WorldWideScience

Sample records for gene structure variations

  1. Variation within the Huntington's disease gene influences normal brain structure.

    Directory of Open Access Journals (Sweden)

    Mark Mühlau

    Full Text Available Genetics of the variability of normal and diseased brain structure largely remains to be elucidated. Expansions of certain trinucleotide repeats cause neurodegenerative disorders of which Huntington's disease constitutes the most common example. Here, we test the hypothesis that variation within the IT15 gene on chromosome 4, whose expansion causes Huntington's disease, influences normal human brain structure. In 278 normal subjects, we determined CAG repeat length within the IT15 gene on chromosome 4 and analyzed high-resolution T1-weighted magnetic resonance images by the use of voxel-based morphometry. We found an increase of GM with increasing long CAG repeat and its interaction with age within the pallidum, which is involved in Huntington's disease. Our study demonstrates that a certain trinucleotide repeat influences normal brain structure in humans. This result may have important implications for the understanding of both the healthy and diseased brain.

  2. Structural variation of the ribosomal gene cluster within the class Insecta

    Energy Technology Data Exchange (ETDEWEB)

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V. [Vavilov Institute of General Genetics, Moscow (Russian Federation)] [and others

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  3. From Structural Variation of Gene Molecules to Chromatin Dynamics and Transcriptional Bursting

    Directory of Open Access Journals (Sweden)

    Hinrich Boeger

    2015-06-01

    Full Text Available Transcriptional activation of eukaryotic genes is accompanied, in general, by a change in the sensitivity of promoter chromatin to endonucleases. The structural basis of this alteration has remained elusive for decades; but the change has been viewed as a transformation of one structure into another, from “closed” to “open” chromatin. In contradistinction to this static and deterministic view of the problem, a dynamical and probabilistic theory of promoter chromatin has emerged as its solution. This theory, which we review here, explains observed variation in promoter chromatin structure at the level of single gene molecules and provides a molecular basis for random bursting in transcription—the conjecture that promoters stochastically transition between transcriptionally conducive and inconducive states. The mechanism of transcriptional regulation may be understood only in probabilistic terms.

  4. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Directory of Open Access Journals (Sweden)

    Karen E Sears

    2015-08-01

    Full Text Available Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11 and late (expansion and elongation; E11-13 limb development in mouse. This resulted in an Early (ESN and Late (LSN Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species.

  5. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  6. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Indian Academy of Sciences (India)

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  7. Structural variations in pig genomes

    NARCIS (Netherlands)

    Paudel, Y.

    2015-01-01

    Abstract Paudel, Y. (2015). Structural variations in pig genomes. PhD thesis, Wageningen University, the Netherlands Structural variations are chromosomal rearrangements such as insertions-deletions (INDELs), duplications, inversions, translocations, and copy number variations (CNVs

  8. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    Science.gov (United States)

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  9. Structural variation around prolactin gene linked to quantitative traits in an elite Holstein sire family.

    Science.gov (United States)

    Cowan, C M; Dentine, M R; Ax, R L; Schuler, L A

    1990-05-01

    Digestion of genomic DNA with the restriction endonuclease Avail disclosed a probable insertion deletion of approximately 200 base pairs (bp) near the prolactin gene. Two alleles were apparent as three distinct hybridization patterns. These alleles were statistically associated with quantitative trait loci among sons of one elite Holstein sire family. The favorable genotype was correlated with the presence of a 1.15-kb hybridization band inherited from the sire when genomic DNA was probed with a full-length cDNA for prolactin. Pedigree estimates of genetic merit among genotypes were similar, differing by only 19.3 kg for milk in ancestor merit. Comparisons of genetic estimates for quantitative yield traits in offspring of this heterozygous sire showed significant (Pcheese yield dollars, and protein dollars. The estimated differences between homozygous genotypes for USDA Transmitting Abilities of PDM, PD$, Cheese Yield $ and Protein $ were 282.93 kg, $74.35, $48.58 and $53.67, respectively. However, the estimated breeding values from progeny ranged over 900 kg in transmitting ability for milk. Frequency of the favorable marker allele was estimated to be 0.231 in the elite cow population used as dams of sons. These results demonstrate the potential of molecular biological techniques to discriminate between individuals within a family and to predict breeding values for selection schemes.

  10. An LTR Retrotransposon-Derived Gene Displays Lineage-Specific Structural and Putative Species-Specific Functional Variations in Eutherians

    Science.gov (United States)

    Irie, Masahito; Koga, Akihiko; Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

    2016-01-01

    Amongst the 11 eutherian-specific genes acquired from a sushi-ichi retrotransposon is the CCHC type zinc-finger protein-encoding gene SIRH11/ZCCHC16. Its contribution to eutherian brain evolution is implied because of its involvement in cognitive function in mice, possibly via the noradrenergic system. Although, the possibility that Sirh11/Zcchc16 functions as a non-coding RNA still remains, dN/dS ratios in pairwise comparisons between its orthologs have provided supportive evidence that it acts as a protein. It became a pseudogene in armadillos (Cingulata) and sloths (Pilosa), the only two extant orders of xenarthra, which prompted us to examine the lineage-specific variations of SIRH11/ZCCHC16 in eutherians. We examined the predicted SIRH11/ZCCHC16 open reading frame (ORF) in 95 eutherian species based on the genomic DNA information in GenBank. A large variation in the SIRH11/ZCCHC16 ORF was detected in several lineages. These include a lack of a CCHC RNA-binding domain in its C-terminus, observed in gibbons (Hylobatidae: Primates) and megabats (Megachiroptera: Chiroptera). A lack of the N-terminal half, on the other hand, was observed in New World monkeys (Platyrrhini: Primates) and species belonging to New World and African Hystricognaths (Caviomorpha and Bathyergidae: Rodents) along with Cetacea and Ruminantia (Cetartiodactyla). Among the hominoids, interestingly, three out of four genera of gibbons have lost normal SIRH11/ZCCHC16 function by deletion or the lack of the CCHC RNA-binding domain. Our extensive dN/dS analysis suggests that such truncated SIRH11/ZCCHC16 ORFs are functionally diversified even within lineages. Combined, our results show that SIRH11/ZCCHC16 may contribute to the diversification of eutherians by lineage-specific structural changes after its domestication in the common eutherian ancestor, followed by putative species-specific functional changes that enhanced fitness and occurred as a consequence of complex natural selection events

  11. The influence of population structure on gene expression and flowering time variation in the ubiquitous weed Capsella bursa-pastoris (Brassicaceae).

    Science.gov (United States)

    Kryvokhyzha, Dmytro; Holm, Karl; Chen, Jun; Cornille, Amandine; Glémin, Sylvain; Wright, Stephen I; Lagercrantz, Ulf; Lascoux, Martin

    2016-03-01

    Population structure is a potential problem when testing for adaptive phenotypic differences among populations. The observed phenotypic differences among populations can simply be due to genetic drift, and if the genetic distance between them is not considered, the differentiation may be falsely interpreted as adaptive. Conversely, adaptive and demographic processes might have been tightly associated and correcting for the population structure may lead to false negatives. Here, we evaluated this problem in the cosmopolitan weed Capsella bursa-pastoris. We used RNA-Seq to analyse gene expression differences among 24 accessions, which belonged to a much larger group that had been previously characterized for flowering time and circadian rhythm and were genotyped using genotyping-by-sequencing (GBS) technique. We found that clustering of accessions for gene expression retrieved the same three clusters that were obtained with GBS data previously, namely Europe, the Middle East and Asia. Moreover, the three groups were also differentiated for both flowering time and circadian rhythm variation. Correction for population genetic structure when analysing differential gene expression analysis removed all differences among the three groups. This may suggest that most differences are neutral and simply reflect population history. However, geographical variation in flowering time and circadian rhythm indicated that the distribution of adaptive traits might be confounded by population structure. To bypass this confounding effect, we compared gene expression differentiation between flowering ecotypes within the genetic groups. Among the differentially expressed genes, FLOWERING LOCUS C was the strongest candidate for local adaptation in regulation of flowering time.

  12. A sequence variation scan of the coagulation factor VIII (FVIII) structural gene and associations with plasma FVIII activity levels.

    Science.gov (United States)

    Viel, Kevin R; Machiah, Deepa K; Warren, Diane M; Khachidze, Manana; Buil, Alfonso; Fernstrom, Karl; Souto, Juan C; Peralta, Juan M; Smith, Todd; Blangero, John; Porter, Sandra; Warren, Stephen T; Fontcuberta, Jordi; Soria, Jose M; Flanders, W Dana; Almasy, Laura; Howard, Tom E

    2007-05-01

    Plasma factor VIII coagulant activity (FVIII:C) level is a highly heritable quantitative trait that is strongly correlated with thrombosis risk. Polymorphisms within only 1 gene, the ABO blood-group locus, have been unequivocally demonstrated to contribute to the broad population variability observed for this trait. Because less than 2.5% of the structural FVIII gene (F8) has been examined previously, we resequenced all known functional regions in 222 potentially distinct alleles from 137 unrelated nonhemophilic individuals representing 7 racial groups. Eighteen of the 47 variants identified, including 17 single-nucleotide polymorphisms (SNPs), were previously unknown. As the degree of linkage disequilibrium across F8 was weak overall, we used measured-genotype association analysis to evaluate the influence of each polymorphism on the FVIII:C levels in 398 subjects from 21 pedigrees known as the Genetic Analysis of Idiopathic Thrombophilia project (GAIT). Our results suggested that 92714C>G, a nonsynonymous SNP encoding the B-domain substitution D1241E, was significantly associated with FVIII:C level. After accounting for important covariates, including age and ABO genotype, the association persisted with each C-allele additively increasing the FVIII:C level by 14.3 IU dL(-1) (P = .016). Nevertheless, because the alleles of 56010G>A, a SNP within the 3' splice junction of intron 7, are strongly associated with 92714C>G in GAIT, additional studies are required to determine whether D1241E is itself a functional variant.

  13. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.

    Science.gov (United States)

    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng

    2016-05-01

    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.

  14. Population genetic structure of the African elephant in Uganda based on variation at mitochondrial and nuclear loci: evidence for male-biased gene flow.

    Science.gov (United States)

    Nyakaana, S; Arctander, P

    1999-07-01

    A drastic decline has occurred in the size of the Uganda elephant population in the last 40 years, exacerbated by two main factors; an increase in the size of the human population and poaching for ivory. One of the attendant consequences of such a decline is a reduction in the amount of genetic diversity in the surviving populations due to increased effects of random genetic drift. Information about the amount of genetic variation within and between the remaining populations is vital for their future conservation and management. The genetic structure of the African elephant in Uganda was examined using nucleotide variation of mitochondrial control region sequences and four nuclear microsatellite loci in 72 individuals from three localities. Eleven mitochondrial DNA (mtDNA) haplotypes were observed, nine of which were geographically localized. We found significant genetic differentiation between the three populations at the mitochondrial locus while three out of the four microsatellite loci differentiated KV and QE, one locus differentiated KV and MF and no loci differentiated MF and QE. Expected heterozygosity at the four loci varied between 0.51 and 0.84 while nucleotide diversity at the mitochondrial locus was 1.4%. Incongruent patterns of genetic variation within and between populations were revealed by the two genetic systems, and we have explained these in terms of the differences in the effective population sizes of the two genomes and male-biased gene flow between populations.

  15. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important contributors...

  16. Variation analysis of the severe acute respiratory syndrome coronavirus putative non-structural protein 2 gene and construction of three-dimensional model

    Institute of Scientific and Technical Information of China (English)

    LU Jia-hai; CHEN Wei-qing; LING Wen-hua; YU Xin-bing; ZHONG Nan-shan; ZHANG Ding-mei; WANG Guo-ling; GUO Zhong-min; ZHANG Chuan-hai; TAN Bing-yan; OUYANG Li-ping; LIN Li; LIU Yi-min

    2005-01-01

    cells successfully. The result of sequencing and sequence comparison with other SARS-CoV strains showed that nsp2 gene was relatively conservative during the transmission and total five base sites mutated in about 100 strains investigated, three of which in the early and middle phases caused synonymous mutation, and another two base sites variation in the late phase resulted in the amino acid substitutions and secondary structure changes. The three-dimensional structure of the nsp2 protein was successfully constructed. Conclusions The results suggest that polymerase nsp2 is relatively stable during the phase of epidemic. The amino acid and secondary structure change may be important for viral infection. The fact that majority of single nucleotide variations (SNVs) are predicted to cause synonymous, as well as the result of low mutation rate of nsp2 gene in the epidemic variations, indicates that the nsp2 is conservative and could be a target for anti-SARS drugs. The three-dimensional structure result indicates that the nsp2 protein of GD strain is high homologous with 3CLpro of SARS-CoV urbani strain, 3CLpro of transmissible gastroenteritis virus and 3CLpro of human coronavirus 229E strain, which further suggests that nsp2 protein of GD strain possesses the activity of 3CLpro.

  17. Functional and structural variation of uridine diphosphate glycosyltransferase (UGT) gene of Stevia rebaudiana-UGTSr involved in the synthesis of rebaudioside A.

    Science.gov (United States)

    Madhav, Harish; Bhasker, Salini; Chinnamma, Mohankumar

    2013-02-01

    The sweetness of honey leaf plant Stevia rebaudiana is attributed to steviol glycosides or steviosides, accumulated in the leaves. Steviol glycosides are diterpenoids derived from steviol as the final step of glycosylation by the marker enzyme Uridine diphosphate glycosyltransferase (UGT). Out of the eight different steviol glycosides, rebaudioside A was detected as the sweetest glycoside with reduced bitter aftertaste. The pattern of glycosylation of steviol has a crucial role in maintaining the sweetness as well as the taste perception of stevioside. Within the 12 UGTs of S. rebaudiana so far elucidated, the functional genomics of three UGTs-UGT76G1, UGT74G1 & UGT85C2 in stevioside synthesis were studied. In the present study a UGT gene of S. rebaudiana named UGTSr showing resemblance with UGT76G1 was structurally analyzed and the functional role of the recombinant UGTSr in the synthesis of rebaudioside A was ascertained. The relative expression of UGTSr by qPCR showed a higher level of expression in mature leaves than in tender. Despite the similarity of nucleotide with UGT76G1, the gene UGTSr exhibits 48 SNPs and 39 associated amino acid substitutions with remarkable variation in the secondary and tertiary structure of the protein. The helical changes, the presence of a new amino acid, novel substitutions of amino acids and the hydrogen bond in the conserved histidine and aspartame residues observed in UGTSr support its functional stability and specificity from that of other UGTs of S. rebaudiana. Based on these features UGTSr exhibits a novel status from other UGTs of S. rebaudiana.

  18. Low Variation in the Polymorphic Clock Gene Poly-Q Region Despite Population Genetic Structure across Barn Swallow (Hirundo rustica) Populations

    Science.gov (United States)

    Dor, Roi; Lovette, Irby J.; Safran, Rebecca J.; Billerman, Shawn M.; Huber, Gernot H.; Vortman, Yoni; Lotem, Arnon; McGowan, Andrew; Evans, Matthew R.; Cooper, Caren B.; Winkler, David W.

    2011-01-01

    Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica), a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies) and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA). We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus. PMID:22216124

  19. Low variation in the polymorphic Clock gene poly-Q region despite population genetic structure across barn swallow (Hirundo rustica populations.

    Directory of Open Access Journals (Sweden)

    Roi Dor

    Full Text Available Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica, a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA. We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus.

  20. Propagation of genetic variation in gene regulatory networks.

    Science.gov (United States)

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W

    2013-08-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing how genetic variation in a locus is propagated through the network, and show how their derivatives are related to the network's feedback structure. Similarly, feedback functions describe the effect of genotypic variation of a locus on itself, either directly or mediated by the network. A simple sign rule relates the sign of the derivative of the feedback function of any locus to the feedback loops involving that particular locus. We show that the sign of the phenotypically manifested interaction between alleles at a diploid locus is equal to the sign of the dominant feedback loop involving that particular locus, in accordance with recent results for a single locus system. Our results provide tools by which one can use observable equilibrium concentrations of gene products to disclose structural properties of the network architecture. Our work is a step towards a theory capable of explaining the pleiotropy and epistasis features of genetic variation in complex regulatory networks as functions of regulatory anatomy and functional location of the genetic variation.

  1. O-antigen structure of Shigella flexneri serotype Yv and effect of the lpt-O gene variation on phosphoethanolamine modification of S. flexneri O-antigens.

    Science.gov (United States)

    Knirel, Yuriy A; Lan, Ruiting; Senchenkova, Sof'ya N; Wang, Jianping; Shashkov, Alexander S; Wang, Yan; Perepelov, Andrei V; Xiong, Yanwen; Xu, Jianguo; Sun, Qiangzheng

    2013-04-01

    Shigella flexneri is the major human pathogen causing shigellosis. O-antigens of all S. flexneri serotypes (except for serotype 6) share the →2)-α-l-Rhap(III)-(1 → 2)-α-l-Rhap(II)-(1 → 3)-α-l-Rhap(I)-(1 → 3)-β-d-GlcpNAc-(1→ basic O-unit, whereas differences between the serotypes are conferred by phage-encoded glucosylation and/or O-acetylation at various positions. Recently, in serotype X and 4a variants called Xv and 4av, respectively, O-antigen modification with phosphoethanolamine (PEtN) has been identified, which is encoded by a plasmid-borne gene (lpt-O) for a PEtN-transferase and confers the monoclonal antibody IV-1(MASF IV-1) determinant to the bacteria. In this study, we elucidated the O-antigen structure of serotype Yv, another MASF IV-1-positive novel variant of S. flexneri. The serotype Yv O-antigen has the same basic carbohydrate backbone structure as that of the "classical" serotype Y, but differs in the presence of PEtN at position 3 of Rha(III) (major) or both Rha(II) and Rha(III) (minor). This pattern is similar to that of serotype 4av, but different from the pattern of serotype Xv, which is characterized by major PEtN modification on Rha(II). In serotype Yv, mono- and bisphosphorylated O-units generate a block-copolymeric structure, the former being partially O-acetylated at position 6 of GlcNAc and the latter lacking O-acetylation. Functional analysis revealed a correlation between the serotype-specific PEtN modification pattern and the lpt-O variation in different serotypes: lpt-O(RII) in serotype Xv is better tuned for phosphorylation of Rha(II) and lpt-O(RIII) in serotypes Yv and 4av for phosphorylation of Rha(III). These data enhance our knowledge of S. flexneri serotype conversion mechanisms and help to understand the biosynthesis process of the new O-antigen variants.

  2. Post-zygotic and inter-individual structural genetic variation in a presumptive enhancer element of the locus between the IL10Rβ and IFNAR1 genes.

    Directory of Open Access Journals (Sweden)

    Hamid Reza Razzaghian

    Full Text Available Although historically considered as junk-DNA, tandemly repeated sequence motifs can affect human phenotype. For example, variable number tandem repeats (VNTR with embedded enhancers have been shown to regulate gene transcription. The post-zygotic variation is the presence of genetically distinct populations of cells in an individual derived from a single zygote, and this is an understudied aspect of genome biology. We report somatically variable VNTR with sequence properties of an enhancer, located upstream of IFNAR1. Initially, SNP genotyping of 63 monozygotic twin pairs and multiple tissues from 21 breast cancer patients suggested a frequent post-zygotic mosaicism. The VNTR displayed a repeated 32 bp core motif in the center of the repeat, which was flanked by similar variable motifs. A total of 14 alleles were characterized based on combinations of segments, which showed post-zygotic and inter-individual variation, with up to 6 alleles in a single subject. Somatic variation occurred in ∼24% of cases. In this hypervariable region, we found a clustering of transcription factor binding sites with strongest sequence similarity to mouse Foxg1 transcription factor binding motif. This study describes a VNTR with sequence properties of an enhancer that displays post-zygotic and inter-individual genetic variation. This element is within a locus containing four related cytokine receptors: IFNAR2, IL10Rβ, IFNAR1 and IFNGR2, and we hypothesize that it might function in transcriptional regulation of several genes in this cluster. Our findings add another level of complexity to the variation among VNTR-based enhancers. Further work may unveil the normal function of this VNTR in transcriptional control and its possible involvement in diseases connected with these receptors, such as autoimmune conditions and cancer.

  3. Human Structural Variation: Mechanisms of Chromosome Rearrangements.

    Science.gov (United States)

    Weckselblatt, Brooke; Rudd, M Katharine

    2015-10-01

    Chromosome structural variation (SV) is a normal part of variation in the human genome, but some classes of SV can cause neurodevelopmental disorders. Analysis of the DNA sequence at SV breakpoints can reveal mutational mechanisms and risk factors for chromosome rearrangement. Large-scale SV breakpoint studies have become possible recently owing to advances in next-generation sequencing (NGS) including whole-genome sequencing (WGS). These findings have shed light on complex forms of SV such as triplications, inverted duplications, insertional translocations, and chromothripsis. Sequence-level breakpoint data resolve SV structure and determine how genes are disrupted, fused, and/or misregulated by breakpoints. Recent improvements in breakpoint sequencing have also revealed non-allelic homologous recombination (NAHR) between paralogous long interspersed nuclear element (LINE) or human endogenous retrovirus (HERV) repeats as a cause of deletions, duplications, and translocations. This review covers the genomic organization of simple and complex constitutional SVs, as well as the molecular mechanisms of their formation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Genetic Variation, Structure, and Gene Flow in a Sloth Bear (Melursus ursinus Meta-Population in the Satpura-Maikal Landscape of Central India.

    Directory of Open Access Journals (Sweden)

    Trishna Dutta

    Full Text Available Sloth bears (Melursus ursinus are endemic to the Indian subcontinent. As a result of continued habitat loss and degradation over the past century, sloth bear populations have been in steady decline and now exist only in isolated or fragmented habitat across the entire range. We investigated the genetic connectivity of the sloth bear meta-population in five tiger reserves in the Satpura-Maikal landscape of central India. We used noninvasively collected fecal and hair samples to obtain genotypic information using a panel of seven polymorphic loci. Out of 194 field collected samples, we identified 55 individuals in this meta-population. We found that this meta-population has moderate genetic variation, and is subdivided into two genetic clusters. Further, we identified five first-generation migrants and signatures of contemporary gene flow. We found evidence of sloth bears in the corridor between the Kanha and Pench Tiger Reserves, and our results suggest that habitat connectivity and corridors play an important role in maintaining gene flow in this meta-population. These corridors face several anthropogenic and infrastructure development threats that have the potential to sever ongoing gene flow, if policies to protect them are not put into action immediately.

  5. Genetic Variation, Structure, and Gene Flow in a Sloth Bear (Melursus ursinus) Meta-Population in the Satpura-Maikal Landscape of Central India.

    Science.gov (United States)

    Dutta, Trishna; Sharma, Sandeep; Maldonado, Jesús E; Panwar, Hemendra Singh; Seidensticker, John

    2015-01-01

    Sloth bears (Melursus ursinus) are endemic to the Indian subcontinent. As a result of continued habitat loss and degradation over the past century, sloth bear populations have been in steady decline and now exist only in isolated or fragmented habitat across the entire range. We investigated the genetic connectivity of the sloth bear meta-population in five tiger reserves in the Satpura-Maikal landscape of central India. We used noninvasively collected fecal and hair samples to obtain genotypic information using a panel of seven polymorphic loci. Out of 194 field collected samples, we identified 55 individuals in this meta-population. We found that this meta-population has moderate genetic variation, and is subdivided into two genetic clusters. Further, we identified five first-generation migrants and signatures of contemporary gene flow. We found evidence of sloth bears in the corridor between the Kanha and Pench Tiger Reserves, and our results suggest that habitat connectivity and corridors play an important role in maintaining gene flow in this meta-population. These corridors face several anthropogenic and infrastructure development threats that have the potential to sever ongoing gene flow, if policies to protect them are not put into action immediately.

  6. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  7. Structure variations of pumpkin balloon

    Science.gov (United States)

    Yajima, N.; Izutsu, N.; Honda, H.

    2004-01-01

    A lobed pumpkin balloon by 3-D gore design concept is recognized as a basic form for a super-pressure balloon. This paper deals with extensions of this design concept for other large pressurized membrane structures, such as a stratospheric airship and a balloon of which volume is controllable. The structural modifications are performed by means of additional ropes, belts or a strut. When the original pumpkin shape is modified by these systems, the superior characteristics of the 3-D gore design, incorporating large bulges with a small local radius and unidirectional film tension, should be maintained. Improved design methods which are adequate for the above subjects will be discussed in detail. Application for ground structures are also mentioned.

  8. Genetic variation in genes affecting milk composition and quality

    DEFF Research Database (Denmark)

    Bertelsen, Henriette Pasgaard

    In the past decade major advances in next generation sequencing technologies have provided new opportuneties for the detection of genetic variation. Combining the knowlegde of genetic variation with phenotypic distributions provides considerable possibilites for detection of candidate genes....... In addition, exploring genetic variation related to the major milk proteins of bovine milk indntified genetic variations with possitive effects on milk coagulation...

  9. Tandem gene arrays in Trypanosoma brucei: Comparative phylogenomic analysis of duplicate sequence variation

    Directory of Open Access Journals (Sweden)

    Jackson Andrew P

    2007-04-01

    Full Text Available Abstract Background The genome sequence of the protistan parasite Trypanosoma brucei contains many tandem gene arrays. Gene duplicates are created through tandem duplication and are expressed through polycistronic transcription, suggesting that the primary purpose of long, tandem arrays is to increase gene dosage in an environment where individual gene promoters are absent. This report presents the first account of the tandem gene arrays in the T. brucei genome, employing several related genome sequences to establish how variation is created and removed. Results A systematic survey of tandem gene arrays showed that substantial sequence variation existed across the genome; variation from different regions of an array often produced inconsistent phylogenetic affinities. Phylogenetic relationships of gene duplicates were consistent with concerted evolution being a widespread homogenising force. However, tandem duplicates were not usually identical; therefore, any homogenising effect was coincident with divergence among duplicates. Allelic gene conversion was detected using various criteria and was apparently able to both remove and introduce sequence variation. Tandem arrays containing structural heterogeneity demonstrated how sequence homogenisation and differentiation can occur within a single locus. Conclusion The use of multiple genome sequences in a comparative analysis of tandem gene arrays identified substantial sequence variation among gene duplicates. The distribution of sequence variation is determined by a dynamic balance of conservative and innovative evolutionary forces. Gene trees from various species showed that intraspecific duplicates evolve in concert, perhaps through frequent gene conversion, although this does not prevent sequence divergence, especially where structural heterogeneity physically separates a duplicate from its neighbours. In describing dynamics of sequence variation that have consequences beyond gene dosage, this

  10. Structure, variation and expression analysis of glutenin gene promoters from Triticum aestivum cultivar Chinese Spring shows the distal region of promoter 1Bx7 is key regulatory sequence.

    Science.gov (United States)

    Wang, Kai; Zhang, Xue; Zhao, Ying; Chen, Fanguo; Xia, Guangmin

    2013-09-25

    In this study, ten glutenin gene promoters were isolated from model wheat (Triticum aestivum L. cv. Chinese Spring) using a genomic PCR strategy with gene-specific primers. Six belonged to high-molecular-weight glutenin subunit (HMW-GS) gene promoters, and four to low-molecular-weight glutenin subunit (LMW-GS). Sequence lengths varied from 1361 to 2,554 bp. We show that the glutenin gene promoter motifs are conserved in diverse sequences in this study, with HMW-GS and LMW-GS gene promoters characterized by distinct conserved motif combinations. Our findings show that HMW-GS promoters contain more functional motifs in the distal region of the glutenin gene promoter (> -700 bp) compared with LMW-GS. The y-type HMW-GS gene promoters possess unique motifs including RY repeat and as-2 box compared to the x-type. We also identified important motifs in the distal region of HMW-GS gene promoters including the 5'-UTR Py-rich stretch motif and the as-2 box motif. We found that cis-acting elements in the distal region of promoter 1Bx7 enhanced the expression of HMW-GS gene 1Bx7. Taken together, these data support efforts in designing molecular breeding strategies aiming to improve wheat quality. Our results offer insight into the regulatory mechanisms of glutenin gene expression.

  11. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Directory of Open Access Journals (Sweden)

    Leekitcharoenphon Pimlapas

    2012-03-01

    Full Text Available Abstract Background Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over time. The core genes--the genes that are conserved in all (or most members of a genus or species--are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher confidence. The core genes can be divided into two categories: a few highly variable genes and a larger set of conserved core genes, with low variance. For the most variable core genes, the variance in amino acid sequences is higher than for the corresponding nucleotide sequences, suggesting that there is a positive selection towards mutations leading to amino acid changes. Conclusions Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important especially in trend analysis.

  12. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  13. Online resources for genomic structural variation.

    Science.gov (United States)

    Sneddon, Tam P; Church, Deanna M

    2012-01-01

    Genomic structural variation (SV) can be thought of on a continuum from a single base pair insertion/deletion (INDEL) to large megabase-scale rearrangements involving insertions, deletions, duplications, inversions, or translocations of whole chromosomes or chromosome arms. These variants can occur in coding or noncoding DNA, they can be inherited or arise sporadically in the germline or somatic cells. Many of these events are segregating in the population and can be considered common alleles while others are new alleles and thus rare events. All species studied to date harbor structural variants and these may be benign, contributing to phenotypes such as sensory perception and immunity, or pathogenic resulting in genomic disorders including DiGeorge/velocardiofacial, Smith-Margenis, Williams-Beuren, and Prader-Willi syndromes. As structural variants are identified, validated, and their significance, origin, and prevalence are elucidated, it is of critical importance that these data be collected and collated in a way that can be easily accessed and analyzed. This chapter describes current structural variation online resources (see Fig. 1 and Table 1), highlights the challenges in capturing, storing, and displaying SV data, and discusses how dbVar and DGVa, the genomic structural variation databases developed at NCBI and EBI, respectively, were designed to address these issues.

  14. Molecular and structural analysis of genetic variations in congenital cataract

    Science.gov (United States)

    Kumar, Manoj; Agarwal, Tushar; Kaur, Punit; Kumar, Manoj; Khokhar,, Sudarshan

    2013-01-01

    Objective To determine the relative contributions of mutations in congenital cataract cases in an Indian population by systematic screening of genes associated with cataract. Methods We enrolled 100 congenital cataract cases presenting at the Dr. R. P. Centre for Ophthalmic Sciences, a tertiary research and referral hospital (AIIMS, New Delhi, India). Crystallin, alpha A (CRYAA), CRYAB, CRYGs, CRYBA1, CRYBA4, CRYBB1, CRYBB2, CRYBB3, beaded filament structural protein 1 (BFSP1), gap function protein, alpha 3 (GJA3), GJA8, and heat shock transcription factor 4 gene genes were amplified. Protein structure differences analysis was performed using Discovery Studio (DS) 2.0. Results The mean age of the patients was 17.45±16.51 months, and the age of onset was 1.618±0.7181 months. Sequencing analysis of 14 genes identified 18 nucleotide variations. Fourteen variations were found in the crystallin genes, one in Cx-46 (GJA3), and three in BFSP1. Conclusions Congenital cataract shows marked clinical and genetic heterogeneity. Five nucleotide variations (CRYBA4:p.Y67N, CRYBB1:p.D85N, CRYBB1:p.E75K, CRYBB1:p.E155K, and GJA3:p.M1V) were predicted to be pathogenic. Variants in other genes might also be involved in maintaining lens development, growth, and transparency. The study confirms that the crystallin beta cluster on chromosome 22, Cx-46, and BFSP1 plays a major role in maintaining lens transparency. This study also expands the mutation spectrum of the genes associated with congenital cataract. PMID:24319337

  15. Global properties and functional complexity of human gene regulatory variation.

    Directory of Open Access Journals (Sweden)

    Daniel J Gaffney

    2013-05-01

    Full Text Available Identification and functional interpretation of gene regulatory variants is a major focus of modern genomics. The application of genetic mapping to molecular and cellular traits has enabled the detection of regulatory variation on genome-wide scales and revealed an enormous diversity of regulatory architecture in humans and other species. In this review I summarise the insights gained and questions raised by a decade of genetic mapping of gene expression variation. I discuss recent extensions of this approach using alternative molecular phenotypes that have revealed some of the biological mechanisms that drive gene expression variation between individuals. Finally, I highlight outstanding problems and future directions for development.

  16. Variation of the fine structure constant

    CERN Document Server

    Lipovka, Anton A

    2016-01-01

    In present paper we evaluate the fine structure constant variation which should take place as the Universe is expanded and its curvature is changed adiabatically. This changing of the fine structure constant is attributed to the energy lost by physical system (consist of baryonic component and electromagnetic field) due to expansion of our Universe. Obtained ratio (d alpha)/alpha = 1. 10{-18} (per second) is only five times smaller than actually reported experimental limit on this value. For this reason this variation can probably be measured within a couple of years. To argue the correctness of our approach we calculate the Planck constant as adiabatic invariant of electromagnetic field, from geometry of our Universe in the framework of the pseudo- Riemannian geometry. Finally we discuss the double clock experiment based on Al+ and Hg+ clocks carried out by T. Rosenband et al. (Science 2008). We show that in this particular case there is an error in method and this way the fine structure constant variation c...

  17. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...

  18. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

    2012-01-01

    Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...... that there is a positive selection towards mutations leading to amino acid changes. Conclusions: Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important...

  19. Theories of Population Variation in Genes and Genomes

    DEFF Research Database (Denmark)

    Christiansen, Freddy

    genetics, while emphasizing the close interplay between theory and empiricism. Traditional topics such as genetic and phenotypic variation, mutation, migration, and linkage are covered and advanced by contemporary coalescent theory, which describes the genealogy of genes in a population, ultimately...

  20. Recurrent Somatic Structural Variations Contribute to Tumorigenesis in Pediatric Osteosarcoma

    Directory of Open Access Journals (Sweden)

    Xiang Chen

    2014-04-01

    Full Text Available Pediatric osteosarcoma is characterized by multiple somatic chromosomal lesions, including structural variations (SVs and copy number alterations (CNAs. To define the landscape of somatic mutations in pediatric osteosarcoma, we performed whole-genome sequencing of DNA from 20 osteosarcoma tumor samples and matched normal tissue in a discovery cohort, as well as 14 samples in a validation cohort. Single-nucleotide variations (SNVs exhibited a pattern of localized hypermutation called kataegis in 50% of the tumors. We identified p53 pathway lesions in all tumors in the discovery cohort, nine of which were translocations in the first intron of the TP53 gene. Beyond TP53, the RB1, ATRX, and DLG2 genes showed recurrent somatic alterations in 29%–53% of the tumors. These data highlight the power of whole-genome sequencing for identifying recurrent somatic alterations in cancer genomes that may be missed using other methods.

