9. Induction of sustained hypercholesterolemia by single adeno-associated virus-mediated gene transfer of mutant hPCSK9.

    Science.gov (United States)

    Roche-Molina, Marta; Sanz-Rosa, David; Cruz, Francisco M; García-Prieto, Jaime; López, Sergio; Abia, Rocío; Muriana, Francisco J G; Fuster, Valentín; Ibáñez, Borja; Bernal, Juan A

    2015-01-01

    Patients with mutations in the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene have hypercholesterolemia and are at high risk of adverse cardiovascular events. We aimed to stably express the pathological human D374Y gain-of-function mutant form of PCSK9 (PCSK9(DY)) in adult wild-type mice to generate a hyperlipidemic and proatherogenic animal model, achieved with a single systemic injection with adeno-associated virus (AAV). We constructed an AAV-based vector to support targeted transfer of the PCSK9(DY) gene to liver. After injection with 3.5×10(10) viral particles, mice in the C57BL/6J, 129/SvPasCrlf, or FVB/NCrl backgrounds developed long-term hyperlipidemia with a strong increase in serum low-density lipoprotein. Macroscopic and histological analysis showed atherosclerotic lesions in the aortas of AAV-PCSK9(DY) mice fed a high-fat-diet. Advanced lesions in these high-fat-diet-fed mice also showed evidence of macrophage infiltration and fibrous cap formation. Hepatic AAV-PCSK9(DY) infection did not result in liver damage or signs of immunologic response. We further tested the use of AAV-PCSK9(DY) to study potential genetic interaction with the ApoE gene. Histological analysis of ApoE(-/-) AAV-PCSK9(DY) mice showed a synergistic response to ApoE deficiency, with aortic lesions twice as extensive in ApoE(-/-) AAV-PCSK9(DY)-transexpressing mice as in ApoE(-/-) AAV-Luc controls without altering serum cholesterol levels. Single intravenous AAV-PCSK9(DY) injection is a fast, easy, and cost-effective approach, resulting in rapid and long-term sustained hyperlipidemia and atherosclerosis. We demonstrate as a proof of concept the synergy between PCSK9(DY) gain-of-function and ApoE deficiency. This methodology could allow testing of the genetic interaction of several mutations without the need for complex and time-consuming backcrosses. © 2014 American Heart Association, Inc.

  10. Use of irradiated pollen for differential gene transfer in wheat (Triticum aestivum)

    Energy Technology Data Exchange (ETDEWEB)

    Snape, J.W.; Parker, B.B.; Simpson, E.; Ainsworth, C.C.; Payne, P.I.; Law, C.N.

    1983-01-01

    The use of irradiated pollen to bring about limited gene transfer in wheat has been investigated. Doses of X-rays of 2Kr, 3Kr and 5Kr were used to generate M/sub 1/ progeny between maternal and paternal genotypes differing in quantitative and major gene characters. Cytological studies of M/sub 1/ plants revealed hybrids with widespread aneuploidy and structural rearrangements in the paternal genome. These effects resulted in phenotypic variation between M/sub 1/ progeny and complex multivalent formation at meiosis. All M/sub 1/ plants at the 5Kr and 3Kr doses were sterile and all but 2 plants at the 2Kr dose. Studies of the two M/sub 2/ families from these plants revealed disturbances in genotype frequencies for some of the marker loci with an excess of maternal homozygotes and a deficit of paternal homozygotes. This was also reflected in a more maternal appearance for quantitative characters. These results are interpreted as showing that irradiation damage to the paternal genome in M/sub 1/ plants results in the differential transmission of maternal alleles.

  11. Vesicular stomatitis virus enables gene transfer and transsynaptic tracing in a wide range of organisms.

    Science.gov (United States)

    Mundell, Nathan A; Beier, Kevin T; Pan, Y Albert; Lapan, Sylvain W; Göz Aytürk, Didem; Berezovskii, Vladimir K; Wark, Abigail R; Drokhlyansky, Eugene; Bielecki, Jan; Born, Richard T; Schier, Alexander F; Cepko, Constance L

    2015-08-01

    Current limitations in technology have prevented an extensive analysis of the connections among neurons, particularly within nonmammalian organisms. We developed a transsynaptic viral tracer originally for use in mice, and then tested its utility in a broader range of organisms. By engineering the vesicular stomatitis virus (VSV) to encode a fluorophore and either the rabies virus glycoprotein (RABV-G) or its own glycoprotein (VSV-G), we created viruses that can transsynaptically label neuronal circuits in either the retrograde or anterograde direction, respectively. The vectors were investigated for their utility as polysynaptic tracers of chicken and zebrafish visual pathways. They showed patterns of connectivity consistent with previously characterized visual system connections, and revealed several potentially novel connections. Further, these vectors were shown to infect neurons in several other vertebrates, including Old and New World monkeys, seahorses, axolotls, and Xenopus. They were also shown to infect two invertebrates, Drosophila melanogaster, and the box jellyfish, Tripedalia cystophora, a species previously intractable for gene transfer, although no clear evidence of transsynaptic spread was observed in these species. These vectors provide a starting point for transsynaptic tracing in most vertebrates, and are also excellent candidates for gene transfer in organisms that have been refractory to other methods. © 2015 Wiley Periodicals, Inc.

  12. Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat

    International Nuclear Information System (INIS)

    Prabhakara Rao, M.V.

    1977-01-01

    The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)

  13. Recurrent adenylation domain replacement in the microcystin synthetase gene cluster

    Directory of Open Access Journals (Sweden)

    Laakso Kati

    2007-10-01

    Full Text Available Abstract Background Microcystins are small cyclic heptapeptide toxins produced by a range of distantly related cyanobacteria. Microcystins are synthesized on large NRPS-PKS enzyme complexes. Many structural variants of microcystins are produced simulatenously. A recombination event between the first module of mcyB (mcyB1 and mcyC in the microcystin synthetase gene cluster is linked to the simultaneous production of microcystin variants in strains of the genus Microcystis. Results Here we undertook a phylogenetic study to investigate the order and timing of recombination between the mcyB1 and mcyC genes in a diverse selection of microcystin producing cyanobacteria. Our results provide support for complex evolutionary processes taking place at the mcyB1 and mcyC adenylation domains which recognize and activate the amino acids found at X and Z positions. We find evidence for recent recombination between mcyB1 and mcyC in strains of the genera Anabaena, Microcystis, and Hapalosiphon. We also find clear evidence for independent adenylation domain conversion of mcyB1 by unrelated peptide synthetase modules in strains of the genera Nostoc and Microcystis. The recombination events replace only the adenylation domain in each case and the condensation domains of mcyB1 and mcyC are not transferred together with the adenylation domain. Our findings demonstrate that the mcyB1 and mcyC adenylation domains are recombination hotspots in the microcystin synthetase gene cluster. Conclusion Recombination is thought to be one of the main mechanisms driving the diversification of NRPSs. However, there is very little information on how recombination takes place in nature. This study demonstrates that functional peptide synthetases are created in nature through transfer of adenylation domains without the concomitant transfer of condensation domains.

  14. Intrahepatic injection of adenovirus reduces inflammation and increases gene transfer and therapeutic effect in mice

    OpenAIRE

    Crettaz, J. (Julien); Berraondo, P. (Pedro); Mauleon, I. (Itsaso); Ochoa, L. (Laura); Shankar, V. (Vijay); Barajas, M. (Miguel); Rooijen, N. (Nico) van; Kochanek, S. (Stefan); Qian, C. (Cheng); Prieto, J. (Jesús); Hernandez-Alcoceba, R. (Rubén); Gonzalez-Aseguinolaza, G. (Gloria)

    2006-01-01

    Recombinant adenoviruses (Ad) are among the most extensively used vectors for liver gene transfer. One of the major limitations for the clinical application of these vectors is the inflammatory immune response associated with systemic administration of high dose of virus. We evaluated the effect of Ad administration route on the inflammatory immune response and liver transgene expression. We compared direct intrahepatic injection (IH) with the systemic administration via tail vein (IV). IH in...

  15. The ionospheric response to flux transfer events: the first few minutes

    Directory of Open Access Journals (Sweden)

    A. S. Rodger

    1997-06-01

    Full Text Available We utilise high-time resolution measurements from the PACE HF radar at Halley, Antarctica to explore the evolution of the ionospheric response during the first few minutes after enhanced reconnection occurs at the magnetopause. We show that the plasma velocity increases associated with flux transfer events (FTEs occur first ~100–200 km equatorward of the region to which magnetosheath (cusp precipitation maps to the ionosphere. We suggest that these velocity variations start near the ionospheric footprint of the boundary between open and closed magnetic field lines. We show that these velocity variations have rise times ~100 s and fall times of ~10 s. When these velocity transients reach the latitude of the cusp precipitation, sometimes the equatorward boundary of the precipitation begins to move equatorward, the expected and previously reported ionospheric signature of enhanced reconnection. A hypothesis is proposed to explain the velocity variations. It involves the rapid outflow of magnetospheric electrons into the magnetosheath along the most recently reconnected field lines. Several predictions are made arising from the proposed explanation which could be tested with ground-based and space-based observations.

  16. Linear Energy Transfer-Dependent Change in Rice Gene Expression Profile after Heavy-Ion Beam Irradiation.

    Science.gov (United States)

    Ishii, Kotaro; Kazama, Yusuke; Morita, Ryouhei; Hirano, Tomonari; Ikeda, Tokihiro; Usuda, Sachiko; Hayashi, Yoriko; Ohbu, Sumie; Motoyama, Ritsuko; Nagamura, Yoshiaki; Abe, Tomoko

    2016-01-01

    A heavy-ion beam has been recognized as an effective mutagen for plant breeding and applied to the many kinds of crops including rice. In contrast with X-ray or γ-ray, the heavy-ion beam is characterized by a high linear energy transfer (LET). LET is an important factor affecting several aspects of the irradiation effect, e.g. cell survival and mutation frequency, making the heavy-ion beam an effective mutagen. To study the mechanisms behind LET-dependent effects, expression profiling was performed after heavy-ion beam irradiation of imbibed rice seeds. Array-based experiments at three time points (0.5, 1, 2 h after the irradiation) revealed that the number of up- or down-regulated genes was highest 2 h after irradiation. Array-based experiments with four different LETs at 2 h after irradiation identified LET-independent regulated genes that were up/down-regulated regardless of the value of LET; LET-dependent regulated genes, whose expression level increased with the rise of LET value, were also identified. Gene ontology (GO) analysis of LET-independent up-regulated genes showed that some GO terms were commonly enriched, both 2 hours and 3 weeks after irradiation. GO terms enriched in LET-dependent regulated genes implied that some factor regulates genes that have kinase activity or DNA-binding activity in cooperation with the ATM gene. Of the LET-dependent up-regulated genes, OsPARP3 and OsPCNA were identified, which are involved in DNA repair pathways. This indicates that the Ku-independent alternative non-homologous end-joining pathway may contribute to repairing complex DNA legions induced by high-LET irradiation. These findings may clarify various LET-dependent responses in rice.