  1. Variations of sphenoid and related structures

    Energy Technology Data Exchange (ETDEWEB)

    Sirikci, A.; Bayram, M. [Dept. of Radiology, Gaziantep University, Koljtepe (Turkey); Bayazit, Y.A.; Mumbuc, S.; Kanlikama, M. [Dept. of Otolaryngology and Head and Neck Surgery, Gaziantep University, Koljtepe (Turkey); Guengoer, K. [Dept. of Ophthalmology, Gaziantep University, Koljtepe (Turkey)

    2000-05-01

    The aim of this study was to delineate the precise relationship between the sphenoid sinus and internal carotid artery and the optic nerve, as well as to assess incidence of the anatomic variations of these structures. A review of 92 paranasal sinus tomographic scans was made for anatomic variations of the sphenoid sinus and related bony and neurovascular structures. Coronal and axial tomographic sections were obtained with 2.5-mm section thickness. We assessed the protrusion of the internal carotid artery (ICA) and the optic nerve (ON) into the sphenoid sinus, bone dehiscence of these structures, and pneumatization of the anterior clinoid process (ACP) and pterygoid recess (PR), as well as the variations of the sphenoid sinus septum. The protrusion of the ICA into the sphenoid sinus was found in 24 (26.1 %) patients. An ON protrusion was present in 29 (31.5 %) patients. Pneumatization of the PR was encountered in 27 (29.3 %) patients. There was not a statistically significant relationship between the pneumatization of the PR and ICA protrusion into the sphenoid sinus ({chi}{sup 2} = 0.258, p = 0.168). A significant relationship between the ACP pneumatization and protrusion of the ON into the sphenoid sinus was found ({chi}{sup 2} = 0.481, p = 0.007). Preoperative recognition of the anatomic variations by the radiologist is beneficial for identification of the limits of dissection. This is particularly important in the sphenoid sinus area where extensive pneumatization of the skull base bones may distort the anatomic configuration. Therefore, axial and coronal CT sections should always be obtained prior to any surgery in the sphenoid sinus area. (orig.)

  2. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  3. MEFV gene variations in patients with systemic lupus erythematosus.

    Science.gov (United States)

    Erer, Burak; Cosan, Fulya; Oku, Basar; Ustek, Duran; Inanc, Murat; Aral, Orhan; Gul, Ahmet

    2014-01-01

    The aim of this study was to investigate the frequency of familial Mediterranean fever (FMF)-associated MEFV gene variations in patients with systemic lupus erythematosus (SLE). The study group comprised 190 SLE patients and 101 healthy controls of Turkish origin with no clinical features of FMF. All individuals were genotyped for the four most common MEFV gene variations (M694V, M680I, V726A and E148Q) by PCR-restriction fragment length polymorphism analysis. The frequency of carrying any of the four MEFV gene variations under study was 15 % in patients with SLE and 10 % in the healthy controls (p = 0.23). After the exclusion of the less penetrant E148Q variation, re-analysis for the three penetrant mutations revealed a significant association between exon 10 variations and pericarditis [p = 0.038, odds ratio (OR) 3.5, 95 % confidence interval (CI) 1.0-12.1], and pleural effusion (p = 0.043, OR 5.2, 95 % CI 0.8-30.9). No significant association was detected between the MEFV gene variations and a higher acute phase response. The MEFV gene variations analyzed in our study do not seem to increase the overall susceptibility to SLE and do not have any strong association with its clinical manifestations. The possibility of a modest effect of penetrant exon 10 MEFV variants on the development of serosal effusions needs to be explored in a larger series of patients.

  4. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  5. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  6. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    , conidia are produced and discharged when humidity gets high—usually during night. In an earlier secretome study of field-collected grain aphids (Sitobion avenae) infected with entomophthoralean fungi, a number of pathogenesis-related, secreted enzymes were discovered (Fungal Genetics and Biology 2011, vol...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  7. Fine Structure Constant: Theme With Variations

    CERN Document Server

    Bezerra, V B; Muniz, C R; Tahim, M O; Vieira, H S

    2016-01-01

    In this paper, we study the spatial variation of the fine structure constant $\\alpha$ due to the presence of a static and spherically symmetric gravitational source. The procedure consists of calculating the solution including the energy eigenvalues of a massive scalar field around that source, considering the weak-field regimen, which yields the gravitational analog of the atomic Bohr levels. From this result, we obtain several values for the effective $\\alpha$ by considering some scenarios of semi-classical and quantum gravities. Constraints on the parameters of the involved theories are calculated from astrophysical observations of the white dwarf emission spectra. Such constraints are compared with those ones obtained in the literature.

  8. Population structure and gene flow of the Atlantic walrus ( Odobenus rosmarus rosmarus ) in the eastern Atlantic Arctic based on mitochondrial DNA and microsatellite variation

    DEFF Research Database (Denmark)

    Andersen, L.W.; Born, E.W.; Gjertz, I.;

    1998-01-01

    The population structure of the Atlantic walrus, Odobenus rosmarus rosmarus, was studied using 11 polymorphic microsatellites and restriction fragment length polymorphism detected in the NADH-dehydrogenase ND1, ND2 and ND3/4 segments in mtDNA. A total of 105 walrus samples were analysed from nort...

  9. Variational approach for static mirror structures

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, E. A. [P.N. Lebedev Physical Institute RAS, 53 Leninsky Ave., 119991 Moscow (Russian Federation); Space Research Institute RAS, 84/32 Profsoyuznaya str., 117997 Moscow (Russian Federation); L.D. Landau Institute for Theoretical Physics RAS, 2 Kosygin str., 119334 Moscow (Russian Federation); Passot, T.; Sulem, P. L. [UNS, CNRS, Observatoire de la Côte d' Azur, CS 34229, 06304 Nice Cedex 4 (France); Ruban, V. P. [L.D. Landau Institute for Theoretical Physics RAS, 2 Kosygin str., 119334 Moscow (Russian Federation)

    2015-04-15

    Anisotropic static plasma equilibria where the parallel and perpendicular pressures are only functions of the amplitude of the local magnetic field are shown to be amenable to a variational principle with a free energy density given by the parallel tension. This approach is used to demonstrate that two-dimensional small-amplitude static magnetic holes constructed from a Grad-Shafranov type equation slightly below the (subcritical) mirror instability threshold identify with lump solitons of KPII equation, but turn out to be unstable. Differently, large-amplitude magnetic structures, which are stable as they realize a minimum of the free energy, are computed using a gradient method within two-dimensional numerical simulations where the regularizing effect of finite Larmor radius corrections is retained. Interestingly, these structures transform from stripes to bubbles when the angle of the magnetic field with the coordinate plane is increased.

  10. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-03-11

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations.

  11. Total Variation and Multisymplectic Structure for CNLS System

    Institute of Scientific and Technical Information of China (English)

    SUN Jian-Qiang; QIN Meng-Zhao; LIU Ting-Ting

    2006-01-01

    The relation between the total variation of classical field theory and the multisymplectic structure is shown. Then the multisymplectic structure and the corresponding multisymplectic conservation of the coupled nonlinear Schrodinger system are obtained directly from the variational principle.

  12. Variation in the Major Surface Glycoprotein Genes in Pneumocystis jirovecii

    Science.gov (United States)

    Kutty, Geetha; Maldarelli, Frank; Achaz, Guillaume; Kovacs, Joseph A.

    2008-01-01

    The genome of Pneumocystis, which causes life-threatening pneumonia in immunosuppressed patients, contains a multi-copy gene family that encodes the major surface glycoprotein (Msg). Pneumocystis can vary the expressed Msg, presumably as a mechanism to avoid host immune responses. Analysis of 24 msg gene sequences obtained from a single human Pneumocystis isolate demonstrated that the sequences segregate into two branches. Based on a number of analyses, recombination among msg genes appears to be an important mechanism for generating msg diversity. Intra-branch recombination occurred more frequently than inter-branch recombination. Restriction fragment length polymorphism analysis demonstrated substantial variation in the repertoire of the msg gene family among isolates of human Pneumocystis, which was not observed in laboratory isolates of rat or mouse Pneumocystis; this may be the result of examining outbred vs. captive populations. Increased diversity in the Msg repertoire, generated in part by recombination, increases the potential for antigenic variation in this abundant surface protein. PMID:18627244

  13. Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment

    Science.gov (United States)

    Xu, Qin; Zhu, Caiyun; Fan, Yangyang; Song, Zhihong; Xing, Shilai; Liu, Wei; Yan, Juan; Sang, Tao

    2016-01-01

    Expression variation plays an important role in plant adaptation, but little is known about the factors impacting the expression variation when population adapts to changing environment. We used RNA-seq data from 80 individuals in 14 Miscanthus lutarioriparius populations, which were transplanted into a harsh environment from native habitat, to investigate the expression level, expression diversity and genetic diversity for genes expressed in both environments. The expression level of genes with lower expression level or without SNP tended to be more changeable in new environment, which suggested highly expressed genes experienced stronger purifying selection than those at lower level. Low proportion of genes with population effect confirmed the weak population structure and frequent gene flow in these populations. Meanwhile, the number of genes with environment effect was the most frequent compared with that with population effect. Our results showed that environment and genetic diversity were the main factors determining gene expression variation in population. This study could facilitate understanding the mechanisms of global gene expression variation when plant population adapts to changing environment. PMID:27150248

  14. Insights into structural variations and genome rearrangements in prokaryotic genomes.

    Science.gov (United States)

    Periwal, Vinita; Scaria, Vinod

    2015-01-01

    Structural variations (SVs) are genomic rearrangements that affect fairly large fragments of DNA. Most of the SVs such as inversions, deletions and translocations have been largely studied in context of genetic diseases in eukaryotes. However, recent studies demonstrate that genome rearrangements can also have profound impact on prokaryotic genomes, leading to altered cell phenotype. In contrast to single-nucleotide variations, SVs provide a much deeper insight into organization of bacterial genomes at a much better resolution. SVs can confer change in gene copy number, creation of new genes, altered gene expression and many other functional consequences. High-throughput technologies have now made it possible to explore SVs at a much refined resolution in bacterial genomes. Through this review, we aim to highlight the importance of the less explored field of SVs in prokaryotic genomes and their impact. We also discuss its potential applicability in the emerging fields of synthetic biology and genome engineering where targeted SVs could serve to create sophisticated and accurate genome editing.

  15. Importance of Local Structural Variations on Recrystallization

    DEFF Research Database (Denmark)

    Juul Jensen, Dorte; Lin, Fengxiang; Zhang, Yubin

    2013-01-01

    Effects of local variations in the deformation microstructure on subsequent recrystallization are discussed and illustrated by three examples. The three examples consider local variations on different length scales and are: 1. Effects of local variations in the deformation microstructure on the f...... on the formation of protrusions on migrating boundaries. 2. Effects of an inhomogeneous spatial distribution of second phase particles on growth. 3. Effects of stored energy and orientation variations on recrystallization kinetics. © (2013) Trans Tech Publications, Switzerland....

  16. Structural variation of chromosomes in autism spectrum disorder.

    Science.gov (United States)

    Marshall, Christian R; Noor, Abdul; Vincent, John B; Lionel, Anath C; Feuk, Lars; Skaug, Jennifer; Shago, Mary; Moessner, Rainald; Pinto, Dalila; Ren, Yan; Thiruvahindrapduram, Bhooma; Fiebig, Andreas; Schreiber, Stefan; Friedman, Jan; Ketelaars, Cees E J; Vos, Yvonne J; Ficicioglu, Can; Kirkpatrick, Susan; Nicolson, Rob; Sloman, Leon; Summers, Anne; Gibbons, Clare A; Teebi, Ahmad; Chitayat, David; Weksberg, Rosanna; Thompson, Ann; Vardy, Cathy; Crosbie, Vicki; Luscombe, Sandra; Baatjes, Rebecca; Zwaigenbaum, Lonnie; Roberts, Wendy; Fernandez, Bridget; Szatmari, Peter; Scherer, Stephen W

    2008-02-01

    Structural variation (copy number variation [CNV] including deletion and duplication, translocation, inversion) of chromosomes has been identified in some individuals with autism spectrum disorder (ASD), but the full etiologic role is unknown. We performed genome-wide assessment for structural abnormalities in 427 unrelated ASD cases via single-nucleotide polymorphism microarrays and karyotyping. With microarrays, we discovered 277 unbalanced CNVs in 44% of ASD families not present in 500 controls (and re-examined in another 1152 controls). Karyotyping detected additional balanced changes. Although most variants were inherited, we found a total of 27 cases with de novo alterations, and in three (11%) of these individuals, two or more new variants were observed. De novo CNVs were found in approximately 7% and approximately 2% of idiopathic families having one child, or two or more ASD siblings, respectively. We also detected 13 loci with recurrent/overlapping CNV in unrelated cases, and at these sites, deletions and duplications affecting the same gene(s) in different individuals and sometimes in asymptomatic carriers were also found. Notwithstanding complexities, our results further implicate the SHANK3-NLGN4-NRXN1 postsynaptic density genes and also identify novel loci at DPP6-DPP10-PCDH9 (synapse complex), ANKRD11, DPYD, PTCHD1, 15q24, among others, for a role in ASD susceptibility. Our most compelling result discovered CNV at 16p11.2 (p = 0.002) (with characteristics of a genomic disorder) at approximately 1% frequency. Some of the ASD regions were also common to mental retardation loci. Structural variants were found in sufficiently high frequency influencing ASD to suggest that cytogenetic and microarray analyses be considered in routine clinical workup.

  17. Exploiting natural variation to identify insect-resistance genes.

    Science.gov (United States)

    Broekgaarden, Colette; Snoeren, Tjeerd A L; Dicke, Marcel; Vosman, Ben

    2011-10-01

    Herbivorous insects are widespread and often serious constraints to crop production. The use of insect-resistant crops is a very effective way to control insect pests in agriculture, and the development of such crops can be greatly enhanced by knowledge on plant resistance mechanisms and the genes involved. Plants have evolved diverse ways to cope with insect attack that has resulted in natural variation for resistance towards herbivorous insects. Studying the molecular genetics and transcriptional background of this variation has facilitated the identification of resistance genes and processes that lead to resistance against insects. With the development of new technologies, molecular studies are not restricted to model plants anymore. This review addresses the need to exploit natural variation in resistance towards insects to increase our knowledge on resistance mechanisms and the genes involved. We will discuss how this knowledge can be exploited in breeding programmes to provide sustainable crop protection against insect pests. Additionally, we discuss the current status of genetic research on insect-resistance genes. We conclude that insect-resistance mechanisms are still unclear at the molecular level and that exploiting natural variation with novel technologies will contribute greatly to the development of insect-resistant crop varieties.

  18. Chromatin structure regulates gene conversion.

    Directory of Open Access Journals (Sweden)

    W Jason Cummings

    2007-10-01

    Full Text Available Homology-directed repair is a powerful mechanism for maintaining and altering genomic structure. We asked how chromatin structure contributes to the use of homologous sequences as donors for repair using the chicken B cell line DT40 as a model. In DT40, immunoglobulin genes undergo regulated sequence diversification by gene conversion templated by pseudogene donors. We found that the immunoglobulin Vlambda pseudogene array is characterized by histone modifications associated with active chromatin. We directly demonstrated the importance of chromatin structure for gene conversion, using a regulatable experimental system in which the heterochromatin protein HP1 (Drosophila melanogaster Su[var]205, expressed as a fusion to Escherichia coli lactose repressor, is tethered to polymerized lactose operators integrated within the pseudo-Vlambda donor array. Tethered HP1 diminished histone acetylation within the pseudo-Vlambda array, and altered the outcome of Vlambda diversification, so that nontemplated mutations rather than templated mutations predominated. Thus, chromatin structure regulates homology-directed repair. These results suggest that histone modifications may contribute to maintaining genomic stability by preventing recombination between repetitive sequences.

  19. Copy number variations exploration of multiple genes in Graves' disease.

    Science.gov (United States)

    Song, Rong-Hua; Shao, Xiao-Qing; Li, Ling; Wang, Wen; Zhang, Jin-An

    2017-01-01

    Few previous published papers reported copy number variations of genes could affect the predisposition of Graves' disease (GD). Herein, the aim of this study was to explore the association between copy number variations (CNV) profile and GD. The preliminary copy number microarray used to screen copy number variant genes was performed in 6 GD patients. Five CNV candidate genes (CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17) were then validated in an independent set of samples (50 GD patients and 50 matched healthy ones) by the Accucopy assay method. The CNV of the other 2 genes TRY6 and CCL3L1 was investigated in 144 GD patients and 144 healthy volunteers by the definitive genotyping technique using the Taqman quantitative polymerase-chain-reaction (Taqman qPCR). TRY6 gene-associated single nucleotide polymorphism (SNP), rs13230029, was genotyped by the PCR-ligase detection reaction (LDR) in 675 GD patients and 898 healthy controls. There were no correlation of the gene copy number (GCN) of CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17 with GD. In comparison with that of controls, the GCN distribution of TRY6 and CCL3L1 in GD patients did not show significantly differ (P > 0.05). Furthermore, TRY6-related polymorphism (rs13230029) showed no difference between GD patients and controls. No correlation was found between CNV or SNP genotype and clinical phenotypes. Generally, there were no link of the copy numbers of several genes, including CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1 to GD. Our results clearly indicated that the copy number variations of multiple genes, namely CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1, were not associated with the development of GD.

  20. The challenges and importance of structural variation detection in livestock

    Directory of Open Access Journals (Sweden)

    Derek M Bickhart

    2014-02-01

    Full Text Available Recent studies in humans and other model organisms have demonstrated that structural variants (SVs comprise a substantial proportion of variation among individuals of each species. Many of these variants have been linked to debilitating diseases in humans, thereby cementing the importance of refining methods for their detection. Despite progress in the field, reliable detection of SVs still remains a problem even for human subjects. Many of the underlying problems that make SVs difficult to detect in humans are amplified in livestock species, whose lower quality genome assemblies and incomplete gene annotation can often give rise to false positive SV discoveries. Regardless of the challenges, SV detection is just as important for livestock researchers as it is for human researchers, given that several productive traits and diseases have been linked to Copy Number Variations (CNVs in cattle, sheep and pig. Already, there is evidence that many beneficial SVs have been artificially selected in livestock such as a duplication of the ASIP gene that causes white coat color in sheep. In this review, we will list current SV and CNV discoveries in livestock and discuss the problems that hinder routine discovery and tracking of these polymorphisms. We will also discuss the impacts of selective breeding on CNV and SV frequencies and mention how SV genotyping could be used in the future to improve genetic selection.

  1. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2012-06-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is transformed via the didactic transposition into school science textbooks. The results indicate that a common textbook discourse on genes and their function exist in textbooks from the different countries. The structure of science as represented by conceptual variation and the use of multiple models was present in all the textbooks. However, the existence of conceptual variation and multiple models is implicit in these textbooks, i.e., the phenomenon of conceptual variation and multiple models are not addressed explicitly, nor its consequences and, thus, it ends up introducing conceptual incoherence about the gene concept and its function within the textbooks. We conclude that within the found textbook-discourse ontological aspects of the academic disciplines of genetics and molecular biology were retained, but without their epistemological underpinnings; these are lost in the didactic transposition. These results are of interest since students might have problems reconstructing the correct scientific understanding from the transformed school science knowledge as depicted within the high school textbooks. Implications for textbook writing as well as teaching are discussed in the paper.

  2. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  3. Variation in the RAD51 gene and familial breast cancer

    Science.gov (United States)

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  4. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Science.gov (United States)

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution.

  5. Looking on the bright side of serotonin transporter gene variation.

    Science.gov (United States)

    Homberg, Judith R; Lesch, Klaus-Peter

    2011-03-15

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for depression in interaction with psychosocial adversity across the life span. However, genetically driven deficient serotonin transporter (5-HTT) function would not have been maintained throughout evolution if it only exerted negative effects without conveying any gain of function. Here, we review recent findings that humans and nonhuman primates carrying the s variant of the 5-HTTLPR outperform subjects carrying the long allele in an array of cognitive tasks and show increased social conformity. In addition, studies in 5-HTT knockout rodents are included that provide complementary insights in the beneficial effects of the 5-HTTLPR s-allele. We postulate that hypervigilance, mediated by hyperactivity in corticolimbic structures, may be the common denominator in the anxiety-related traits and (social) cognitive superiority of s-allele carriers and that environmental conditions determine whether a response will turn out to be negative (emotional) or positive (cognitive, in conformity with the social group). Taken together, these findings urge for a conceptual change in the current deficit-oriented connotation of the 5-HTTLPR variants. In fact, these factors may counterbalance or completely offset the negative consequences of the anxiety-related traits. This notion may not only explain the modest effect size of the 5-HTTLPR and inconsistent reports but may also lead to a more refined appreciation of allelic variation in 5-HTT function. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  6. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin;

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  7. Genomic and gene variation in Mycoplasma hominis strains

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Andersen, H; Birkelund, Svend

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed...... no identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns....... These hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  8. Hypertension and genetic variation in endothelial-specific genes.

    Directory of Open Access Journals (Sweden)

    Erik Larsson

    Full Text Available Genome-wide association (GWA studies usually detect common genetic variants with low-to-medium effect sizes. Many contributing variants are not revealed, since they fail to reach significance after strong correction for multiple comparisons. The WTCCC study for hypertension, for example, failed to identify genome-wide significant associations. We hypothesized that genetic variation in genes expressed specifically in the endothelium may be important for hypertension development. Results from the WTCCC study were combined with previously published gene expression data from mice to specifically investigate SNPs located within endothelial-specific genes, bypassing the requirement for genome-wide significance. Six SNPs from the WTCCC study were selected for independent replication in 5205 hypertensive patients and 5320 population-based controls, and successively in a cohort of 16,537 individuals. A common variant (rs10860812 in the DRAM (damage-regulated autophagy modulator locus showed association with hypertension (P = 0.008 in the replication study. The minor allele (A had a protective effect (OR = 0.93; 95% CI 0.88-0.98 per A-allele, which replicates the association in the WTCCC GWA study. However, a second follow-up, in the larger cohort, failed to reveal an association with blood pressure. We further tested the endothelial-specific genes for co-localization with a panel of newly discovered SNPs from large meta-GWAS on hypertension or blood pressure. There was no significant overlap between those genes and hypertension or blood pressure loci. The result does not support the hypothesis that genetic variation in genes expressed in endothelium plays an important role for hypertension development. Moreover, the discordant association of rs10860812 with blood pressure in the case control study versus the larger Malmö Preventive Project-study highlights the importance of rigorous replication in multiple large independent studies.

  9. Child Development and Structural Variation in the Human Genome

    Science.gov (United States)

    Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

    2013-01-01

    Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

  10. Structural variation of chromosomes in autism spectrum disorder

    NARCIS (Netherlands)

    Marshall, Christian R.; Noor, Abdul; Vincent, John B.; Lionel, Anath C.; Feuk, Lars; Skaug, Jennifer; Shago, Mary; Moessner, Rainald; Pinto, Dalila; Ren, Yan; Thiruvahindrapduram, Bhoorna; Fiebig, Andreas; Schreiber, Stefan; Friedman, Jan; Ketelaars, Cees E. J.; Vos, Yvonne J.; Ficicioglu, Can; Kirkpatrick, Susan; Nicolson, Rob; Sloman, Leon; Surnmers, Anne; Gibbons, Clare A.; Teebi, Ahmad; Chitayat, David; Weksberg, Rosanna; Thompson, Ann; Vardy, Cathy; Crosbie, Vicki; Luscombe, Sandra; Baatjes, Rebecca; Zwaigenbaum, Lonnie; Roberts, Wendy; Fernandez, Bridget; Szatmari, Peter; Scherer, Stephen W.

    2008-01-01

    Structural variation (copy number variation [CNV] including deletion and duplication, translocation, inversion) of chromosomes has been identified in some individuals with autism spectrum disorder (ASD), but the full etiologic role is unknown. We performed genome-wide assessment for structural abnor

  11. Search for Possible Variation of the Fine Structure Constant

    OpenAIRE

    2003-01-01

    Determination of the fine structure constant alpha and search for its possible variation are considered. We focus on a role of the fine structure constant in modern physics and discuss precision tests of quantum electrodynamics. Different methods of a search for possible variations of fundamental constants are compared and those related to optical measurements are considered in detail.

  12. Child Development and Structural Variation in the Human Genome

    Science.gov (United States)

    Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

    2013-01-01

    Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

  13. 木薯 MeNCED3基因克隆、结构变异及其表达分析%Cloning and Analysis of Structure Variation and Expression of MeNCED3 Gene in Cassava

    Institute of Scientific and Technical Information of China (English)

    丁泽红; 付莉莉; 铁韦韦; 颜彦; 胡伟

    2016-01-01

    旨在揭示木薯 MeNCED3基因在干旱等非生物胁迫应答中的作用。用 RT-PCR 的方法从木薯叶片中克隆 MeNCED3基因,用 MEGA 软件构建进化树;用 DnaSP 软件分析基因结构变异,用荧光定量 PCR 技术分析 MeNCED3在不同非生物胁迫下的表达特性。结果显示,从木薯中克隆了一个 NCED 基因 MeNCED3,该基因具有1803 bp 的开放阅读框,编码600个氨基酸,含有 NCED 家族保守结构域。进化树分析表明,MeNCED3与杨树和杞柳中同源基因的亲缘关系较近,序列相似性分别达到83.9%和82.5%。基因结构变异发现,木薯野生种和栽培种之间共有8个错义突变,其中5个可能与 MeNCED3的表达量有关。实时荧光定量 PCR 分析表明,MeNCED3在根中的表达量要远远高于叶片和茎。而且,MeNCED3的表达能被 PEG、ABA 和 NaCl 处理显著诱导。因此,MeNCED3在转录水平对木薯渗透胁迫、盐胁迫起调控作用,可作为候选基因进一步研究其在木薯抗旱中的功能。%To reveal the roles of MeNCED3 gene in abiotic stresses(e.g.,drought)in cassava. RT-PCR method was applied to clone MeNCED3 gene from cassava leaves,MEGA software was used to construct its phylogenetic tree,DnaSP software was used to analysis its structural variation,and quantitative RT-PCR(qRT-PCR)was used to explore its expression patterns in response to different abiotic stresses. Results showed that a NCED(9-cis-epoxycarotenoid dioxygenase)gene,MeNCED3,was cloned from cassava. This gene had a 1 803 bp open reading frame,encoded 600 amino acids,and contained a NCED conserved domain. Phylogenetic analysis showed that MeNCED3 had close genetic relationship with its homologs from Populus trichocarpa and Salix purpurea,and the sequence similarity was up to 83.9% and 82.5%,respectively. Genetic structural variation revealed that a total of eight mis-sense mutations were identified between wild and cultivated cassava species,of which

  14. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  15. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  16. Extensive Natural Variation in Arabidopsis Seed Mucilage Structure

    Directory of Open Access Journals (Sweden)

    Cătălin eVoiniciuc

    2016-06-01

    Full Text Available Hydrated Arabidopsis thaliana seeds are coated by a gelatinous layer called mucilage, which is mainly composed of cell wall polysaccharides. Since mucilage is rich in pectin, its architecture can be visualized with the ruthenium red (RR dye. We screened the seeds of around 280 Arabidopsis natural accessions for variation in mucilage structure, and identified a large number of novel variants that differed from the Col-0 wild-type. Most of the accessions released smaller RR-stained capsules compared to the Col-0 reference. By biochemically characterizing the phenotypes of 25 of these accessions in greater detail, we discovered that distinct changes in polysaccharide structure resulted in gelatinous coatings with a deceptively similar appearance. Monosaccharide composition analysis of total mucilage extracts revealed a remarkable variation (from 50% to 200% of Col-0 levels in the content of galactose and mannose, which are important subunits of heteromannan. In addition, most of the natural variants had altered Pontamine Fast Scarlet 4B staining of cellulose and significantly reduced birefringence of crystalline structures. This indicates that the production or organization of cellulose may be affected by the presence of different amounts of hemicellulose. Although the accessions described in this study were primarily collected from Western Europe, they form five different phenotypic classes based on the combined results of our experiments. This suggests that polymorphisms at multiple loci are likely responsible for the observed mucilage structure. The transcription of MUCILAGE-RELATED10 (MUCI10, which encodes a key enzyme for galactoglucomannan synthesis, was severely reduced in multiple variants that phenocopied the muci10-1 insertion mutant. Although we could not pinpoint any causal polymorphisms in this gene, constitutive expression of fluorescently-tagged MUCI10 proteins complemented the mucilage defects of a muci10-like accession. This leads

  17. PAX6 gene variations associated with aniridia in south India

    Directory of Open Access Journals (Sweden)

    Shashikant Shetty

    2004-04-01

    Full Text Available Abstract Background Mutations in the transcription factor gene PAX6 have been shown to be the cause of the aniridia phenotype. The purpose of this study was to analyze patients with aniridia to uncover PAX6 gene mutations in south Indian population. Methods Total genomic DNA was isolated from peripheral blood of twenty-eight members of six clinically diagnosed aniridia families and 60 normal healthy controls. The coding exons of the human PAX6 gene were amplified by PCR and allele specific variations were detected by single strand conformation polymorphism (SSCP followed by automated sequencing. Results The sequencing results revealed novel PAX6 mutations in three patients with sporadic aniridia: c.715ins5, [c.1201delA; c.1239A>G] and c.901delA. Two previously reported nonsense mutations were also found: c.482C>A, c.830G>A. A neutral polymorphism was detected (IVS9-12C>T at the boundary of intron 9 and exon 10. The two nonsense mutations found in the coding region of human PAX6 gene are reported for the first time in the south Indian population. Conclusion The genetic analysis confirms that haploinsuffiency of the PAX6 gene causes the classic aniridia phenotype. Most of the point mutations detected in our study results in stop codons. Here we add three novel PAX6 gene mutations in south Indian population to the existing spectrum of mutations, which is not a well-studied ethnic group. Our study supports the hypothesis that a mutation in the PAX6 gene correlates with expression of aniridia.

  18. Phenotypic impact of genomic structural variation

    DEFF Research Database (Denmark)

    Weischenfeldt, Joachim; Symmons, Orsolya; Spitz, François;

    2013-01-01

    Genomic structural variants have long been implicated in phenotypic diversity and human disease, but dissecting the mechanisms by which they exert their functional impact has proven elusive. Recently however, developments in high-throughput DNA sequencing and chromosomal engineering technology have...... facilitated the analysis of structural variants in human populations and model systems in unprecedented detail. In this Review, we describe how structural variants can affect molecular and cellular processes, leading to complex organismal phenotypes, including human disease. We further present advances...

  19. Diurnal variation of hepatic antioxidant gene expression in mice.

    Directory of Open Access Journals (Sweden)

    Yi-Qiao Xu

    Full Text Available BACKGROUND: This study was aimed to examine circadian variations of hepatic antioxidant components, including the Nrf2- pathway, the glutathione (GSH system, antioxidant enzymes and metallothionein in mouse liver. METHODS AND RESULTS: Adult mice were housed in light- and temperature-controlled facilities for 2 weeks, and livers were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis. Hepatic mRNA levels of Nrf2, Keap1, Nqo1 and Gclc were higher in the light-phase than the dark-phase, and were female-predominant. Hepatic GSH presented marked circadian fluctuations, along with glutathione S-transferases (GST-α1, GST-µ, GST-π and glutathione peroxidase (GPx1. The expressions of GPx1, GST-µ and GST-π mRNA were also higher in females. Antioxidant enzymes Cu/Zn superoxide dismutase (Sod1, catalase (CAT, cyclooxygenase-2 (Cox-2 and heme oxygenase-1 (Ho-1 showed circadian rhythms, with higher expressions of Cox-2 and CAT in females. Metallothionein, a small non-enzymatic antioxidant protein, showed dramatic circadian variation in males, but higher expression in females. The circadian variations of the clock gene Brain and Muscle Arnt-like Protein-1(Bmal1, albumin site D-binding protein (Dbp, nuclear receptor Rev-Erbα (Nr1d1, period protein (Per1 and Per2 and cryptochrome 1(Cry1 were in agreement with the literature. Furthermore, acetaminophen hepatotoxicity is more severe when administered in the afternoon when hepatic GSH was lowest. CONCLUSIONS: Circadian variations and gender differences in transcript levels of antioxidant genes exist in mouse liver, which could affect body responses to oxidative stress at different times of the day.

  20. Making the difference: integrating structural variation detection tools.

    Science.gov (United States)

    Lin, Ke; Smit, Sandra; Bonnema, Guusje; Sanchez-Perez, Gabino; de Ridder, Dick

    2015-09-01

    From prokaryotes to eukaryotes, phenotypic variation, adaptation and speciation has been associated with structural variation between genomes of individuals within the same species. Many computer algorithms detecting such variations (callers) have recently been developed, spurred by the advent of the next-generation sequencing technology. Such callers mainly exploit split-read mapping or paired-end read mapping. However, as different callers are geared towards different types of structural variation, there is still no single caller that can be considered a community standard; instead, increasingly the various callers are combined in integrated pipelines. In this article, we review a wide range of callers, discuss challenges in the integration step and present a survey of pipelines used in population genomics studies. Based on our findings, we provide general recommendations on how to set-up such pipelines. Finally, we present an outlook on future challenges in structural variation detection.

  1. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  2. AGTR1 gene variation: association with depression and frontotemporal morphology.

    Science.gov (United States)

    Taylor, Warren D; Benjamin, Sophiya; McQuoid, Douglas R; Payne, Martha E; Krishnan, Ranga R; MacFall, James R; Ashley-Koch, Allison

    2012-05-31

    The renin-angiotensin system (RAS) is implicated in the response to physiological and psychosocial stressors, but its role in stress-related psychiatric disorders is poorly understood. We examined if variation in AGTR1, the gene coding for the type 1 angiotensin II receptor (AT(1)R), is associated with a diagnosis of depression and differences in white matter hyperintensities and frontotemporal brain volumes. Participants comprised 257 depressed and 116 nondepressed elderly Caucasian subjects who completed clinical assessments and provided blood samples for genotyping. We used a haplotype-tagging single nucleotide polymorphism (htSNP) analysis to test for variation in AGTR1. For measurement of hyperintense lesions, 1.5 Tesla magnetic resonance imaging (MRI) data were available on 33 subjects. For measurements of the hippocampus and dorsolateral prefrontal cortex (dlPFC), 3 Tesla MRI data were available on 70 subjects. Two htSNPs exhibited statistically significant frequency differences between diagnostic cohorts: rs10935724 and rs12721331. Although hyperintense lesion volume did not significantly differ by any htSNP, dlPFC and hippocampus volume differed significantly for several htSNPs. Intriguingly, for those htSNPs differing significantly for both dlPFC and hippocampus volume, the variant associated with smaller dlPFC volume was associated with larger hippocampal volume. This supports the idea that genetic variation in AGTR1 is associated with depression and differences in frontotemporal morphology. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  3. Patterns of variation among distinct alleles of the Flag silk gene from Nephila clavipes.

    Science.gov (United States)

    Higgins, Linden E; White, Sheryl; Nuñez-Farfán, Juan; Vargas, Jesus

    2007-02-20

    Spider silk proteins and their genes are very attractive to researchers in a wide range of disciplines because they permit linking many levels of organization. However, hypotheses of silk gene evolution have been built primarily upon single sequences of each gene each species, and little is known about allelic variation within a species. Silk genes are known for their repeat structure with high levels of homogenization of nucleotide and amino acid sequence among repeated units. One common explanation for this homogeneity is gene convergence. To test this model, we sequenced multiple alleles of one intron-exon segment from the Flag gene from four populations of the spider Nephila clavipes and compared the new sequences to a published sequence. Our analysis revealed very high levels of heterozygosity in this gene, with no pattern of population differentiation. There was no evidence of gene convergence within any of these alleles, with high levels of nucleotide and amino acid substitution among the repeating motifs. Our data suggest that minimally, there is relaxed selection on mutations in this gene and that there may actually be positive selection for heterozygosity.

  4. Prototype Schemas, Variation Theory, and the Structural Syllabus.

    Science.gov (United States)

    Adamson, H. D.

    1990-01-01

    A review of theories and research regarding cognitive psychology and second-language acquisition discusses Krashen's monitor model (1982), Pienemann's teachability hypothesis (1985), variation theory, the structural syllabus, and grammatical prototypes. (29 references) (CB)

  5. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  6. Algorithm of detecting structural variations in DNA sequences

    Science.gov (United States)

    Nałecz-Charkiewicz, Katarzyna; Nowak, Robert

    2014-11-01

    Whole genome sequencing enables to use the longest common subsequence algorithm to detect genetic structure variations. We propose to search position of short unique fragments, genetic markers, to achieve acceptable time and space complexity. The markers are generated by algorithms searching the genetic sequence or its Fourier transformation. The presented methods are checked on structural variations generated in silico on bacterial genomes giving the comparable or better results than other solutions.

  7. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Science.gov (United States)

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder.

  8. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Onouchi

    Full Text Available Kawasaki disease (KD; MIM#61175 is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+ release activated Ca(2+ (CRAC channel mediating store-operated Ca(2+ entry (SOCE on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596 was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls, P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method. Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012. These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+/NFAT pathway in the pathogenesis of this disorder.

  9. Variations in ORAI1 Gene Associated with Kawasaki Disease

    Science.gov (United States)

    Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca2+ release activated Ca2+ (CRAC) channel mediating store-operated Ca2+ entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca2+/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  10. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  11. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  12. Structure of the murine Thy-1 gene

    NARCIS (Netherlands)

    V. Giguere; K-I. Isobe; F.G. Grosveld (Frank)

    1985-01-01

    textabstractWe have cloned the murine Thy-1.1 (AKR) and Thy-1.2 (Balb/c) genes. The complete exon/intron structure and the nucleotide sequence of the Thy-1.2 gene was determined. The gene contains four exons and three intervening sequences. The complete transcriptional unit gives rise to a tissue an

  13. Mitochondrial tRNALeu/Lys and ATPase 6/8 gene variations in spinocerebellar ataxias.

    Science.gov (United States)

    Safaei, Sepideh; Houshmand, Massoud; Banoei, Mohammad Mehdi; Panahi, Mehdi Shafa Shariat; Nafisi, Shahriar; Parivar, Kazem; Rostami, Maryam; Shariati, Parvin

    2009-01-01

    The spinocerebellar ataxias (SCA) comprise a heterogeneous group of severe late-onset neurodegenerative diseases that are promoted by the expansion of a tandem-arrayed DNA sequence that modifies the primary structure of the protein. Genomic DNA of 20 patients affected with SCAs was extracted from peripheral blood and screened for deletions in mitochondrial DNA (mtDNA). Sequencing of tRNA(Leu), tRNA(Lys), cytochrome oxidase II, ATPase 6/8 and NADH dehydrogenase I (NDI) genes belonging to mtDNA from patients with SCAs was also carried out to detect the presence of variations. We identified cytosine-adenine-guanine (CAG) trinucleotide repeat expansions in 20 patients. Seven of these patients had at least one nucleotide change in mtDNA. In such cases, 5 nucleotide variations resulted in amino acid changes with two novel variations T8256G and G9010A. SCA patients showed high levels of mtDNA variations in lymphocytes. It can be proposed that the SCA gene proteins (Ataxins) are involved in the complicated intracellular mechanisms that affect cellular organelles and their components, such as the mitochondrial genome. The instability of CAG repeats in polyglutamine diseases such as SCAs and Huntington's disease might be a causative factor in mtDNA variation or possible damage. Copyright 2008 S. Karger AG, Basel.

  14. Human loci involved in drug biotransformation: worldwide genetic variation, population structure, and pharmacogenetic implications.

    Science.gov (United States)

    Maisano Delser, Pierpaolo; Fuselli, Silvia

    2013-05-01

    Understanding the role of inheritance in individual variation in drug response is the focus of pharmacogenetics (PGx). A key part of this understanding is quantifying the role of genetic ancestry in this phenotypic outcome. To provide insight into the relationship between ethnicity and drug response, this study first infers the global distribution of PGx variation and defines its structure. Second, the study evaluates if geographic population structure stems from all PGx loci in general, or if structure is caused by specific genes. Lastly, we identify the genetic variants contributing the greatest proportion of such structure. Our study describes the global genetic structure of PGx loci across the 52 populations of the Human Genome Diversity Cell-Line Panel, the most inclusive set of human populations freely available for studies on human genetic variation. By analysing genetic variation at 1,001 single nucleotide polymorphisms (SNPs) involved in biotransformation of exogenous substances, we describe the between-populations PGx variation, as well geographical groupings of diversity. In addition, with discriminant analysis of principal component (DAPC), we infer how many and which groups of populations are supported by PGx variation, and identify which SNPs actually contribute to the PGx structure between such groups. Our results show that intergenic, synonymous and non-synonymous SNPs show similar levels of genetic variation across the globe. Conversely, loci coding for Cytochrome P450s (mainly metabolizing exogenous substances) show significantly higher levels of genetic diversity between populations than the other gene categories. Overall, genetic variation at PGx loci correlates with geographic distances between populations, and the apportionment of genetic variation is similar to that observed for the rest of the genome. In other words, the pattern of PGx variation has been mainly shaped by the demographic history of our species, as in the case of most of our

  15. Variation in the Ace Gene in Elite Polish Football Players

    Directory of Open Access Journals (Sweden)

    Cięszczyk Paweł

    2016-12-01

    Full Text Available Purpose. A common polymorphism in the angiotensin converting enzyme I gene (the ACE I/D variant represents one of the first characterized and the most widely studied genetic variants in the context of elite athletes status and performance related traits. The aim of the study was to determine the genotype and allele distribution of the allele and genotype of the ACE gene in Polish male football players. Methods. The total of 106 Polish male professional football players were recruited. They were divided into groups according to the position in the field: forwards, defenders, midfielders, and goalkeepers. For controls, samples were prepared with 115 unrelated volunteers. DNA was extracted from the buccal cells donated by the subjects, and the PCR amplification of the polymorphic region of the ACE gene containing either the insertion (I or deletion (D fragment was performed. Results. The genotype distribution and allele frequencies among all football players did not differ significantly when compared with sedentary control individuals (p = 0.887, p = 0.999, respectively. Likewise, the analysis of forwards, defenders, midfielders, and goalkeepers revealed no significant differences in either ACE genotype or allele frequencies. Conclusions. We did not provide evidence for difference of variation of the ACE I/D polymorphism between Polish football players and controls, as we did not obtain any statistically significantly higher frequency of either of the analysed alleles (I and D or genotypes (DD, ID, and II in the studied subgroups. It may be suspected that harbouring of I/D allelic variants of the ACE gene neither decreases nor increases the probability of being a professional football player in Poland.

  16. Caenorhabditis elegans Genes Affecting Interindividual Variation in Life-span Biomarker Gene Expression.

    Science.gov (United States)

    Mendenhall, Alexander; Crane, Matthew M; Tedesco, Patricia M; Johnson, Thomas E; Brent, Roger

    2017-10-01

    Genetically identical organisms grown in homogenous environments differ in quantitative phenotypes. Differences in one such trait, expression of a single biomarker gene, can identify isogenic cells or organisms that later manifest different fates. For example, in isogenic populations of young adult Caenorhabditis elegans, differences in Green Fluorescent Protein (GFP) expressed from the hsp-16.2 promoter predict differences in life span. Thus, it is of interest to determine how interindividual differences in biomarker gene expression arise. Prior reports showed that the thermosensory neurons and insulin signaling systems controlled the magnitude of the heat shock response, including absolute expression of hsp-16.2. Here, we tested whether these regulatory signals might also influence variation in hsp-16.2 reporter expression. Genetic experiments showed that the action of AFD thermosensory neurons increases interindividual variation in biomarker expression. Further genetic experimentation showed the insulin signaling system acts to decrease interindividual variation in life-span biomarker expression; in other words, insulin signaling canalizes expression of the hsp-16.2-driven life-span biomarker. Our results show that specific signaling systems regulate not only expression level, but also the amount of interindividual expression variation for a life-span biomarker gene. They raise the possibility that manipulation of these systems might offer means to reduce heterogeneity in the aging process. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Genes controlling mimetic colour pattern variation in butterflies.

    Science.gov (United States)

    Nadeau, Nicola J

    2016-10-01

    Butterfly wing patterns are made up of arrays of coloured scales. There are two genera in which within-species variation in wing patterning is common and has been investigated at the molecular level, Heliconius and Papilio. Both of these species have mimetic relationships with other butterfly species that increase their protection from predators. Heliconius have a 'tool-kit' of five genetic loci that control colour pattern, three of which have been identified at the gene level, and which have been repeatedly used to modify colour pattern by different species in the genus. By contrast, the three Papilio species that have been investigated each have different genetic mechanisms controlling their polymorphic wing patterns.

  18. A Variational Monte Carlo Approach to Atomic Structure

    Science.gov (United States)

    Davis, Stephen L.

    2007-01-01

    The practicality and usefulness of variational Monte Carlo calculations to atomic structure are demonstrated. It is found to succeed in quantitatively illustrating electron shielding, effective nuclear charge, l-dependence of the orbital energies, and singlet-tripetenergy splitting and ionization energy trends in atomic structure theory.

  19. Quantitative gene-gene and gene-environment mapping for leaf shape variation using tree-based models

    Science.gov (United States)

    Leaf shape traits have long been a focus of many disciplines, but searching for complex genetic and environmental interactive mechanisms regulating leaf shape variation has not yet been well developed. The question of the respective roles of gene and environment and how they interplay to modulate l...

  20. Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Megan C. McDonald

    2016-04-01

    Full Text Available Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene.

  1. Landscape and variation of RNA secondary structure across the human transcriptome.

    Science.gov (United States)

    Wan, Yue; Qu, Kun; Zhang, Qiangfeng Cliff; Flynn, Ryan A; Manor, Ohad; Ouyang, Zhengqing; Zhang, Jiajing; Spitale, Robert C; Snyder, Michael P; Segal, Eran; Chang, Howard Y

    2014-01-30

    In parallel to the genetic code for protein synthesis, a second layer of information is embedded in all RNA transcripts in the form of RNA structure. RNA structure influences practically every step in the gene expression program. However, the nature of most RNA structures or effects of sequence variation on structure are not known. Here we report the initial landscape and variation of RNA secondary structures (RSSs) in a human family trio (mother, father and their child). This provides a comprehensive RSS map of human coding and non-coding RNAs. We identify unique RSS signatures that demarcate open reading frames and splicing junctions, and define authentic microRNA-binding sites. Comparison of native deproteinized RNA isolated from cells versus refolded purified RNA suggests that the majority of the RSS information is encoded within RNA sequence. Over 1,900 transcribed single nucleotide variants (approximately 15% of all transcribed single nucleotide variants) alter local RNA structure. We discover simple sequence and spacing rules that determine the ability of point mutations to impact RSSs. Selective depletion of 'riboSNitches' versus structurally synonymous variants at precise locations suggests selection for specific RNA shapes at thousands of sites, including 3' untranslated regions, binding sites of microRNAs and RNA-binding proteins genome-wide. These results highlight the potentially broad contribution of RNA structure and its variation to gene regulation.

  2. Gene function prediction based on the Gene Ontology hierarchical structure.

    Science.gov (United States)

    Cheng, Liangxi; Lin, Hongfei; Hu, Yuncui; Wang, Jian; Yang, Zhihao

    2014-01-01

    The information of the Gene Ontology annotation is helpful in the explanation of life science phenomena, and can provide great support for the research of the biomedical field. The use of the Gene Ontology is gradually affecting the way people store and understand bioinformatic data. To facilitate the prediction of gene functions with the aid of text mining methods and existing resources, we transform it into a multi-label top-down classification problem and develop a method that uses the hierarchical relationships in the Gene Ontology structure to relieve the quantitative imbalance of positive and negative training samples. Meanwhile the method enhances the discriminating ability of classifiers by retaining and highlighting the key training samples. Additionally, the top-down classifier based on a tree structure takes the relationship of target classes into consideration and thus solves the incompatibility between the classification results and the Gene Ontology structure. Our experiment on the Gene Ontology annotation corpus achieves an F-value performance of 50.7% (precision: 52.7% recall: 48.9%). The experimental results demonstrate that when the size of training set is small, it can be expanded via topological propagation of associated documents between the parent and child nodes in the tree structure. The top-down classification model applies to the set of texts in an ontology structure or with a hierarchical relationship.

  3. Copy number variations in alternative splicing gene networks impact lifespan.

    Directory of Open Access Journals (Sweden)

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  4. Evolution of variation in presence and absence of genes in bacterial pathways

    Directory of Open Access Journals (Sweden)

    Francis Andrew R

    2012-04-01

    Full Text Available Abstract Background Bacterial genomes exhibit a remarkable degree of variation in the presence and absence of genes, which probably extends to the level of individual pathways. This variation may be a consequence of the significant evolutionary role played by horizontal gene transfer, but might also be explained by the loss of genes through mutation. A challenge is to understand why there would be variation in gene presence within pathways if they confer a benefit only when complete. Results Here, we develop a mathematical model to study how variation in pathway content is produced by horizontal transfer, gene loss and partial exposure of a population to a novel environment. Conclusions We discuss the possibility that variation in gene presence acts as cryptic genetic variation on which selection acts when the appropriate environment occurs. We find that a high level of variation in gene presence can be readily explained by decay of the pathway through mutation when there is no longer exposure to the selective environment, or when selection becomes too weak to maintain the genes. In the context of pathway variation the role of horizontal gene transfer is probably the initial introduction of a complete novel pathway rather than in building up the variation in a genome without the pathway.

  5. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding the...

  6. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Science.gov (United States)

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species.

  7. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    Science.gov (United States)

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama

    2014-01-01

    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  8. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  9. Serotonergic gene variation: implications for personality traits and psychopathology.

    Science.gov (United States)

    Lesch, K P

    1999-06-01

    Serotonin 5-hydroxytryptamine (5-HT) is an important regulator of morphogenetic activities during early central nervous system development, including cell proliferation, migration, and differentiation as well as synapto-genesis. Serotonergic raphe neurons diffusely project to a variety of brain regions (e.g. cortex, amygdala, hippocampus) and play known roles in integrating emotion, cognition, motor function as well as in food intake, sleep, pain, and sexual activity. The diversity of physiologic functions is due to the fact that 5-HT acts as a master control neurotransmitter within a highly complex system of neural communication mediated by multiple pre- and postsynaptic 5-HT receptors, thus orchestrating the activity and interaction of several other neurotransmitter systems. Since proteins involved in the regulation of central serotonergic activity (e.g. enzymes, receptors, transporter) play pivotal role in brain 5-HT homeostasis, polymorphisms in the regulatory regions of their genes resulting in variation of expression and function are likely to influence complex traits, such as temperament/personality and psychopathology.

  10. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  11. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  12. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    Science.gov (United States)

    Scott, Cinda P.; Williams, Dean A.; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory environment (G10). The G10 individuals have significantly less genetic variation than individuals obtained in the field and had a significantly lower variation in mRNA expression across all genes in comparison to the other two groups (p ≤ 0.001). When examining the gene specific variation, twenty-two genes had variation in expression that was significantly different among groups with lower variation in G10 individuals than in acclimated individuals. Additionally, there were fewer genes with significant differences in expression among G10 individuals versus either acclimated or field individuals: 66 genes have statistically different levels of expression versus 107 or 97 for Acclimated or Field groups. Based on the permutation of the data, these differences in the number of genes with significant differences among individuals within a group are unlikely to occur by chance (p < 0.01). Surprisingly, variation in mRNA expression in field individuals is lower than in acclimated individuals. Relative to the variation among individual within a group, few genes have significant differences in expression among groups (seven, 2.3%) and none of these are different between acclimated and field individuals. The results support the concept that genetic variation affects variation in mRNA expression and also suggests that temporal environmental variation associated with estuarine environments does not increase the variation among individuals or add to the differences among groups. PMID

  13. GeneFisher-P: variations of GeneFisher as processes in Bio-jETI

    Science.gov (United States)

    Lamprecht, Anna-Lena; Margaria, Tiziana; Steffen, Bernhard; Sczyrba, Alexander; Hartmeier, Sven; Giegerich, Robert

    2008-01-01

    Background PCR primer design is an everyday, but not trivial task requiring state-of-the-art software. We describe the popular tool GeneFisher and explain its recent restructuring using workflow techniques. We apply a service-oriented approach to model and implement GeneFisher-P, a process-based version of the GeneFisher web application, as a part of the Bio-jETI platform for service modeling and execution. We show how to introduce a flexible process layer to meet the growing demand for improved user-friendliness and flexibility. Results Within Bio-jETI, we model the process using the jABC framework, a mature model-driven, service-oriented process definition platform. We encapsulate remote legacy tools and integrate web services using jETI, an extension of the jABC for seamless integration of remote resources as basic services, ready to be used in the process. Some of the basic services used by GeneFisher are in fact already provided as individual web services at BiBiServ and can be directly accessed. Others are legacy programs, and are made available to Bio-jETI via the jETI technology. The full power of service-based process orientation is required when more bioinformatics tools, available as web services or via jETI, lead to easy extensions or variations of the basic process. This concerns for instance variations of data retrieval or alignment tools as provided by the European Bioinformatics Institute (EBI). Conclusions The resulting service- and process-oriented GeneFisher-P demonstrates how basic services from heterogeneous sources can be easily orchestrated in the Bio-jETI platform and lead to a flexible family of specialized processes tailored to specific tasks. PMID:18460174

  14. Time Variation in Asset Return Dependence: Strength or Structure?

    NARCIS (Netherlands)

    T.D. Markwat (Thijs); H.J.W.G. Kole (Erik); D.J.C. van Dijk (Dick)

    2009-01-01

    textabstractThe dependence between asset returns varies. Its strength can become stronger or weaker. Also, its structure can change, for example, when asymmetries related to bull and bear markets become more or less pronounced. To analyze these different types of variations, we develop a model that

  15. Inter-chromosomal variation in the pattern of human population genetic structure

    Directory of Open Access Journals (Sweden)

    Baye Tesfaye M

    2011-05-01

    Full Text Available Abstract Emerging technologies now make it possible to genotype hundreds of thousands of genetic variations in individuals, across the genome. The study of loci at finer scales will facilitate the understanding of genetic variation at genomic and geographic levels. We examined global and chromosomal variations across HapMap populations using 3.7 million single nucleotide polymorphisms to search for the most stratified genomic regions of human populations and linked these regions to ontological annotation and functional network analysis. To achieve this, we used five complementary statistical and genetic network procedures: principal component (PC, cluster, discriminant, fixation index (FST and network/pathway analyses. At the global level, the first two PC scores were sufficient to account for major population structure; however, chromosomal level analysis detected subtle forms of population structure within continental populations, and as many as 31 PCs were required to classify individuals into homogeneous groups. Using recommended population ancestry differentiation measures, a total of 126 regions of the genome were catalogued. Gene ontology and networks analyses revealed that these regions included the genes encoding oculocutaneous albinism II (OCA2, hect domain and RLD 2 (HERC2, ectodysplasin A receptor (EDAR and solute carrier family 45, member 2 (SLC45A2. These genes are associated with melanin production, which is involved in the development of skin and hair colour, skin cancer and eye pigmentation. We also identified the genes encoding interferon-γ (IFNG and death-associated protein kinase 1 (DAPK1, which are associated with cell death, inflammatory and immunological diseases. An in-depth understanding of these genomic regions may help to explain variations in adaptation to different environments. Our approach offers a comprehensive strategy for analysing chromosome-based population structure and differentiation, and demonstrates the

  16. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    Science.gov (United States)

    Klann, Marleen; Stollewerk, Angelika

    2017-02-24

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  17. Polymorphic genes of major effect: consequences for variation, selection and evolution in Arabidopsis thaliana.

    Science.gov (United States)

    Stinchcombe, John R; Weinig, Cynthia; Heath, Katy D; Brock, Marcus T; Schmitt, Johanna

    2009-07-01

    The importance of genes of major effect for evolutionary trajectories within and among natural populations has long been the subject of intense debate. For example, if allelic variation at a major-effect locus fundamentally alters the structure of quantitative trait variation, then fixation of a single locus can have rapid and profound effects on the rate or direction of subsequent evolutionary change. Using an Arabidopsis thaliana RIL mapping population, we compare G-matrix structure between lines possessing different alleles at ERECTA, a locus known to affect ecologically relevant variation in plant architecture. We find that the allele present at ERECTA significantly alters G-matrix structure-in particular the genetic correlations between branch number and flowering time traits-and may also modulate the strength of natural selection on these traits. Despite these differences, however, when we extend our analysis to determine how evolution might differ depending on the ERECTA allele, we find that predicted responses to selection are similar. To compare responses to selection between allele classes, we developed a resampling strategy that incorporates uncertainty in estimates of selection that can also be used for statistical comparisons of G matrices.

  18. ViVar: a comprehensive platform for the analysis and visualization of structural genomic variation.

    Science.gov (United States)

    Sante, Tom; Vergult, Sarah; Volders, Pieter-Jan; Kloosterman, Wigard P; Trooskens, Geert; De Preter, Katleen; Dheedene, Annelies; Speleman, Frank; De Meyer, Tim; Menten, Björn

    2014-01-01

    Structural genomic variations play an important role in human disease and phenotypic diversity. With the rise of high-throughput sequencing tools, mate-pair/paired-end/single-read sequencing has become an important technique for the detection and exploration of structural variation. Several analysis tools exist to handle different parts and aspects of such sequencing based structural variation analyses pipelines. A comprehensive analysis platform to handle all steps, from processing the sequencing data, to the discovery and visualization of structural variants, is missing. The ViVar platform is built to handle the discovery of structural variants, from Depth Of Coverage analysis, aberrant read pair clustering to split read analysis. ViVar provides you with powerful visualization options, enables easy reporting of results and better usability and data management. The platform facilitates the processing, analysis and visualization, of structural variation based on massive parallel sequencing data, enabling the rapid identification of disease loci or genes. ViVar allows you to scale your analysis with your work load over multiple (cloud) servers, has user access control to keep your data safe and is easy expandable as analysis techniques advance. URL: https://www.cmgg.be/vivar/

  19. ViVar: a comprehensive platform for the analysis and visualization of structural genomic variation.

    Directory of Open Access Journals (Sweden)

    Tom Sante

    Full Text Available Structural genomic variations play an important role in human disease and phenotypic diversity. With the rise of high-throughput sequencing tools, mate-pair/paired-end/single-read sequencing has become an important technique for the detection and exploration of structural variation. Several analysis tools exist to handle different parts and aspects of such sequencing based structural variation analyses pipelines. A comprehensive analysis platform to handle all steps, from processing the sequencing data, to the discovery and visualization of structural variants, is missing. The ViVar platform is built to handle the discovery of structural variants, from Depth Of Coverage analysis, aberrant read pair clustering to split read analysis. ViVar provides you with powerful visualization options, enables easy reporting of results and better usability and data management. The platform facilitates the processing, analysis and visualization, of structural variation based on massive parallel sequencing data, enabling the rapid identification of disease loci or genes. ViVar allows you to scale your analysis with your work load over multiple (cloud servers, has user access control to keep your data safe and is easy expandable as analysis techniques advance. URL: https://www.cmgg.be/vivar/

  20. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  1. FEA of the Variations in Sound Insulation in Nominally Identical Prefabricated Lightweight Timber Panel Structures

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Andersen, Lars

    2013-01-01

    The measurements of sound propagation in buildings usually show a variation between nominally identical constructed structures. These variations can be due to variations in structural properties, measurement uncertainties or workmanship related factors. Better knowledge about the source for these......The measurements of sound propagation in buildings usually show a variation between nominally identical constructed structures. These variations can be due to variations in structural properties, measurement uncertainties or workmanship related factors. Better knowledge about the source...

  2. Time Variation of the Fine Structure Constant Driven by Quintessence

    CERN Document Server

    Anchordoqui, L A; Anchordoqui, Luis; Goldberg, Haim

    2003-01-01

    There are indications from the study of quasar absorption spectra that the fine structure constant $\\alpha$ may have been measurably smaller for redshifts $z>2.$ Analyses of other data ($^{149}$Sm fission rate for the Oklo natural reactor, variation of $^{187}$Re $\\beta$-decay rate in meteorite studies, atomic clock measurements) which probe variations of $\\alpha$ in the more recent past imply much smaller deviations from its present value. In this work we tie the variation of $\\alpha$ to the evolution of the quintessence field proposed by Albrecht and Skordis, and show that agreement with all these data, as well as consistency with WMAP observations, can be achieved for a range of parameters. Some definite predictions follow for upcoming space missions searching for violations of the equivalence principle.

  3. Time variation of the fine structure constant driven by quintessence

    Science.gov (United States)

    Anchordoqui, Luis; Goldberg, Haim

    2003-10-01

    There are indications from the study of quasar absorption spectra that the fine structure constant α may have been measurably smaller for redshifts z>2. Analyses of other data (149Sm fission rate for the Oklo natural reactor, variation of 187Re β-decay rate in meteorite studies, atomic clock measurements) which probe variations of α in the more recent past imply much smaller deviations from its present value. In this work we tie the variation of α to the evolution of the quintessence field proposed by Albrecht and Skordis, and show that agreement with all these data, as well as consistency with Wilkinson Microwave Anisotropy Probe observations, can be achieved for a range of parameters. Some definite predictions follow for upcoming space missions searching for violations of the equivalence principle.

  4. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Science.gov (United States)

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. Published by Oxford University Press on behalf of Kazusa DNA Research Institute 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  5. Chicken rRNA Gene Cluster Structure.

    Directory of Open Access Journals (Sweden)

    Alexander G Dyomin

    Full Text Available Ribosomal RNA (rRNA genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5'ETS (1836 bp, 18S rRNA gene (1823 bp, ITS1 (2530 bp, 5.8S rRNA gene (157 bp, ITS2 (733 bp, 28S rRNA gene (4441 bp and 3'ETS (343 bp. The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region. The results have confirmed the chicken rRNA gene cluster validity.

  6. Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of Prostate Cancer

    Science.gov (United States)

    2015-10-01

    occupation, and smoking . 2. To examine the modifying effect of genetic variants in ITC-metabolizing genes on the associations between cruciferous...AWARD NUMBER: W81XWH-14-1-0453 TITLE: Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of...COVERED 15 Sep 2014 - 14 Sep 2015 4. TITLE AND SUBTITLE Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in

  7. Geographic variation and genetic structure in Spotted Owls

    Science.gov (United States)

    Haig, Susan M.; Wagner, R.S.; Forsman, E.D.; Mullins, Thomas D.

    2001-01-01

    We examined genetic variation, population structure, and definition of conservation units in Spotted Owls (Strix occidentalis). Spotted Owls are mostly non-migratory, long-lived, socially monogamous birds that have decreased population viability due to their occupation of highly-fragmented late successional forests in western North America. To investigate potential effects of habitat fragmentation on population structure, we used random amplified polymorphic DNA (RAPD) to examine genetic variation hierarchically among local breeding areas, subregional groups, regional groups, and subspecies via sampling of 21 breeding areas (276 individuals) among the three subspecies of Spotted Owls. Data from 11 variable bands suggest a significant relationship between geographic distance among local breeding groups and genetic distance (Mantel r = 0.53, P genetic drift. Merging nuclear data with recent mitochondrial data provides support for designation of an Evolutionary Significant Unit for Mexican Spotted Owls and two overlapping Management Units for Northern and California Spotted Owls.

  8. Structure linguistique: problemes de la constance et des variations (Linguistic Structure: Constance and Variation Problems).

    Science.gov (United States)

    Mahmoudian, Morteza

    1980-01-01

    Language is viewed as a nonhomogeneous hierarchical system, where complex correlations between a psychological/social dimension (external) and a linguistic dimension (internal) permit measurements of the stability and acceptability of its structures. Frequency of occurrence and integration in the system are presented as the key factors in the…

  9. Genome-wide association implicates numerous genes underlying ecological trait variation in natural populations of Populus trichocarpa.

    Science.gov (United States)

    McKown, Athena D; Klápště, Jaroslav; Guy, Robert D; Geraldes, Armando; Porth, Ilga; Hannemann, Jan; Friedmann, Michael; Muchero, Wellington; Tuskan, Gerald A; Ehlting, Jürgen; Cronk, Quentin C B; El-Kassaby, Yousry A; Mansfield, Shawn D; Douglas, Carl J

    2014-07-01

    In order to uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa) from much of its range in western North America. Extensive data from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34 K Populus single nucleotide polymorphism (SNP) array) of all accessions were used for gene discovery in a genome-wide association study (GWAS). We performed GWAS with 40 biomass, ecophysiology and phenology traits and 29,355 filtered SNPs representing 3518 genes. The association analyses were carried out using a Unified Mixed Model accounting for population structure effects among accessions. We uncovered 410 significant SNPs using a Bonferroni-corrected threshold (P<1.7×10(-6)). Markers were found across 19 chromosomes, explained 1-13% of trait variation, and implicated 275 unique genes in trait associations. Phenology had the largest number of associated genes (240 genes), followed by biomass (53 genes) and ecophysiology traits (25 genes). The GWAS results propose numerous loci for further investigation. Many traits had significant associations with multiple genes, underscoring their genetic complexity. Genes were also identified with multiple trait associations within and/or across trait categories. In some cases, traits were genetically correlated while in others they were not.

  10. Cloning of fiber-specific cDNAs and their structural variations in 4 fiber mutants

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A mRNA preferentially expressed in cotton fiber was cloned from fiber total RNA of normal upland cotton TM-1 (wild-type) by using RT-PCR and corresponding cDNA (signed as TM-E6) was sequenced. TM-E6 gene had no intron and contained an open reading frame of 771 bp long, and might encode a peptide of 246 amino acids. Other 4 genes, Fl-E6, Li-E6, N-E6 and Bl-E6, which were homologous to TM-E6 gene, were also isolated from 4 fiber mutants of Fiberless Xu-zhou 142, Ligon lintless, Naked seed and Brown lint, respectively. Sequence analysis of each of these mutant genes revealed many variations in structure and nucleotide composition of gene when compared with the sequence of TM-E6 gene. (ⅰ) There was a changeable repetitive segment in which GGCTCA (Gly-Ser) was repeated 3-5 times between the 82nd and the 93rd codons in different mutant genes. Since the change of Gly-Ser repetitive segment occurred not only in the mutants but also in the wild-type cotton, the repeat frequency might not be associated with the mutation of fiber characteristics. (ⅱ) Among the 4 mutant genes, the percentage of changed codons was 7.05% in Fl-E6, 4.98% in Li-E6, and 4.15% in N-E6 and Bl-E6. It seems that the percentage of changed codons in E6 sequence was posi-tively correlated to the degree of fiber morphological varia-tion. (ⅲ) E6 polypeptides of two long-fiberless mutants (Fi-berless Xuzhou 142 and Ligon lintless) contained high simi-lar (99.4%) variation in the region of 1-174 amino acids from N-terminus, and those of short-fiberless mutants (Fi-berless Xuzhou and naked seed) revealed identical variation in the region of 116th-220th amino acids. It also seems that there was a parallel relation between E6 protein variation and fiber phenotype mutation. (ⅳ) Li-E6 and Bl-E6 genes also expressed at low level in seed coat besides at high level in fiber.

  11. Correlations in the population structure of music, genes and language.

    Science.gov (United States)

    Brown, Steven; Savage, Patrick E; Ko, Albert Min-Shan; Stoneking, Mark; Ko, Ying-Chin; Loo, Jun-Hun; Trejaut, Jean A

    2014-01-07

    We present, to our knowledge, the first quantitative evidence that music and genes may have coevolved by demonstrating significant correlations between traditional group-level folk songs and mitochondrial DNA variation among nine indigenous populations of Taiwan. These correlations were of comparable magnitude to those between language and genes for the same populations, although music and language were not significantly correlated with one another. An examination of population structure for genetics showed stronger parallels to music than to language. Overall, the results suggest that music might have a sufficient time-depth to retrace ancient population movements and, additionally, that it might be capturing different aspects of population history than language. Music may therefore have the potential to serve as a novel marker of human migrations to complement genes, language and other markers.

  12. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo-

  13. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo- an

  14. Natural variation in the Pto pathogen resistance gene within species of wild tomato (Lycopersicon). I. Functional analysis of Pto alleles.

    Science.gov (United States)

    Rose, Laura E; Langley, Charles H; Bernal, Adriana J; Michelmore, Richard W

    2005-09-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene.

  15. Structure, expression and functions of MTA genes.

    Science.gov (United States)

    Kumar, Rakesh; Wang, Rui-An

    2016-05-15

    Metastatic associated proteins (MTA) are integrators of upstream regulatory signals with the ability to act as master coregulators for modifying gene transcriptional activity. The MTA family includes three genes and multiple alternatively spliced variants. The MTA proteins neither have their own enzymatic activity nor have been shown to directly interact with DNA. However, MTA proteins interact with a variety of chromatin remodeling factors and complexes with enzymatic activities for modulating the plasticity of nucleosomes, leading to the repression or derepression of target genes or other extra-nuclear and nucleosome remodeling and histone deacetylase (NuRD)-complex independent activities. The functions of MTA family members are driven by the steady state levels and subcellular localization of MTA proteins, the dynamic nature of modifying signals and enzymes, the structural features and post-translational modification of protein domains, interactions with binding proteins, and the nature of the engaged and resulting features of nucleosomes in the proximity of target genes. In general, MTA1 and MTA2 are the most upregulated genes in human cancer and correlate well with aggressive phenotypes, therapeutic resistance, poor prognosis and ultimately, unfavorable survival of cancer patients. Here we will discuss the structure, expression and functions of the MTA family of genes in the context of cancer cells.

  16. Natural variation in abiotic stress responsive gene expression and local adaptation to climate in Arabidopsis thaliana.

    Science.gov (United States)

    Lasky, Jesse R; Des Marais, David L; Lowry, David B; Povolotskaya, Inna; McKay, John K; Richards, James H; Keitt, Timothy H; Juenger, Thomas E

    2014-09-01

    Gene expression varies widely in natural populations, yet the proximate and ultimate causes of this variation are poorly known. Understanding how variation in gene expression affects abiotic stress tolerance, fitness, and adaptation is central to the field of evolutionary genetics. We tested the hypothesis that genes with natural genetic variation in their expression responses to abiotic stress are likely to be involved in local adaptation to climate in Arabidopsis thaliana. Specifically, we compared genes with consistent expression responses to environmental stress (expression stress responsive, "eSR") to genes with genetically variable responses to abiotic stress (expression genotype-by-environment interaction, "eGEI"). We found that on average genes that exhibited eGEI in response to drought or cold had greater polymorphism in promoter regions and stronger associations with climate than those of eSR genes or genomic controls. We also found that transcription factor binding sites known to respond to environmental stressors, especially abscisic acid responsive elements, showed significantly higher polymorphism in drought eGEI genes in comparison to eSR genes. By contrast, eSR genes tended to exhibit relatively greater pairwise haplotype sharing, lower promoter diversity, and fewer nonsynonymous polymorphisms, suggesting purifying selection or selective sweeps. Our results indicate that cis-regulatory evolution and genetic variation in stress responsive gene expression may be important mechanisms of local adaptation to climatic selective gradients.