  17. Transduction-like gene transfer in the methanogen Methanococcus voltae

    Science.gov (United States)

    Bertani, G.

    1999-01-01

    Strain PS of Methanococcus voltae (a methanogenic, anaerobic archaebacterium) was shown to generate spontaneously 4.4-kbp chromosomal DNA fragments that are fully protected from DNase and that, upon contact with a cell, transform it genetically. This activity, here called VTA (voltae transfer agent), affects all markers tested: three different auxotrophies (histidine, purine, and cobalamin) and resistance to BES (2-bromoethanesulfonate, an inhibitor of methanogenesis). VTA was most effectively prepared by culture filtration. This process disrupted a fraction of the M. voltae cells (which have only an S-layer covering their cytoplasmic membrane). VTA was rapidly inactivated upon storage. VTA particles were present in cultures at concentrations of approximately two per cell. Gene transfer activity varied from a minimum of 2 x 10(-5) (BES resistance) to a maximum of 10(-3) (histidine independence) per donor cell. Very little VTA was found free in culture supernatants. The phenomenon is functionally similar to generalized transduction, but there is no evidence, for the time being, of intrinsically viral (i.e., containing a complete viral genome) particles. Consideration of VTA DNA size makes the existence of such viral particles unlikely. If they exist, they must be relatively few in number;perhaps they differ from VTA particles in size and other properties and thus escaped detection. Digestion of VTA DNA with the AluI restriction enzyme suggests that it is a random sample of the bacterial DNA, except for a 0.9-kbp sequence which is amplified relative to the rest of the bacterial chromosome. A VTA-sized DNA fraction was demonstrated in a few other isolates of M. voltae.

  18. Mixed heterolobosean and novel gregarine lineage genes from culture ATCC 50646: Long-branch artefacts, not lateral gene transfer, distort α-tubulin phylogeny.

    Science.gov (United States)

    Cavalier-Smith, Thomas

    2015-04-01

    Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.

  19. Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment

    OpenAIRE

    Ricard, Guénola; McEwan, Neil R; Dutilh, Bas E; Jouany, Jean-Pierre; Macheboeuf, Didier; Mitsumori, Makoto; McIntosh, Freda M; Michalowski, Tadeusz; Nagamine, Takafumi; Nelson, Nancy; Newbold, Charles J; Nsabimana, Eli; Takenaka, Akio; Thomas, Nadine A; Ushida, Kazunari

    2006-01-01

    Abstract Background The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and...

  20. Genetic incorporation of the protein transduction domain of Tat into Ad5 fiber enhances gene transfer efficacy

    Directory of Open Access Journals (Sweden)

    Siegal Gene P

    2007-10-01

    Full Text Available Abstract Background Human adenovirus serotype 5 (Ad5 has been widely explored as a gene delivery vector for a variety of diseases. Many target cells, however, express low levels of Ad5 native receptor, the Coxsackie-Adenovirus Receptor (CAR, and thus are resistant to Ad5 infection. The Protein Transduction Domain of the HIV Tat protein, namely PTDtat, has been shown to mediate protein transduction in a wide range of cells. We hypothesize that re-targeting Ad5 vector via the PTDtat motif would improve the efficacy of Ad5-mediated gene delivery. Results In this study, we genetically incorporated the PTDtat motif into the knob domain of Ad5 fiber, and rescued the resultant viral vector, Ad5.PTDtat. Our data showed the modification did not interfere with Ad5 binding to its native receptor CAR, suggesting Ad5 infection via the CAR pathway is retained. In addition, we found that Ad5.PTDtat exhibited enhanced gene transfer efficacy in all of the cell lines that we have tested, which included both low-CAR and high-CAR decorated cells. Competitive inhibition assays suggested the enhanced infectivity of Ad5.PTDtat was mediated by binding of the positively charged PTDtat peptide to the negatively charged epitopes on the cells' surface. Furthermore, we investigated in vivo gene delivery efficacy of Ad5.PTDtat using subcutaneous tumor models established with U118MG glioma cells, and found that Ad5.PTDtat exhibited enhanced gene transfer efficacy compared to unmodified Ad5 vector as analyzed by a non-invasive fluorescence imaging technique. Conclusion Genetic incorporation of the PTDtat motif into Ad5 fiber allowed Ad5 vectors to infect cells via an alternative PTDtat targeting motif while retaining the native CAR-mediated infection pathway. The enhanced infectivity was demonstrated in both cultured cells and in in vivo tumor models. Taken together, our study identifies a novel tropism expanded Ad5 vector that may be useful for clinical gene therapy

  1. Morphogenesis in sea urchin embryos: linking cellular events to gene regulatory network states

    Science.gov (United States)

    Lyons, Deidre; Kaltenbach, Stacy; McClay, David R.

    2013-01-01

    Gastrulation in the sea urchin begins with ingression of the primary mesenchyme cells (PMCs) at the vegetal pole of the embryo. After entering the blastocoel the PMCs migrate, form a syncitium, and synthesize the skeleton of the embryo. Several hours after the PMCs ingress the vegetal plate buckles to initiate invagination of the archenteron. That morphogenetic process occurs in several steps. The non-skeletogenic cells produce the initial inbending of the vegetal plate. Endoderm cells then rearrange and extend the length of the gut across the blastocoel to a target near the animal pole. Finally, cells that will form part of the midgut and hindgut are added to complete gastrulation. Later, the stomodeum invaginates from the oral ectoderm and fuses with the foregut to complete the archenteron. In advance of, and during these morphogenetic events an increasingly complex gene regulatory network controls the specification and the cell biological events that conduct the gastrulation movements. PMID:23801438

  2. Transfer of a repair gene from E. coli as a tool in studies on the action of alkylating mutagens in tobacco

    Energy Technology Data Exchange (ETDEWEB)

    Veleminsky, J; Briza, J; Angelis, K; Satava, J [Institute of Experimental Botany, Czechoslovakian Academy of Sciences, Prague (Czech Republic); Margison, G [Institute of Experimental Botany, Czechoslovakian Academy of Sciences, Prague (Czech Republic); [Paterson Institute for Cancer Research, CRC, Manchester (United Kingdom)

    1990-01-01

    Full text: Alkylating agents (AA) belong to the most potent mutagens. Nevertheless, the role of individual DNA lesions in the toxic and mutagenic effects of AA in plants are poorly understood. A new tool to study this topic is the transfer of a gene with a specified repair function for a specific DNA lesion. Differences in the responses to AA can be assumed to be caused by changes in the amount of DNA lesion(s) repaired by the introduced gene. Methyl-nitroso urea (MNU) produces 06-methylG and other DNA lesions methylated at O-sites. Taurine-chloroethyl-nitrosourea (TCNH) causes DNA-DNA crosslinks, the formation of which starts with the chloroethylation of G at 06. Both 06-methylG, 04-methylT, O-methylphosphotriesters produced by MNH and 06-chloroethylG produced by TCNH are known to be repaired with AT coded by E. coli ada gene. Transfer of this gene and its expression in tobacco appeared to increase the resistance of the transformed cell to both AA tested. It seems, therefore, likely that the DNA lesions mentioned above are at least partly involved in the production of toxic effects of AA in tobacco. (author)

  3. NPY gene transfer in the hippocampus attenuates synaptic plasticity and learning

    DEFF Research Database (Denmark)

    Sørensen, Andreas T; Kanter-Schlifke, Irene; Carli, Mirjana

    2008-01-01

    -mediated mechanisms. In addition, transgene NPY seems to be released during high frequency neuronal activity, leading to decreased glutamate release in excitatory synapses. Importantly, memory consolidation appears to be affected by the treatment. We found that long-term potentiation (LTP) in the CA1 area...... processing. Here we show, by electrophysiological recordings in CA1 of the hippocampal formation of rats, that hippocampal NPY gene transfer into the intact brain does not affect basal synaptic transmission, but slightly alters short-term synaptic plasticity, most likely via NPY Y2 receptor....... Future clinical progress, however, requires more detailed evaluation of possible side effects of this treatment. Until now it has been unknown whether rAAV vector-based NPY overexpression in the hippocampus alters normal synaptic transmission and plasticity, which could disturb learning and memory...

  4. Stress Transfer Processes during Great Plate Boundary Thrusting Events: A Study from the Andaman and Nicobar Segments

    Science.gov (United States)

    Andrade, V.; Rajendran, K.

    2010-12-01

    The response of subduction zones to large earthquakes varies along their strike, both during the interseismic and post-seismic periods. The December 26, 2004 earthquake nucleated at 3° N latitude and its rupture propagated northward, along the Andaman-Sumatra subduction zone, terminating at 15°N. Rupture speed was estimated at about 2.0 km per second in the northern part under the Andaman region and 2.5 - 2.7 km per second under southern Nicobar and North Sumatra. We have examined the pre and post-2004 seismicity to understand the stress transfer processes within the subducting plate, in the Andaman (10° - 15° N ) and Nicobar (5° - 10° N) segments. The seismicity pattern in these segments shows distinctive characteristics associated with the outer rise, accretionary prism and the spreading ridge, all of which are relatively better developed in the Andaman segment. The Ninety East ridge and the Sumatra Fault System are significant tectonic features in the Nicobar segment. The pre-2004 seismicity in both these segments conform to the steady-state conditions wherein large earthquakes are fewer and compressive stresses dominate along the plate interface. Among the pre-2004 great earthquakes are the 1881 Nicobar and 1941 Andaman events. The former is considered to be a shallow thrust event that generated a small tsunami. Studies in other subduction zones suggest that large outer-rise tensional events follow great plate boundary breaking earthquakes due to the the up-dip transfer of stresses within the subducting plate. The seismicity of the Andaman segment (1977-2004) concurs with the steady-state stress conditions where earthquakes occur dominantly by thrust faulting. The post-2004 seismicity shows up-dip migration along the plate interface, with dominance of shallow normal faulting, including a few outer rise events and some deeper (> 100 km) strike-slip faulting events within the subducting plate. The September 13, 2002, Mw 6.5 thrust faulting earthquake at

  5. Cumulus-specific genes are transcriptionally silent following somatic cell nuclear transfer in a mouse model*

    OpenAIRE

    Tong, Guo-qing; Heng, Boon-chin; Ng, Soon-chye

    2007-01-01

    This study investigated whether four cumulus-specific genes: follicular stimulating hormone receptor (FSHr), hyaluronan synthase 2 (Has2), prostaglandin synthase 2 (Ptgs2) and steroidogenic acute regulator protein (Star), were correctly reprogrammed to be transcriptionally silent following somatic cell nuclear transfer (SCNT) in a murine model. Cumulus cells of C57×CBA F1 female mouse were injected into enucleated oocytes, followed by activation in 10 µmol/L strontium chloride for 5 h and sub...