  17. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  18. Genetic Variation in Osteopontin Gene Is Associated with Susceptibility to Sarcoidosis in Slovenian Population

    Directory of Open Access Journals (Sweden)

    A. Maver

    2009-01-01

    Full Text Available Sarcoidosis is a systemic inflammatory disease characterised by appearance of granulomas. Precise etiology has not been elucidated. Osteopontin (Opn is a Th1 cytokine whose levels have been found increased in granulomas and serum samples from patients with sarcoidosis. We investigated whether genetic variation in Osteopontin gene (OPN gene contributes to susceptibility to sarcoidosis. Haplotype-block structure in the OPN gene region was investigated using data from HapMap project. Three representative SNPs have been selected from each block of SNPs in linkage disequilibrium (rs11730582-C/T, rs11728697-C/T and rs4754-C/T. Genotyping was performed using TaqMan SNP Genotyping Assays on a sample of 165 patients and 284 controls. Statistical analyses of association were performed using Chi-Square test and algorithms implemented in the haplo.stats and PHASE packages. Genotyping analysis revealed a significant difference in genotype frequencies at rs4754 polymorphism in groups of patients and controls under recessive genetic model (p=0.036, OR=1.99, 95%CI=1.04-3.82, CC homozygotes being significantly over-represented in the patients group. However these results failed to reach significance after correction for multiple testing (p=0.25. The frequencies of predicted haplotypes differed between patient and control groups, frequency of TTT haplotype was found to be significantly decreased in the group of patients with sarcoidosis (p=0.014, OR=0.40, 95%CI=0.20-0.79. Our results suggest that variation in the OPN gene might be significantly associated with sarcoidosis and that the TTT haplotype in OPN may act as a protective factor in sarcoidosis.

  19. Variation and Genetic Structure in Platanus mexicana (Platanaceae along Riparian Altitudinal Gradient

    Directory of Open Access Journals (Sweden)

    Dulce M. Galván-Hernández

    2015-01-01

    Full Text Available Platanus mexicana is a dominant arboreal species of riparian ecosystems. These ecosystems are associated with altitudinal gradients that can generate genetic differences in the species, especially in the extremes of the distribution. However, studies on the altitudinal effect on genetic variation to riparian species are scarce. In Mexico, the population of P. mexicana along the Colipa River (Veracruz State grows below its reported minimum altitude range, possibly the lowest where this tree grows. This suggests that altitude might be an important factor in population genetics differentiation. We examined the genetic variation and population structuring at four sites with different altitudes (70, 200, 600 and 1700 m a.s.l. using ten inter-simple sequence repeats (ISSR markers. The highest value for Shannon index and Nei’s gene diversity was obtained at 1700 m a.s.l. (He = 0.27, Ne = 1.47, I = 0.42 and polymorphism reached the top value at the middle altitude (% p = 88.57. Analysis of molecular variance (AMOVA and STRUCTURE analysis indicated intrapopulation genetic differentiation. The arithmetic average (UPGMA dendrogram identified 70 m a.s.l. as the most genetically distant site. The genetic structuring resulted from limited gene flow and genetic drift. This is the first report of genetic variation in populations of P. mexicana in Mexico. This research highlights its importance as a dominant species, and its ecological and evolutionary implications in altitudinal gradients of riparian ecosystems.

  20. Identification of genes related to the phenotypic variations of a synthesized Paulownia (Paulownia tomentosa×Paulownia fortunei) autotetraploid.

    Science.gov (United States)

    Li, Yongsheng; Fan, Guoqiang; Dong, Yanpeng; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Xu, Enkai; Niu, Suyan

    2014-12-15

    Paulownia is a fast-growing deciduous tree native to China. It has great economic importance for the pulp and paper industries, as well as ecological prominence in forest ecosystems. Paulownia is of much interest to plant breeder keen to explore new plant varieties by selecting on the basis of phenotype. A newly synthesized autotetraploid Paulownia exhibited advanced characteristics, such as greater yield, and higher resistance than the diploid tree. However, tissue-specific transcriptome and genomic data in public databases are not sufficient to understand the molecular mechanisms associated with genome duplication. To evaluate the effects of genome duplication on the phenotypic variations in Paulownia tomentosa×Paulownia fortunei, the transcriptomes of the autotetraploid and diploid Paulownia were compared. Using Illumina sequencing technology, a total of 82,934 All-unigenes with a mean length of 1109 bp were assembled. The data revealed numerous differences in gene expression between the two transcriptomes, including 718 up-regulated and 667 down-regulated differentially expressed genes between the two Paulownia trees. An analysis of the pathway and gene annotations revealed that genes involved in nucleotide sugar metabolism in plant cell walls were down-regulated, and genes involved in the light signal pathway and the biosynthesis of structural polymers were up-regulated in autotetraploid Paulownia. The differentially expressed genes may contribute to the observed phenotypic variations between diploid and autotetraploid Paulownia. These results provide a significant resource for understanding the variations in Paulownia polyploidization and will benefit future breeding work.

  1. Progress in the detection of human genome structural variations

    Institute of Scientific and Technical Information of China (English)

    WU XueMei; XIAO HuaSheng

    2009-01-01

    The emerging of high.throughput and high-resolution genomic technologies led to the detection of submicroscopic variants ranging from 1 kb to 3 Mb in the human genome. These variants include copy number variations (CNVs), inversions, insertions, deletions and other complex rearrangements of DNA sequences. This paper briefly reviews the commonly used technologies to discover both genomic structural variants and their potential influences. Particularly, we highlight the array-based, PCR-based and sequencing-based assays, including array-based comparative genomic hybridization (aCGH),representational oligonucleotide microarray analysis (ROMA), multiplex amplifiable probe hybridization (MAPH), multiplex ligation-dependent probe amplification (MLPA), paired-end mapping (PEM), and next-generation DNA sequencing technologies. Furthermore, we discuss the limitations and challenges of current assays and give advices on how to make the database of genomic variations more reliable.

  2. Progress in the detection of human genome structural variations

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    The emerging of high-throughput and high-resolution genomic technologies led to the detection of submicroscopic variants ranging from 1 kb to 3 Mb in the human genome.These variants include copy number variations(CNVs),inversions,insertions,deletions and other complex rearrangements of DNA sequences.This paper briefly reviews the commonly used technologies to discover both genomic structural variants and their potential influences.Particularly,we highlight the array-based,PCR-based and sequencing-based assays,including array-based comparative genomic hybridization(aCGH),representational oligonucleotide microarray analysis(ROMA),multiplex amplifiable probe hybridization(MAPH),multiplex ligation-dependent probe amplification(MLPA),paired-end mapping(PEM),and next-generation DNA sequencing technologies.Furthermore,we discuss the limitations and challenges of current assays and give advices on how to make the database of genomic variations more reliable.

  3. Atomic Clocks and Variations of the FIne Structure Constant

    Science.gov (United States)

    Prestage, John D.; Tjoelker, Robert L.; Maleki, Lute

    1995-01-01

    We describe a new test for possible variations of the fine structure constant alpha by comparisons of rates between clocks based on hyperfine transitions in alkali atoms with different atomic number Z. H-maser, Cs, and Hg(+) clocks have a different dependence on alpha via relativistic contributions of order (Z-alpha)(sup 2). Recent H-maser vs Hg(+) clock comparison data improve laboratory limits on a time variation by 100-fold to give dot-alpha less than or equal to 3.7 x 10(exp -14)/yr. Future laser cooled clocks (Be(+), Rb, Cs, Hg(+), etc.), when compared, will yield the most sensitive of all tests for dot-alpha/alpha.

  4. The standing pool of genomic structural variation in a natural population of Mimulus guttatus.

    Science.gov (United States)

    Flagel, Lex E; Willis, John H; Vision, Todd J

    2014-01-01

    Major unresolved questions in evolutionary genetics include determining the contributions of different mutational sources to the total pool of genetic variation in a species, and understanding how these different forms of genetic variation interact with natural selection. Recent work has shown that structural variants (SVs) (insertions, deletions, inversions, and transpositions) are a major source of genetic variation, often outnumbering single nucleotide variants in terms of total bases affected. Despite the near ubiquity of SVs, major questions about their interaction with natural selection remain. For example, how does the allele frequency spectrum of SVs differ when compared with single nucleotide variants? How often do SVs affect genes, and what are the consequences? To begin to address these questions, we have systematically identified and characterized a large set of submicroscopic insertion and deletion (indel) variants (between 1 and 200 kb in length) among ten inbred lines from a single natural population of the plant species Mimulus guttatus. After extensive computational filtering, we focused on a set of 4,142 high-confidence indels that showed an experimental validation rate of 73%. All but one of these indels were less than 200 kb. Although the largest were generally at lower frequencies in the population, a surprising number of large indels are at intermediate frequencies. Although indels overlapping with genes were much rarer than expected by chance, approximately 600 genes were affected by an indel. Nucleotide-binding site leucine-rich repeat (NBS-LRR) defense response genes were the most enriched among the gene families affected. Most indels associated with genes were rare and appeared to be under purifying selection, though we do find four high-frequency derived insertion alleles that show signatures of recent positive selection.

  5. Variation in community structure across vertical intertidal stress gradients: how does it compare with horizontal variation at different scales?

    Directory of Open Access Journals (Sweden)

    Nelson Valdivia

    Full Text Available In rocky intertidal habitats, the pronounced increase in environmental stress from low to high elevations greatly affects community structure, that is, the combined measure of species identity and their relative abundance. Recent studies have shown that ecological variation also occurs along the coastline at a variety of spatial scales. Little is known, however, on how vertical variation compares with horizontal variation measured at increasing spatial scales (in terms of sampling interval. Because broad-scale processes can generate geographical patterns in community structure, we tested the hypothesis that vertical ecological variation is higher than fine-scale horizontal variation but lower than broad-scale horizontal variation. To test this prediction, we compared the variation in community structure across intertidal elevations on rocky shores of Helgoland Island with independent estimates of horizontal variation measured at the scale of patches (quadrats separated by 10s of cm, sites (quadrats separated by a few m, and shores (quadrats separated by 100s to 1000s of m. The multivariate analyses done on community structure supported our prediction. Specifically, vertical variation was significantly higher than patch- and site-scale horizontal variation but lower than shore-scale horizontal variation. Similar patterns were found for the variation in abundance of foundation taxa such as Fucus spp. and Mastocarpus stellatus, suggesting that the effects of these canopy-forming algae, known to function as ecosystem engineers, may explain part of the observed variability in community structure. Our findings suggest that broad-scale processes affecting species performance increase ecological variability relative to the pervasive fine-scale patchiness already described for marine coasts and the well known variation caused by vertical stress gradients. Our results also indicate that experimental research aiming to understand community structure on

  6. Amplification and characterization of eukaryotic structural genes.

    Science.gov (United States)

    Maniatis, T; Efstratiadis, A; Sim, G K; Kafatos, F

    1978-05-01

    An approach to the study of eukaryotic structural genes which are differentially expressed during development is described. This approach involves the isolation and amplification of mRNA sequences by in vitro conversion of mRNA to double-stranded cDNA followed by molecular cloning in bacterial plasmids. This procedure provides highly specific hybridization probes that can be used to identify genes and their contiguous DNA sequences in genomic DNA, and to detect specific RNA transcripts during development. The nature of the method allows the isolation of individual mRNA sequences from a complex population of molecules at different stages of development.

  7. Theoretical studies of gene substitution, geographic variation, and speciation

    Energy Technology Data Exchange (ETDEWEB)

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  8. Variations and classification of toxic epitopes related to celiac disease among α-gliadin genes from four Aegilops genomes.

    Science.gov (United States)

    Li, Jie; Wang, Shunli; Li, Shanshan; Ge, Pei; Li, Xiaohui; Ma, Wujun; Zeller, F J; Hsam, Sai L K; Yan, Yueming

    2012-07-01

    The α-gliadins are associated with human celiac disease. A total of 23 noninterrupted full open reading frame α-gliadin genes and 19 pseudogenes were cloned and sequenced from C, M, N, and U genomes of four diploid Aegilops species. Sequence comparison of α-gliadin genes from Aegilops and Triticum species demonstrated an existence of extensive allelic variations in Gli-2 loci of the four Aegilops genomes. Specific structural features were found including the compositions and variations of two polyglutamine domains (QI and QII) and four T cell stimulatory toxic epitopes. The mean numbers of glutamine residues in the QI domain in C and N genomes and the QII domain in C, N, and U genomes were much higher than those in Triticum genomes, and the QI domain in C and N genomes and the QII domain in C, M, N, and U genomes displayed greater length variations. Interestingly, the types and numbers of four T cell stimulatory toxic epitopes in α-gliadins from the four Aegilops genomes were significantly less than those from Triticum A, B, D, and their progenitor genomes. Relationships between the structural variations of the two polyglutamine domains and the distributions of four T cell stimulatory toxic epitopes were found, resulting in the α-gliadin genes from the Aegilops and Triticum genomes to be classified into three groups.

  9. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  10. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    OpenAIRE

    Cinda P Scott; Williams, Dean A; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory...

  11. A variational formulation for translation and assimilation of coherent structures

    Directory of Open Access Journals (Sweden)

    M. Plu

    2013-10-01

    Full Text Available The assimilation of observations from teledetected images in geophysical models requires one to develop algorithms that would account for the existence of coherent structures. In the context of variational data assimilation, a method is proposed to allow the background to be translated so as to fit structure positions deduced from images. Translation occurs as a first step before assimilating all the observations using a classical assimilation procedure with specific covariances for the translated background. A simple validation is proposed using a dynamical system based on the one-dimensional complex Ginzburg–Landau equation in a regime prone to phase and amplitude errors. Assimilation of observations after background translation leads to better scores and a better representation of extremas than the method without translation.

  12. Fine structure constant variation or space-time anisotropy?

    CERN Document Server

    Chang, Zhe; Li, Xin

    2011-01-01

    Recent observations on quasar absorption spectra supply evidences for variation of fine structure constant $\\alpha$. In this paper, we propose another interpretation of the observational data on quasar absorption spectra: a scenario with space-time inhomogeneity and anisotropy but uniform fine structure constant. Maybe the space-time is characterized by Finsler geometry instead of Riemann one. Finsler geometry admits less symmetries than Riemann geometry does. We investigate the Finslerian geodesic equations in Randers space-time (a special Finsler space-time). It is found that the cosmological redshift in this space-time is deviated from the one in general relativity. The modification term to redshift could be generally revealed as a monopole plus dipole function about space-time locations and directions. We suggest that this modification corresponds to the observed spatial monopole and Australian Dipole in quasar absorption spectra.

  13. Looking on the bright side of serotonin transporter gene variation.

    NARCIS (Netherlands)

    Homberg, J.R.; Lesch, K.P.

    2011-01-01

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for

  14. Integrated analyses of copy number variations and gene expression in lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Tzu-Pin Lu

    Full Text Available Numerous efforts have been made to elucidate the etiology and improve the treatment of lung cancer, but the overall five-year survival rate is still only 15%. Identification of prognostic biomarkers for lung cancer using gene expression microarrays poses a major challenge in that very few overlapping genes have been reported among different studies. To address this issue, we have performed concurrent genome-wide analyses of copy number variation and gene expression to identify genes reproducibly associated with tumorigenesis and survival in non-smoking female lung adenocarcinoma. The genomic landscape of frequent copy number variable regions (CNVRs in at least 30% of samples was revealed, and their aberration patterns were highly similar to several studies reported previously. Further statistical analysis for genes located in the CNVRs identified 475 genes differentially expressed between tumor and normal tissues (p<10(-5. We demonstrated the reproducibility of these genes in another lung cancer study (p = 0.0034, Fisher's exact test, and showed the concordance between copy number variations and gene expression changes by elevated Pearson correlation coefficients. Pathway analysis revealed two major dysregulated functions in lung tumorigenesis: survival regulation via AKT signaling and cytoskeleton reorganization. Further validation of these enriched pathways using three independent cohorts demonstrated effective prediction of survival. In conclusion, by integrating gene expression profiles and copy number variations, we identified genes/pathways that may serve as prognostic biomarkers for lung tumorigenesis.

  15. Common variation in fatty acid metabolic genes and risk of incident sudden cardiac arrest

    NARCIS (Netherlands)

    R.N. Lemaitre (Rozenn ); C.O. Johnson (Catherine); S. Hesselson (Stephanie); N. Sotoodhenia (Nona); B. McKnight (Barbara); C.M. Sitlani (Colleen); D. Rea (Dan); I.B. King (Irena); P.-Y. Kwok (Pui-Yan); A. Mak (Angel); G. Li (Guo); J. Brody (Jennifer); E.B. Larson (Eric); D. Mozaffarian (Dariush); B.M. Psaty (Bruce); A. Huertas-Vazquez (Adriana); J.-C. Tardif (Jean-Claude); C.M. Albert (Christine); L.-P. Lyytikäinen (Leo-Pekka); D.E. Arking (Dan); S. Kääb (Stefan); H.V. Huikuri (Heikki); B.P. Krijthe (Bouwe); M. Eijgelsheim (Mark); Y.A. Wang (Ying); K. Reinier (Kyndaron); T. Lehtimäki (Terho); S.L. Pulit (Sara); R. Brugada (Ramon); M. Müller-Nurasyid (Martina); C. Newton-Cheh (Christopher); P.J. Karhunen (Pekka); B.H.Ch. Stricker (Bruno); P. Goyette (Philippe); J.I. Rotter (Jerome); S.S. Chugh (Sumeet); A. Chakravarti (Aravinda); X. Jouven (Xavier); D.S. Siscovick (David)

    2014-01-01

    textabstractBackground There is limited information on genetic factors associated with sudden cardiac arrest (SCA). Objective To assess the association of common variation in genes in fatty acid pathways with SCA risk. Methods We selected 85 candidate genes and 1155 single nucleotide polymorphisms (

  16. Unraveling the regulatory mechanisms underlying tissue-dependent genetic variation of gene expression

    NARCIS (Netherlands)

    Fu, Jingyuan; Wolfs, Marcel G M; Deelen, Patrick; Westra, Harm Jan; Fehrmann, Rudolf S N; te Meerman, Gerhardus; Buurman, Wim A; Rensen, Sander S M; Groen, Hendricus; Weersma, Rinse K; van den Berg, Leonard H; Veldink, Jan; Ophoff, Roel A; Snieder, Harold; van Heel, David; Jansen, Ritsert C; Hofker, Marten H; Wijmenga, Cisca; Franke, Lude

    2012-01-01

    It is known that genetic variants can affect gene expression, but it is not yet completely clear through what mechanisms genetic variation mediate this expression. We therefore compared the cis-effect of single nucleotide polymorphisms (SNPs) on gene expression between blood samples from 1,240 human

  17. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    DEFF Research Database (Denmark)

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  18. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovari...

  19. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  20. NMDA receptor gene variations as modifiers in Huntington disease : a replication study

    NARCIS (Netherlands)

    Saft, Carsten; Epplen, Jörg T; Wieczorek, Stefan; Landwehrmeyer, G Bernhard; Roos, Raymund A C; de Yebenes, Justo Garcia; Dose, Matthias; Tabrizi, Sarah J; Craufurd, David; Arning, Larissa; Kremer, Berry

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN

  1. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  2. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    Science.gov (United States)

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  3. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  4. NUCLEOTIDE SEQUENCE VARIATION IN LEPTIN GENE OF MURRAH BUFFALO (BUBALUS BUBALIS

    Directory of Open Access Journals (Sweden)

    Sanjoy Datta

    2012-12-01

    Full Text Available Leptin is a 16 kD protein, synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility and immune functions. Present study was undertaken with the objectives of sequence characterization and studying the nucleotide variation in leptin gene in Murrah buffalo. The leptin gene consists of three exons and two introns which spans about 18.9kb, of which the first exon is not transcribed into protein. In buffaloes, the leptin gene is located on chromosome eight and maps to BBU 8q32. The leptin gene was amplified by PCR using oligonucleotide primers to obtain 289 bp fragment comprising of exon 2 and 405 bp fragment containing exon 3 of leptin gene. The amplicons were sequenced to identify variation at nucleotide level. Sequence comparison of buffalo with cattle reveals variation at five nucleotide sequences at positions 983, 1083, 1147, 1152, 1221 and all the SNPs are synonymous resulting no in change in amino acids. Three of these eight nucleotide variations have been reported for the first time in buffalo. The results indicate conservation of DNA sequence between cattle and buffalo. Nucleotide sequence variations observed at leptin gene between Bubalus bubalis and Bos taurus species revealed 97% nucleotide identity.

  5. Variation in fibrinogen FGG and FGA genes and risk of stroke: the Rotterdam Study.

    Science.gov (United States)

    Cheung, Elim Y L; Bos, Michiel J; Leebeek, Frank W G; Koudstaal, Peter J; Hofman, Albert; de Maat, Moniek P M; Breteler, Monique M B

    2008-08-01

    Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

  6. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Directory of Open Access Journals (Sweden)

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  7. Associations between Variation in X Chromosome Male Reproductive Genes and Sperm Competitive Ability in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Leah Greenspan

    2011-01-01

    Full Text Available Variation in reproductive success has long been thought to be mediated in part by genes encoding seminal proteins. Here we explore the effect on male reproductive phenotypes of X-linked polymorphisms, a chromosome that is depauperate in genes encoding seminal proteins. Using 57 X chromosome substitution lines, sperm competition was tested both when the males from the wild-extracted line were the first to mate (“defense” crosses, followed by a tester male, and when extracted-line males were the second to mate, after a tester male (“offfense” crosses. We scored the proportion of progeny sired by each male, the fecundity, the remating rate and refractoriness to remating, and tested the significance of variation among lines. Eleven candidate genes were chosen based on previous studies, and portions of these genes were sequenced in all 57 lines. A total of 131 polymorphisms were tested for associations with the reproductive phenotypes using linear models. Nine polymorphisms in 4 genes were found to show significant associations (at a 5% FDR. Overall, it appears that the X chromosomes harbor abundant variation in sperm competition, especially considering the paucity of seminal protein genes. This suggests that much of the male reproductive variation lies outside of genes that encode seminal proteins.

  8. Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago.

    Science.gov (United States)

    Tezuka, A; Kasagi, S; van Oosterhout, C; McMullan, M; Iwasaki, W M; Kasai, D; Yamamichi, M; Innan, H; Kawamura, S; Kawata, M

    2014-11-01

    The guppy is known to exhibit remarkable interindividual variations in spectral sensitivity of middle to long wavelength-sensitive (M/LWS) cone photoreceptor cells. The guppy has four M/LWS-type opsin genes (LWS-1, LWS-2, LWS-3 and LWS-4) that are considered to be responsible for this sensory variation. However, the allelic variation of the opsin genes, particularly in terms of their absorption spectrum, has not been explored in wild populations. Thus, we examined nucleotide variations in the four M/LWS opsin genes as well as blue-sensitive SWS2-B and ultraviolet-sensitive SWS1 opsin genes for comparison and seven non-opsin nuclear loci as reference genes in 10 guppy populations from various light environments in Trinidad and Tobago. For the first time, we discovered a potential spectral variation (180 Ser/Ala) in LWS-1 that differed at an amino acid site known to affect the absorption spectra of opsins. Based on a coalescent simulation of the nucleotide variation of the reference genes, we showed that the interpopulation genetic differentiation of two opsin genes was significantly larger than the neutral expectation. Furthermore, this genetic differentiation was significantly related to differences in dissolved oxygen (DO) level, and it was not explained by the spatial distance between populations. The DO levels are correlated with eutrophication that possibly affects the color of aquatic environments. These results suggest that the population diversity of opsin genes is significantly driven by natural selection and that the guppy could adapt to various light environments through color vision changes.

  9. Species transformation and structure variation of fulvic acid during ozonation

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The species transformation and structure variation of fulvic acid (FA) during ozonation were investi- gated in this study. The molecular weight (MW) distribution, the species of intermediate products and the variation of polar functional groups were studied by ultrafiltration, gas chromatography/mass spectrometry (GC/MS) and titration analyses respectively. The average MW of FA decreased signifi- cantly during ozonation. The amount of polar functional groups (carboxylic and phenolic (ph-OH) groups) per unit DOC (mol/kg C) increased with increasing ozonation time. Furthermore, GC/MS ex- periments demonstrated the formation of polar species (e.g., hexadecanoic acid, benzoic acid and oc- tadecanoic alcohol) and less-polar species (e.g., aliphatic hydrocarbons and butanedioic acid, bis(2-methylpropyl) ester). Electron spin resonance (ESR) measurements proved the presence of ·OH radicals in the ozonation system. Based on our experimental results, it appears that the oxidations by ozone molecule and ·OH radicals were responsible for the transformation of organics (FA and its oxi- dation products) during ozonation. These two oxidants showed significant influence on organics transformation and exhibited different mechanisms contributing to these processes.

  10. Evolution of polymer photovoltaic performances from subtle chemical structure variations.

    Science.gov (United States)

    Yan, Han; Li, Denghua; Lu, Kun; Zhu, Xiangwei; Zhang, Yajie; Yang, Yanlian; Wei, Zhixiang

    2012-11-21

    Conjugated polymers are promising replacements for their inorganic counterparts in photovoltaics due to their low cost, ease of processing, and straightforward thin film formation. New materials have been able to improve the power conversion efficiency of photovoltaic cells up to 8%. However, rules for rational material design are still lacking, and subtle chemical structure variations usually result in large performance discrepancies. The present paper reports a detailed study on the crystalline structure, morphology, and in situ optoelectronic properties of blend films of polythiophene derivatives and [6,6]-phenyl C61-butyric acid methyl ester by changing the alkyl side chain length and position of polythiophene. The correlation among the molecular structure, mesoscopic morphology, mesoscopic optoelectronic property and macroscopic device performance (highest efficiency above 4%) was directly established. Both solubility and intermolecular interactions should be considered in rational molecular design. Knowledge obtained from this study can aid the selection of appropriate processing conditions that improve blend film morphology, charge transport property, and overall solar cell efficiency.

  11. Structural genomic variation in childhood epilepsies with complex phenotypes

    DEFF Research Database (Denmark)

    Helbig, Ingo; Swinkels, Marielle E M; Aten, Emmelien

    2014-01-01

    A genetic contribution to a broad range of epilepsies has been postulated, and particularly copy number variations (CNVs) have emerged as significant genetic risk factors. However, the role of CNVs in patients with epilepsies with complex phenotypes is not known. Therefore, we investigated the role...... of CNVs in patients with unclassified epilepsies and complex phenotypes. A total of 222 patients from three European countries, including patients with structural lesions on magnetic resonance imaging (MRI), dysmorphic features, and multiple congenital anomalies, were clinically evaluated and screened...... for CNVs. MRI findings including acquired or developmental lesions and patient characteristics were subdivided and analyzed in subgroups. MRI data were available for 88.3% of patients, of whom 41.6% had abnormal MRI findings. Eighty-eight rare CNVs were discovered in 71 out of 222 patients (31...

  12. Variational grand-canonical electronic structure method for open systems.

    Science.gov (United States)

    Jacobi, Shlomit; Baer, Roi

    2005-07-22

    An ab initio method is developed for variational grand-canonical molecular electronic structure of open systems based on the Gibbs-Peierls-Boguliobov inequality. We describe the theory and a practical method for performing the calculations within standard quantum chemistry codes using Gaussian basis sets. The computational effort scales similarly to the ground-state Hartree-Fock method. The quality of the approximation is studied on a hydrogen molecule by comparing to the exact Gibbs free energy, computed using full configuration-interaction calculations. We find the approximation quite accurate, with errors similar to those of the Hartree-Fock method for ground-state (zero-temperature) calculations. A further demonstration is given of the temperature effects on the bending potential curve for water. Some future directions and applications of the method are discussed. Several appendices give the mathematical and algorithmic details of the method.

  13. Computing Lagrangian coherent structures from their variational theory.

    Science.gov (United States)

    Farazmand, Mohammad; Haller, George

    2012-03-01

    Using the recently developed variational theory of hyperbolic Lagrangian coherent structures (LCSs), we introduce a computational approach that renders attracting and repelling LCSs as smooth, parametrized curves in two-dimensional flows. The curves are obtained as trajectories of an autonomous ordinary differential equation for the tensor lines of the Cauchy-Green strain tensor. This approach eliminates false positives and negatives in LCS detection by separating true exponential stretching from shear in a frame-independent fashion. Having an explicitly parametrized form for hyperbolic LCSs also allows for their further in-depth analysis and accurate advection as material lines. We illustrate these results on a kinematic model flow and on a direct numerical simulation of two-dimensional turbulence.

  14. Brillouin resonance broadening due to structural variations in nanoscale waveguides

    CERN Document Server

    Wolff, Christian; Steel, Michael J; Eggleton, Benjamin J; Poulton, Christopher G

    2015-01-01

    We study the impact of structural variations (that is slowly varying geometry aberrations and internal strain fields) on the resonance width and shape of stimulated Brillouin scattering (SBS) in nanoscale waveguides. We find that they lead to an inhomogeneous resonance broadening through two distinct mechanisms: firstly, the acoustic frequency is directly influenced via mechanical nonlinearities; secondly, the optical wave numbers are influenced via the opto-mechanical nonlinearity leading to an additional acoustic frequency shift via the phase-matching condition. We find that this second mechanism is proportional to the opto-mechanical coupling and, hence, related to the SBS-gain itself. It is absent in intra-mode forward SBS, while it plays a significant role in backward scattering. In backward SBS increasing the opto-acoustic overlap beyond a threshold defined by the fabrication tolerances will therefore no longer yield the expected quadratic increase in overall Stokes amplification. Our results can be tra...

  15. A new approach to quantify the adaptive potential of gene expression variation in gymnosperms.

    Science.gov (United States)

    Renaut, Sébastien

    2013-05-01

    Variation in patterns of gene expression contributes to phenotypic diversity and can ultimately predict adaptive responses. However, in many cases, the consequences of regulatory mutations on patterns of gene expression and ultimately phenotypic differences remain elusive. A standard way to study the genetic architecture of expression variation in model systems has been to map gene expression variation to genetic loci (Fig. 1a). At the same time, in many nonmodel species, especially for long-lived organisms, controlled crosses are not feasible. If we are to expand our understanding of the role of regulatory mutations on phenotypes, we need to develop new methodologies to study species under ecologically relevant conditions. In this issue of Molecular Ecology, Verta et al. (2013) present a new approach to analyse gene expression variation and regulatory networks in gymnosperms (Fig. 1b). They capitalized on the fact that gymnosperm seeds contain an energy storage tissue (the megagametophyte) that is directly derived from a single haploid cell (the megaspore). The authors identified over 800 genes for which expression segregated in this maternally inherited haploid tissue. Based on the observed segregation patterns, these genes (Mendelian Expression Traits) are most probably controlled by biallelic variants at a single locus. Most of these genes also belonged to different regulatory networks, except for one large group of 180 genes under the control of a putative trans-acting factor. In addition, the approach developed here may also help to uncover the effect of rare recessive mutations, which usually remain hidden in a heterozygous state in diploid individuals. The appeal of the work by Verta et al. (2013) to study gene expression variation is in its simplicity, which circumvents several of the hurdles behind traditional expression quantitative trait locus (eQTL) studies, and could potentially be applied to a large number of species.

  16. Allelic variation in the NPY gene in 14 Indian populations.

    Science.gov (United States)

    Bhaskar, L V K S; Thangaraj, K; Shah, Anish M; Pardhasaradhi, G; Praveen Kumar, K; Reddy, A G; Papa Rao, A; Mulligan, C J; Singh, Lalji; Rao, V R

    2007-01-01

    NPY is a 36-aminoacid peptide expressed in several areas of the nervous system. Neuropeptide Y (NPY) receptors represent a widely diffused system that is involved in the regulation of multiple biological functions. The human NPY gene is located in chromosome 7. The functional significance of coding Leu7Pro polymorphism in the signal peptide of preproNPY is known. Six hundred and fifty four individuals of 14 ethnic Indian populations were screened for three mutations in the NPY gene, including Leu7Pro. We found that the Pro7 frequencies among the studied populations were much higher than in previous studies from other parts of the world. The highest allele frequency of Pro7 was detected in the Kota population in the Nilgiri Hill region of south India, and this may reflect a founder event in the past or genetic drift. All populations followed the Hardy-Weinberg equilibrium for the assayed markers. A total of five haplotypes were observed, only two of which were found to occur with a high frequency in all populations. No linkage disequilibrium (LD) was observed across the tested alleles in any population with the exception of Leu7Pro and Ser50Ser in the Badaga population (chi(2) = 13.969; p = 0.0001).

  17. BGMUT: NCBI dbRBC database of allelic variations of genes encoding antigens of blood group systems.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Helmberg, Wolfgang; Blumenfeld, Olga O

    2012-01-01

    Analogous to human leukocyte antigens, blood group antigens are surface markers on the erythrocyte cell membrane whose structures differ among individuals and which can be serologically identified. The Blood Group Antigen Gene Mutation Database (BGMUT) is an online repository of allelic variations in genes that determine the antigens of various human blood group systems. The database is manually curated with allelic information collated from scientific literature and from direct submissions from research laboratories. Currently, the database documents sequence variations of a total of 1251 alleles of all 40 gene loci that together are known to affect antigens of 30 human blood group systems. When available, information on the geographic or ethnic prevalence of an allele is also provided. The BGMUT website also has general information on the human blood group systems and the genes responsible for them. BGMUT is a part of the dbRBC resource of the National Center for Biotechnology Information, USA, and is available online at http://www.ncbi.nlm.nih.gov/projects/gv/rbc/xslcgi.fcgi?cmd=bgmut. The database should be of use to members of the transfusion medicine community, those interested in studies of genetic variation and related topics such as human migrations, and students as well as members of the general public.

  18. Variational asymptotic modeling of composite dimensionally reducible structures

    Science.gov (United States)

    Yu, Wenbin

    A general framework to construct accurate reduced models for composite dimensionally reducible structures (beams, plates and shells) was formulated based on two theoretical foundations: decomposition of the rotation tensor and the variational asymptotic method. Two engineering software systems, Variational Asymptotic Beam Sectional Analysis (VABS, new version) and Variational Asymptotic Plate and Shell Analysis (VAPAS), were developed. Several restrictions found in previous work on beam modeling were removed in the present effort. A general formulation of Timoshenko-like cross-sectional analysis was developed, through which the shear center coordinates and a consistent Vlasov model can be obtained. Recovery relations are given to recover the asymptotic approximations for the three-dimensional field variables. A new version of VABS has been developed, which is a much improved program in comparison to the old one. Numerous examples are given for validation. A Reissner-like model being as asymptotically correct as possible was obtained for composite plates and shells. After formulating the three-dimensional elasticity problem in intrinsic form, the variational asymptotic method was used to systematically reduce the dimensionality of the problem by taking advantage of the smallness of the thickness. The through-the-thickness analysis is solved by a one-dimensional finite element method to provide the stiffnesses as input for the two-dimensional nonlinear plate or shell analysis as well as recovery relations to approximately express the three-dimensional results. The known fact that there exists more than one theory that is asymptotically correct to a given order is adopted to cast the refined energy into a Reissner-like form. A two-dimensional nonlinear shell theory consistent with the present modeling process was developed. The engineering computer code VAPAS was developed and inserted into DYMORE to provide an efficient and accurate analysis of composite plates and

  19. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Valeria Paula Carreira

    Full Text Available Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may

  20. Chimpanzee sociability is associated with vasopressin (Avpr1a) but not oxytocin receptor gene (OXTR) variation.

    Science.gov (United States)

    Staes, Nicky; Koski, Sonja E; Helsen, Philippe; Fransen, Erik; Eens, Marcel; Stevens, Jeroen M G

    2015-09-01

    The importance of genes in regulating phenotypic variation of personality traits in humans and animals is becoming increasingly apparent in recent studies. Here we focus on variation in the vasopressin receptor gene 1a (Avpr1a) and oxytocin receptor gene (OXTR) and their effects on social personality traits in chimpanzees. We combine newly available genetic data on Avpr1a and OXTR allelic variation of 62 captive chimpanzees with individual variation in personality, based on behavioral assessments. Our study provides support for the positive association of the Avpr1a promoter region, in particular the presence of DupB, and sociability in chimpanzees. This complements findings of previous studies on adolescent chimpanzees and studies that assessed personality using questionnaire data. In contrast, no significant associations were found for the single nucleotide polymorphism (SNP) ss1388116472 of the OXTR and any of the personality components. Most importantly, our study provides additional evidence for the regulatory function of the 5' promoter region of Avpr1a on social behavior and its evolutionary stable effect across species, including rodents, chimpanzees and humans. Although it is generally accepted that complex social behavior is regulated by a combination of genes, the environment and their interaction, our findings highlight the importance of candidate genes with large effects on behavioral variation.

  1. Degranulation of rat cerebellum induces selective variations in gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Eliyahu, D.; Soreq, H.

    1982-02-01

    Selective variations in the composition of poly(A)-containing mRNA were found to be induced in the rat cerebellum by X-irradiation. mRNA populations prepared from normal and X-irradiated rat cerebella at different stages of their development displayed equal efficiencies when translated in vitro in reticulocyte lysates. Specific differences were revealed, however, when the labeled translation products of both mRNA preparations were subjected to two-dimensional gel electrophoresis followed by fluorography of the dried gels. Of more than 100 polypeptide products, several showed marked intensity differences, indicating changes in the abundance of their directing mRNA species. These differences appear both in developing and in mature cerebellar mRNA, and the extent of modification in mRNA is much higher than the consequent changes in the composition of proteins in the irradiated cerebellum. The degranulation-induced modifications in levels of specific cerebellar mRNA species can be used to identify proteins whose biosynthesis depends on the presence of interneurons.

  2. Gene Silencing and Antigenic Variation in Malaria Parasites

    Directory of Open Access Journals (Sweden)

    Kirk W. Deitsch

    2001-01-01

    Full Text Available Malaria remains one of the most important infectious diseases in the world today, infecting 300 to 500 million people yearly and resulting in 1 to 2 million deaths, primarily of young African children[1]. The most severe form of this disease is caused by infection with the mosquito borne protozoan parasite Plasmodium falciparum. This parasite lives by invading and multiplying within the red blood cells of its host, causing disease through anemia resulting from red cell destruction, and also through modifications made to the surface of infected red cells. These modifications make infected cells cytoadherent or “sticky”, allowing them to adhere to the walls of blood vessels, leading to obstruction of blood flow and such clinical manifestations as the often fatal syndrome of cerebral malaria[2]. In addition, parasites are capable of undergoing antigenic variation, a process of continually changing the identity of proteins on the surface of infected cells and thus avoiding the immune response mounted by the host[3]. This process promotes a long term, persistent infection that is difficult to clear.

  3. Geographic variation and genetic structure in the Bahama Oriole (Icterus northropi, a critically endangered synanthropic species

    Directory of Open Access Journals (Sweden)

    Melissa R. Price

    2015-11-01

    Full Text Available Bird species may exhibit unexpected population structuring over small distances, with gene flow restricted by geographic features such as water or mountains. The Bahama Oriole (Icterus northropi is a critically endangered, synanthropic island endemic with a declining population of fewer than 300 individuals. It now remains only on Andros Island (The Bahamas, which is riddled with waterways that past studies assumed did not hinder gene flow. We examined 1,858 base pairs of mitochondrial DNA sequenced from four gene regions in 14 birds (roughly 5% of the remaining population found on the largest land masses of Andros Island (North Andros and Mangrove Cay/South Andros. We sought to discern genetic structuring between the remaining subpopulations and its relationship to current conservation concerns. Four unique haplotypes were identified, with only one shared between the two subpopulations. Nucleotide and haplotype diversity were higher for the North Andros subpopulation than for the Mangrove Cay/South Andros subpopulation. Analysis of molecular variance (AMOVA yielded a Wright’s fixation index (Fst of 0.60 (PFst = 0.016, with 40.2% of the molecular variation explained by within-population differences and 59.8% by among-population differences. Based on the mitochondrial regions examined in this study, we suggest the extant subpopulations of Bahama Oriole exhibit significant population structuring over short distances, consistent with some other non-migratory tropical songbird species.

  4. FEA of the Variations in Sound Insulation in Nominally Identical Prefabricated Lightweight Timber Panel Structures

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Andersen, Lars

    2013-01-01

    The measurements of sound propagation in buildings usually show a variation between nominally identical constructed structures. These variations can be due to variations in structural properties, measurement uncertainties or workmanship related factors. Better knowledge about the source for these......The measurements of sound propagation in buildings usually show a variation between nominally identical constructed structures. These variations can be due to variations in structural properties, measurement uncertainties or workmanship related factors. Better knowledge about the source...... in sound transmission due to variation in material properties and geometric properties of the walls. The obtanied results indicate that the sound transmission is sensitive to variations in a material properties and less sensitive to variations in the geometric properties....

  5. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  6. Variations in the β-Globin genes of Sickle Cell Anaemia Patients in ...

    African Journals Online (AJOL)

    ... this article online. Quick Response Code: ... Genbank Reference β-globin gene (NC_000011.9) using Basic Local Alignment. Search Tool ... of Chromosome 11 constituting 1.6kb of the β-globin ... natural selection, population genetics, gene expression, ... The molecular structure of the beta globin gene has a bearing on ...

  7. The Mycoplasma hominis vaa gene displays a mosaic gene structure

    DEFF Research Database (Denmark)

    Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.;

    1998-01-01

    Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular compos...

  8. Gene diversity and genetic variation in lung flukes (genus Paragonimus).

    Science.gov (United States)

    Blair, David; Nawa, Yukifumi; Mitreva, Makedonka; Doanh, Pham Ngoc

    2016-01-01

    Paragonimiasis caused by lung flukes (genus Paragonimus) is a neglected disease occurring in Asia, Africa and the Americas. The genus is species-rich, ancient and widespread. Genetic diversity is likely to be considerable, but investigation of this remains confined to a few populations of a few species. In recent years, studies of genetic diversity have moved from isoenzyme analysis to molecular phylogenetic analysis based on selected DNA sequences. The former offered better resolution of questions relating to allelic diversity and gene flow, whereas the latter is more suitable for questions relating to molecular taxonomy and phylogeny. A picture is emerging of a highly diverse taxon of parasites, with the greatest diversity found in eastern and southern Asia where ongoing speciation might be indicated by the presence of several species complexes. Diversity of lung flukes in Africa and the Americas is very poorly sampled. Functional molecules that might be of value for immunodiagnosis, or as targets for medical intervention, are of great interest. Characterisation of these from Paragonimus species has been ongoing for a number of years. However, the imminent release of genomic and transcriptomic data for several species of Paragonimus will dramatically increase the rate of discovery of such molecules, and illuminate their diversity within and between species.

  9. [Association of schizophrenia with variations in genes encoding transcription factors].

    Science.gov (United States)

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  10. Genetic variation in V gene of class II Newcastle disease virus.

    Science.gov (United States)

    Hao, Huafang; Chen, Shengli; Liu, Peng; Ren, Shanhui; Gao, Xiaolong; Wang, Yanping; Wang, Xinglong; Zhang, Shuxia; Yang, Zengqi

    2016-01-01

    The genetic variation and molecular evolution of the V gene of the class II Newcastle disease virus (NDV) isolates with genotypes I-XVIII were determined using bioinformatics. Results indicated that low homology existed in different genotype viruses, whereas high homology often for the same genotypes, exception may be existed within genotypes I, V, VI, and XII. Sequence analysis showed that the genetic variation of V protein was consistent with virus genotype, and specific signatures on the V protein for nine genotypes were identified. Phylogenetic analysis demonstrated that the phylogenetic trees were highly consistent between the V and F genes, with slight discrepancies in the sub-genotypes. Evolutionary rate analyses based on V and F genes revealed the evolution rates varied in genotypes. These data indicate that the genetic variation of V protein is genotype-related and will help in elucidating the molecular evolution of NDV.

  11. Common variation of the CYP17 gene in Iraqi women with endometriosis disease.

    Science.gov (United States)

    Al-Rubae'i, Salwa H N; Naji, Tamara Sami; Turki, Kisma M

    2017-03-01

    Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17), a gene that codes for a key enzyme (cytochrome P450c17a1) in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23-46), the associations between selected single-nucleotide polymorphisms (SNPs) in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01)between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01) in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  12. Common variation of the CYP17 gene in Iraqi women with endometriosis disease

    Directory of Open Access Journals (Sweden)

    Salwa H.N. Al-Rubae'i

    2017-03-01

    Full Text Available Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17, a gene that codes for a key enzyme (cytochrome P450c17a1 in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23–46, the associations between selected single-nucleotide polymorphisms (SNPs in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01 in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  13. Structural Variations of Human Glucokinase Glu256Lys in MODY2 Condition Using Molecular Dynamics Study

    Directory of Open Access Journals (Sweden)

    Nanda Kumar Yellapu

    2013-01-01

    Full Text Available Glucokinase (GK is the predominant hexokinase that acts as glucose sensor and catalyses the formation of Glucose-6-phosphate. The mutations in GK gene influence the affinity for glucose and lead to altered glucose levels in blood causing maturity onset diabetes of the young type 2 (MODY2 condition, which is one of the prominent reasons of type 2 diabetic condition. In view of the importance of mutated GK resulting in hyperglycemic condition, in the present study, molecular dynamics simulations were carried out in intact and 256 E-K mutated GK structures and their energy values and conformational variations were correlated. Energy variations were observed in mutated GK (3500 Kcal/mol structure with respect to intact GK (5000 Kcal/mol, and it showed increased γ-turns, decreased β-turns, and more helix-helix interactions that affected substrate binding region where its volume increased from 1089.152 Å2 to 1246.353 Å2. Molecular docking study revealed variation in docking scores (intact = −12.199 and mutated = −8.383 and binding mode of glucose in the active site of mutated GK where the involvement of A53, S54, K56, K256, D262 and Q286 has resulted in poor glucose binding which probably explains the loss of catalytic activity and the consequent prevailing of high glucose levels in MODY2 condition.

  14. Structural Variations of Human Glucokinase Glu256Lys in MODY2 Condition Using Molecular Dynamics Study.

    Science.gov (United States)

    Yellapu, Nanda Kumar; Kandlapalli, Kalpana; Valasani, Koteswara Rao; Sarma, P V G K; Matcha, Bhaskar

    2013-01-01

    Glucokinase (GK) is the predominant hexokinase that acts as glucose sensor and catalyses the formation of Glucose-6-phosphate. The mutations in GK gene influence the affinity for glucose and lead to altered glucose levels in blood causing maturity onset diabetes of the young type 2 (MODY2) condition, which is one of the prominent reasons of type 2 diabetic condition. In view of the importance of mutated GK resulting in hyperglycemic condition, in the present study, molecular dynamics simulations were carried out in intact and 256 E-K mutated GK structures and their energy values and conformational variations were correlated. Energy variations were observed in mutated GK (3500 Kcal/mol) structure with respect to intact GK (5000 Kcal/mol), and it showed increased γ -turns, decreased β -turns, and more helix-helix interactions that affected substrate binding region where its volume increased from 1089.152 Å(2) to 1246.353 Å(2). Molecular docking study revealed variation in docking scores (intact = -12.199 and mutated = -8.383) and binding mode of glucose in the active site of mutated GK where the involvement of A53, S54, K56, K256, D262 and Q286 has resulted in poor glucose binding which probably explains the loss of catalytic activity and the consequent prevailing of high glucose levels in MODY2 condition.

  15. Investigation of variation in gene expression profiling of human blood by extended principle component analysis.

    Directory of Open Access Journals (Sweden)

    Qinghua Xu

    Full Text Available BACKGROUND: Human peripheral blood is a promising material for biomedical research. However, various kinds of biological and technological factors result in a large degree of variation in blood gene expression profiles. METHODOLOGY/PRINCIPAL FINDINGS: Human peripheral blood samples were drawn from healthy volunteers and analysed using the Human Genome U133Plus2 Microarray. We applied a novel approach using the Principle Component Analysis and Eigen-R(2 methods to dissect the overall variation of blood gene expression profiles with respect to the interested biological and technological factors. The results indicated that the predominating sources of the variation could be traced to the individual heterogeneity of the relative proportions of different blood cell types (leukocyte subsets and erythrocytes. The physiological factors like age, gender and BMI were demonstrated to be associated with 5.3% to 9.2% of the total variation in the blood gene expression profiles. We investigated the gene expression profiles of samples from the same donors but with different levels of RNA quality. Although the proportion of variation associated to the RNA Integrity Number was mild (2.1%, the significant impact of RNA quality on the expression of individual genes was observed. CONCLUSIONS: By characterizing the major sources of variation in blood gene expression profiles, such variability can be minimized by modifications to study designs. Increasing sample size, balancing confounding factors between study groups, using rigorous selection criteria for sample quality, and well controlled experimental processes will significantly improve the accuracy and reproducibility of blood transcriptome study.

  16. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.

    2002-01-01

    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  17. NMDA receptor gene variations as modifiers in Huntington disease: a replication study

    OpenAIRE

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN2A and GRIN2B in the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). The analyses did replicate the association reported between the GRIN2A rs2650427 variation and AO in the ...

  18. Genetic variation in telomere maintenance genes in relation to ovarian cancer survival.

    Science.gov (United States)

    Harris, Holly R; Vivo, Immaculata De; Titus, Linda J; Vitonis, Allison F; Wong, Jason Y Y; Cramer, Daniel W; Terry, Kathryn L

    2012-01-01

    Telomeres are repetitive non-coding DNA sequences at the ends of chromosomes that provide protection against chromosomal instability. Telomere length and stability are influenced by proteins, including telomerase which is partially encoded by the TERT gene. Genetic variation in the TERT gene is associated with ovarian cancer risk, and predicts survival in lung cancer and glioma. We investigated whether genetic variation in five telomere maintenance genes was associated with survival among 1480 cases of invasive epithelial ovarian cancer in the population-based New England Case-Control Study. Cox proportional hazard models were used to calculate hazard ratios and 95% confidence intervals. Overall we observed no significant associations between SNPs in telomere maintenance genes and mortality using a significance threshold of p=0.001. However, we observed some suggestive associations in subgroup analyses. Future studies with larger populations may further our understanding of what role telomeres play in ovarian cancer survival.

  19. [Diversity and genetic stability of yeast flocculation caused by variation of tandem repeats in yeast flocculin genes].

    Science.gov (United States)

    Yue, Feng; Guo, Xuena; He, Xiuping; Zhang, Borun

    2013-07-01

    Yeast flocculation is described as a reversible, asexual and calcium dependent process, in which cells adhere to form flocs by interaction of specific cell surface proteins named flocculins on yeast cells with mannose residues present on the cell wall of adjacent yeast cells. Yeast flocculation provides a very economical and convenient pathway for separation of yeast cells from the fermentation broth or removal of heavy metal ions from effluent. A large number of tandem repeats have been found in genes encoding flocculins, which not only have great regulatory effect on the structure and function of flocculins, generating the diversity of flocculation characteristics, but lead to genetic instability in flocculation as well for driving slippage and recombination reactions within and between FLO genes. Here, the research progress in effect of variation of tandem repeats in FLO genes on flocculation characteristics and genetic stability were reviewed to direct and promote the controllable application of flocculation in industrial fermentation process and environmental remediation.

  20. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Directory of Open Access Journals (Sweden)

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  1. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Science.gov (United States)

    Porto-Neto, Laercio R.; Fortes, Marina R. S.; McWilliam, Sean M.; Lehnert, Sigrid A.; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10−5). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  2. Copy number variation of KIR genes influences HIV-1 control

    DEFF Research Database (Denmark)

    Pelak, Kimberly; Need, Anna C; Fellay, Jacques;

    2011-01-01

    A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses...... the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3......DS1 count associates with a lower viral set point if its putative ligand is present (p = 0.00028), as does an increase in KIR3DL1 count in the presence of KIR3DS1 and appropriate ligands for both receptors (p = 0.0015). We further provide functional data that demonstrate that NK cells from...

  3. Copy number variation of KIR genes influences HIV-1 control

    DEFF Research Database (Denmark)

    Pelak, Kimberly; Need, Anna C; Fellay, Jacques

    2011-01-01

    A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses...... the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3...... individuals with multiple copies of KIR3DL1, in the presence of KIR3DS1 and the appropriate ligands, inhibit HIV-1 replication more robustly, and associated with a significant expansion in the frequency of KIR3DS1+, but not KIR3DL1+, NK cells in their peripheral blood. Our results suggest that the relative...

  4. Variation.

    Science.gov (United States)

    Hamilton City Board of Education (Ontario).

    Suggestions for studying the topic of variation of individuals and objects (balls) to help develop elementary school students' measurement, comparison, classification, evaluation, and data collection and recording skills are made. General suggestions of variables that can be investigated are made for the study of human variation. Twelve specific…

  5. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  6. Exploiting natural variation in Saccharomyces cerevisiae to identify genes for increased ethanol resistance.

    Science.gov (United States)

    Lewis, Jeffrey A; Elkon, Isaac M; McGee, Mick A; Higbee, Alan J; Gasch, Audrey P

    2010-12-01

    Ethanol production from lignocellulosic biomass holds promise as an alternative fuel. However, industrial stresses, including ethanol stress, limit microbial fermentation and thus prevent cost competitiveness with fossil fuels. To identify novel engineering targets for increased ethanol tolerance, we took advantage of natural diversity in wild Saccharomyces cerevisiae strains. We previously showed that an S288c-derived lab strain cannot acquire higher ethanol tolerance after a mild ethanol pretreatment, which is distinct from other stresses. Here, we measured acquired ethanol tolerance in a large panel of wild strains and show that most strains can acquire higher tolerance after pretreatment. We exploited this major phenotypic difference to address the mechanism of acquired ethanol tolerance, by comparing the global gene expression response to 5% ethanol in S288c and two wild strains. Hundreds of genes showed variation in ethanol-dependent gene expression across strains. Computational analysis identified several transcription factor modules and known coregulated genes as differentially expressed, implicating genetic variation in the ethanol signaling pathway. We used this information to identify genes required for acquisition of ethanol tolerance in wild strains, including new genes and processes not previously linked to ethanol tolerance, and four genes that increase ethanol tolerance when overexpressed. Our approach shows that comparative genomics across natural isolates can quickly identify genes for industrial engineering while expanding our understanding of natural diversity.

  7. Detection, Validation, and Downstream Analysis of Allelic Variation in Gene Expression

    Science.gov (United States)

    Ciobanu, Daniel C.; Lu, Lu; Mozhui, Khyobeni; Wang, Xusheng; Jagalur, Manjunatha; Morris, John A.; Taylor, William L.; Dietz, Klaus; Simon, Perikles; Williams, Robert W.

    2010-01-01

    Common sequence variants within a gene often generate important differences in expression of corresponding mRNAs. This high level of local (allelic) control—or cis modulation—rivals that produced by gene targeting, but expression is titrated finely over a range of levels. We are interested in exploiting this allelic variation to study gene function and downstream consequences of differences in expression dosage. We have used several bioinformatics and molecular approaches to estimate error rates in the discovery of cis modulation and to analyze some of the biological and technical confounds that contribute to the variation in gene expression profiling. Our analysis of SNPs and alternative transcripts, combined with eQTL maps and selective gene resequencing, revealed that between 17 and 25% of apparent cis modulation is caused by SNPs that overlap probes rather than by genuine quantitative differences in mRNA levels. This estimate climbs to 40–50% when qualitative differences between isoform variants are included. We have developed an analytical approach to filter differences in expression and improve the yield of genuine cis-modulated transcripts to ∼80%. This improvement is important because the resulting variation can be successfully used to study downstream consequences of altered expression on higher-order phenotypes. Using a systems genetics approach we show that two validated cis-modulated genes, Stk25 and Rasd2, are likely to control expression of downstream targets and affect disease susceptibility. PMID:19884314

  8. Variation of ant community structure on Ficus benguetensis

    Directory of Open Access Journals (Sweden)

    Shang-Yang Lin

    2016-03-01

    Full Text Available Although ants are commonly found on Ficus trees, information remains lacking on the pattern and diversity of the ant community visiting these trees. We hypothesize that dynamic changes in the availability and types of food can affect the composition as well as abundance of ant communities occurring on fig trees. To investigate the impact of resource availability, diversity, and variability on the ant community structure, we surveyed and recorded the fig phenology and ant abundance on 17 trees (11 male and six female trees of Ficus benguetensis in New Taipei City in northern Taiwan from 2011 to 2013. A total of 13 ant species were found on these fig trees, with 6 species more abundant than the others. The composition and relative abundance of the ant species occurring on F. benguetensis trees showed significant variations associated with tree sex, fig abundance, fig developmental phase, as well as temperature. A degree of dietary niche partitioning was also observed. We suggest that sexual differentiation in fig phenology plays a major role in controlling the availability and variance in food resources for ants, thereby shaping the complex ant communities foraging on F. benguetensis.

  9. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Directory of Open Access Journals (Sweden)

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  10. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  11. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    DEFF Research Database (Denmark)

    Song, H.; Hogdall, E.; Ramus, S.J.

    2008-01-01

    PURPOSE: Somatic alterations have been shown to correlate with ovarian cancer prognosis and survival, but less is known about the effects on survival of common inherited genetic variation. Of particular interest are genes involved in cell cycle pathways, which regulate cell division and could pla...

  12. Population structure of nuclear and mitochondrial DNA variation among humpback whales in the North Pacific.

    Science.gov (United States)

    Baker, C S; Medrano-Gonzalez, L; Calambokidis, J; Perry, A; Pichler, F; Rosenbaum, H; Straley, J M; Urban-Ramirez, J; Yamaguchi, M; von Ziegesar, O

    1998-06-01

    The population structure of variation in a nuclear actin intron and the control region of mitochondrial DNA is described for humpback whales from eight regions in the North Pacific Ocean: central California, Baja Peninsula, nearshore Mexico (Bahia Banderas), offshore Mexico (Socorro Island), southeastern Alaska, central Alaska (Prince Williams Sound), Hawaii and Japan (Ogasawara Islands). Primary mtDNA haplotypes and intron alleles were identified using selected restriction fragment length polymorphisms of target sequences amplified by the polymerase chain reaction (PCR-RFLP). There was little evidence of heterogeneity in the frequencies of mtDNA haplotypes or actin intron alleles due to the year or sex composition of the sample. However, frequencies of four mtDNA haplotypes showed marked regional differences in their distributions (phi ST = 0.277; P feeding grounds were selected for additional analyses of nuclear differentiation using allelic variation at four microsatellite loci. All four loci showed significant differences in allele frequencies (overall FST = 0.043; P feeding grounds were not panmictic for nuclear or mitochondrial loci, estimates of long-term migration rates suggested that male-mediated gene flow was several-fold greater than female gene flow. These results include and extend the range and sample size of previously published work, providing additional evidence for the significance of genetic management units within oceanic populations of humpback whales.

  13. Structural and Expressional Variations of the Mitochondrial Genome Conferring the Wild Abortive Type of Cytoplasmic Male Sterility in Rice

    Institute of Scientific and Technical Information of China (English)

    Zhen-Lan Liu; Hong Xu; Jing-Xin Guo; Yao-Guang Liu

    2007-01-01

    The so-called "wild abortive" (WA) type of cytoplasmic male sterility (CMS) derived from a wild rice species Oryza rufipogon has been extensively used for hybrid rice breeding. However, extensive analysis of the structure of the related mitochondrial genome has not been reported, and the CMS-associated gene(s) remain unknown. In this study, we exploited a mitochondrial genome-wide strategy to examine the structural and expressional variations in the mitochondrial genome conferring the CMS. The entire mitochondrial genomes of a CMS-WA line and two normal fertile rice lines were amplified by Long-polymerase chain reaction into tilling fragments of up to 15.2 kb. Restriction and DNA blotting analyses of these fragments revealed that structural variations occurred in several regions in the WA mitochondrial genome, as compared to those of the fertile lines. All of the amplified fragments covering the entire mitochondrial genome were used as RNA blot probes to examine the mitochondrial expression profile among the CMS-WA and fertile lines. As a result, only two mRNAs were found to be differentially expressed between the CMS-WA and the fertile lines, which were detected by a probe containing the nadS and orf153 genes and the other having the ribosomal protein gene rp15, respectively. These mRNAs are proposed to be the candidates for further identification and functional studies of the CMS gene.

  14. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Directory of Open Access Journals (Sweden)

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  15. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Science.gov (United States)

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  16. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  17. Gene expression profiles deciphering leaf senescence variation between early- and late-senescence cotton lines.

    Directory of Open Access Journals (Sweden)

    Xiangqiang Kong

    Full Text Available Leaf senescence varies greatly among genotypes of cotton (Gossypium hirsutium L, possibly due to the different expression of senescence-related genes. To determine genes involved in leaf senescence, we performed genome-wide transcriptional profiling of the main-stem leaves of an early- (K1 and a late-senescence (K2 cotton line at 110 day after planting (DAP using the Solexa technology. The profiling analysis indicated that 1132 genes were up-regulated and 455 genes down-regulated in K1 compared with K2 at 110 DAP. The Solexa data were highly consistent with, and thus were validated by those from real-time quantitative PCR (RT-PCR. Most of the genes related to photosynthesis, anabolism of carbohydrates and other biomolecules were down-regulated, but those for catabolism of proteins, nucleic acids, lipids and nutrient recycling were mostly up-regulated in K1 compared with K2. Fifty-one differently expressed hormone-related genes were identified, of which 5 ethylene, 3 brassinosteroid (BR, 5 JA, 18 auxin, 8 GA and 1 ABA related genes were up-regulated in K1 compared with K2, indicating that these hormone-related genes might play crucial roles in early senescence of K1 leaves. Many differently expressed transcription factor (TF genes were identified and 11 NAC and 8 WRKY TF genes were up-regulated in K1 compared with K2, suggesting that TF genes, especially NAC and WRKY genes were involved in early senescence of K1 leaves. Genotypic variation in leaf senescence was attributed to differently expressed genes, particularly hormone-related and TF genes.

  18. Genetic variation of the IL-28B promoter affecting gene expression.

    Directory of Open Access Journals (Sweden)

    Masaya Sugiyama

    Full Text Available The current standard of care for the treatment of chronic hepatitis C is pegylated interferon-α (PEG-IFNα and ribavirin (RBV. The treatment achieves a sustained viral clearance in only approximately 50% of patients. Recent whole genome association studies revealed that single nucleotide polymorphisms (SNPs around IL-28B have been associated with response to the standard therapy and could predict treatment responses at approximately 80%. However, it is not clear which SNP is most informative because the genomic region containing significant SNPs shows strong linkage disequilibrium. We focused on SNPs in close proximity to the IL-28B gene to evaluate the function of each and identify the SNP affecting the IL-28B expression level most. The structures of IL-28A/B from 5' to 3'-UTR were determined by complete cDNA cloning. Both IL-28A and 28B genes consisted of 6 exons, differing from the CCDS data of NCBI. Two intron SNPs and a nonsynonymous SNP did not affect IL-28B gene function and expression levels but a SNP located in the proximal promoter region influenced gene expression. A (TA dinucleotide repeat, rs72258881, located in the promoter region was discovered by our functional studies of the proximal SNPs upstream of IL-28B; the transcriptional activity of the promoter increased gradually in a (TA(n length-dependent manner following IFN-α and lipopolysaccharide stimulation. Healthy Japanese donors exhibited a broad range of (TA dinucleotide repeat numbers from 10 to 18 and the most prevalent genotype was 12/12 (75%, differing from the database (13/13. However, genetic variation of IL-28A corresponding to that of IL-28B was not detected in these Japanese donors. These findings suggest that the dinucleotide repeat could be associated with the transcriptional activity of IL-28B as well as being a marker to improve the prediction of the response to interferon-based hepatitis C virus treatment.

  19. Variation in gene expression patterns in effusions and primary tumors from serous ovarian cancer patients

    Directory of Open Access Journals (Sweden)

    Tropè Claes G

    2005-07-01

    Full Text Available Abstract Background While numerous studies have characterized primary ovarian tumors, little information is available regarding expression patterns of metastatic sites of this cancer. To define sets of genes that distinguish primary and metastatic ovarian tumors, we used cDNA microarrays to characterize global gene expression patterns in 38 effusions (28 peritoneal, 10 pleural and 8 corresponding primary ovarian tumors, and searched for associations between expression patterns and clinical parameters. Results We observed multidimensional variation in expression patterns among the cancers. Coordinate variation in expression of genes from two chromosomal regions, 8q and 19q, was seen in subsets of the cancers indicating possible amplifications in these regions. A set of 112 unique genes of known function was differentially expressed between primary tumors and effusions using supervised analysis. Relatively few differences were seen between effusions isolated from the pleural and peritoneal cavities or between effusions from patients diagnosed with stage III and stage IV cancers. A set of 84 unique genes was identified that distinguished high from lower grade ovarian cancers. The results were corroborated using immunocytochemistry, mRNA in situ hybridization, and immunoblotting. Conclusion The extensive variation in expression patterns observed underscores the molecular heterogeneity of ovarian cancer, but suggests a similar molecular profile for ovarian carcinoma cells in serosal cavities.

  20. Evidence of novel fine-scale structural variation at autism spectrum disorder candidate loci

    Directory of Open Access Journals (Sweden)

    Hedges Dale J

    2012-04-01

    Full Text Available Abstract Background Autism spectrum disorders (ASD represent a group of neurodevelopmental disorders characterized by a core set of social-communicative and behavioral impairments. Gamma-aminobutyric acid (GABA is the major inhibitory neurotransmitter in the brain, acting primarily via the GABA receptors (GABR. Multiple lines of evidence, including altered GABA and GABA receptor expression in autistic patients, indicate that the GABAergic system may be involved in the etiology of autism. Methods As copy number variations (CNVs, particularly rare and de novo CNVs, have now been implicated in ASD risk, we examined the GABA receptors and genes in related pathways for structural variation that may be associated with autism. We further extended our candidate gene set to include 19 genes and regions that had either been directly implicated in the autism literature or were directly related (via function or ancestry to these primary candidates. For the high resolution CNV screen we employed custom-designed 244 k comparative genomic hybridization (CGH arrays. Collectively, our probes spanned a total of 11 Mb of GABA-related and additional candidate regions with a density of approximately one probe every 200 nucleotides, allowing a theoretical resolution for detection of CNVs of approximately 1 kb or greater on average. One hundred and sixty-eight autism cases and 149 control individuals were screened for structural variants. Prioritized CNV events were confirmed using quantitative PCR, and confirmed loci were evaluated on an additional set of 170 cases and 170 control individuals that were not included in the original discovery set. Loci that remained interesting were subsequently screened via quantitative PCR on an additional set of 755 cases and 1,809 unaffected family members. Results Results include rare deletions in autistic individuals at JAKMIP1, NRXN1, Neuroligin4Y, OXTR, and ABAT. Common insertion/deletion polymorphisms were detected at several

  1. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  2. Prosomes. Ubiquity and inter-species structural variation.

    Science.gov (United States)

    Martins de Sa, C; Grossi de Sa, M F; Akhayat, O; Broders, F; Scherrer, K; Horsch, A; Schmid, H P

    1986-02-20

    that, in its structural variations shown here, reflects function and species.

  3. Poly(T) variation within mitochondrial protein-coding genes in Globodera (Nematoda: Heteroderidae).

    Science.gov (United States)

    Riepsamen, Angelique H; Blok, Vivian C; Phillips, Mark; Gibson, Tracey; Dowton, Mark

    2008-03-01

    We sequenced a mitochondrial subgenome from the nematode Globodera rostochiensis, in two overlapping pieces. The subgenome was 9210 bp and contained four protein-coding genes (ND4, COIII, ND3, Cytb) and two tRNA genes (tRNA(Thr), tRNA(Gln)). Genome organization was similar to that of Globodera pallida, which is multipartite. Together with the small number of genes on this subgenome, this suggests that the mitochondrial genome of G. rostochiensis is also multipartite. In the initial clones sequenced, COIII and ND3 were full-length, while ND4 and Cytb were interrupted by premature stop codons and contained point indels that disrupted the reading frame. However, sequencing of multiple clones, from DNA extracted both from multiple individuals and from single cysts, revealed a predominant source of variation-in the length of polythymidine tracts. Comparison of our genomic sequences with ESTs similarly revealed variation in the length of polythymidine tracts. We subsequently sequenced both genomic DNA and mRNA from populations of G. pallida. In each case, variation in the length of polythymidine tracts was observed. The levels of expression of mitochondrial genes in G. pallida were representative of the subgenomes present: little evidence of differential expression was observed. These observations are consistent with the operation of posttranscriptional editing in Globodera mitochondria, although this is difficult to show conclusively in the presence of intraindividual gene sequence variation. Further, alternative explanations cannot be discounted; these include the operation of slippage during translation or that genomic copies of most genes are pseudogenes with a small proportion of full-length sequences able to maintain mitochondrial function.

  4. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  5. Assessing the Association of Mitochondrial Genetic Variation With Primary Open-Angle Glaucoma Using Gene-Set Analyses.