  6. Plasmid transfer by conjugation in Xylella fastidiosa.

    Science.gov (United States)

    Recombination and horizontal gene transfer have been implicated in the adaption of Xylella fastidiosa (Xf) to infect a wide variety of different plant species. There is evidence that certain strains of Xf carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as ...

  7. Linear Energy Transfer-Dependent Change in Rice Gene Expression Profile after Heavy-Ion Beam Irradiation.

    Directory of Open Access Journals (Sweden)

    Kotaro Ishii

    Full Text Available A heavy-ion beam has been recognized as an effective mutagen for plant breeding and applied to the many kinds of crops including rice. In contrast with X-ray or γ-ray, the heavy-ion beam is characterized by a high linear energy transfer (LET. LET is an important factor affecting several aspects of the irradiation effect, e.g. cell survival and mutation frequency, making the heavy-ion beam an effective mutagen. To study the mechanisms behind LET-dependent effects, expression profiling was performed after heavy-ion beam irradiation of imbibed rice seeds. Array-based experiments at three time points (0.5, 1, 2 h after the irradiation revealed that the number of up- or down-regulated genes was highest 2 h after irradiation. Array-based experiments with four different LETs at 2 h after irradiation identified LET-independent regulated genes that were up/down-regulated regardless of the value of LET; LET-dependent regulated genes, whose expression level increased with the rise of LET value, were also identified. Gene ontology (GO analysis of LET-independent up-regulated genes showed that some GO terms were commonly enriched, both 2 hours and 3 weeks after irradiation. GO terms enriched in LET-dependent regulated genes implied that some factor regulates genes that have kinase activity or DNA-binding activity in cooperation with the ATM gene. Of the LET-dependent up-regulated genes, OsPARP3 and OsPCNA were identified, which are involved in DNA repair pathways. This indicates that the Ku-independent alternative non-homologous end-joining pathway may contribute to repairing complex DNA legions induced by high-LET irradiation. These findings may clarify various LET-dependent responses in rice.

  8. Evolutionary Inference across Eukaryotes Identifies Specific Pressures Favoring Mitochondrial Gene Retention.

    Science.gov (United States)

    Johnston, Iain G; Williams, Ben P

    2016-02-24

    Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Genetic recombination at the human RH locus: A family study of the red-cell Evans phenotype reveals a transfer of exons 2-6 from the RHD to the RHCE gene

    Energy Technology Data Exchange (ETDEWEB)

    Huang, C.H.; Chen, Y.; Reid, M. [Lindsley F. Kimball Research Inst., New York, NY (United States); Ghosh, S.

    1996-10-01

    The human RH locus appears to consist of two structural genes, D and CE, which map on the short arm p34-36 of chromosome 1 and specify a most complex system of blood-group genetic polymorphisms. Here we describe a family study of the Evans (also known as {open_quotes}D..{open_quotes}) phenotype, a codominant trait associated with both qualitative and quantitative changes in D-antigen expression. A cataract-causing mutation was also inherited in this family and was apparently cotransmitted with Evans, suggesting a chromosomal linkage of these two otherwise unrelated traits. Southern blot analysis and allele-specific PCR showed the linkage of Evans with a SphI RFLP marker and the presence of a hybrid gene in the RH locus. To delineate the pattern of gene expression, the composition and structure of Rh-polypeptide transcripts were characterized by reverse transcriptase-PCR and nucleotide sequencing. This resulted in the identification of a novel Rh transcript expressed only in the Evans-positive erythroid cells. Sequence analysis showed that the transcript maintained a normal open reading frame but occurred as a CE-D-CE composite in which exons 2-6 of the CE gene were replaced by the homologous counterpart of the D gene. This hybrid gene was predicted to encode a CE-D-CE fusion protein whose surface expression correlates with the Evans phenotype. The mode and consequence of such a recombination event suggest the occurrence, in the RH locus, of a segmental DNA transfer via the mechanism of gene conversion. 31 refs., 6 figs., 1 tab.

  10. Conditions for the Evolution of Gene Clusters in Bacterial Genomes

    Science.gov (United States)

    Ballouz, Sara; Francis, Andrew R.; Lan, Ruiting; Tanaka, Mark M.

    2010-01-01

    Genes encoding proteins in a common pathway are often found near each other along bacterial chromosomes. Several explanations have been proposed to account for the evolution of these structures. For instance, natural selection may directly favour gene clusters through a variety of mechanisms, such as increased efficiency of coregulation. An alternative and controversial hypothesis is the selfish operon model, which asserts that clustered arrangements of genes are more easily transferred to other species, thus improving the prospects for survival of the cluster. According to another hypothesis (the persistence model), genes that are in close proximity are less likely to be disrupted by deletions. Here we develop computational models to study the conditions under which gene clusters can evolve and persist. First, we examine the selfish operon model by re-implementing the simulation and running it under a wide range of conditions. Second, we introduce and study a Moran process in which there is natural selection for gene clustering and rearrangement occurs by genome inversion events. Finally, we develop and study a model that includes selection and inversion, which tracks the occurrence and fixation of rearrangements. Surprisingly, gene clusters fail to evolve under a wide range of conditions. Factors that promote the evolution of gene clusters include a low number of genes in the pathway, a high population size, and in the case of the selfish operon model, a high horizontal transfer rate. The computational analysis here has shown that the evolution of gene clusters can occur under both direct and indirect selection as long as certain conditions hold. Under these conditions the selfish operon model is still viable as an explanation for the evolution of gene clusters. PMID:20168992

  11. Genetic Diversity of Bacterial Communities and Gene Transfer Agents in Northern South China Sea

    Science.gov (United States)

    Sun, Fu-Lin; Wang, You-Shao; Wu, Mei-Lin; Jiang, Zhao-Yu; Sun, Cui-Ci; Cheng, Hao

    2014-01-01

    Pyrosequencing of the 16S ribosomal RNA gene (rDNA) amplicons was performed to investigate the unique distribution of bacterial communities in northern South China Sea (nSCS) and evaluate community structure and spatial differences of bacterial diversity. Cyanobacteria, Proteobacteria, Actinobacteria, and Bacteroidetes constitute the majority of bacteria. The taxonomic description of bacterial communities revealed that more Chroococcales, SAR11 clade, Acidimicrobiales, Rhodobacterales, and Flavobacteriales are present in the nSCS waters than other bacterial groups. Rhodobacterales were less abundant in tropical water (nSCS) than in temperate and cold waters. Furthermore, the diversity of Rhodobacterales based on the gene transfer agent (GTA) major capsid gene (g5) was investigated. Four g5 gene clone libraries were constructed from samples representing different regions and yielded diverse sequences. Fourteen g5 clusters could be identified among 197 nSCS clones. These clusters were also related to known g5 sequences derived from genome-sequenced Rhodobacterales. The composition of g5 sequences in surface water varied with the g5 sequences in the sampling sites; this result indicated that the Rhodobacterales population could be highly diverse in nSCS. Phylogenetic tree analysis result indicated distinguishable diversity patterns among tropical (nSCS), temperate, and cold waters, thereby supporting the niche adaptation of specific Rhodobacterales members in unique environments. PMID:25364820

  12. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  13. Acute hypoxia stress induced abundant differential expression genes and alternative splicing events in heart of tilapia.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran

    2018-01-10

    Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Transfer of Antibiotic Resistance in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Haaber, Jakob; Penadés, José R; Ingmer, Hanne

    2017-01-01

    Staphylococcus aureus is a serious human pathogen with remarkable adaptive powers. Antibiotic-resistant clones rapidly emerge mainly by acquisition of antibiotic-resistance genes from other S. aureus strains or even from other genera. Transfer is mediated by a diverse complement of mobile genetic...... of plasmids that can be transferred by conjugation and the efficiency with which transduction occurs. Here, we review the main routes of antibiotic resistance gene transfer in S. aureus in the context of its biology as a human commensal and a life-threatening pathogen. Staphylococcus aureus cells...... are effective in exchanging mobile genetic elements, including antibiotic-resistance genes.During colonization or infection of host organisms, the exchange appears to be particularly effective.Bacteriophage-mediated transfer involves both transduction and autotransduction, which may enable lysogenic S. aureus...

  15. A matter of phylogenetic scale: Distinguishing incomplete lineage sorting from lateral gene transfer as the cause of gene tree discord in recent versus deep diversification histories.

    Science.gov (United States)

    Knowles, L Lacey; Huang, Huateng; Sukumaran, Jeet; Smith, Stephen A

    2018-03-01

    Discordant gene trees are commonly encountered when sequences from thousands of loci are applied to estimate phylogenetic relationships. Several processes contribute to this discord. Yet, we have no methods that jointly model different sources of conflict when estimating phylogenies. An alternative to analyzing entire genomes or all the sequenced loci is to identify a subset of loci for phylogenetic analysis. If we can identify data partitions that are most likely to reflect descent from a common ancestor (i.e., discordant loci that indeed reflect incomplete lineage sorting [ILS], as opposed to some other process, such as lateral gene transfer [LGT]), we can analyze this subset using powerful coalescent-based species-tree approaches. Test data sets were simulated where discord among loci could arise from ILS and LGT. Data sets where analyzed using the newly developed program CLASSIPHY (Huang et al., ) to assess whether our ability to distinguish the cause of discord among loci varied when ILS and LGT occurred in the recent versus deep past and whether the accuracy of these inferences were affected by the mutational process. We show that accuracy of probabilistic classification of individual loci by the cause of discord differed when ILS and LGT events occurred more recently compared with the distant past and that the signal-to-noise ratio arising from the mutational process contributes to difficulties in inferring LGT data partitions. We discuss our findings in terms of the promise and limitations of identifying subsets of loci for species-tree inference that will not violate the underlying coalescent model (i.e., data partitions in which ILS, and not LGT, contributes to discord). We also discuss the empirical implications of our work given the many recalcitrant nodes in the tree of life (e.g., origins of angiosperms, amniotes, or Neoaves), and recent arguments for concatenating loci. © 2018 Botanical Society of America.