    Science.gov (United States)

    Khawaja, Anthony P; Cooke Bailey, Jessica N; Kang, Jae Hee; Allingham, R Rand; Hauser, Michael A; Brilliant, Murray; Budenz, Donald L; Christen, William G; Fingert, John; Gaasterland, Douglas; Gaasterland, Terry; Kraft, Peter; Lee, Richard K; Lichter, Paul R; Liu, Yutao; Medeiros, Felipe; Moroi, Syoko E; Richards, Julia E; Realini, Tony; Ritch, Robert; Schuman, Joel S; Scott, William K; Singh, Kuldev; Sit, Arthur J; Vollrath, Douglas; Wollstein, Gadi; Zack, Donald J; Zhang, Kang; Pericak-Vance, Margaret; Weinreb, Robert N; Haines, Jonathan L; Pasquale, Louis R; Wiggs, Janey L

    2016-09-01

    Recent studies indicate that mitochondrial proteins may contribute to the pathogenesis of primary open-angle glaucoma (POAG). In this study, we examined the association between POAG and common variations in gene-encoding mitochondrial proteins. We examined genetic data from 3430 POAG cases and 3108 controls derived from the combination of the GLAUGEN and NEIGHBOR studies. We constructed biological-system coherent mitochondrial nuclear-encoded protein gene-sets by intersecting the MitoCarta database with the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. We examined the mitochondrial gene-sets for association with POAG and with normal-tension glaucoma (NTG) and high-tension glaucoma (HTG) subsets using Pathway Analysis by Randomization Incorporating Structure. We identified 22 KEGG pathways with significant mitochondrial protein-encoding gene enrichment, belonging to six general biological classes. Among the pathway classes, mitochondrial lipid metabolism was associated with POAG overall (P = 0.013) and with NTG (P = 0.0006), and mitochondrial carbohydrate metabolism was associated with NTG (P = 0.030). Examining the individual KEGG pathway mitochondrial gene-sets, fatty acid elongation and synthesis and degradation of ketone bodies, both lipid metabolism pathways, were significantly associated with POAG (P = 0.005 and P = 0.002, respectively) and NTG (P = 0.0004 and P < 0.0001, respectively). Butanoate metabolism, a carbohydrate metabolism pathway, was significantly associated with POAG (P = 0.004), NTG (P = 0.001), and HTG (P = 0.010). We present an effective approach for assessing the contributions of mitochondrial genetic variation to open-angle glaucoma. Our findings support a role for mitochondria in POAG pathogenesis and specifically point to lipid and carbohydrate metabolism pathways as being important.

  6. SoftSearch: integration of multiple sequence features to identify breakpoints of structural variations.

    Directory of Open Access Journals (Sweden)

    Steven N Hart

    Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.

  7. Antigenic variation in Plasmodium falciparum malaria involves a highly structured switching pattern.

    Directory of Open Access Journals (Sweden)

    Mario Recker

    2011-03-01

    Full Text Available Many pathogenic bacteria, fungi, and protozoa achieve chronic infection through an immune evasion strategy known as antigenic variation. In the human malaria parasite Plasmodium falciparum, this involves transcriptional switching among members of the var gene family, causing parasites with different antigenic and phenotypic characteristics to appear at different times within a population. Here we use a genome-wide approach to explore this process in vitro within a set of cloned parasite populations. Our analyses reveal a non-random, highly structured switch pathway where an initially dominant transcript switches via a set of switch-intermediates either to a new dominant transcript, or back to the original. We show that this specific pathway can arise through an evolutionary conflict in which the pathogen has to optimise between safeguarding its limited antigenic repertoire and remaining capable of establishing infections in non-naïve individuals. Our results thus demonstrate a crucial role for structured switching during the early phases of infections and provide a unifying theory of antigenic variation in P. falciparum malaria as a balanced process of parasite-intrinsic switching and immune-mediated selection.

  8. Gene expression and variation in social aggression by queens of the harvester ant Pogonomyrmex californicus.

    Science.gov (United States)

    Helmkampf, Martin; Mikheyev, Alexander S; Kang, Yun; Fewell, Jennifer; Gadau, Jürgen

    2016-08-01

    A key requirement for social cooperation is the mitigation and/or social regulation of aggression towards other group members. Populations of the harvester ant Pogonomyrmex californicus show the alternate social phenotypes of queens founding nests alone (haplometrosis) or in groups of unrelated yet cooperative individuals (pleometrosis). Pleometrotic queens display an associated reduction in aggression. To understand the proximate drivers behind this variation, we placed foundresses of the two populations into social environments with queens from the same or the alternate population, and measured their behaviour and head gene expression profiles. A proportion of queens from both populations behaved aggressively, but haplometrotic queens were significantly more likely to perform aggressive acts, and conflict escalated more frequently in pairs of haplometrotic queens. Whole-head RNA sequencing revealed variation in gene expression patterns, with the two populations showing moderate differentiation in overall transcriptional profile, suggesting that genetic differences underlie the two founding strategies. The largest detected difference, however, was associated with aggression, regardless of queen founding type. Several modules of coregulated genes, involved in metabolism, immune system and neuronal function, were found to be upregulated in highly aggressive queens. Conversely, nonaggressive queens exhibited a striking pattern of upregulation in chemosensory genes. Our results highlight that the social phenotypes of cooperative vs. solitary nest founding tap into a set of gene regulatory networks that seem to govern aggression level. We also present a number of highly connected hub genes associated with aggression, providing opportunity to further study the genetic underpinnings of social conflict and tolerance.

  9. Identifying the genetic variation of gene expression using gene sets: application of novel gene Set eQTL approach to PharmGKB and KEGG.

    Directory of Open Access Journals (Sweden)

    Ryan Abo

    Full Text Available Genetic variation underlying the regulation of mRNA gene expression in humans may provide key insights into the molecular mechanisms of human traits and complex diseases. Current statistical methods to map genetic variation associated with mRNA gene expression have typically applied standard linkage and/or association methods; however, when genome-wide SNP and mRNA expression data are available performing all pair wise comparisons is computationally burdensome and may not provide optimal power to detect associations. Consideration of different approaches to account for the high dimensionality and multiple testing issues may provide increased efficiency and statistical power. Here we present a novel approach to model and test the association between genetic variation and mRNA gene expression levels in the context of gene sets (GSs and pathways, referred to as gene set - expression quantitative trait loci analysis (GS-eQTL. The method uses GSs to initially group SNPs and mRNA expression, followed by the application of principal components analysis (PCA to collapse the variation and reduce the dimensionality within the GSs. We applied GS-eQTL to assess the association between SNP and mRNA expression level data collected from a cell-based model system using PharmGKB and KEGG defined GSs. We observed a large number of significant GS-eQTL associations, in which the most significant associations arose between genetic variation and mRNA expression from the same GS. However, a number of associations involving genetic variation and mRNA expression from different GSs were also identified. Our proposed GS-eQTL method effectively addresses the multiple testing limitations in eQTL studies and provides biological context for SNP-expression associations.

  10. Spiral structures and regularities in magnetic field variations and auroras

    Directory of Open Access Journals (Sweden)

    Y. I. Feldstein

    2012-02-01

    Full Text Available The conception of spiral shaped precipitation regions, where solar corpuscles penetrate the upper atmosphere, was introduced into geophysics by C. Störmer and K. Birkeland at the beginning of the last century. Later, in the course of the XX-th century, spiral distributions were disclosed and studied in various geophysical phenomena. Most attention was devoted to spiral shapes in the analysis of regularities pertaining to the geomagnetic activity and auroras.

    We review the historical succession of perceptions about the number and positions of spiral shapes, that characterize the spatial-temporal distribution of magnetic disturbances. We describe the processes in the upper atmosphere, which are responsible for the appearance of spiral patterns. We considered the zones of maximal aurora frequency and of maximal particle precipitation intensity, as offered in the literature, in their connection with the spirals.

    We discuss the current system model, that is closely related to the spirals and that appears to be the source for geomagnetic field variations during magnetospheric substorms and storms. The currents in ionosphere and magnetosphere constitute together with field-aligned (along the geomagnetic field lines currents (FACs a common 3-D current system. At ionospheric heights, the westward and eastward electrojets represent characteristic elements of the current system. The westward electrojet covers the longitudinal range from the morning to the evening hours, while the eastward electrojet ranges from afternoon to near-midnight hours. The polar electrojet is positioned in the dayside sector at cusp latitudes. All these electrojets map along the magnetic field lines to certain plasma structures in the near-Earth space. The first spiral distribution of auroras was found based on observations in Antarctica for the nighttime-evening sector (N-spiral, and later in the nighttime-evening (N-spiral and morning (M-spiral sectors both in

  11. Variation in the OC locus of Acinetobacter baumannii genomes predicts extensive structural diversity in the lipooligosaccharide.

    Directory of Open Access Journals (Sweden)

    Johanna J Kenyon

    Full Text Available Lipooligosaccharide (LOS is a complex surface structure that is linked to many pathogenic properties of Acinetobacter baumannii. In A. baumannii, the genes responsible for the synthesis of the outer core (OC component of the LOS are located between ilvE and aspS. The content of the OC locus is usually variable within a species, and examination of 6 complete and 227 draft A. baumannii genome sequences available in GenBank non-redundant and Whole Genome Shotgun databases revealed nine distinct new types, OCL4-OCL12, in addition to the three known ones. The twelve gene clusters fell into two distinct groups, designated Group A and Group B, based on similarities in the genes present. OCL6 (Group B was unique in that it included genes for the synthesis of L-Rhamnosep. Genetic exchange of the different configurations between strains has occurred as some OC forms were found in several different sequence types (STs. OCL1 (Group A was the most widely distributed being present in 18 STs, and OCL6 was found in 16 STs. Variation within clones was also observed, with more than one OC locus type found in the two globally disseminated clones, GC1 and GC2, that include the majority of multiply antibiotic resistant isolates. OCL1 was the most abundant gene cluster in both GC1 and GC2 genomes but GC1 isolates also carried OCL2, OCL3 or OCL5, and OCL3 was also present in GC2. As replacement of the OC locus in the major global clones indicates the presence of sub-lineages, a PCR typing scheme was developed to rapidly distinguish Group A and Group B types, and to distinguish the specific forms found in GC1 and GC2 isolates.

  12. Natural variation for gene expression responses to abiotic stress in maize.

    Science.gov (United States)

    Waters, Amanda J; Makarevitch, Irina; Noshay, Jaclyn; Burghardt, Liana T; Hirsch, Candice N; Hirsch, Cory D; Springer, Nathan M

    2017-02-01

    Plants respond to abiotic stress through a variety of physiological, biochemical, and transcriptional mechanisms. Many genes exhibit altered levels of expression in response to abiotic stress, which requires concerted action of both cis- and trans-regulatory features. In order to study the variability in transcriptome response to abiotic stress, RNA sequencing was performed using 14-day-old maize seedlings of inbreds B73, Mo17, Oh43, PH207 and B37 under control, cold and heat conditions. Large numbers of genes that responded differentially to stress between parental inbred lines were identified. RNA sequencing was also performed on similar tissues of the F1 hybrids produced by crossing B73 and each of the three other inbred lines. By evaluating allele-specific transcript abundance in the F1 hybrids, we were able to measure the abundance of cis- and trans-regulatory variation between genotypes for both steady-state and stress-responsive expression differences. Although examples of trans-regulatory variation were observed, cis-regulatory variation was more common for both steady-state and stress-responsive expression differences. The genes with cis-allelic variation for response to cold or heat stress provided an opportunity to study the basis for regulatory diversity.

  13. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    Science.gov (United States)

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, ppopulation. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  14. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  15. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  16. Effects of Genetic Drift and Gene Flow on the Selective Maintenance of Genetic Variation

    OpenAIRE

    Star, Bastiaan; Spencer, Hamish G.

    2013-01-01

    Explanations for the genetic variation ubiquitous in natural populations are often classified by the population–genetic processes they emphasize: natural selection or mutation and genetic drift. Here we investigate models that incorporate all three processes in a spatially structured population, using what we call a construction approach, simulating finite populations under selection that are bombarded with a steady stream of novel mutations. As expected, the amount of genetic variation compa...

  17. Conceptual Variation in the Depiction of Gene Function in Upper Secondary School Textbooks

    Science.gov (United States)

    Gericke, Niklas Markus; Hagberg, Mariana

    2010-10-01

    This paper explores conceptual variation in the depiction of gene function in upper secondary school textbooks. Historically, concepts in genetics have developed in various scientific frameworks, which has led to a level of incommensurability as concepts have changed over time within their respective frameworks. Since students may have difficulties in understanding concepts where there is implicit variation in descriptions of the same phenomena, we have developed a concept mapping instrument and applied it to study the gene function concepts in biology and chemistry textbooks that are widely used in Sweden, and others used in a selection of English speaking countries. The data were then further examined using content analysis. In the present paper we describe the conceptual variation of gene function as it is presented in the textbooks, and analyze the ways in which students’ understanding may be influenced. We conclude that it may be difficult for students to gain a modern, process-oriented understanding of gene function if textbooks are used as foundations for the planning and execution of lessons.

  18. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey

    2016-06-01

    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  19. Copy Number Variation of UGT 2B Genes in Indian Families Using Whole Genome Scans

    Directory of Open Access Journals (Sweden)

    Avinash M. Veerappa

    2016-01-01

    Full Text Available Background and Objectives. Uridine diphospho-glucuronosyltransferase 2B (UGT2B is a family of genes involved in metabolizing steroid hormones and several other xenobiotics. These UGT2B genes are highly polymorphic in nature and have distinct polymorphisms associated with specific regions around the globe. Copy number variations (CNVs status of UGT2B17 in Indian population is not known and their disease associations have been inconclusive. It was therefore of interest to investigate the CNV profile of UGT2B genes. Methods. We investigated the presence of CNVs in UGT2B genes in 31 members from eight Indian families using Affymetrix Genome-Wide Human SNP Array 6.0 chip. Results. Our data revealed >50% of the study members carried CNVs in UGT2B genes, of which 76% showed deletion polymorphism. CNVs were observed more in UGT2B17 (76.4% than in UGT2B15 (17.6%. Molecular network and pathway analysis found enrichment related to steroid metabolic process, carboxylesterase activity, and sequence specific DNA binding. Interpretation and Conclusion. We report the presence of UGT2B gene deletion and duplication polymorphisms in Indian families. Network analysis indicates the substitutive role of other possible genes in the UGT activity. The CNVs of UGT2B genes are very common in individuals indicating that the effect is neutral in causing any suspected diseases.

  20. Novel Register Sharing in Datapath for Structural Robustness against Delay Variation

    OpenAIRE

    Inoue, Keisuke; KANEKO, Mineo; Iwagaki, Tsuyoshi

    2008-01-01

    As the feature size of VLSI becomes smaller, delay variations become a serious problem in VLSI. In this paper, we propose a novel class of robustness for a datapath against delay variations, which is named structural robustness against delay variation (SRV), and propose sufficient conditions for a datapath to have SRV. A resultant circuit designed under these conditions has a larger timing margin to delay variations than previous designs without sacrificing effective computation time. In addi...

  1. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  2. Supplementary Material for: Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody

    2016-01-01

    Abstract Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  3. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga

    2009-01-01

    -binding protein), which is induced by glucose, and SREBP-1 (sterol response element-binding protein-1), which is stimulated by insulin through the PI3K/Akt signal transduction pathway. We investigated whether the genetic variability of the genes encoding for ChREBP, SREBP and FAS (respectively, MLXIPL, SREBF1...... and FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall...

  4. Variational analysis of the disc-loaded waveguide slow-wave structures

    Institute of Scientific and Technical Information of China (English)

    Li Jian-Qing; Mo Yuan-Long

    2005-01-01

    The variational method is applied to calculate the dispersion characteristics of disc-loaded waveguide slow-wave structures. The parameters describing the waveguide discontinuities in disc-loaded waveguide are calculated by the variational method. Then the dispersion characteristics of slow-wave structures are obtained using lossless microwave quadrupole theory. Good agreement was observed between results of the variational method and those of field matching method and high frequency structure simulator. In the case of broad band, results of the variational method are better than those of field matching method.

  5. Chloroplast gene arrangement variation within a closely related group of green algae (Trebouxiophyceae, Chlorophyta).

    Science.gov (United States)

    Letsch, Molly R; Lewis, Louise A

    2012-09-01

    The 22 published chloroplast genomes of green algae, representing sparse taxonomic sampling of diverse lineages that span over one billion years of evolution, each possess a unique gene arrangement. In contrast, many of the >190 published embryophyte (land plant) chloroplast genomes have relatively conserved architectures. To determine the phylogenetic depth at which chloroplast gene rearrangements occur in green algae, a 1.5-4 kb segment of the chloroplast genome was compared across nine species in three closely related genera of Trebouxiophyceae (Chlorophyta). In total, four distinct gene arrangements were obtained for the three genera Elliptochloris, Hemichloris, and Coccomyxa. In Elliptochloris, three distinct chloroplast gene arrangements were detected, one of which is shared with members of its sister genus Hemichloris. Both species of Coccomyxa examined share the fourth arrangement of this genome region, one characterized by very long spacers. Next, the order of genes found in this segment of the chloroplast genome was compared across green algae and land plants. As taxonomic ranks are not equivalent among different groups of organisms, the maximum molecular divergence among taxa sharing a common gene arrangement in this genome segment was compared. Well-supported clades possessing a single gene order had similar phylogenetic depth in green algae and embryophytes. When the dominant gene order of this chloroplast segment in embryophytes was assumed to be ancestral for land plants, the maximum molecular divergence was found to be over two times greater in embryophytes than in trebouxiophyte green algae. This study greatly expands information about chloroplast genome variation in green algae, is the first to demonstrate such variation among congeneric green algae, and further illustrates the fluidity of green algal chloroplast genome architecture in comparison to that of many embryophytes.

  6. Threshold-dominated regulation hides genetic variation in gene expression networks

    Directory of Open Access Journals (Sweden)

    Plahte Erik

    2007-12-01

    Full Text Available Abstract Background In dynamical models with feedback and sigmoidal response functions, some or all variables have thresholds around which they regulate themselves or other variables. A mathematical analysis has shown that when the dose-response functions approach binary or on/off responses, any variable with an equilibrium value close to one of its thresholds is very robust to parameter perturbations of a homeostatic state. We denote this threshold robustness. To check the empirical relevance of this phenomenon with response function steepnesses ranging from a near on/off response down to Michaelis-Menten conditions, we have performed a simulation study to investigate the degree of threshold robustness in models for a three-gene system with one downstream gene, using several logical input gates, but excluding models with positive feedback to avoid multistationarity. Varying parameter values representing functional genetic variation, we have analysed the coefficient of variation (CV of the gene product concentrations in the stable state for the regulating genes in absolute terms and compared to the CV for the unregulating downstream gene. The sigmoidal or binary dose-response functions in these models can be considered as phenomenological models of the aggregated effects on protein or mRNA expression rates of all cellular reactions involved in gene expression. Results For all the models, threshold robustness increases with increasing response steepness. The CVs of the regulating genes are significantly smaller than for the unregulating gene, in particular for steep responses. The effect becomes less prominent as steepnesses approach Michaelis-Menten conditions. If the parameter perturbation shifts the equilibrium value too far away from threshold, the gene product is no longer an effective regulator and robustness is lost. Threshold robustness arises when a variable is an active regulator around its threshold, and this function is maintained by

  7. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  8. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    OpenAIRE

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  9. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Directory of Open Access Journals (Sweden)

    Slavé Petrovski

    2015-09-01

    Full Text Available Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS, termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1 genes that are known to cause disease through haploinsufficiency, 2 genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3 genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4 genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding

  10. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Science.gov (United States)

    Petrovski, Slavé; Gussow, Ayal B; Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H; Allen, Andrew S; Goldstein, David B

    2015-09-01

    Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, nc

  11. Genome-Wide Mapping of Structural Variations Reveals a Copy Number Variant That Determines Reproductive Morphology in Cucumber.

    Science.gov (United States)

    Zhang, Zhonghua; Mao, Linyong; Chen, Huiming; Bu, Fengjiao; Li, Guangcun; Sun, Jinjing; Li, Shuai; Sun, Honghe; Jiao, Chen; Blakely, Rachel; Pan, Junsong; Cai, Run; Luo, Ruibang; Van de Peer, Yves; Jacobsen, Evert; Fei, Zhangjun; Huang, Sanwen

    2015-06-01

    Structural variations (SVs) represent a major source of genetic diversity. However, the functional impact and formation mechanisms of SVs in plant genomes remain largely unexplored. Here, we report a nucleotide-resolution SV map of cucumber (Cucumis sativas) that comprises 26,788 SVs based on deep resequencing of 115 diverse accessions. The largest proportion of cucumber SVs was formed through nonhomologous end-joining rearrangements, and the occurrence of SVs is closely associated with regions of high nucleotide diversity. These SVs affect the coding regions of 1676 genes, some of which are associated with cucumber domestication. Based on the map, we discovered a copy number variation (CNV) involving four genes that defines the Female (F) locus and gives rise to gynoecious cucumber plants, which bear only female flowers and set fruit at almost every node. The CNV arose from a recent 30.2-kb duplication at a meiotically unstable region, likely via microhomology-mediated break-induced replication. The SV set provides a snapshot of structural variations in plants and will serve as an important resource for exploring genes underlying key traits and for facilitating practical breeding in cucumber.

  12. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  13. Regulation of flowering in rice: two florigen genes, a complex gene network, and natural variation.

    Science.gov (United States)

    Tsuji, Hiroyuki; Taoka, Ken-ichiro; Shimamoto, Ko

    2011-02-01

    Photoperiodic control of flowering time consists of a complicated network that converges into the generation of a mobile flowering signal called florigen. Recent advances identifying the protein FT/Hd3a as the molecular nature responsible for florigen activity have focused current research on florigen genes as the important output of this complex signaling network. Rice is a model system for short-day plants and recent progress in elucidating the flowering network from rice and Arabidopsis, a long-day plant, provides an evolutionarily comparative view of the photoperiodic flowering pathway. This review summarizes photoperiodic flowering control in rice, including the interaction of complex layers of gene networks contributed from evolutionarily unique factors and the regulatory adaptation of conserved factors.

  14. Genetic variations of glycinin subunit genes among cultivated and wild type soybean species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Glycinin is a predominant storage protein in most soybean accessions. It is a hexamer constituted by five major subunits, which can be classified into two groups. Group Ⅰ contains Gl, G2 and G3, and Group Ⅱ contains G4 and G5. The genes encoding these subunits have been designated from Gyl to Gy5, respectively. In the present study, Gyl genomic fragments were cloned from wild accessions of subgenera Glycine glycine, Glycine soja and a cultivar of Glycine max. Their sequences and the deduced amino acid sequences were compared. The residues critical for assembling of G1 subunits from the wild perennial accession were conservative. The Gy4 fragments were cloned from two wild perennial accessions and compared with that from subgenus Soja. The intron 3 of Gy4 had abundant variations between the subgenera G. Soja and G. Glycine as well as within the subgenus G. Glycine. Abundant variations existed in the disordered regions 3 and 4 of G4 subunits from two wild perennial accessions. The genomic organization of glycinin genes was analyzed in 19 accessions from subgenera Soja and Glycine. The hybridization patterns were identical among the accessions of subgenus Soja. On the contrary, abundant polymorphisms existed between the accessions from subgenus Glycine. These results indicated that glycinin genes have high degree of conservation within subgenus Soja but more variations within subgenus Glycine.

  15. Novel rare variations of the oxytocin receptor (OXTR) gene in autism spectrum disorder individuals.

    Science.gov (United States)

    Liu, Xiaoxi; Kawashima, Minae; Miyagawa, Taku; Otowa, Takeshi; Latt, Khun Zaw; Thiri, Myo; Nishida, Hisami; Sugiyama, Toshiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Mabuchi, Akihiko; Tokunaga, Katsushi; Sasaki, Tsukasa

    2015-01-01

    The oxytocin receptor (OXTR) gene has been implicated as a risk gene for autism spectrum disorder (ASD)-a neurodevelopmental disorder with essential features of impairments in social communication and reciprocal interaction. The genetic associations between common variations in OXTR and ASD have been reported in multiple ethnic populations. However, little is known about the distribution of rare variations within OXTR in ASD patients. In this study, we resequenced the full length of OXTR in 105 ASD individuals using an approach that combined the power of next-generation sequencing technology, long-range PCR and DNA pooling. We demonstrated that rare variants with minor allele frequency as low as 0.05% could be reliably detected by our method. We identified 28 novel variants including potential functional variants in the intron region and one rare missense variant (R150S). We subsequently performed Sanger sequencing and validated five novel variants located in previously suggested candidate regions in ASD individuals. Further sequencing of 312 healthy subjects showed that the burden of rare variants is significantly higher in ASDs compared with healthy individuals. Our results support that the rare variation in OXTR gene might be involved in ASD.

  16. Effects of abhydrolase domain containing 5 gene (ABHD5) expression and variations on chicken fat metabolism.

    Science.gov (United States)

    Ouyang, Hongjia; Liu, Qing; Xu, Jiguo; Zeng, Fang; Pang, Xiaolin; Jebessa, Endashaw; Liang, Shaodong; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    Abhydrolase domain containing 5 gene (ABHD5), also known as comparative gene identification 58 (CGI-58), is a member of the α/β-hydrolase family as a protein cofactor of ATGL stimulating its triacylglycerol hydrolase activity. In this study, we aim to characterize the expression and variations of ABHD5 and to study their functions in chicken fat metabolism. We compared the ABHD5 expression level in various tissues and under different nutrition conditions, identified the variations of ABHD5, and associated them with production traits in an F2 resource population of chickens. Overexpression analysis with two different genotypes and siRNA interfering analysis of ABHD5 were performed in chicken preadipocytes. Chicken ABDH5 was expressed widely and most predominantly in adipose tissue. Five SNPs of the ABHD5 gene were identified and genotyped in the F2 resource population. The c.490C > T SNP was associated with subcutaneous fat thickness (P  C SNP was also associated with chicken body weight (P chicken preadipocytes, overexpression of wild type ABDH5 did not affect the mRNA level of ATGL (adipose triglyceride lipase) but markedly decreased (P chickens with a high fat diet. These results suggest that expression and variations of ABHD5 may affect fat metabolism through regulating the activity of ATGL in chickens.

  17. Contribution of haplotypes across the fibrinogen gene cluster to variation in risk of myocardial infarction.

    Science.gov (United States)

    Mannila, Maria Nastase; Eriksson, Per; Lundman, Pia; Samnegård, Ann; Boquist, Susanna; Ericsson, Carl-Göran; Tornvall, Per; Hamsten, Anders; Silveira, Angela

    2005-03-01

    Fibrinogen has consistently been recognized as an independent predictor of myocardial infarction (MI). Multiple mechanisms link fibrinogen to MI; therefore disentangling the factors underlying variation in plasma fibrinogen concentration is essential. Candidate regions in the fibrinogen gamma (FGG), alpha (FGA) and beta (FGB) genes were screened for single nucleotide polymorphisms (SNPs). Several novel SNPs were detected in the FGG and FGA genes in addition to the previously known SNPs in the fibrinogen genes. Tight linkage disequilibrium extending over various physical distances was observed between most SNPs. Consequently, eight SNPs were chosen and determined in 377 postinfarction patients and 387 healthy individuals. None of the SNPs were associated with plasma fibrinogen concentration or MI. Haplotype analyses revealed a consistent pattern of haplotypes associated with variation in risk of MI. Of the four haplotypes inferred using the FGA -58G>A and FGG 1299 +79T>C SNPs, the most frequent haplotype, FGG-FGA*1 (prevalence 46.6%), was associated with increased risk of MI (OR 1.51; 95%CI 1.18, 1.93), whereas the least frequent haplotype, FGG-FGA*4 (11.8%), was associated with lower risk of MI (OR 0.79 95%CI 0.64, 0.98). In conclusion, fibrinogen haplotypes, but not SNPs in isolation, are associated with variation in risk of MI.

  18. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Directory of Open Access Journals (Sweden)

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  19. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  20. A preliminary investigation into the genetic variation and population structure of Taenia hydatigena from Sardinia, Italy.

    Science.gov (United States)

    Boufana, Belgees; Scala, Antonio; Lahmar, Samia; Pointing, Steve; Craig, Philip S; Dessì, Giorgia; Zidda, Antonella; Pipia, Anna Paola; Varcasia, Antonio

    2015-11-30

    Cysticercosis caused by the metacestode stage of Taenia hydatigena is endemic in Sardinia. Information on the genetic variation of this parasite is important for epidemiological studies and implementation of control programs. Using two mitochondrial genes, the cytochrome c oxidase subunit 1 (cox1) and the NADH dehydrogenase subunit 1 (ND1) we investigated the genetic variation and population structure of Cysticercus tenuicollis from Sardinian intermediate hosts and compared it to that from other hosts from various geographical regions. The parsimony cox1 network analysis indicated the existence of a common lineage for T. hydatigena and the overall diversity and neutrality indices indicated demographic expansion. Using the cox1 sequences, low pairwise fixation index (Fst) values were recorded for Sardinian, Iranian and Palestinian sheep C. tenuicollis which suggested the absence of genetic differentiation. Using the ND1 sequences, C. tenuicollis from Sardinian sheep appeared to be differentiated from those of goat and pig origin. In addition, goat C. tenuicollis were genetically different from adult T. hydatigena as indicated by the statistically significant Fst value. Our results are consistent with biochemical and morphological studies that suggest the existence of variants of T. hydatigena.

  1. Association of variation in Fc gamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples

    NARCIS (Netherlands)

    McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.

    2010-01-01

    Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of polymorphonucl

  2. Development of EMS-induced mutation population for amylose and resistant starch variation in bread wheat (Triticum aestivum) and identification of candidate genes responsible for amylose variation.

    Science.gov (United States)

    Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy

    2016-10-06

    Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and

  3. Mutations in MAPT gene cause chromosome instability and introduce copy number variations widely in the genome.

    Science.gov (United States)

    Rossi, Giacomina; Conconi, Donatella; Panzeri, Elena; Redaelli, Serena; Piccoli, Elena; Paoletta, Laura; Dalprà, Leda; Tagliavini, Fabrizio

    2013-01-01

    In addition to the main function of promoting polymerization and stabilization of microtubules, other roles are being attributed to tau, now considered a multifunctional protein. In particular, previous studies suggest that tau is involved in chromosome stability and genome protection. We performed cytogenetic analysis, including molecular karyotyping, on lymphocytes and fibroblasts from patients affected by frontotemporal lobar degeneration carrying different mutations in the microtubule-associated protein tau gene, to investigate the effects of these mutations on genome stability. Furthermore, we analyzed the response of mutated lymphoblastoid cell lines to genotoxic agents to evaluate the participation of tau to DNA repair systems. We found a significantly higher level of chromosome aberrations in mutated than in control cells. Mutated lymphocytes showed higher percentages of stable lesions, clonal and total aneuploidy (medians: 2 versus 0, p $\\ll$ 0.01; 1.5 versus 0, p $\\ll$ 0.01; 16.5 versus 0, p $\\ll$ 0.01, respectively). Fibroblasts of patients showed higher percentages of stable lesions, structural aberrations and total aneuploidy (medians: 0 versus 0, p = 0.03; 5.8 versus 0, p = 0.02; 26.5 versus 12.6, p $\\ll$ 0.01, respectively). In addition, the in depth analysis of DNA copy number variations showed a higher tendency to non-allelic homologous recombination in mutated cells. Finally, while our analysis did not support an involvement of tau in DNA repair systems, it revealed its role in stabilization of chromatin. In summary, our findings indicate a role of tau in genome and chromosome stability that can be ascribed to its function as a microtubule-associated protein as well as a protein protecting chromatin integrity through interaction with DNA.

  4. Active structural vibration control: Robust to temperature variations

    Science.gov (United States)

    Gupta, Vivek; Sharma, Manu; Thakur, Nagesh

    2012-11-01

    d-form augmented piezoelectric constitutive equations which take into account temperature dependence of piezoelectric strain coefficient (d31) and permittivity (∈33), are converted into e-form. Using e-form constitutive equations, a finite element model of a smart two dimensional plate instrumented with piezoelectric patches is derived. Equations of motion are derived using Hamilton's variational principle. Coupled equations of motion are uncoupled using modal analysis. Modal state vectors are estimated using the Kalman observer. The first mode of smart cantilevered plate is actively controlled using negative first modal velocity feedback at various temperatures. Total control effort required to do so is calculated using the electro-mechanical impedance method. The temperature dependence of sensor voltage, control voltage, control effort and Kalman observer equations is shown analytically. Simulation results are presented using MATLAB. Variations in (i) peak sensor voltage, (ii) actual and estimated first modal velocities, (iii) peak control voltage, (iv) total control effort and (v) settling time with respect to temperature are presented. Active vibration control performance is not maintained at temperature away from reference temperature when the temperature dependence of piezoelectric stress coefficient ‘e31' and permittivity ‘∈33' is not included in piezoelectric constitutive equations. Active control of vibrations becomes robust to temperature variations when the temperature dependence of ‘e31' and ‘∈33' is included in piezoelectric constitutive equations.

  5. Novel Register Sharing in Datapath for Structural Robustness against Delay Variation

    Science.gov (United States)

    Inoue, Keisuke; Kaneko, Mineo; Iwagaki, Tsuyoshi

    As the feature size of VLSI becomes smaller, delay variations become a serious problem in VLSI. In this paper, we propose a novel class of robustness for a datapath against delay variations, which is named structural robustness against delay variation (SRV), and propose sufficient conditions for a datapath to have SRV. A resultant circuit designed under these conditions has a larger timing margin to delay variations than previous designs without sacrificing effective computation time. In addition, under any degree of delay variations, we can always find an available clock frequency for a datapath having SRV property to operate correctly, which could be a preferable characteristic in IP-based design.

  6. Sweet taste receptor gene variation and aspartame taste in primates and other species.

    Science.gov (United States)

    Li, Xia; Bachmanov, Alexander A; Maehashi, Kenji; Li, Weihua; Lim, Raymond; Brand, Joseph G; Beauchamp, Gary K; Reed, Danielle R; Thai, Chloe; Floriano, Wely B

    2011-06-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, T1R2 and T1R3, we sequenced these genes in 9 aspartame taster and nontaster primate species. We then compared these sequences with sequences of their orthologs in 4 other nontasters species. We identified 9 variant sites in the gene encoding T1R2 and 32 variant sites in the gene encoding T1R3 that distinguish aspartame tasters and nontasters. Molecular docking of aspartame to computer-generated models of the T1R2 + T1R3 receptor dimer suggests that species variation at a secondary, allosteric binding site in the T1R2 protein is the most likely origin of differences in perception of the sweetness of aspartame. These results identified a previously unknown site of aspartame interaction with the sweet receptor and suggest that the ability to taste aspartame might have developed during evolution to exploit a specialized food niche.