  16. The use of irradiated pollen for differential gene transfer in wheat (Triticum aestivum)

    International Nuclear Information System (INIS)

    Snape, J.W.; Parker, B.B.; Simpson, E.; Ainsworth, C.C.; Payne, P.I.; Law, C.N.

    1983-01-01

    The use of irradiated pollen to bring about limited gene transfer in wheat has been investigated. Doses of X-rays of 2Kr, 3Kr and 5Kr were used to generate M 1 progeny between maternal and paternal genotypes differing in quantitative and major gene characters. Cytological studies of M 1 plants revealed hybrids with widespread aneuploidy and structural rearrangements in the paternal genome. These effects resulted in phenotypic variation between M 1 progeny and complex multivalent formation at meiosis. All M 1 plants at the 5Kr and 3Kr doses were sterile and all but 2 plants at the 2Kr dose. Studies of the two M 2 families from these plants revealed disturbances in genotype frequencies for some of the marker loci with an excess of maternal homozygotes and a deficit of paternal homozygotes. This was also reflected in a more maternal appearance for quantitative characters. These results are interpreted as showing that irradiation damage to the paternal genome in M 1 plants results in the differential transmission of maternal alleles. (orig.)

  17. A fast method for calculating reliable event supports in tree reconciliations via Pareto optimality.

    Science.gov (United States)

    To, Thu-Hien; Jacox, Edwin; Ranwez, Vincent; Scornavacca, Celine

    2015-11-14

    Given a gene and a species tree, reconciliation methods attempt to retrieve the macro-evolutionary events that best explain the discrepancies between the two tree topologies. The DTL parsimonious approach searches for a most parsimonious reconciliation between a gene tree and a (dated) species tree, considering four possible macro-evolutionary events (speciation, duplication, transfer, and loss) with specific costs. Unfortunately, many events are erroneously predicted due to errors in the input trees, inappropriate input cost values or because of the existence of several equally parsimonious scenarios. It is thus crucial to provide a measure of the reliability for predicted events. It has been recently proposed that the reliability of an event can be estimated via its frequency in the set of most parsimonious reconciliations obtained using a variety of reasonable input cost vectors. To compute such a support, a straightforward but time-consuming approach is to generate the costs slightly departing from the original ones, independently compute the set of all most parsimonious reconciliations for each vector, and combine these sets a posteriori. Another proposed approach uses Pareto-optimality to partition cost values into regions which induce reconciliations with the same number of DTL events. The support of an event is then defined as its frequency in the set of regions. However, often, the number of regions is not large enough to provide reliable supports. We present here a method to compute efficiently event supports via a polynomial-sized graph, which can represent all reconciliations for several different costs. Moreover, two methods are proposed to take into account alternative input costs: either explicitly providing an input cost range or allowing a tolerance for the over cost of a reconciliation. Our methods are faster than the region based method, substantially faster than the sampling-costs approach, and have a higher event-prediction accuracy on

  18. Challenges to develop nitrogen-fixing cereals by direct nif-gene transfer.

    Science.gov (United States)

    Curatti, Leonardo; Rubio, Luis M

    2014-08-01

    Some regions of the developing world suffer low cereal production yields due to low fertilizer inputs, among other factors. Biological N2 fixation, catalyzed by the prokaryotic enzyme nitrogenase, is an alternative to the use of synthetic N fertilizers. The molybdenum nitrogenase is an O2-labile metalloenzyme composed of the NifDK and NifH proteins, which biosyntheses require a number of nif gene products. A challenging strategy to increase cereal crop productivity in a scenario of low N fertilization is the direct transfer of nif genes into cereals. The sensitivity of nitrogenase to O2 and the apparent complexity of nitrogenase biosynthesis are the main barriers identified so far. Expression of active NifH requires the products of nifM, nifH, and possibly nifU and nifS, whereas active NifDK requires the products of nifH, nifD, nifK, nifB, nifE, nifN, and possibly nifU, nifS, nifQ, nifV, nafY, nifW and nifZ. Plastids and mitochondria are potential subcellular locations for nitrogenase. Both could provide the ATP and electrons required for nitrogenase to function but they differ in their internal O2 levels and their ability to incorporate ammonium into amino acids. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. High temperature in combination with UV irradiation enhances horizontal transfer of stx2 gene from E. coli O157:H7 to non-pathogenic E. coli.

    Directory of Open Access Journals (Sweden)

    Wan-Fu Yue

    Full Text Available Shiga toxin (stx genes have been transferred to numerous bacteria, one of which is E. coli O157:H7. It is a common belief that stx gene is transferred by bacteriophages, because stx genes are located on lambdoid prophages in the E. coli O157:H7 genome. Both E. coli O157:H7 and non-pathogenic E. coli are highly enriched in cattle feedlots. We hypothesized that strong UV radiation in combination with high temperature accelerates stx gene transfer into non-pathogenic E. coli in feedlots.E. coli O157:H7 EDL933 strain were subjected to different UV irradiation (0 or 0.5 kJ/m(2 combination with different temperature (22, 28, 30, 32, and 37 °C treatments, and the activation of lambdoid prophages was analyzed by plaque forming unit while induction of Stx2 prophages was quantified by quantitative real-time PCR. Data showed that lambdoid prophages in E. coli O157:H7, including phages carrying stx2, were activated under UV radiation, a process enhanced by elevated temperature. Consistently, western blotting analysis indicated that the production of Shiga toxin 2 was also dramatically increased by UV irradiation and high temperature. In situ colony hybridization screening indicated that these activated Stx2 prophages were capable of converting laboratory strain of E. coli K12 into new Shiga toxigenic E. coli, which were further confirmed by PCR and ELISA analysis.These data implicate that high environmental temperature in combination with UV irradiation accelerates the spread of stx genes through enhancing Stx prophage induction and Stx phage mediated gene transfer. Cattle feedlot sludge are teemed with E. coli O157:H7 and non-pathogenic E. coli, and is frequently exposed to UV radiation via sunlight, which may contribute to the rapid spread of stx gene to non-pathogenic E. coli and diversity of shiga toxin producing E. coli.

  20. Improving the transition of care in patients transferred through the ochsner medical center transfer center.

    Science.gov (United States)

    Amedee, Ronald G; Maronge, Genevieve F; Pinsky, William W

    2012-01-01

    Patient transfers from other hospitals within the Ochsner Health System to the main campus are coordinated through a Transfer Center that was established in fall 2008. We analyzed the transfer process to assess distinct opportunities to enhance the overall transition of patient care. We surveyed internal medicine residents and nocturnists to determine their satisfaction with transfers in terms of safety, efficiency, and usefulness of information provided at the time of transfer. After a kaizen event at which complementary goals for the institution and members of the study team were recognized and implemented, we resurveyed the group to evaluate improvement in the transfer process. The preintervention average satisfaction score was 1.18 (SD=0.46), while the postintervention score was 3.7 (SD=1.01). A t test showed a significant difference in the average scores between the preintervention and postintervention surveys (Pkaizen event), data were collected that facilitated fewer and higher quality handoffs that were performed in less time. In addition, the process resulted in increased awareness of the value of resident participation in institutional quality improvement projects.

  1. Visualization of gene expression in the live subject using the Na/I symporter as a reporter gene: applications in biotherapy.

    Science.gov (United States)

    Baril, Patrick; Martin-Duque, Pilar; Vassaux, Georges

    2010-02-01

    Biotherapies involve the utilization of antibodies, genetically modified viruses, bacteria or cells for therapeutic purposes. Molecular imaging has the potential to provide unique information that will guarantee their biosafety in humans and provide a rationale for the future development of new generations of reagents. In this context, non-invasive imaging of gene expression is an attractive prospect, allowing precise, spacio-temporal measurements of gene expression in longitudinal studies involving gene transfer vectors. With the emergence of cell therapies in regenerative medicine, it is also possible to track cells injected into subjects. In this context, the Na/I symporter (NIS) has been used in preclinical studies. Associated with a relevant radiotracer ((123)I(-), (124)I(-), (99m)TcO4(-)), NIS can be used to monitor gene transfer and the spread of selectively replicative viruses in tumours as well as in cells with a therapeutic potential. In addition to its imaging potential, NIS can be used as a therapeutic transgene through its ability to concentrate therapeutic doses of radionuclides in target cells. This dual property has applications in cancer treatment and could also be used to eradicate cells with therapeutic potential in the case of adverse events. Through experience acquired in preclinical studies, we can expect that non-invasive molecular imaging using NIS as a transgene will be pivotal for monitoring in vivo the exact distribution and pharmacodynamics of gene expression in a precise and quantitative way. This review highlights the applications of NIS in biotherapy, with a particular emphasis on image-guided radiotherapy, monitoring of gene and vector biodistribution and trafficking of stem cells.

  2. An acyltransferase gene that putatively functions in anthocyanin modification was horizontally transferred from Fabaceae into the genus Cuscuta

    Directory of Open Access Journals (Sweden)

    Ting Sun

    2016-06-01

    Full Text Available Horizontal gene transfer (HGT refers to the flow of genetic materials to non-offspring, and occasionally HGT in plants can improve the adaptation of organisms in new niches due to expanded metabolic capability. Anthocyanins are an important group of water-soluble red, purple, or blue secondary metabolites, whose diversity results from modification after the main skeleton biosynthesis. Cuscuta is a stem holoparasitic genus, whose members form direct connection with hosts to withdraw water, nutrients, and macromolecules. Such intimate association is thought to increase the frequency of HGT. By transcriptome screening for foreign genes in Cuscuta australis, we discovered that one gene encoding a putative anthocyanin acyltransferase gene of the BAHD family, which is likely to be involved in anthocyanin modification, was acquired by C. australis from Fabaceae through HGT. The anthocyanin acyltransferase-like (AT-like gene was confirmed to be present in the genome assembly of C. australis and the transcriptomes of Cuscuta pentagona. The higher transcriptional level in old stems is consistent with its putative function in secondary metabolism by stabilizing anthocyanin at neutral pH and thus HGT of this AT-like gene may have improved biotic and abiotic resistance of Cuscuta.