  7. Formation of chimeric genes by copy-number variation as a mutational mechanism in schizophrenia.

    Science.gov (United States)

    Rippey, Caitlin; Walsh, Tom; Gulsuner, Suleyman; Brodsky, Matt; Nord, Alex S; Gasperini, Molly; Pierce, Sarah; Spurrell, Cailyn; Coe, Bradley P; Krumm, Niklas; Lee, Ming K; Sebat, Jonathan; McClellan, Jon M; King, Mary-Claire

    2013-10-03

    Chimeric genes can be caused by structural genomic rearrangements that fuse together portions of two different genes to create a novel gene. We hypothesize that brain-expressed chimeras may contribute to schizophrenia. Individuals with schizophrenia and control individuals were screened genome wide for copy-number variants (CNVs) that disrupted two genes on the same DNA strand. Candidate events were filtered for predicted brain expression and for frequency genes in localization, regulation, or function. Subcellular localizations of DNAJA2-NETO2 and MAP3K3-DDX42 differed from their parent genes. On the basis of the expression profile of the MATK promoter, MATK-ZFR2 is likely to be far more highly expressed in the brain during development than the ZFR2 parent gene. MATK-ZFR2 includes a ZFR2-derived isoform that we demonstrate localizes preferentially to neuronal dendritic branch sites. These results suggest that the formation of chimeric genes is a mechanism by which CNVs contribute to schizophrenia and that, by interfering with parent gene function, chimeras may disrupt critical brain processes, including neurogenesis, neuronal differentiation, and dendritic arborization.

  8. Whole-genome sequencing reveals the diversity of cattle copy number variations and multicopy genes

    Science.gov (United States)

    Structural and functional impacts of copy number variations (CNVs) on livestock genomes are not yet well understood. We identified 1853 CNV regions using population-scale sequencing data generated from 75 cattle representing 8 breeds (Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, Romagnol...

  9. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....... and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according...

  10. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    Science.gov (United States)

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

  11. CREST maps somatic structural variation in cancer genomes with base-pair resolution.

    Science.gov (United States)

    Wang, Jianmin; Mullighan, Charles G; Easton, John; Roberts, Stefan; Heatley, Sue L; Ma, Jing; Rusch, Michael C; Chen, Ken; Harris, Christopher C; Ding, Li; Holmfeldt, Linda; Payne-Turner, Debbie; Fan, Xian; Wei, Lei; Zhao, David; Obenauer, John C; Naeve, Clayton; Mardis, Elaine R; Wilson, Richard K; Downing, James R; Zhang, Jinghui

    2011-06-12

    We developed 'clipping reveals structure' (CREST), an algorithm that uses next-generation sequencing reads with partial alignments to a reference genome to directly map structural variations at the nucleotide level of resolution. Application of CREST to whole-genome sequencing data from five pediatric T-lineage acute lymphoblastic leukemias (T-ALLs) and a human melanoma cell line, COLO-829, identified 160 somatic structural variations. Experimental validation exceeded 80%, demonstrating that CREST had a high predictive accuracy.

  12. CREST maps somatic structural variation in cancer genomes with base-pair resolution

    OpenAIRE

    2011-01-01

    We developed CREST (Clipping REveals STructure), an algorithm that uses next-generation sequencing reads with partial alignments to a reference genome to directly map structural variations at the nucleotide level of resolution. Application of CREST to whole-genome sequencing data from five pediatric T-lineage acute lymphoblastic leukemias (T-ALLs) and a human melanoma cell line, COLO-829, identified 160 somatic structural variations. Experimental validation exceeded 80% demonstrating that CRE...

  13. Functional genomics and structural biology in the definition of gene function.

    Science.gov (United States)

    Hrmova, Maria; Fincher, Geoffrey B

    2009-01-01

    By mid-2007, the three-dimensional (3D) structures of some 45,000 proteins have been solved, over a period where the linear structures of millions of genes have been defined. Technical challenges associated with X-ray crystallography are being overcome and high-throughput methods both for crystallization of proteins and for solving their 3D structures are under development. The question arises as to how structural biology can be integrated with and adds value to functional genomics programs. Structural biology will assist in the definition of gene function through the identification of the likely function of the protein products of genes. The 3D information allows protein sequences predicted from DNA sequences to be classified into broad groups, according to the overall 'fold', or 3D shape, of the protein. Structural information can be used to predict the preferred substrate of a protein, and thereby greatly enhance the accurate annotation of the corresponding gene. Furthermore, it will enable the effects of amino acid substitutions in enzymes to be better understood with respect to enzyme function and could thereby provide insights into natural variation in genes. If the molecular basis of transcription factor-DNA interactions were defined through precise 3D knowledge of the protein-DNA binding site, it would be possible to predict the effects of base substitutions within the motif on the specificity and/or kinetics of binding. In this chapter, we present specific examples of how structural biology can provide valuable information for functional genomics programs.

  14. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  15. Copy number variation of age-related macular degeneration relevant genes in the Korean population.

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    Full Text Available PURPOSE: Studies that analyzed single nucleotide polymorphisms (SNP in various genes have shown that genetic factors are strongly associated with age-related macular degeneration (AMD susceptibility. Copy number variation (CNV may be an additional type of genetic variation that contributes to AMD pathogenesis. This study investigated CNV in 4 AMD-relevant genes in Korean AMD patients and control subjects. METHODS: Four CNV candidate regions located in AMD-relevant genes (VEGFA, ARMS2/HTRA1, CFH and VLDLR, were selected based on the outcomes of our previous study which elucidated common CNVs in the Asian populations. Real-time PCR based TaqMan Copy Number Assays were performed on CNV candidates in 273 AMD patients and 257 control subjects. RESULTS: The predicted copy number (PCN, 0, 1, 2 or 3+ of each region was called using the CopyCaller program. All candidate genes except ARMS2/HTRA1 showed CNV in at least one individual, in which losses of VEGFA and VLDLR represent novel findings in the Asian population. When the frequencies of PCN were compared, only the gain in VLDLR showed significant differences between AMD patients and control subjects (p = 0.025. Comparisons of the raw copy values (RCV revealed that 3 of 4 candidate genes showed significant differences (2.03 vs. 1.92 for VEGFA, p<0.01; 2.01 vs. 1.97 for CFH, p<0.01; 1.97 vs. 2.01, p<0.01 for ARMS2/HTRA1. CONCLUSION: CNVs located in AMD-relevant genes may be associated with AMD susceptibility. Further investigations encompassing larger patient cohorts are needed to elucidate the role of CNV in AMD pathogenesis.

  16. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Science.gov (United States)

    Purrington, Kristen S.; Slettedahl, Seth; Bolla, Manjeet K.; Michailidou, Kyriaki; Czene, Kamila; Nevanlinna, Heli; Bojesen, Stig E.; Andrulis, Irene L.; Cox, Angela; Hall, Per; Carpenter, Jane; Yannoukakos, Drakoulis; Haiman, Christopher A.; Fasching, Peter A.; Mannermaa, Arto; Winqvist, Robert; Brenner, Hermann; Lindblom, Annika; Chenevix-Trench, Georgia; Benitez, Javier; Swerdlow, Anthony; Kristensen, Vessela; Guénel, Pascal; Meindl, Alfons; Darabi, Hatef; Eriksson, Mikael; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Wang, Xianshu; Olswold, Curtis; Olson, Janet E.; Mulligan, Anna Marie; Knight, Julia A.; Tchatchou, Sandrine; Reed, Malcolm W.R.; Cross, Simon S.; Liu, Jianjun; Li, Jingmei; Humphreys, Keith; Clarke, Christine; Scott, Rodney; Fostira, Florentia; Fountzilas, George; Konstantopoulou, Irene; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Ekici, Arif B.; Hartmann, Arndt; Beckmann, Matthias W.; Hartikainen, Jaana M.; Kosma, Veli-Matti; Kataja, Vesa; Jukkola-Vuorinen, Arja; Pylkäs, Katri; Kauppila, Saila; Dieffenbach, Aida Karina; Stegmaier, Christa; Arndt, Volker; Margolin, Sara; Balleine, Rosemary; Arias Perez, Jose Ignacio; Pilar Zamora, M.; Menéndez, Primitiva; Ashworth, Alan; Jones, Michael; Orr, Nick; Arveux, Patrick; Kerbrat, Pierre; Truong, Thérèse; Bugert, Peter; Toland, Amanda E.; Ambrosone, Christine B.; Labrèche, France; Goldberg, Mark S.; Dumont, Martine; Ziogas, Argyrios; Lee, Eunjung; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Long, Jirong; Shrubsole, Martha; Deming-Halverson, Sandra; Ficarazzi, Filomena; Barile, Monica; Peterlongo, Paolo; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Brüning, Thomas; Ko, Yon-Dschun; Van Deurzen, Carolien H.M.; Martens, John W.M.; Kriege, Mieke; Figueroa, Jonine D.; Chanock, Stephen J.; Lissowska, Jolanta; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Schneeweiss, Andreas; Tapper, William J.; Gerty, Susan M.; Durcan, Lorraine; Mclean, Catriona; Milne, Roger L.; Baglietto, Laura; dos Santos Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Van'T Veer, Laura J.; Cornelissen, Sten; Försti, Asta; Torres, Diana; Rüdiger, Thomas; Rudolph, Anja; Flesch-Janys, Dieter; Nickels, Stefan; Weltens, Caroline; Floris, Giuseppe; Moisse, Matthieu; Dennis, Joe; Wang, Qin; Dunning, Alison M.; Shah, Mitul; Brown, Judith; Simard, Jacques; Anton-Culver, Hoda; Neuhausen, Susan L.; Hopper, John L.; Bogdanova, Natalia; Dörk, Thilo; Zheng, Wei; Radice, Paolo; Jakubowska, Anna; Lubinski, Jan; Devillee, Peter; Brauch, Hiltrud; Hooning, Maartje; García-Closas, Montserrat; Sawyer, Elinor; Burwinkel, Barbara; Marmee, Frederick; Eccles, Diana M.; Giles, Graham G.; Peto, Julian; Schmidt, Marjanka; Broeks, Annegien; Hamann, Ute; Chang-Claude, Jenny; Lambrechts, Diether; Pharoah, Paul D.P.; Easton, Douglas; Pankratz, V. Shane; Slager, Susan; Vachon, Celine M.; Couch, Fergus J.

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymorphisms (SNPs) from 194 mitotic genes and breast cancer risk, overall and by histologic grade, in the Breast Cancer Association Consortium (BCAC) iCOGS study (n = 39 067 cases; n = 42 106 controls). SNPs in TACC2 [rs17550038: odds ratio (OR) = 1.24, 95% confidence interval (CI) 1.16–1.33, P = 4.2 × 10−10) and EIF3H (rs799890: OR = 1.07, 95% CI 1.04–1.11, P = 8.7 × 10−6) were significantly associated with risk of low-grade breast cancer. The TACC2 signal was retained (rs17550038: OR = 1.15, 95% CI 1.07–1.23, P = 7.9 × 10−5) after adjustment for breast cancer risk SNPs in the nearby FGFR2 gene, suggesting that TACC2 is a novel, independent genome-wide significant genetic risk locus for low-grade breast cancer. While no SNPs were individually associated with high-grade disease, a pathway-level gene set analysis showed that variation across the 194 mitotic genes was associated with high-grade breast cancer risk (P = 2.1 × 10−3). These observations will provide insight into the contribution of mitotic defects to histological grade and the etiology of breast cancer. PMID:24927736

  17. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  18. Characterization of Genetic Structures of the QepA3 Gene in Clinical Isolates of Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Dongguo eWang

    2015-10-01

    Full Text Available QepA is one of the genes that confer quinolone resistance in bacteria. The aim of this study was to analyze the genetic structures of plasmids that carry a qepA3, a recently discovered allele of qepA in Enterobacteriaceae clinical isolates. 656 non-redundant Enterobacteriaceae clinical isolates were screened for the qepA3 gene and five isolated were identified to carry the gene. Plasmids were isolated from these isolates and were found to increase antibiotic resistance once the plasmids were transferred to Escherichia coli. These plasmids were subcloned and sequenced to analyze the genetic structures surrounding the the qepA3 gene. The results showed that the five plasmids had different genetic structures; one of qepA3-containning isolates had either the blaCTX-M-14 or blaTEM-12 gene in place of the blaTEM-1 gene. The structures of both pKP3764 and pECL3786 have not been previously described. In comparison with pHPA, there were a number of changes in DNA sequences up- and down-stream the qepA3 gene. These findings provide better understanding of the genetic variations in qepA3 and would be useful for diagnosis and control of quinolone resistance in clinical settings.

  19. Characterization of genetic structures of the QepA3 gene in clinical isolates of Enterobacteriaceae

    Science.gov (United States)

    Wang, Dongguo; Huang, Xitian; Chen, Jiayu; Mou, Yonghua; Li, Haijun; Yang, Liqin

    2015-01-01

    QepA is one of the genes that confer quinolone resistance in bacteria. The aim of this study was to analyze the genetic structures of plasmids that carry a qepA3, a recently discovered allele of qepA in Enterobacteriaceae clinical isolates. 656 non-redundant Enterobacteriaceae clinical isolates were screened for the qepA3 gene and five isolates were identified to carry the gene. Plasmids were isolated from these isolates and were found to increase antibiotic resistance once the plasmids were transferred to Escherichia coli. These plasmids were subcloned and sequenced to analyze the genetic structures surrounding the qepA3 gene. The results showed that the five plasmids had different genetic structures; two of the qepA3-containning isolates had either the blaCTX-M-14 or blaTEM-12 gene instead of the blaTEM-1 gene. The structures of both pKP3764 and pECL3786 have not been previously described. In comparison with pHPA, there were a number of changes in DNA sequences up- and down-stream of the qepA3 gene. These findings provide better understanding of the genetic variations in qepA3 and would be useful for diagnosis and control of quinolone resistance in clinical settings. PMID:26528280

  20. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  1. Homogeneous genetic structure and variation in tree architecture of Larix kaempferi along altitudinal gradients on Mt. Fuji.

    Science.gov (United States)

    Nishimura, Masao; Setoguchi, Hiroaki

    2011-03-01

    Variations in tree architecture and in the genetic structure of Larix kaempferi on Mt. Fuji were surveyed along altitudinal gradients using 11 nSSR loci. In total, 249 individuals from six populations along three trails at altitudes ranging from approximately 1,300 to 2,700 m were investigated. Gradual changes in tree architecture with increasing elevation, from erect trees to flag trees and krummholz mats, were observed in the high-altitude populations (> 2,000 m) on all trails. These findings suggest that tree architecture is correlated with the severe environmental conditions associated with increasing elevation, such as strong winds. In contrast to obvious variations in tree architecture, the genetic diversity of populations along the trails was almost uniform (H (E) = 0.717-0.762) across the altitudinal range. The results of the AMOVA and STRUCTURE analyses, and the analysis for isolation by distance pattern, suggest homogeneous genetic structuring across all populations on Mt. Fuji, while the pairwise F (ST) showed barriers to gene flow between altitudinal populations that were demarcated as high- or low-altitude populations by Abies-Tsuga forest. Although the evergreen coniferous forests on the mountainside may hinder gene flow, this may be explained by the long-distance seed dispersal of the Japanese larch and/or a short population history resulting from eruptions or slush avalanches, although evergreen coniferous forests on the mountainside may hinder gene flow.

  2. Uncertainty and Variation of Vibration in Lightweight Structures

    DEFF Research Database (Denmark)

    Dickow, Kristoffer Ahrens

    2012-01-01

    Multi-family dwellings and offices build from lightweight materials are becoming a cost efficient and environmentally friendly alternative to traditional heavy structures.......Multi-family dwellings and offices build from lightweight materials are becoming a cost efficient and environmentally friendly alternative to traditional heavy structures....

  3. Variation in the Helical Structure of Native Collagen

    Science.gov (United States)

    2014-02-24

    Hongo C, Noguchi K (2006) Helical twists of collagen model peptides. Biopolymers 84: 421–432. 39. Kramer R, Bella J, Mayville P, Brodsky B, Berman H...Iguchi M, Noguchi K (2006) Revision of collagen molecular structure. Biopolymers 84: 181–191. 43. Shoulders MD, Raines RT (2009) Collagen structure

  4. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Directory of Open Access Journals (Sweden)

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  5. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Science.gov (United States)

    Anderson, Mark T; Seifert, H Steven

    2013-01-01

    Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae when investigating

  6. p63 gene structure in the phylum mollusca.

    Science.gov (United States)

    Baričević, Ana; Štifanić, Mauro; Hamer, Bojan; Batel, Renato

    2015-08-01

    Roles of p53 family ancestor (p63) in the organisms' response to stressful environmental conditions (mainly pollution) have been studied among molluscs, especially in the genus Mytilus, within the last 15 years. Nevertheless, information about gene structure of this regulatory gene in molluscs is scarce. Here we report the first complete genomic structure of the p53 family orthologue in the mollusc Mediterranean mussel Mytilus galloprovincialis and confirm its similarity to vertebrate p63 gene. Our searches within the available molluscan genomes (Aplysia californica, Lottia gigantea, Crassostrea gigas and Biomphalaria glabrata), found only one p53 family member present in a single copy per haploid genome. Comparative analysis of those orthologues, additionally confirmed the conserved p63 gene structure. Conserved p63 gene structure can be a helpful tool to complement or/and revise gene annotations of any future p63 genomic sequence records in molluscs, but also in other animal phyla. Knowledge of the correct gene structure will enable better prediction of possible protein isoforms and their functions. Our analyses also pointed out possible mis-annotations of the p63 gene in sequenced molluscan genomes and stressed the value of manual inspection (based on alignments of cDNA and protein onto the genome sequence) for a reliable and complete gene annotation.

  7. Morphodynamics structures induced by variations of the channel width

    Science.gov (United States)

    Duro, Gonzalo; Crosato, Alessandra; Tassi, Pablo

    2014-05-01

    In alluvial channels, forcing effects, such as a longitudinally varying width, can induce the formation of steady bars (Olesen, 1984). The type of bars that form, such as alternate, central or multiple, will mainly depend on the local flow width-to-depth ratio and on upstream conditions (Struiksma et al., 1985). The effects on bar formation of varying the channel width received attention only recently and investigations, based on flume experiments and mathematical modelling, are mostly restricted to small longitudinal sinusoidal variations of the channel width (e.g. Repetto et al., 2002; Wu and Yeh, 2005, Zolezzi et al., 2012; Frascati and Lanzoni, 2013). In this work, we analyze the variations in equilibrium bed topography in a longitudinal width-varying channel with characteristic scales of the Waal River (The Netherlands) using two different 2D depth-averaged morphodynamic models, one based on the Delft3D code and one on Telemac-Mascaret system. In particular, we explore the effects of changing the wavelength of sinusoidal width variations in a straight channel, focusing on the effects of the spatial lag between bar formation and forcing that is observed in numerical models and laboratory experiments (e.g. Crosato et al, 2011). We extend the investigations to finite width variations in which longitudinal changes of the width-to-depth ratio are such that they may affect the type of bars that become unstable (alternate, central or multiple bars). Numerical results are qualitatively validated with field observations and the resulting morphodynamic pattern is compared with the physics-based predictor of river bar modes by Crosato and Mosselman (2009). The numerical models are finally used to analyse the experimental conditions of Wu and Yeh (2005). The study should be seen as merely exploratory. The aim is to investigate possible approaches for future research aiming at assessing the effects of artificial river widening and narrowing to control bar formation in

  8. Antigen-presenting genes and genomic copy number variations in the Tasmanian devil MHC

    Directory of Open Access Journals (Sweden)

    Cheng Yuanyuan

    2012-03-01

    Full Text Available Abstract Background The Tasmanian devil (Sarcophilus harrisii is currently under threat of extinction due to an unusual fatal contagious cancer called Devil Facial Tumour Disease (DFTD. DFTD is caused by a clonal tumour cell line that is transmitted between unrelated individuals as an allograft without triggering immune rejection due to low levels of Major Histocompatibility Complex (MHC diversity in Tasmanian devils. Results Here we report the characterization of the genomic regions encompassing MHC Class I and Class II genes in the Tasmanian devil. Four genomic regions approximately 960 kb in length were assembled and annotated using BAC contigs and physically mapped to devil Chromosome 4q. 34 genes and pseudogenes were identified, including five Class I and four Class II loci. Interestingly, when two haplotypes from two individuals were compared, three genomic copy number variants with sizes ranging from 1.6 to 17 kb were observed within the classical Class I gene region. One deletion is particularly important as it turns a Class Ia gene into a pseudogene in one of the haplotypes. This deletion explains the previously observed variation in the Class I allelic number between individuals. The frequency of this deletion is highest in the northwestern devil population and lowest in southeastern areas. Conclusions The third sequenced marsupial MHC provides insights into the evolution of this dynamic genomic region among the diverse marsupial species. The two sequenced devil MHC haplotypes revealed three copy number variations that are likely to significantly affect immune response and suggest that future work should focus on the role of copy number variations in disease susceptibility in this species.

  9. Nucleic Acid Backbone Structure Variations: Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    Nielsen, Peter E.

    2010-01-01

    )RNA and in the future also antigene applications targeting the double-stranded DNA of the genes themselves leading to gene silencing or guiding specific gene repair. Finally, the special chemical and structural properties of PNA suggest that these or similar molecules might have played a role in the prebiotic origin...

  10. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Directory of Open Access Journals (Sweden)

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  11. Evolutionary rate variation and RNA secondary structure prediction

    DEFF Research Database (Denmark)

    Knudsen, B; Andersen, E S; Damgaard, Christian Kroun

    2004-01-01

    of approach. Determining these rates can be hard to do reliably without a large and accurate initial alignment, which ideally also has structural annotation. Hence, one must often apply rates extracted from other RNA families with trusted alignments and structures. Here, we investigate this problem......Predicting RNA secondary structure using evolutionary history can be carried out by using an alignment of related RNA sequences with conserved structure. Accurately determining evolutionary substitution rates for base pairs and single stranded nucleotides is a concern for methods based on this type...... by applying rates derived from tRNA and rRNA to the prediction of the much more rapidly evolving 5'-region of HIV-1. We find that the HIV-1 prediction is in agreement with experimental data, even though the relative evolutionary rate between A and G is significantly increased, both in stem and loop regions...

  12. The structure and expression of the human neuroligin-3 gene.

    Science.gov (United States)

    Philibert, R A; Winfield, S L; Sandhu, H K; Martin, B M; Ginns, E I

    2000-04-04

    The neuroligins are a family of proteins that are thought to mediate cell to cell interactions between neurons. During the sequencing at an Xq13 locus associated with a mental retardation syndrome in some studies, we discovered a portion of the human orthologue of the rat neuroligin-3 gene. We now report the structure and the expression of that gene. The gene spans approximately 30kb and contains eight exons. Unlike the rat gene, it codes for at least two mRNAs and at least one of which is expressed outside the CNS. Interestingly, the putative promoter for the gene overlaps the last exon of the neighboring HOPA gene and is located less than 1kb from an OPA element in which a polymorphism associated with mental retardation is found. These findings suggest a possible role for the neuroligin gene in mental retardation and that the role of the gene in humans may differ from its role in rats.

  13. [Genetic variation analysis of canine parvovirus VP2 gene in China].

    Science.gov (United States)

    Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

    2009-11-01

    To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

  14. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Science.gov (United States)

    Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D

    2016-01-01

    Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  15. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  16. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Science.gov (United States)

    Li, Zhenkun; Huo, Xueyun; Zhang, Shuangyue; Lu, Jing; Li, Changlong; Guo, Meng; Fu, Rui; He, Zhengming; Du, Xiaoyan; Chen, Zhenwen

    2015-01-01

    Deformities in the Circle of Willis (CoW) can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH). After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR) on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2) associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  17. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Directory of Open Access Journals (Sweden)

    Zhenkun Li

    Full Text Available Deformities in the Circle of Willis (CoW can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH. After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2 associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  18. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome.

    Science.gov (United States)

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal models suggest a role for oxytocin (OXT) and oxytocin receptor (OXTR) genes in social-emotional behaviors, and several studies indicate that the oxytocin/oxytocin receptor system is altered in individuals with ASC. Previous studies have reported associations between genetic variations in the OXTR gene and ASC. The present study tested for an association between nine single nucleotide polymorphisms (SNPs) in the OXTR gene and AS in 530 individuals of Caucasian origin, using SNP association test and haplotype analysis. There was a significant association between rs2268493 in OXTR and AS. Multiple haplotypes that include this SNP (rs2268493-rs2254298, rs2268490-rs2268493-rs2254298, rs2268493-rs2254298-rs53576, rs237885-rs2268490-rs2268493-rs2254298, rs2268490-rs2268493-rs2254298-rs53576) were also associated with AS. rs2268493 has been previously associated with ASC and putatively alters several transcription factor-binding sites and regulates chromatin states, either directly or through other variants in linkage disequilibrium (LD). This study reports a significant association of the sequence variant rs2268493 in the OXTR gene and associated haplotypes with AS.

  19. Systematic variation in gene expression patterns in human cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ross, Douglas T.; Scherf, Uwe; Eisen, Michael B.; Perou, Charles M.; Rees, Christian; Spellman, Paul; Iyer, Vishwanath; Jeffrey, Stefanie S.; Van de Rijn, Matt; Waltham, Mark; Pergamenschikov, Alexander; Lee, Jeffrey C.F.; Lashkari, Deval; Shalon, Dari; Myers, Timothy G.; Weinstein, John N.; Botstein, David; Brown, Patrick O.

    2000-01-01

    We used cDNA micro arrays to explore the variation in expression of approximately 8,000 unique genes among the 60 cell lines used in the National Cancer Institute s screen for anti-cancer drugs. Classification of the cell lines based solely on the observed patterns of gene expression revealed a correspondence to the ostensible origins of the tumors from which the cell lines were derived. The consistent relationship between the gene expression patterns and the tissue of origin allowed us to recognize outliers whose previous classification appeared incorrect. Specific features of the gene expression patterns appeared to be related to physiological properties of the cell lines, such as their doubling time in culture, drug metabolism or the interferon response. Comparison of gene expression patterns in the cell lines to those observed in normal breast tissue or in breast tumor specimens revealed features of the expression patterns in the tumors that had recognizable counterparts in specific cell lines, reflecting the tumor, stromal and inflammatory components of the tumor tissue. These results provided a novel molecular characterization of this important group of human cell lines and their relationships to tumors in vivo.

  20. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  1. Mobile genes in the human microbiome are structured from global to individual scales.

    Science.gov (United States)

    Brito, I L; Yilmaz, S; Huang, K; Xu, L; Jupiter, S D; Jenkins, A P; Naisilisili, W; Tamminen, M; Smillie, C S; Wortman, J R; Birren, B W; Xavier, R J; Blainey, P C; Singh, A K; Gevers, D; Alm, E J

    2016-07-21

    Recent work has underscored the importance of the microbiome in human health, and has largely attributed differences in phenotype to differences in the species present among individuals. However, mobile genes can confer profoundly different phenotypes on different strains of the same species. Little is known about the function and distribution of mobile genes in the human microbiome, and in particular whether the gene pool is globally homogenous or constrained by human population structure. Here, we investigate this question by comparing the mobile genes found in the microbiomes of 81 metropolitan North Americans with those of 172 agrarian Fiji islanders using a combination of single-cell genomics and metagenomics. We find large differences in mobile gene content between the Fijian and North American microbiomes, with functional variation that mirrors known dietary differences such as the excess of plant-based starch degradation genes found in Fijian individuals. Notably, we also observed differences between the mobile gene pools of neighbouring Fijian villages, even though microbiome composition across villages is similar. Finally, we observe high rates of recombination leading to individual-specific mobile elements, suggesting that the abundance of some genes may reflect environmental selection rather than dispersal limitation. Together, these data support the hypothesis that human activities and behaviours provide selective pressures that shape mobile gene pools, and that acquisition of mobile genes is important for colonizing specific human populations.

  2. Genetic variation in telomere maintenance genes, telomere length, and lung cancer susceptibility.

    Science.gov (United States)

    Hosgood, H Dean; Cawthon, Richard; He, Xingzhou; Chanock, Stephen; Lan, Qing

    2009-11-01

    Telomeres are responsible for the protection of the chromosome ends and shortened telomere length has been associated with risk of multiple cancers. Genetic variation in telomere-related genes may alter cancer risk associated with telomere length. Using lung cancer cases (n=120) and population-based controls (n=110) from Xuanwei, China, we analyzed telomere length separately and in conjunction with single nucleotide polymorphisms in the telomere maintenance genes POT1, TERT, and TERF2, which we have previously reported were associated with risk of lung cancer in this study. POT1 rs10244817, TERT rs2075786, and TERF2 rs251796 were significantly associated with lung cancer (p(trend)telomere length was not significantly associated with risk of lung cancer (OR=1.58; 95% CI=0.79-3.18) when compared to the longest tertile of telomere length. When stratified by genotype, there was a suggestion of a dose-response relationship between tertiles of telomere length and risk of lung cancer among the POT1 rs10244817 common variant carriers (OR (95% CI)=1.33 (0.47-3.75), 3.30 (1.14-9.56), respectively) but not among variant genotype carriers (p(interaction)=0.05). Our findings provide evidence that telomere length and genetic variation in telomere maintenance genes may be associated with risk of lung cancer susceptibility and warrant replication in larger studies.

  3. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Science.gov (United States)

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; Hasler, Brant P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2013-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30–54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p seasonal patterns of recurrence or exacerbation. PMID:22881342

  4. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  5. Genetic variations of the dihydrofolate reductase gene of Plasmodium vivax in Mandalay Division, Myanmar.

    Science.gov (United States)

    Na, Byoung-Kuk; Lee, Hyeong-Woo; Moon, Sung-Ung; In, Tae-Suk; Lin, Khin; Maung, Maung; Chung, Gyung-Tae; Lee, Jong-Koo; Kim, Tong-Soo; Kong, Yoon

    2005-07-01

    Dihydrofolate reductase (DHFR; EC1.5.1.3) is a known target enzyme for antifolate agents, which are used as alternative chemotherapeutics for chloroquine-resistant malaria. Mutations in the dhfr gene of Plasmodium vivax are thought to be associated with resistance to the antifolate drugs. In this study, we have analyzed genetic variations in the dhfr genes of clinical isolates of P. vivax (n=21) in Myanmar, to monitor antifolate resistance in this country. Sequence variations within the entire dhfr gene were highly restricted to codons from 57 to 117, and the GGDN tandem repeat region. Double (S58R and S117N/T) or quadruple mutations (F57L/I, S58R, T61M, and S117N/T), which may be closely related to the drug resistance, were recognized in most of the isolates (20/21 cases). Our results suggest that antifolate-resistant P. vivax is becoming widespread in Myanmar, as it also is in the neighboring countries in Southeast Asia. It appears that the drug resistance situation may be worsening in the country.

  6. Selection for phase variation of LOS biosynthetic genes frequently occurs in progression of non-typeable Haemophilus influenzae infection from the nasopharynx to the middle ear of human patients.

    Directory of Open Access Journals (Sweden)

    Kate L Fox

    Full Text Available Surface structures in Haemophilus influenzae are subject to rapid ON/OFF switching of expression, a process termed phase variation. We analyse tetranucleotide repeats controlling phase variation in lipo-oligosaccharide (LOS genes of H. influenzae in paired isolates from both the nasopharynx and middle ears of paediatric patients with chronic or recurrent otitis media. A change in expression of at least one of the seven phase variable LOS biosynthesis genes was seen in 12 of the 21 strain pairs. Several strains showed switching of expression in multiple LOS genes, consistent with a key role for phase variable LOS biosynthetic genes in human infection.

  7. Identification of local variations within secondary structures of proteins.

    Science.gov (United States)

    Kumar, Prasun; Bansal, Manju

    2015-05-01

    Secondary-structure elements (SSEs) play an important role in the folding of proteins. Identification of SSEs in proteins is a common problem in structural biology. A new method, ASSP (Assignment of Secondary Structure in Proteins), using only the path traversed by the C(α) atoms has been developed. The algorithm is based on the premise that the protein structure can be divided into continuous or uniform stretches, which can be defined in terms of helical parameters, and depending on their values the stretches can be classified into different SSEs, namely α-helices, 310-helices, π-helices, extended β-strands and polyproline II (PPII) and other left-handed helices. The methodology was validated using an unbiased clustering of these parameters for a protein data set consisting of 1008 protein chains, which suggested that there are seven well defined clusters associated with different SSEs. Apart from α-helices and extended β-strands, 310-helices and π-helices were also found to occur in substantial numbers. ASSP was able to discriminate non-α-helical segments from flanking α-helices, which were often identified as part of α-helices by other algorithms. ASSP can also lead to the identification of novel SSEs. It is believed that ASSP could provide a better understanding of the finer nuances of protein secondary structure and could make an important contribution to the better understanding of comparatively less frequently occurring structural motifs. At the same time, it can contribute to the identification of novel SSEs. A standalone version of the program for the Linux as well as the Windows operating systems is freely downloadable and a web-server version is also available at http://nucleix.mbu.iisc.ernet.in/assp/index.php.

  8. Genetic variation of Taenia pisiformis collected from Sichuan, China, based on the mitochondrial cytochrome B gene.

    Science.gov (United States)

    Yang, Deying; Ren, Yongjun; Fu, Yan; Xie, Yue; Nie, Huaming; Nong, Xiang; Gu, Xiaobin; Wang, Shuxian; Peng, Xuerong; Yang, Guangyou

    2013-08-01

    Taenia pisiformis is one of the most important parasites of canines and rabbits. T. pisiformis cysticercus (the larval stage) causes severe damage to rabbit breeding, which results in huge economic losses. In this study, the genetic variation of T. pisiformis was determined in Sichuan Province, China. Fragments of the mitochondrial cytochrome b (cytb) (922 bp) gene were amplified in 53 isolates from 8 regions of T. pisiformis. Overall, 12 haplotypes were found in these 53 cytb sequences. Molecular genetic variations showed 98.4% genetic variation derived from intra-region. FST and Nm values suggested that 53 isolates were not genetically differentiated and had low levels of genetic diversity. Neutrality indices of the cytb sequences showed the evolution of T. pisiformis followed a neutral mode. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. These findings indicate that 53 isolates of T. pisiformis keep a low genetic variation, which provide useful knowledge for monitoring changes in parasite populations for future control strategies.

  9. Structural variations in layered alkaline earth metal cyclohexyl phosphonates

    Indian Academy of Sciences (India)

    Ramaswamy Murugavel; Nayanmoni Gogoi

    2009-06-01

    Two series of alkaline earth metal cyclohexyl phosphonates, M(C6H11PO3H)2(H2O) (M = Ca, Sr and Ba) (1–3) and M(C6H11PO3)(H2O) (M = Mg, Ca, Sr, and Ba) (4–7) have been synthesized under mild reaction conditions. All new compounds have been characterized using elemental analysis, IR, TGA and powder X-ray diffraction techniques. The molecular structure of compound 2 determined using single crystal X-ray diffraction technique reveals a layered polymeric structure.

  10. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation.

    Science.gov (United States)

    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw

    2016-12-31

    Host-pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Common genetic variations in the CYP2R1 and GC genes are determinants of vitamin D status in Danes

    DEFF Research Database (Denmark)

    Nissen, Ioanna

    ), after 6 months intake of vitamin D3-fortified bread and milk (paper II) and in 92 participants in the VitDgen study after artificial UVB irradiation during winter (paper III). Common genetic variations in the CYP2R1 and GC genes were found to be important determinants of vitamin D status in three out...... by genetic variation in vitamin D modulating genes. Twin and family-based studies indicate that genetic variation may have an appreciable influence on vitamin D status. Moreover, several candidate gene studies including two genome-wide association studies (GWAS) have found single nucleotide polymorphisms...... (SNPs) in CYP2R1, CYP24A1, CYP27B1, C10orf88, DHCR7/NADSYN1, GC and VDR genes to be associated with vitamin D status. The main hypothesis of this work was that genetically determined variation in vitamin D metabolism would influence the effect of vitamin D sources (vitamin D...