  3. The experimental study of reporter probe 131I-FIAU in neonatal cardiac myocytes after transfer of herpes simplex virus type 1 thymidine kinase reporter gene by different vectors

    International Nuclear Information System (INIS)

    Yin Xiaohua; Lan Xiaoli; Wang Ruihua; Liu Ying; Zhang Yongxue

    2009-01-01

    Objective: Reporter gene imaging is a promising approach for noninvasive monitoring of cardiac gene therapy. In the present study, the recombinant plasmid and adenoviral vector carrying reporter gene. herpes simplex virus type 1 thymidine kinase (HSV1-tk), were constructed and transferred into nee-natal cardiac myocytes, and a series of in vitro studies were carried out on the cells transferred to evaluate the uptake of radiolabeled reporter probe and to compare both vectors for cardiac reporter gene imaging. Methods: Neonatal cardiac myocytes were obtained from rat heart by single collagenase digestion. HSVI-tk. chosen as the reporter gene.was inserted into adenovirus vector (Ad5-tk) and plasmid (pDC316-tk), thus it could be transferred into neonatal cardiac myocytes. Recombinant adenovirus containing enhanced green fluorescent protein (Ad5-EGFP) was used as control. Recombinant plasmid was coated with lipofectamine TM 2000 (pDC316-tk/lipoplex). The specific reporter probe of HSV1-tk, 2'-fluoro-2'-deoxy-l-β-D-arabinofuranosyl-uracil (FAU), was labeled with 131 I by solid phase oxidation with lodogen. Product wag purified on a reverse. phase Sep-Pak C18 column and the radiochemical purity wag then assessed. The accumulation of it in the transferred cardiac myocytes wag detected as uptake rate. Furthermore, mRNA expression of HSV1-tk was detected by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), while its protein expression wag located by immunocytochemistry. Results: FAU could be labeled with 131 I and the labeling efficiency was (53.82 ±2.05)%. The radiochemical purity was (94.85 ± 1.76)% after purification, and it kept stable in vitro for at least 24h. Time-dependent increase of the ac- cumulation of 131 I-FIAU was observed in both Ad5-tk group and pDC316-tk/lipoplex group. and the highest uptake rate occurred at 5h, with peak values of (12.55 ± 0.37)% and (2.09 ± 0.34)% respectively. However, it also indicated that greater

  4. Comparative genomics reveals cotton-specific virulence factors in flexible genomic regions in Verticillium dahliae and evidence of horizontal gene transfer from Fusarium.

    Science.gov (United States)

    Chen, Jie-Yin; Liu, Chun; Gui, Yue-Jing; Si, Kai-Wei; Zhang, Dan-Dan; Wang, Jie; Short, Dylan P G; Huang, Jin-Qun; Li, Nan-Yang; Liang, Yong; Zhang, Wen-Qi; Yang, Lin; Ma, Xue-Feng; Li, Ting-Gang; Zhou, Lei; Wang, Bao-Li; Bao, Yu-Ming; Subbarao, Krishna V; Zhang, Geng-Yun; Dai, Xiao-Feng

    2018-01-01

    Verticillium dahliae isolates are most virulent on the host from which they were originally isolated. Mechanisms underlying these dominant host adaptations are currently unknown. We sequenced the genome of V. dahliae Vd991, which is highly virulent on its original host, cotton, and performed comparisons with the reference genomes of JR2 (from tomato) and VdLs.17 (from lettuce). Pathogenicity-related factor prediction, orthology and multigene family classification, transcriptome analyses, phylogenetic analyses, and pathogenicity experiments were performed. The Vd991 genome harbored several exclusive, lineage-specific (LS) genes within LS regions (LSRs). Deletion mutants of the seven genes within one LSR (G-LSR2) in Vd991 were less virulent only on cotton. Integration of G-LSR2 genes individually into JR2 and VdLs.17 resulted in significantly enhanced virulence on cotton but did not affect virulence on tomato or lettuce. Transcription levels of the seven LS genes in Vd991 were higher during the early stages of cotton infection, as compared with other hosts. Phylogenetic analyses suggested that G-LSR2 was acquired from Fusarium oxysporum f. sp. vasinfectum through horizontal gene transfer. Our results provide evidence that horizontal gene transfer from Fusarium to Vd991 contributed significantly to its adaptation to cotton and may represent a significant mechanism in the evolution of an asexual plant pathogen. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  5. Lightning-triggered electroporation and electrofusion as possible contributors to natural horizontal gene transfer.

    Science.gov (United States)

    Kotnik, Tadej

    2013-09-01

    Phylogenetic studies show that horizontal gene transfer (HGT) is a significant contributor to genetic variability of prokaryotes, and was perhaps even more abundant during the early evolution. Hitherto, research of natural HGT has mainly focused on three mechanisms of DNA transfer: conjugation, natural competence, and viral transduction. This paper discusses the feasibility of a fourth such mechanism--cell electroporation and/or electrofusion triggered by atmospheric electrostatic discharges (lightnings). A description of electroporation as a phenomenon is followed by a review of experimental evidence that electroporation of prokaryotes in aqueous environments can result in release of non-denatured DNA, as well as uptake of DNA from the surroundings and transformation. Similarly, a description of electrofusion is followed by a review of experiments showing that prokaryotes devoid of cell wall can electrofuse into hybrids expressing the genes of their both precursors. Under sufficiently fine-tuned conditions, electroporation and electrofusion are efficient tools for artificial transformation and hybridization, respectively, but the quantitative analysis developed here shows that conditions for electroporation-based DNA release, DNA uptake and transformation, as well as for electrofusion are also present in many natural aqueous environments exposed to lightnings. Electroporation is thus a plausible contributor to natural HGT among prokaryotes, and could have been particularly important during the early evolution, when the other mechanisms might have been scarcer or nonexistent. In modern prokaryotes, natural absence of the cell wall is rare, but it is reasonable to assume that the wall has formed during a certain stage of evolution, and at least prior to this, electrofusion could also have contributed to natural HGT. The concluding section outlines several guidelines for assessment of the feasibility of lightning-triggered HGT. © 2013 Elsevier B.V. All rights

  6. Hypothalamic Gene Transfer of BDNF Inhibits Breast Cancer Progression and Metastasis in Middle Age Obese Mice

    OpenAIRE

    Liu, Xianglan; McMurphy, Travis; Xiao, Run; Slater, Andrew; Huang, Wei; Cao, Lei

    2014-01-01

    Activation of the hypothalamus-adipocyte axis is associated with an antiobesity and anticancer phenotype in animal models of melanoma and colon cancer. Brain-derived neurotrophic factor (BDNF) is a key mediator in the hypothalamus leading to preferential sympathoneural activation of adipose tissue and the ensuing resistance to obesity and cancer. Here, we generated middle age obese mice by high fat diet feeding for a year and investigated the effects of hypothalamic gene transfer of BDNF on a...

  7. Conditions for the evolution of gene clusters in bacterial genomes.

    Directory of Open Access Journals (Sweden)

    Sara Ballouz

    2010-02-01

    Full Text Available Genes encoding proteins in a common pathway are often found near each other along bacterial chromosomes. Several explanations have been proposed to account for the evolution of these structures. For instance, natural selection may directly favour gene clusters through a variety of mechanisms, such as increased efficiency of coregulation. An alternative and controversial hypothesis is the selfish operon model, which asserts that clustered arrangements of genes are more easily transferred to other species, thus improving the prospects for survival of the cluster. According to another hypothesis (the persistence model, genes that are in close proximity are less likely to be disrupted by deletions. Here we develop computational models to study the conditions under which gene clusters can evolve and persist. First, we examine the selfish operon model by re-implementing the simulation and running it under a wide range of conditions. Second, we introduce and study a Moran process in which there is natural selection for gene clustering and rearrangement occurs by genome inversion events. Finally, we develop and study a model that includes selection and inversion, which tracks the occurrence and fixation of rearrangements. Surprisingly, gene clusters fail to evolve under a wide range of conditions. Factors that promote the evolution of gene clusters include a low number of genes in the pathway, a high population size, and in the case of the selfish operon model, a high horizontal transfer rate. The computational analysis here has shown that the evolution of gene clusters can occur under both direct and indirect selection as long as certain conditions hold. Under these conditions the selfish operon model is still viable as an explanation for the evolution of gene clusters.

  8. Fluorescence recovery allows theimplementation of a fluorescence reporter gene platform applicable for the detection and quantification of horizontal gene transfer in anoxic environments

    DEFF Research Database (Denmark)

    Pinilla-Redondo, Rafael; Riber, Leise; Sørensen, Søren Johannes

    2018-01-01

    H limitations, and provide experimental tools that will help broaden its horizon of application to other fields.IMPORTANCEMany anaerobic environments, like the gastrointestinal tract, anaerobic digesters, and the interiors of dense biofilms, have been shown to be hotspots for horizontal gene transfer (HGT......). Despite the increasing wealth of reports warning about the alarming spread of antibiotic resistance determinants, to date, HGT studies mainly rely on cultivation-based methods. Unfortunately, the relevance of these studies is often questionable, as only a minor fraction of bacteria can be cultivated...

  9. Gene Transfer of Brain-derived Neurotrophic Factor (BDNF) Prevents Neurodegeneration Triggered by FXN Deficiency.

    Science.gov (United States)

    Katsu-Jiménez, Yurika; Loría, Frida; Corona, Juan Carlos; Díaz-Nido, Javier

    2016-05-01

    Friedreich's ataxia is a predominantly neurodegenerative disease caused by recessive mutations that produce a deficiency of frataxin (FXN). Here, we have used a herpesviral amplicon vector carrying a gene encoding for brain-derived neurotrophic factor (BDNF) to drive its overexpression in neuronal cells and test for its effect on FXN-deficient neurons both in culture and in the mouse cerebellum in vivo. Gene transfer of BDNF to primary cultures of mouse neurons prevents the apoptosis which is triggered by the knockdown of FXN gene expression. This neuroprotective effect of BDNF is also observed in vivo in a viral vector-based knockdown mouse cerebellar model. The injection of a lentiviral vector carrying a minigene encoding for a FXN-specific short hairpin ribonucleic acid (shRNA) into the mouse cerebellar cortex triggers a FXN deficit which is accompanied by significant apoptosis of granule neurons as well as loss of calbindin in Purkinje cells. These pathological changes are accompanied by a loss of motor coordination of mice as assayed by the rota-rod test. Coinjection of a herpesviral vector encoding for BDNF efficiently prevents both the development of cerebellar neuropathology and the ataxic phenotype. These data demonstrate the potential therapeutic usefulness of neurotrophins like BDNF to protect FXN-deficient neurons from degeneration.

  10. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  11. Oncogenic Activation of Fibroblast Growth Factor Receptor-3 and RAS Genes as Non-Overlapping Mutual Exclusive Events in Urinary Bladder Cancer.

    Science.gov (United States)

    Pandith, Arshad A; Hussain, Aashaq; Khan, Mosin S; Shah, Zafar A; Wani, M Saleem; Siddiqi, Mushtaq A

    2016-01-01

    Urinary bladder cancer is a common malignancy in the West and ranks as the 7th most common cancer in our region of Kashmir, India. FGFR3 mutations are frequent in superficial urothelial carcinoma (UC) differing from the RAS gene mutational pattern. The aim of this study was to analyze the frequency and association of FGFR3 and RAS gene mutations in UC cases. Paired tumor and adjacent normal tissue specimens of 65 consecutive UC patients were examined. DNA preparations were evaluated for the occurrence of FGFR3 and RAS gene mutations by PCR-SCCP and DNA sequencing. Somatic point mutations of FGFR3 were identified in 32.3% (21 of 65). The pattern and distribution were significantly associated with low grade/stage (<0.05). The overall mutations in exon 1 and 2 in all the forms of RAS genes aggregated to 21.5% and showed no association with any clinic-pathological parameters. In total, 53.8% (35 of 65) of the tumors studied had mutations in either a RAS or FGFR3 gene, but these were totally mutually exclusive in and none of the samples showed both the mutational events in mutually exclusive RAS and FGFR3. We conclude that RAS and FGFR3 mutations in UC are mutually exclusive and non-overlapping events which reflect activation of oncogenic pathways through different elements.

  12. Lipid-mediated glial cell line-derived neurotrophic factor gene transfer to cultured porcine ventral mesencephalic tissue

    DEFF Research Database (Denmark)

    Bauer, Matthias; Meyer, Morten; Brevig, Thomas

    2002-01-01

    Transplantation of dopaminergic ventral mesencephalic (VM) tissue into the basal ganglia of patients with Parkinson's disease (PD) shows at best moderate symptomatic relief in some of the treated cases. Experimental animal studies and clinical trials with allogenic and xenogenic pig-derived VM...... tissue grafts to PD patients indicate that one reason for the poor outcome of neural transplantation is the low survival and differentiation of grafted dopaminergic neurons. To improve dopaminergic cell survival through a gene-therapeutic approach we have established and report here results of lipid-mediated...... numbers of tyrosine hydroxylase-positive neurons in the cultured VM tissue. We conclude that lipid-mediated gene transfer employed on embryonic pig VM explant cultures is a safe and effective method to improve survival of dopaminergic neurons and may become a valuable tool to improve allo...

  13. Identification and characterization of a novel gene differentially expressed in zebrafish cross-subfamily cloned embryos

    Directory of Open Access Journals (Sweden)

    Wang Ya-Ping

    2008-03-01

    Full Text Available Abstract Background Cross-species nuclear transfer has been shown to be a potent approach to retain the genetic viability of a certain species near extinction. However, most embryos produced by cross-species nuclear transfer were compromised because that they were unable to develop to later stages. Gene expression analysis of cross-species cloned embryos will yield new insights into the regulatory mechanisms involved in cross-species nuclear transfer and embryonic development. Results A novel gene, K31, was identified as an up-regulated gene in fish cross-subfamily cloned embryos using SSH approach and RACE method. K31 complete cDNA sequence is 1106 base pairs (bp in length, with a 342 bp open reading frame (ORF encoding a putative protein of 113 amino acids (aa. Comparative analysis revealed no homologous known gene in zebrafish and other species database. K31 protein contains a putative transmembrane helix and five putative phosphorylation sites but without a signal peptide. Expression pattern analysis by real time RT-PCR and whole-mount in situ hybridization (WISH shows that it has the characteristics of constitutively expressed gene. Sub-cellular localization assay shows that K31 protein can not penetrate the nuclei. Interestingly, over-expression of K31 gene can cause lethality in the epithelioma papulosum cyprinid (EPC cells in cell culture, which gave hint to the inefficient reprogramming events occurred in cloned embryos. Conclusion Taken together, our findings indicated that K31 gene is a novel gene differentially expressed in fish cross-subfamily cloned embryos and over-expression of K31 gene can cause lethality of cultured fish cells. To our knowledge, this is the first report on the determination of novel genes involved in nucleo-cytoplasmic interaction of fish cross-subfamily cloned embryos.

  14. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  15. Radionuclide reporter gene imaging for cardiac gene therapy

    International Nuclear Information System (INIS)

    Inubushi, Masayuki; Tamaki, Nagara

    2007-01-01

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  16. Directed mutagenesis affects recombination in Azospirillum brasilense nif genes

    Directory of Open Access Journals (Sweden)

    C.P. Nunes

    2000-12-01

    Full Text Available In order to improve the gene transfer/mutagenesis system for Azospirillum brasilense, gene-cartridge mutagenesis was used to replace the nifD gene with the Tn5 kanamycin resistance gene. The construct was transferred to A. brasilense by electrotransformation. Of the 12 colonies isolated using the suicide plasmid pSUP202 as vector, only four did not show vector integration into the chromosome. Nevertheless, all 12 colonies were deficient in acetylene reduction, indicating an Nif- phenotype. Four Nif- mutants were analyzed by Southern blot, using six different probes spanning the nif and Km r genes and the plasmid vector. Apparently, several recombination events occurred in the mutant genomes, probably caused mainly by gene disruption owing to the mutagenesis technique used: resistance gene-cartridge mutagenesis combined with electrotransformation.Com o objetivo de melhorar os sistemas de transferência gênica e mutagênese para Azospirillum brasilense, a técnica de mutagênese através do uso de um gene marcador ("gene-cartridge mutagenesis" foi utilizada para substituir a região genômica de A. brasilense correspondente ao gene nifD por um segmento de DNA do transposon Tn5 contendo o gene que confere resistência ao antibiótico canamicina. A construção foi transferida para a linhagem de A. brasilense por eletrotransformação. Doze colônias transformantes foram isoladas com o plasmídeo suicida pSUP202 servindo como vetor. Dessas, somente quatro não possuíam o vetor integrado no cromossomo da bactéria. Independentemente da integração ou não do vetor, as 12 colônias foram deficientes na redução do gás acetileno, evidenciando o fenótipo Nif -. Quatro mutantes Nif - foram analisados através da técnica de Southern blot, utilizando-se seis diferentes fragmentos contendo genes nif, de resistência à canamicina e do vetor como sondas. Os resultados sugerem a ocorrência de eventos recombinacionais variados no genoma dos mutantes. A

  17. Polygalacturonase from Sitophilus oryzae: Possible horizontal transfer of a pectinase gene from fungi to weevils

    Directory of Open Access Journals (Sweden)

    Zhicheng Shen

    2003-08-01

    Full Text Available Endo-polygalacturonase, one of the group of enzymes known collectively as pectinases, is widely distributed in bacteria, plants and fungi. The enzyme has also been found in several weevil species and a few other insects, such as aphids, but not in Drosophila melanogaster, Anopheles gambiae, or Caenorhabditis elegans or, as far as is known, in any more primitive animal species. What, then, is the genetic origin of the polygalacturonases in weevils? Since some weevil species harbor symbiotic microorganisms, it has been suggested, reasonably, that the symbionts' genomes of both aphids and weevils, rather than the insects' genomes, could encode polygalacturonase. We report here the cloning of a cDNA that encodes endo-polygalacturonase in the rice weevil, Sitophilus oryzae (L., and investigations based on the cloned cDNA. Our results, which include analysis of genes in antibiotic-treated rice weevils, indicate that the enzyme is, in fact, encoded by the insect genome. Given the apparent absence of the gene in much of the rest of the animal kingdom, it is therefore likely that the rice weevil polygalacturonase gene was incorporated into the weevil's genome by horizontal transfer, possibly from a fungus.

  18. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation.The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors.Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in fleshy-fruit.

  19. Comparison of Gene Expression Profiles in Human Germinal Vesicle Before and After Cytoplasmic Transfer From Mature Oocytes in Iranian Infertile Couples

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Hoseini

    2016-08-01

    Full Text Available Objective: To evaluate the effect of cytoplasm transfer from mature oocytes to germinal vesicle(GVs on promoting the maturation of cytoplasm of GV at the mRNA level.Materials and methods: Sixty six in vitro fertilization (IVF operations between June 2012 and November 2013 were included in this study. Totally 120 GVs were obtained. Normal GVs were categorized into 3 groups (n = 40 randomly: the first comprised oocytes that did not receive the cytoplasm of mature oocytes; the second group comprised oocytes that did not receive the cytoplasm of mature oocytes but were incubated for 24 h; and the third group comprised oocytes that received 10-15% the cytoplasm of mature oocytes and were then incubated for 24 h. Each group was separately analyzed by quantitative polymerase chain reaction (qPCR and the expression levels of selected genes were assessed.Results: The expression levels of genes involved in the cytoplasmic maturity, and energy-producing mitochondria were significantly higher in the pooled oocytes of 2nd control group than those of the 1st control and intervention groups (p < 0.001. The genes involved in the meiosis, spindle check point, DNA repairing and cell cycle checkpoint did not have any expression in the 1st and intervention groups; however, these genes were expressed in the 2nd group, significantly. In the 2nd group, the highest expression level was observed for genes involved in the DNA repairing and cell cycle checkpoint. In the intervention group, none of the genes were expressed except for energy-producing mitochondria gene; even in this case, the expression level of this gene in this group of oocytes was significantly lower than that in other groups (p < 0.001. After 24 h meiosis assumption was significantly higher in the third group than in the second group (95% vs. 68%, p < 0.001.Conclusion: The cytoplasm transfer technique is not effective in cytoplasmic maturity of the recipient GV oocytes. In contrast, 24-hr in

  20. BraLTP1, a lipid transfer protein gene involved in epicuticular wax deposition, cell proliferation and flower development in Brassica napus.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available Plant non-specific lipid transfer proteins (nsLTPs constitute large multigene families that possess complex physiological functions, many of which remain unclear. This study isolated and characterized the function of a lipid transfer protein gene, BraLTP1 from Brassica rapa, in the important oilseed crops Brassica napus. BraLTP1 encodes a predicted secretory protein, in the little known VI Class of nsLTP families. Overexpression of BnaLTP1 in B. napus caused abnormal green coloration and reduced wax deposition on leaves and detailed wax analysis revealed 17-80% reduction in various major wax components, which resulted in significant water-loss relative to wild type. BnaLTP1 overexpressing leaves exhibited morphological disfiguration and abaxially curled leaf edges, and leaf cross-sections revealed cell overproliferation that was correlated to increased cytokinin levels (tZ, tZR, iP, and iPR in leaves and high expression of the cytokinin biosynthsis gene IPT3. BnaLTP1-overexpressing plants also displayed morphological disfiguration of flowers, with early-onset and elongated carpel development and outwardly curled stamen. This was consistent with altered expression of a a number of ABC model genes related to flower development. Together, these results suggest that BraLTP1 is a new nsLTP gene involved in wax production or deposition, with additional direct or indirect effects on cell division and flower development.

  1. Frequent gain and loss of introns in fungal cytochrome b genes.

    Directory of Open Access Journals (Sweden)

    Liang-Fen Yin

    Full Text Available In this study, all available cytochrome b (Cyt b genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms.

  2. Quantification of sequence exchange events between PMS2 and PMS2CL provides a basis for improved mutation scanning of Lynch syndrome patients.

    Science.gov (United States)

    van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T

    2010-05-01

    Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.

  3. Integrating Horizontal Gene Transfer and Common Descent to Depict Evolution and Contrast It with “Common Design”1

    Science.gov (United States)

    GUILLERMO PAZ-Y-MIÑO-C; ESPINOSA, AVELINA

    2016-01-01

    Horizontal gene transfer (HGT) and common descent interact in space and time. Because events of HGT co-occur with phylogenetic evolution, it is difficult to depict evolutionary patterns graphically. Tree-like representations of life’s diversification are useful, but they ignore the significance of HGT in evolutionary history, particularly of unicellular organisms, ancestors of multicellular life. Here we integrate the reticulated-tree model, ring of life, symbiogenesis whole-organism model, and eliminative pattern pluralism to represent evolution. Using Entamoeba histolytica alcohol dehydrogenase 2 (EhADH2), a bifunctional enzyme in the glycolytic pathway of amoeba, we illustrate how EhADH2 could be the product of both horizontally acquired features from ancestral prokaryotes (i.e. aldehyde dehydrogenase [ALDH] and alcohol dehydrogenase [ADH]), and subsequent functional integration of these enzymes into EhADH2, which is now inherited by amoeba via common descent. Natural selection has driven the evolution of EhADH2 active sites, which require specific amino acids (cysteine 252 in the ALDH domain; histidine 754 in the ADH domain), iron- and NAD+ as cofactors, and the substrates acetyl-CoA for ALDH and acetaldehyde for ADH. Alternative views invoking “common design” (i.e. the non-naturalistic emergence of major taxa independent from ancestry) to explain the interaction between horizontal and vertical evolution are unfounded. PMID:20021546

  4. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  5. Intraocular gene transfer of ciliary neurotrophic factor rescues photoreceptor degeneration in RCS rats.

    Science.gov (United States)

    Huang, Shun-Ping; Lin, Po-Kang; Liu, Jorn-Hon; Khor, Chin-Ni; Lee, Yih-Jing

    2004-01-01

    Ciliary neurotrophic factor (CNTF) is known as an important factor in the regulation of retinal cell growth. We used both recombinant CNTF and an adenovirus carrying the CNTF gene to regulate retinal photoreceptor expression in a retinal degenerative animal, Royal College of Surgeons (RCS) rats. Cells in the outer nuclear layer of the retinae from recombinant-CNTF-treated, adenoviral-CNTF-treated, saline-operated, and contralateral untreated preparations were examined for those exhibiting CNTF photoreceptor protective effects. Cell apoptosis in the outer nuclear layer of the retinae was also detected. It was found that CNTF had a potent effect on delaying the photoreceptor degeneration process in RCS rats. Furthermore, adenovirus CNTF gene transfer was proven to be better at rescuing photoreceptors than that when using recombinant CNTF, since adenoviral CNTF prolonged the photoreceptor protection effect. The function of the photoreceptors was also examined by taking electroretinograms of different animals. Adenoviral-CNTF-treated eyes showed better retinal function than did the contralateral control eyes. This study indicates that adenoviral CNTF effectively rescues degenerating photoreceptors in RCS rats. Copyright 2004 National Science Council, ROC and S. Karger AG, Basel

  6. Hematopoiesis stimulation test by interleukin 1α gene transfer in the Cynomolgus macaque: application to secondary medullary aplasia from an accidental irradiation

    International Nuclear Information System (INIS)

    De Revel, Th.

    2002-12-01

    After a description of the context of medullary aplasia (haematological radiobiology, radiation acute syndrome, therapeutic care), and an overview of knowledge about the interleukin-1 and medullary stroma cells, this research thesis aims at investigating therapeutic alternatives for radio-accidental aplasia. More precisely, it aims at defining means to get cytokines which are efficient for haematopoiesis. Interleukin-1 is chosen for its properties and tests are performed on a macaque with two approaches for gene transfer: an ex vivo transfer by retroviral vector enabling an integration in the target cell genome, and an in situ transfer by adeno-viral vector directly applied in the animal osseous medulla

  7. Gene therapy for lung cancer.

    Science.gov (United States)

    Toloza, Eric M; Morse, Michael A; Lyerly, H Kim

    2006-09-01

    Lung cancer patients suffer a 15% overall survival despite advances in chemotherapy, radiation therapy, and surgery. This unacceptably low survival rate is due to the usual finding of advanced disease at diagnosis. However, multimodality strategies using conventional therapies only minimally improve survival rates even in early stages of lung cancer. Attempts to improve survival in advanced disease using various combinations of platinum-based chemotherapy have demonstrated that no regimen is superior, suggesting a therapeutic plateau and the need for novel, more specific, and less toxic therapeutic strategies. Over the past three decades, the genetic etiology of cancer has been gradually delineated, albeit not yet completely. Understanding the molecular events that occur during the multistep process of bronchogenic carcinogenesis may make these tasks more surmountable. During these same three decades, techniques have been developed which allow transfer of functional genes into mammalian cells. For example, blockade of activated tumor-promoting oncogenes or replacement of inactivated tumor-suppressing or apoptosis-promoting genes can be achieved by gene therapy. This article will discuss the therapeutic implications of these molecular changes associated with bronchogenic carcinomas and will then review the status of gene therapies for treatment of lung cancer. (c) 2006 Wiley-Liss, Inc.

  8. Hypothalamic gene transfer of BDNF inhibits breast cancer progression and metastasis in middle age obese mice.

    Science.gov (United States)

    Liu, Xianglan; McMurphy, Travis; Xiao, Run; Slater, Andrew; Huang, Wei; Cao, Lei

    2014-07-01

    Activation of the hypothalamus-adipocyte axis is associated with an antiobesity and anticancer phenotype in animal models of melanoma and colon cancer. Brain-derived neurotrophic factor (BDNF) is a key mediator in the hypothalamus leading to preferential sympathoneural activation of adipose tissue and the ensuing resistance to obesity and cancer. Here, we generated middle age obese mice by high fat diet feeding for a year and investigated the effects of hypothalamic gene transfer of BDNF on a hormone receptor-positive mammary tumor model. The recombinant adeno-associated viral vector-mediated overexpression of BDNF led to marked weight loss and decrease of adiposity without change of food intake. BDNF gene therapy improved glucose tolerance, alleviated steatosis, reduced leptin level, inhibited mouse breast cancer EO771 growth, and prevented the metastasis. The reduced tumor growth in BDNF-treated mice was associated with reduced angiogenesis, decreased proliferation, increased apoptosis, and reduced adipocyte recruitment and lipid accumulation. Moreover, BDNF gene therapy reduced inflammation markers in the hypothalamus, the mammary gland, the subcutaneous fat, and the mammary tumor. Our results suggest that manipulating a single gene in the brain may influence multiple mechanisms implicated in obesity-cancer association and provide a target for the prevention and treatment of both obesity and cancer.

  9. Imaging expression of adenoviral HSV1-tk suicide gene transfer using the nucleoside analogue FIRU

    International Nuclear Information System (INIS)

    Nanda, Dharmin; Jong, Marion de; Bakker, Willem; Bijster, Magda; Cox, Peter; Vogels, Ronald; Havenga, Menzo; Driesse, Maarten; Avezaat, Cees; Morin, Kevin; Naimi, Ebrahim; Knaus, Edward; Wiebe, Leonard; Smitt, Peter Sillevis

    2002-01-01

    Substrates for monitoring HSV1-tk gene expression include uracil and acycloguanosine derivatives.The most commonly used uracil derivative to monitor HSV1-tk gene transfer is 1-(2-fluoro-2-deoxy-β-D-arabinofuranosyl)-5-[*I]iodouracil (fialuridine; I*-FIAU), where the asterisk denotes any of the radioactive iodine isotopes that can be used. We have previously studied other nucleosides with imaging properties as good as or better than FIAU, including 1-(2-fluoro-2-deoxy-β-D-ribofuranosyl)-5-[*I]iodouracil (FIRU). The first aim of this study was to extend the biodistribution data of 123 I-labelled FIRU. Secondly, we assessed the feasibility of detecting differences in HSV1-tk gene expression levels following adenoviral gene transfer in vivo with 123 I-FIRU. 9L rat gliosarcoma cells were stably transfected with the HSV1-tk gene (9L-tk+). 123 I-FIRU was prepared by radioiodination of 1-(2-fluoro-2-deoxy-β-D-ribofuranosyl)-5-tributylstannyl uracil (FTMRSU; precursor compound) and purified using an activated Sep-Pak column. Incubation of 9L-tk+ cells and the parental 9L cells with 123 I-FIRU resulted in a 100-fold higher accumulation of radioactivity in the 9L-tk+ cells after an optimum incubation time of 4 h. NIH-bg-nu-xid mice were then inoculated subcutaneously with HSV1-tk (-) 9L cells or HSV1-tk (+) 9L-tk+ cells into both flanks. Biodistribution studies and gamma camera imaging were performed at 15 min and 1, 2, 4 and 24 h p.i. At 15 min, the tumour/muscle, tumour/blood and tumour/brain ratios were 5.2, 1.0 and 30.3 respectively. Rapid renal clearance of the tracer from the body resulted in increasing tumour/muscle, tumour/blood and tumour/brain ratios, reaching values of 32.2, 12.5 and 171.6 at 4 h p.i. A maximum specific activity of 22%ID/g tissue was reached in the 9L-tk+ tumours 4 h after 123 I-FIRU injection. Two Ad5-based adenoviral vectors containing the HSV1-tk gene were constructed: a replication-incompetent vector with the transgene in the former E1

  10. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  11. Characterising phosphorus transfers in rural catchments using a continuous bank-side analyser

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available A six-month series of high-resolution synchronous stream discharge and total phosphorus (TP concentration data is presented from a 5 km2 agricultural catchment in the Lough Neagh basin, Northern Ireland. The data are hourly averages of 10-minute measurements using a new bankside, automatic, continuous monitoring technology. Three TP transfer "event-types" occur in this catchment: (1 chronic, storm independent transfers; (2 acute, storm dependent transfers; (3 acute, storm independent transfers. Event-type 2 transferred over 90% of the total 279 kg TP load in 39% of the total period; it corresponded to diffuse transfers from agricultural soils. Event-types 1 and 3, however, maintained the river in a highly eutrophic state between storm events and were characteristic of point source pollution, despite there being no major industrial or municipal point sources. Managing P transfers at the catchment scale requires a robust monitoring technology to differentiate between dynamic, multiple sources and associated event types and so enable a reliable assessment of the performance of mitigation measures, monitored at catchment outlets. The synchronous and continuous TP and discharge data series generated in this study demonstrate how this is possible.

  12. Gene transfer, expression, and sarcomeric incorporation of a headless myosin molecule in cardiac myocytes: evidence for a reserve in myofilament motor function

    Science.gov (United States)

    Vandenboom, Rene; Herron, Todd; Favre, Elizabeth; Albayya, Faris P.

    2011-01-01

    The purpose of this study was to implement a living myocyte in vitro model system to test whether a motor domain-deleted headless myosin construct could be incorporated into the sarcomere and affect contractility. To this end we used gene transfer to express a “headless” myosin heavy chain (headless-MHC) in complement with the native full-length myosin motors in the cardiac sarcomere. An NH2-terminal Flag epitope was used for unique detection of the motor domain-deleted headless-MHC. Total MHC content (i.e., headless-MHC + endogenous MHC) remained constant, while expression of the headless-MHC in transduced myocytes increased from 24 to 72 h after gene transfer until values leveled off at 96 h after gene transfer, at which time the headless-MHC comprised ∼20% of total MHC. Moreover, immunofluorescence labeling and confocal imaging confirmed expression and demonstrated incorporation of the headless-MHC in the A band of the cardiac sarcomere. Functional measurements in intact myocytes showed that headless-MHC modestly reduced amplitude of dynamic twitch contractions compared with controls (P < 0.05). In chemically permeabilized myocytes, maximum steady-state isometric force and the tension-pCa relationship were unaltered by the headless-MHC. These data suggest that headless-MHC can express to 20% of total myosin and incorporate into the sarcomere yet have modest to no effects on dynamic and steady-state contractile function. This would indicate a degree of functional tolerance in the sarcomere for nonfunctional myosin molecules. PMID:21112946

  13. Gene therapy and reproductive medicine.

    Science.gov (United States)

    Stribley, John M; Rehman, Khurram S; Niu, Hairong; Christman, Gregory M

    2002-04-01

    To review the literature on the principles of gene therapy and its potential application in reproductive medicine. Literature review. Gene therapy involves transfer of genetic material to target cells using a delivery system, or vector. Attention has primarily focused on viral vectors. Significant problems remain to be overcome including low efficacy of gene transfer, the transient expression of some vectors, safety issues with modified adenoviruses and retroviruses, and ethical concerns. If these issues can be resolved, gene therapy will be applicable to an increasing spectrum of single and multiple gene disorders, as the Human Genome Project data are analyzed, and the genetic component of human disease becomes better understood. Gynecologic gene therapy has advanced to human clinical trials for ovarian carcinoma, and shows potential for the treatment of uterine leiomyomata. Obstetric applications of gene therapy, including fetal gene therapy, remain more distant goals. Concerns about the safety of human gene therapy research are being actively addressed, and remarkable progress in improving DNA transfer has been made. The first treatment success for a genetic disease (severe combined immunodeficiency disease) has been achieved, and ongoing research efforts will eventually yield clinical applications in many spheres of reproductive medicine.

  14. Gene Therapy with the Sleeping Beauty Transposon System.

    Science.gov (United States)

    Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán

    2017-11-01

    The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Gene transfer to chicks using lentiviral vectors administered via the embryonic chorioallantoic membrane.

    Directory of Open Access Journals (Sweden)

    Gideon Hen

    Full Text Available The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV, into the chorioallantoic membrane (CAM of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP or recombinant alpha-melanocyte-stimulating hormone (α-MSH genes, driven by the cytomegalovirus (CMV promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP nick end labeling (TUNEL assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA, and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides.

  16. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

    OpenAIRE

    Koichi Higashi; Toru Tobe; Akinori Kanai; Ebru Uyar; Shu Ishikawa; Yutaka Suzuki; Naotake Ogasawara; Ken Kurokawa; Taku Oshima

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investiga...

  17. Transcriptomic and genetic analysis of direct interspecies electron transfer

    DEFF Research Database (Denmark)

    Shrestha, Pravin Malla; Rotaru, Amelia-Elena; Summers, Zarath M

    2013-01-01

    The possibility that metatranscriptomic analysis could distinguish between direct interspecies electron transfer (DIET) and H2 interspecies transfer (HIT) in anaerobic communities was investigated by comparing gene transcript abundance in cocultures in which Geobacter sulfurreducens....... These results demonstrate that there are unique gene expression patterns that distinguish DIET from HIT and suggest that metatranscriptomics may be a promising route to investigate interspecies electron transfer pathways in more-complex environments....

  18. IR-FEL-induced green fluorescence protein (GFP) gene transfer into plant cell

    CERN Document Server

    Awazu, K; Tamiya, E

    2002-01-01

    A Free Electron Laser (FEL) holds potential for various biotechnological applications due to its characteristics such as flexible wavelength tunability, short pulse and high peak power. We could successfully introduce the Green Fluorescent Protein (GFP) gene into tobacco BY2 cells by IR-FEL laser irradiation. The irradiated area of the solution containing BY2 cells and plasmid was about 0.1 mm sup 2. FEL irradiation at a wavelength of 5.75 and 6.1 mu m, targeting absorption by the ester bond of the lipid and the amide I bond of the protein, respectively, was shown to cause the introduction of the fluorescent dye into the cell. On the other hand, transient expression of the GFP fluorescence was only observed after irradiation at 5.75 mu m. The maximum transfer efficiency was about 0.5%.

  19. Background Adjusted Alignment-Free Dissimilarity Measures Improve the Detection of Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Kujin Tang

    2018-04-01

    Full Text Available Horizontal gene transfer (HGT plays an important role in the evolution of microbial organisms including bacteria. Alignment-free methods based on single genome compositional information have been used to detect HGT. Currently, Manhattan and Euclidean distances based on tetranucleotide frequencies are the most commonly used alignment-free dissimilarity measures to detect HGT. By testing on simulated bacterial sequences and real data sets with known horizontal transferred genomic regions, we found that more advanced alignment-free dissimilarity measures such as CVTree and d2* that take into account the background Markov sequences can solve HGT detection problems with significantly improved performance. We also studied the influence of different factors such as evolutionary distance between host and donor sequences, size of sliding window, and host genome composition on the performances of alignment-free methods to detect HGT. Our study showed that alignment-free methods can predict HGT accurately when host and donor genomes are in different order levels. Among all methods, CVTree with word length of 3, d2* with word length 3, Markov order 1 and d2* with word length 4, Markov order 1 outperform others in terms of their highest F1-score and their robustness under the influence of different factors.

  20. Anti-gp120 minibody gene transfer to female genital epithelial cells protects against HIV-1 virus challenge in vitro.

    Directory of Open Access Journals (Sweden)

    Ussama M Abdel-Motal

    Full Text Available Although cervico-vaginal epithelial cells of the female lower genital tract provide the initial defense system against HIV-1 infection, the protection is sometimes incomplete. Thus, enhancing anti-HIV-1 humoral immunity at the mucosal cell surface by local expression of anti-HIV-1 broadly neutralizing antibodies (BnAb that block HIV-1 entry would provide an important new intervention that could slow the spread of HIV/AIDS.This study tested the hypothesis that adeno-associated virus (AAV-BnAb gene transfer to cervico-vaginal epithelial cells will lead to protection against HIV-1. Accordingly, a recombinant AAV vector that encodes human b12 anti-HIV gp120 BnAb as a single-chain variable fragment Fc fusion (scFvFc, or "minibody" was constructed. The secreted b12 minibody was shown to be biologically functional in binding to virus envelope protein, neutralizing HIV-1 and importantly, blocking transfer and infectivity of HIV-1(bal in an organotypic human vaginal epithelial cell (VEC model. Furthermore, cervico-vaginal epithelial stem cells were found to be efficiently transduced by the optimal AAV serotype mediated expression of GFP.This study provides the foundation for a novel microbicide strategy to protect against sexual transmission of HIV-1 by AAV transfer of broadly neutralizing antibody genes to cervico-vaginal epithelial stem cells that could replenish b12 BnAb secreting cells through multiple menstrual cycles.