  12. Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

    Directory of Open Access Journals (Sweden)

    Jennifer Tsang

    2014-01-01

    Full Text Available Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ54 (also known as RpoN to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni, Gammaproteobacteria (e.g., Vibrio and Pseudomonas species, and Alphaproteobacteria (e.g., Caulobacter crescentus. This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization.

  13. Structural propensities of kinase family proteins from a Potts model of residue co‐variation

    National Research Council Canada - National Science Library

    Haldane, Allan; Flynn, William F; He, Peng; Vijayan, R.S.K; Levy, Ronald M

    2016-01-01

    ...‐variation of pairs of mutations contained in multiple sequence alignments of protein families can be used to build a Potts Hamiltonian model of the sequence patterns which accurately predicts structural contacts...

  14. Variations of Bacterial Community Structure and Composition in Mangrove Sediment at Different Depths in Southeastern Brazil

    Directory of Open Access Journals (Sweden)

    Lucas William Mendes

    2014-12-01

    Full Text Available Tropical mangroves are considered one of the most productive ecosystems of the world, being characterized as nurseries and food sources for fish and other animals. Microorganisms play important roles in these environments, and the study of bacterial communities is of paramount importance for a better comprehension of mangrove dynamics. This study focused on the structure and composition of bacterial communities in mangrove sediments at different depths and points, located in Southeastern Brazil. Terminal Restriction Fragment Length Polymorphism (T-RFLP was used to determine the community structure, and 16S rRNA gene pyrosequencing was used to characterize the community composition. Redundancy analysis of T-RFLP patterns revealed differences in bacterial community structure according to soil attributes and depth. The parameters K and depth presented significant correlation with general community structure. Most sequences were classified into the phylum Proteobacteria (88%, which presented differences according to the depth, where the classes Betaproteobacteria (21% and Deltaproteobacteria (16% were abundant at 10 cm and Epsilonproteobacteria (35% was abundant at 40 cm depth. Clear differences were observed in community composition as shown by the differential distribution of the phyla Firmicutes (1.13% and 3.8%, for 10 cm and 40 cm respectively, Chloroflexi (2.8% and 0.75%, and Acidobacteria (2.75% and 0.57% according to the depth. Bacterial diversity measurements indicated higher diversity in shallow samples. Taken together, our findings indicate that mangrove holds a diverse bacterial community, which is shaped by the variations found in the ecosystem, such as sediment properties and depth.

  15. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    Science.gov (United States)

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods.

  16. FTO gene variation and measures of body mass in an African population

    Directory of Open Access Journals (Sweden)

    Hattersley Andrew T

    2009-03-01

    Full Text Available Abstract Background Variation in the fat mass and obesity associated (FTO gene has been reproducibly associated with body mass index (BMI and obesity in populations of White European origin. Data from Asians and African-Americans is less conclusive. Methods We assessed the effect of 16 FTO polymorphisms on body mass in a large population of predominantly lean Gambians (Nmax 2208 participating in a long-term surveillance program providing contemporary and early-life anthropometric measurements. Results Sixteen FTO tagSNPs screened here, including several associated with BMI in Europeans, were not associated with birth weight (BWT, early weight gain in 1–2 year olds, BMI in adults (≥ 18 y, or weight-for-height (WFH z-score across all ages. No association was seen between genotype and WFH z-score or other measures of body mass. The confidence limits indicate that the effect size for WFH z-score never exceeded 0.17 units per allele copy for any SNP (excluding the three SNPs with allele Conclusion To our knowledge this is the first study of FTO gene variation in a well-characterised African population. Our results suggest that FTO gene variation does not influence measures of body mass in Gambians living a traditional lifestyle, or has a smaller effect than that detected in Europeans. These findings are not directly comparable to results from previous studies in African-Americans due to differences in study design and analysis. It is also possible that any effect of FTO genotype on body mass is of limited relevance in a lean population where little excess food is available, compared to similar ethnic populations where food supply is plentiful.

  17. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Directory of Open Access Journals (Sweden)

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  18. Variation in the helical structure of native collagen.

    Directory of Open Access Journals (Sweden)

    Joseph P R O Orgel

    Full Text Available The structure of collagen has been a matter of curiosity, investigation, and debate for the better part of a century. There has been a particularly productive period recently, during which much progress has been made in better describing all aspects of collagen structure. However, there remain some questions regarding its helical symmetry and its persistence within the triple-helix. Previous considerations of this symmetry have sometimes confused the picture by not fully recognizing that collagen structure is a highly complex and large hierarchical entity, and this affects and is effected by the super-coiled molecules that make it. Nevertheless, the symmetry question is not trite, but of some significance as it relates to extracellular matrix organization and cellular integration. The correlation between helical structure in the context of the molecular packing arrangement determines which parts of the amino acid sequence of the collagen fibril are buried or accessible to the extracellular matrix or the cell. In this study, we concentrate primarily on the triple-helical structure of fibrillar collagens I and II, the two most predominant types. By comparing X-ray diffraction data collected from type I and type II containing tissues, we point to evidence for a range of triple-helical symmetries being extant in the molecules native environment. The possible significance of helical instability, local helix dissociation and molecular packing of the triple-helices is discussed in the context of collagen's supramolecular organization, all of which must affect the symmetry of the collagen triple-helix.

  19. Structural genomic variation as risk factor for idiopathic recurrent miscarriage

    DEFF Research Database (Denmark)

    Nagirnaja, Liina; Palta, Priit; Kasak, Laura;

    2014-01-01

    within RM study group revealed significant enrichment of loci related to innate immunity and immunoregulatory pathways essential for immune tolerance at fetomaternal interface. As a major finding, we report a multicopy duplication (61.6 kb) at 5p13.3 conferring increased maternal risk to RM in Estonia...... and identify common rearrangements modulating risk to RM. Genome-wide screening of Estonian RM patients and fertile controls identified excessive cumulative burden of CNVs (5.4 and 6.1 Mb per genome) in two RM cases possibly increasing their individual disease risk. Functional profiling of all rearranged genes...... and Denmark (meta-analysis, n = 309/205, odds ratio = 4.82, P = 0.012). Comparison to Estonian population-based cohort (total, n = 1000) confirmed the risk for Estonian female cases (P = 7.9 × 10(-4) ). Datasets of four cohorts from the Database of Genomic Variants (total, n = 5,846 subjects) exhibited...

  20. Structural and transcriptional analysis of plant genes encoding the bifunctional lysine ketoglutarate reductase saccharopine dehydrogenase enzyme

    Directory of Open Access Journals (Sweden)

    Gu Yong Q

    2010-06-01

    Full Text Available Abstract Background Among the dietary essential amino acids, the most severely limiting in the cereals is lysine. Since cereals make up half of the human diet, lysine limitation has quality/nutritional consequences. The breakdown of lysine is controlled mainly by the catabolic bifunctional enzyme lysine ketoglutarate reductase - saccharopine dehydrogenase (LKR/SDH. The LKR/SDH gene has been reported to produce transcripts for the bifunctional enzyme and separate monofunctional transcripts. In addition to lysine metabolism, this gene has been implicated in a number of metabolic and developmental pathways, which along with its production of multiple transcript types and complex exon/intron structure suggest an important node in plant metabolism. Understanding more about the LKR/SDH gene is thus interesting both from applied standpoint and for basic plant metabolism. Results The current report describes a wheat genomic fragment containing an LKR/SDH gene and adjacent genes. The wheat LKR/SDH genomic segment was found to originate from the A-genome of wheat, and EST analysis indicates all three LKR/SDH genes in hexaploid wheat are transcriptionally active. A comparison of a set of plant LKR/SDH genes suggests regions of greater sequence conservation likely related to critical enzymatic functions and metabolic controls. Although most plants contain only a single LKR/SDH gene per genome, poplar contains at least two functional bifunctional genes in addition to a monofunctional LKR gene. Analysis of ESTs finds evidence for monofunctional LKR transcripts in switchgrass, and monofunctional SDH transcripts in wheat, Brachypodium, and poplar. Conclusions The analysis of a wheat LKR/SDH gene and comparative structural and functional analyses among available plant genes provides new information on this important gene. Both the structure of the LKR/SDH gene and the immediately adjacent genes show lineage-specific differences between monocots and dicots, and

  1. Two worlds collide: image analysis methods for quantifying structural variation in cluster molecular dynamics.

    Science.gov (United States)

    Steenbergen, K G; Gaston, N

    2014-02-14

    Inspired by methods of remote sensing image analysis, we analyze structural variation in cluster molecular dynamics (MD) simulations through a unique application of the principal component analysis (PCA) and Pearson Correlation Coefficient (PCC). The PCA analysis characterizes the geometric shape of the cluster structure at each time step, yielding a detailed and quantitative measure of structural stability and variation at finite temperature. Our PCC analysis captures bond structure variation in MD, which can be used to both supplement the PCA analysis as well as compare bond patterns between different cluster sizes. Relying only on atomic position data, without requirement for a priori structural input, PCA and PCC can be used to analyze both classical and ab initio MD simulations for any cluster composition or electronic configuration. Taken together, these statistical tools represent powerful new techniques for quantitative structural characterization and isomer identification in cluster MD.

  2. Protein 3D structure computed from evolutionary sequence variation.

    Directory of Open Access Journals (Sweden)

    Debora S Marks

    Full Text Available The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing.In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy.We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues, including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7-4.8 Å C(α-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org. This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of

  3. Protein 3D structure computed from evolutionary sequence variation.

    Science.gov (United States)

    Marks, Debora S; Colwell, Lucy J; Sheridan, Robert; Hopf, Thomas A; Pagnani, Andrea; Zecchina, Riccardo; Sander, Chris

    2011-01-01

    The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing.In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy.We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues, including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7-4.8 Å C(α)-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org). This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of protein structures

  4. Lateral variations of crustal structure beneath the Indochina Peninsula

    Science.gov (United States)

    Yu, Youqiang; Hung, Tran D.; Yang, Ting; Xue, Mei; Liu, Kelly H.; Gao, Stephen S.

    2017-08-01

    Crustal thickness (H) and Vp/Vs (κ) measurements obtained by stacking P-to-S receiver functions recorded at 32 broadband seismic stations covering the Indochina Peninsula reveal systematic spatial variations in crustal properties. Mafic bulk crustal composition as indicated by high κ (>1.81) observations is found to exist along major strike-slip faults and the southern part of the Peninsula, where pervasive basaltic magmatism is found and is believed to be the results of lithospheric thinning associated with the indentation of the Indian into the Eurasian plates. In contrast, crust beneath the Khorat Plateau, which occupies the core of the Indochina Block, has relatively large H values with a mean of 36.9 ± 3 km and small κ measurements with an average of 1.74 ± 0.04, which indicates an overall felsic bulk composition. Those observations for the Khorat Plateau are comparable to the undeformed part of the South China Block. The laterally heterogeneous distribution of crustal properties and its correspondence with indentation-related tectonic features suggest that the Indochina lithosphere is extruded as rigid blocks rather than as a viscous flow.

  5. Variation of backscatter as an indicator of boundary layer structure

    Energy Technology Data Exchange (ETDEWEB)

    Bennett, M. [UMIST, Dept. of Chemical Engineering, Manchester (United Kingdom); Hunter, G.C. [National Power, Swindon (United Kingdom)

    1997-10-01

    In this work we have developed software to display cross-sections of the variance of backscatter over a given sampling period in addition to its absolute mean. We have analyzed a series of Lidar cross-sections of elevated plumes dispersing into a convective BL and have then derived profiles both of the mean backscatter, , as a function of height and of its relative, shot-to-shot, variation, {radical} /. The latter is a measure of the homogeneity of the aerosol. There is no cheap device for measuring BL depths so we were interested in comparing depths estimated using our Lidar with those predicted by the current ADMS atmospheric dispersion model. This is based on integrating an energy budget to predict the BL development and as such relies on values for the initial lapse rate and for the surface sensible heat flux. A major shortcoming of the model appears to be that, in the absence of measurements, it must assume a default value for the former; the latter may be estimated from surface measurements but is very sensitive to the assumed availability of surface moisture. (LN)

  6. Variational coupled mode theory and perturbation analysis for 1D photonic crystal structures using quasi-normal modes

    NARCIS (Netherlands)

    Maksimovic, Milan; Lohmeyer, Manfred; van Groesen, Embrecht W.C.

    2008-01-01

    Quasi-normal modes are used to directly characterize defect resonances in composite 1D Photonic Crystal structures. Variational coupled mode theory using QNMs enables quantification of the eigenfrequency splitting in composite structures. Also, variational perturbation analysis of complex

  7. Comparative genomics of the relationship between gene structure and expression

    NARCIS (Netherlands)

    Ren, X.

    2006-01-01

    The relationship between the structure of genes and their expression is a relatively new aspect of genome organization and regulation. With more genome sequences and expression data becoming available, bioinformatics approaches can help the further elucidation of the relationships between gene struc

  8. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  9. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2016-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  10. Variation in the sequence and modification state of the human insulin gene flanking regions.

    Science.gov (United States)

    Ullrich, A; Dull, T J; Gray, A; Philips, J A; Peter, S

    1982-04-10

    The nucleotide sequence of a highly repetitive sequence region upstream from the human insulin gene is reported. The length of this region varies between alleles in the population, and appears to be stably transmitted to the next generation in a Mendelian fashion. There is no significant correlation between the length of this sequence and two types of diabetes mellitus. We observe variation in the cleavability of a BglI recognition site downstream from the human insulin gene, which is probably due to variable nucleotide modification. This presumed modification state appears not to be inherited, and varies between tissues within an individual and between individuals for a given tissue. Both alleles in a given tissue DNA sample are modified to the same extent.

  11. Structure and in vitro transcription of human globin genes.

    Science.gov (United States)

    Proudfoot, N J; Shander, M H; Manley, J L; Gefter, M L; Maniatis, T

    1980-09-19

    The alpha-like and beta-like subunits of human hemoglobin are encoded by a small family of genes that are differentially expressed during development. Through the use of molecular cloning procedures, each member of this gene family has been isolated and extensively characterized. Although the alpha-like and beta-like globin genes are located on different chromosomes, both sets of genes are arranged in closely linked clusters. In both clusters, each of the genes is transcribed from the same DNA strand, and the genes are arranged in the order of their expressions during development. Structural comparisons of immediately adjacent genes within each cluster have provided evidence for the occurrence of gene duplication and correction during evolution and have led to the discovery of pseudogenes, genes that have acquired numerous mutations that prevent their normal expression. Recently, in vivo and in vitro systems for studying the expression of cloned eukaryotic genes have been developed as a means of identifying DNA sequences that are necessary for normal gene function. This article describes the application of an in vitro transcription procedure to the study of human globin gene expression.

  12. Identifying regulational alterations in gene regulatory networks by state space representation of vector autoregressive models and variational annealing.

    Science.gov (United States)

    Kojima, Kaname; Imoto, Seiya; Yamaguchi, Rui; Fujita, André; Yamauchi, Mai; Gotoh, Noriko; Miyano, Satoru

    2012-01-01

    In the analysis of effects by cell treatment such as drug dosing, identifying changes on gene network structures between normal and treated cells is a key task. A possible way for identifying the changes is to compare structures of networks estimated from data on normal and treated cells separately. However, this approach usually fails to estimate accurate gene networks due to the limited length of time series data and measurement noise. Thus, approaches that identify changes on regulations by using time series data on both conditions in an efficient manner are demanded. We propose a new statistical approach that is based on the state space representation of the vector autoregressive model and estimates gene networks on two different conditions in order to identify changes on regulations between the conditions. In the mathematical model of our approach, hidden binary variables are newly introduced to indicate the presence of regulations on each condition. The use of the hidden binary variables enables an efficient data usage; data on both conditions are used for commonly existing regulations, while for condition specific regulations corresponding data are only applied. Also, the similarity of networks on two conditions is automatically considered from the design of the potential function for the hidden binary variables. For the estimation of the hidden binary variables, we derive a new variational annealing method that searches the configuration of the binary variables maximizing the marginal likelihood. For the performance evaluation, we use time series data from two topologically similar synthetic networks, and confirm that our proposed approach estimates commonly existing regulations as well as changes on regulations with higher coverage and precision than other existing approaches in almost all the experimental settings. For a real data application, our proposed approach is applied to time series data from normal Human lung cells and Human lung cells treated by

  13. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory.

  14. Drd4 gene polymorphisms are associated with personality variation in a passerine bird.

    Science.gov (United States)

    Fidler, Andrew E; van Oers, Kees; Drent, Piet J; Kuhn, Sylvia; Mueller, Jakob C; Kempenaers, Bart

    2007-07-22

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, genotype-environment interactions and confounding environmental factors all act to obscure genotype-personality relationships. Such problems can be addressed by measuring personality under standardized conditions and by selection experiments, with both approaches only feasible with non-human animals. Looking for similar Drd4 genotype-personality associations in a free-living bird, the great tit (Parus major), we detected 73 polymorphisms (66 SNPs, 7 indels) in the P. major Drd4 orthologue. Two of the P. major Drd4 gene polymorphisms were investigated for evidence of association with novelty-seeking behaviour: a coding region synonymous single nucleotide polymorphism (SNP830) and a 15bp indel (ID15) located 5' to the putative transcription initiation site. Frequencies of the three Drd4 SNP830 genotypes, but not the ID15 genotypes, differed significantly between two P. major lines selected over four generations for divergent levels of 'early exploratory behaviour' (EEB). Strong corroborating evidence for the significance of this finding comes from the analysis of free-living, unselected birds where we found a significant association between SNP830 genotypes and differing mean EEB levels. These findings suggest that an association between Drd4 gene polymorphisms and animal personality variation predates the divergence of the avian and mammalian lineages. Furthermore, this work heralds the possibility of following microevolutionary changes in frequencies of behaviourally relevant Drd4 polymorphisms within populations where natural selection acts differentially on different personality types.

  15. Identification, expression and variation of the GNPDA2 gene, and its association with body weight and fatness traits in chicken.

    Science.gov (United States)

    Ouyang, Hongjia; Zhang, Huan; Li, Weimin; Liang, Sisi; Jebessa, Endashaw; Abdalla, Bahareldin A; Nie, Qinghua

    2016-01-01

    Background. The GNPDA2 (glucosamine-6-phosphate deaminase 2) gene is a member of Glucosamine-6-phosphate (GlcN6P) deaminase subfamily, which encoded an allosteric enzyme of GlcN6P. Genome-wide association studies (GWAS) have shown that variations of human GNPDA2 are associated with body mass index and obesity risk, but its function and metabolic implications remain to be elucidated.The object of this study was to characterize the gene structure, expression, and biological functions of GNPDA2 in chickens. Methods. Variant transcripts of chicken GNPDA2 and their expression were investigated using rapid amplification of cDNA ends (RACE) system and real-time quantitative PCR technology. We detected the GNPDA2 expression in hypothalamic, adipose, and liver tissue of Xinghua chickens with fasting and high-glucose-fat diet treatments, and performed association analysis of variations of GNPDA2 with productive traits in chicken. The function of GNPDA2 was further studied by overexpression and small interfering RNA (siRNA) methods in chicken preadipocytes. Results.Four chicken GNPDA2 transcripts (cGNPDA2-a∼cGNPDA2-d) were identified in this study. The complete transcript GNPDA2-a was predominantly expressed in adipose tissue (subcutaneous fat and abdominal fat), hypothalamus, and duodenum. In fasting chickens, the mRNA level of GNPDA2 was decreased by 58.8% (P Chicken fed a high-glucose-fat diet increased GNPDA2 gene expression about 2-fold higher in adipose tissue (P chicken (P chickens.

  16. A variational solution of 2-D sound-structure interaction problems

    Institute of Scientific and Technical Information of China (English)

    Yuying Huang; Haidong Su; Yu Xiang

    2006-01-01

    Based on the fluid-structure coupling theory,a localized variational principle for analyzing the sound radiation from elastic structure submerged in water due to harmonic excitations is presented.It will be a powerful tool to formulate various numerical methods for steady response of structural-acoustic systems.By means of this variational principle a hybrid element method,in which an analytical solution valid in most of the surrounding water is incorporated with finite elements distributed in the structure and its neighboring water,is devised.Computational examples are then given to demonstrate its high accuracy and time saving.

  17. Modeling Three-Dimensional Chromosome Structures Using Gene Expression Data.

    Science.gov (United States)

    Xiao, Guanghua; Wang, Xinlei; Khodursky, Arkady B

    2011-03-01

    Recent genomic studies have shown that significant chromosomal spatial correlation exists in gene expression of many organisms. Interestingly, coexpression has been observed among genes separated by a fixed interval in specific regions of a chromosome chain, which is likely caused by three-dimensional (3D) chromosome folding structures. Modeling such spatial correlation explicitly may lead to essential understandings of 3D chromosome structures and their roles in transcriptional regulation. In this paper, we explore chromosomal spatial correlation induced by 3D chromosome structures, and propose a hierarchical Bayesian method based on helical structures to formally model and incorporate the correlation into the analysis of gene expression microarray data. It is the first study to quantify and infer 3D chromosome structures in vivo using expression microarrays. Simulation studies show computing feasibility of the proposed method and that, under the assumption of helical chromosome structures, it can lead to precise estimation of structural parameters and gene expression levels. Real data applications demonstrate an intriguing biological phenomenon that functionally associated genes, which are far apart along the chromosome chain, are brought into physical proximity by chromosomal folding in 3D space to facilitate their coexpression. It leads to important biological insight into relationship between chromosome structure and function.

  18. Transferrin variation and genetic structure of reindeer populations in Scandinavia

    Directory of Open Access Journals (Sweden)

    Knut H. Røed

    1987-06-01

    Full Text Available Polyacrylamide gel electrophoresis was used to analyse transferrin variation in herds of semi-domestic reindeer from Scandinavia. The results are compared with previously reported values for other populations of both semi-domestic and wild reindeer using the same techniques as in the present study. In all populations the number of alleles was high, ranging from seven to eleven, and the heterozygosity was correspondingly high, with a mean of 0.749. This high genetic variation in all populations suggests that inbreeding is not widespread among Scandinavian reindeer. The pattern of allele frequency distribution indicates a high degree of genetic heterogeneity in the transferrin locus, both between the different semi-domestic herds and between the different wild populations. The mean value of genetic distance was 0.069 between semi-domestic herds and 0.091 between wild populations. Between semi-domestic and wild populations the genetic distance was particularly high, with a mean of 0.188. This high value was mainly due to a different pattern in the distribution of the two most common transferrin alleles: Tfu was most common among semi-domestic herds, while TfEI was most common among wild populations. These differences in transferrin allele distribution are discussed in relation to possible different origins of semi-domestic and wild reindeer in Scandinavia, or alternatively, to different selection forces acting on transferrin genotypes in semi-domestic and wild populations.Transferrin-variasjon og genetisk struktur hos rein i Skandinavia.Abstact in Norwegian / Sammendrag: Transferrin-variasjon i tamreinflokker ble analysert ved hjelp av polyacrylamid gel elektroforese. Resultatene er sammenlignet med verdier som tidligere er beskrevet for både tamrein og villrein hvor det ble benyttet samme metode som i denne undersøkelsen. I alle populasjonene ble det registrert et høyt antall alleler (7-11 og heterozygositeten var tilsvarende høy med en

  19. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. ...... imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). CONCLUSION: These results, generated on a large cohort of women, revealed associations between inherited cellular transport gene variants and risk of EOC histologic subtypes.......BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes....... As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. METHODS: In total, DNA samples were obtained from 14,525 case subjects with invasive EOC...

  20. Molecular cloning and daily variations of the Period gene in a reef fish Siganus guttatus.

    Science.gov (United States)

    Park, Ji-Gweon; Park, Yong-Ju; Sugama, Nozomi; Kim, Se-Jae; Takemura, Akihiro

    2007-04-01

    As the first step in understanding the molecular oscillation of the circa rhythms in the golden rabbitfish Siganus guttatus--a reef fish with a definite lunar-related rhythmicity--we cloned and sequenced a Period gene (rfPer). The rfPer gene contained an open reading frame that encodes a protein consisting of 1,452 amino acids; this protein is highly homologous to PER proteins of vertebrates including zebrafish. Phylogenetic analyses indicated that the rfPER protein is related to the zebrafish PER1 and PER4. The expression of rfPer mRNA in the whole brain, retina, and liver under light/dark (LD) conditions increased at 06:00 h and decreased at 18:00 h, suggesting that its robust circadian rhythm occurs in neural and peripheral tissues. When daily variation in the expression in rfPer mRNA in the whole brain and cultured pineal gland were examined under LD conditions, similar expression patterns of the gene were observed with an increase around dawn. Under constant light condition, the increased expression of rfPer mRNA in the whole brain disappeared around dawn. The present results demonstrate that rfPer is related to zPer4 and possibly zPer1. The present study is the first report on the Period gene from a marine fish.

  1. [Influence of anatomic variations of the structures of the middle nasal meatus on sinonasal diseases].

    Science.gov (United States)

    Buljcik-Cupić, Maja M; Savović, Slobodan N; Jovićević, Jasna S

    2008-01-01

    The most common anatomic variations of the structures of the middle nasal meatus are variations of agger nasi cells, variations of the middle turbinate, variations of uncinate process, variations of the ethmoidal bulla, deviations and deformations of nasal septum in the region of the middle nasal meatus, Haller's cell (orbitoethmoidal) and Onodi's cell (sphenoethmoidal cell). In 1997, the Otorhinolaryngology-Head Neck Surgery, Task Force on Chronic Rhinosinusitis defined chronic sinusitis and nasal disease initially by including sinusitis and rhinitis with one term-chronic rhinosinusitis. This was done because it was apparent to many that nasal disoders often affected the sinuses, and vice versa. Also they established baseline parameters, major and minor signs and symptoms, for definition of rhinosinusitis. Two major factors or one major factor and two minor factors constitute a strong history for rhinosinusitis. The following methods were used in the study: 1. Anamnestic data processing about: disease symptoms that were recognized by American Academy for ENT as major and minor criteria in diagnosing nosinusitis; the duration of symptoms; the kind of sinonasal disorder and the secondary disorders. 2. Data processing obtained by anterior/posterior rhinoscopy. 3. Data processing obtained by endoscopic examination. 4. Data processing obtained by CT of paranasal cavities and the nose. The data about anatomic variations were statistically processed by Eives's correlation coefficient that indicates the degree of correlation between sinonasal disorders and anatomic variation. By analyzing the obtained data in the examined patients with sinonasal disorders, anatomic variations were present in over 50% of the patients and are defined by percentage. 1. The deviation of nasal septum in 83.33% patients. 2. The variations of the form of the middle nasal chonha in 58.92% patients. 3. The presence of agger nasi cells in 50% patients. 4. Variations of the form of ethomoidal bulla

  2. Genetic variation and population structure in native Americans.

    Directory of Open Access Journals (Sweden)

    Sijia Wang

    2007-11-01

    Full Text Available We examined genetic diversity and population structure in the American landmass using 678 autosomal microsatellite markers genotyped in 422 individuals representing 24 Native American populations sampled from North, Central, and South America. These data were analyzed jointly with similar data available in 54 other indigenous populations worldwide, including an additional five Native American groups. The Native American populations have lower genetic diversity and greater differentiation than populations from other continental regions. We observe gradients both of decreasing genetic diversity as a function of geographic distance from the Bering Strait and of decreasing genetic similarity to Siberians--signals of the southward dispersal of human populations from the northwestern tip of the Americas. We also observe evidence of: (1 a higher level of diversity and lower level of population structure in western South America compared to eastern South America, (2 a relative lack of differentiation between Mesoamerican and Andean populations, (3 a scenario in which coastal routes were easier for migrating peoples to traverse in comparison with inland routes, and (4 a partial agreement on a local scale between genetic similarity and the linguistic classification of populations. These findings offer new insights into the process of population dispersal and differentiation during the peopling of the Americas.

  3. Insurer market structure and variation in commercial health care spending.

    Science.gov (United States)

    McKellar, Michael R; Naimer, Sivia; Landrum, Mary B; Gibson, Teresa B; Chandra, Amitabh; Chernew, Michael

    2014-06-01

    To examine the relationship between insurance market structure and health care prices, utilization, and spending. Claims for 37.6 million privately insured employees and their dependents from the Truven Health Market Scan Database in 2009. Measures of insurer market structure derived from Health Leaders Inter study data. Regression models are used to estimate the association between insurance market concentration and health care spending, utilization, and price, adjusting for differences in patient characteristics and other market-level traits. Insurance market concentration is inversely related to prices and spending, but positively related to utilization. Our results imply that, after adjusting for input price differences, a market with two equal size insurers is associated with 3.9 percent lower medical care spending per capita (p = .002) and 5.0 percent lower prices for health care services relative to one with three equal size insurers (p market might lead to higher prices and higher spending for care, suggesting some of the gains from insurer competition may be absorbed by higher prices for health care. Greater attention to prices and utilization in the provider market may need to accompany procompetitive insurance market strategies. © Health Research and Educational Trust.

  4. Primary structural variation in anaplasma marginale Msp2 efficiently generates immune escape variants

    Science.gov (United States)

    Antigenic variation allows microbial pathogens to evade immune clearance and establish persistent infection. Anaplasma marginale utilizes gene conversion of a repertoire of silent msp2 alleles into a single active expression site to encode unique Msp2 variants. As the genomic complement of msp2 alle...

  5. Structure and Function of Cytochrome P-450 Genes

    Science.gov (United States)

    1988-01-25

    UNIT Bolling Air Force Base, D.C. 20332 ELEMENT NO. NO. NO. ACCESSION NO. 61102F 2312 A5 11. TITLE (Include Security Clasification ) Structure and...chromatin structure of these genes and to characterize nuclear proteins that bind to the genes. Accesion For hRIS A-RA&I d OVIrC TAB LISUrc’t,:oimnc...nuclear proteins that bind to the genes. ........ .. A. RESEARCH OBJECTIVES The overall goal and the specific aims of this project remain the same as

  6. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    LENUS (Irish Health Repository)

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  7. The impact of osteopontin gene variations on multiple sclerosis development and progression.

    Science.gov (United States)

    Comi, Cristoforo; Cappellano, Giuseppe; Chiocchetti, Annalisa; Orilieri, Elisabetta; Buttini, Sara; Ghezzi, Laura; Galimberti, Daniela; Guerini, Franca; Barizzone, Nadia; Perla, Franco; Leone, Maurizio; D'Alfonso, Sandra; Caputo, Domenico; Scarpini, Elio; Cantello, Roberto; Dianzani, Umberto

    2012-01-01

    Osteopontin is a proinflammatory molecule, modulating TH1 and TH17 responses. Several reports suggest its involvement in multiple sclerosis (MS) pathogenesis. We previously reported that OPN gene variations at the 3' end are a predisposing factor for MS development and evolution. In this paper, we extended our analysis to a gene variation at the 5' end on the -156G > GG single nucleotide polymorphism (SNP) and replicated our previous findings at the 3' end on the +1239A > C SNP. We found that only +1239A > C SNP displayed a statistically significant association with MS development, but both +1239A > C and -156G > GG had an influence on MS progression, since patients homozygous for both +1239A and -156GG alleles displayed slower progression of disability and slower switch to secondary progression than those carrying +1239C and/or -156G and those homozygous for +1239A only. Moreover, patients homozygous for +1239A also displayed a significantly lower relapse rate than those carrying +1239C, which is in line with the established role of OPN in MS relapses.

  8. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Directory of Open Access Journals (Sweden)

    Helle Ruff Laursen

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  9. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  10. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A

  11. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the

  12. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A a

  13. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    2012-01-01

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the pre

  14. Low structural variation in the host-defense peptide repertoire of the dwarf clawed frog Hymenochirus boettgeri (Pipidae.

    Directory of Open Access Journals (Sweden)

    Severine Matthijs

    Full Text Available THE skin secretion of many amphibians contains peptides that are able to kill a broad range of microorganisms (antimicrobial peptides: AMPs and potentially play a role in innate immune defense. Similar to the toxin arsenals of various animals, amphibian AMP repertoires typically show major structural variation, and previous studies have suggested that this may be the result of diversifying selection in adaptation to a diverse spectrum of pathogens. Here we report on transcriptome analyses that indicate a very different pattern in the dwarf clawed frog H. boettgeri. Our analyses reveal a diverse set of transcripts containing two to six tandem repeats, together encoding 14 distinct peptides. Five of these have recently been identified as AMPs, while three more are shown here to potently inhibit the growth of gram-negative bacteria, including multi-drug resistant strains of the medically important Pseudomonas aeruginosa. Although the number of predicted peptides is similar to the numbers of related AMPs in Xenopus and Silurana frog species, they show significantly lower structural variation. Selection analyses confirm that, in contrast to the AMPs of other amphibians, the H. boettgeri peptides did not evolve under diversifying selection. Instead, the low sequence variation among tandem repeats resulted from purifying selection, recent duplication and/or concerted gene evolution. Our study demonstrates that defense peptide repertoires of closely related taxa, after diverging from each other, may evolve under differential selective regimes, leading to contrasting patterns of structural diversity.

  15. Increased complexity of gene structure and base composition in vertebrates

    Institute of Scientific and Technical Information of China (English)

    Ying Wu; Huizhong Yuan; Shengjun Tan; Jian-Qun Chen; Dacheng Tian; Haiwang Yang

    2011-01-01

    How the structure and base composition of genes changed with the evolution of vertebrates remains a puzzling question. Here we analyzed 895 orthologous protein-coding genes in six multicellular animals: human, chicken, zebrafish, sea squirt, fruit fly, and worm. Our analyses reveal that many gene regions, particularly intron and 3' UTR, gradually expanded throughout the evolution of vertebrates from their invertebrate ancestors, and that the number of exons per gene increased. Studies based on all protein-coding genes in each genome provide consistent results.We also find that GC-content increased in many gene regions (especially 5' UTR) in the evolution of endotherms, except in coding-exons.Analysis of individual genomes shows that 3′ UTR demonstrated stronger length and CC-content correlation with intron than 5' UTR, and gene with large intron in all six species demonstrated relatively similar GC-content. Our data indicates a great increase in complexity in vertebrate genes and we propose that the requirement for morphological and functional changes is probably the driving force behind the evolution of structure and base composition complexity in multicellular animal genes.

  16. Identification, expression and variation of the GNPDA2 gene, and its association with body weight and fatness traits in chicken

    Directory of Open Access Journals (Sweden)

    Hongjia Ouyang

    2016-06-01

    Full Text Available Background. The GNPDA2 (glucosamine-6-phosphate deaminase 2 gene is a member of Glucosamine-6-phosphate (GlcN6P deaminase subfamily, which encoded an allosteric enzyme of GlcN6P. Genome-wide association studies (GWAS have shown that variations of human GNPDA2 are associated with body mass index and obesity risk, but its function and metabolic implications remain to be elucidated.The object of this study was to characterize the gene structure, expression, and biological functions of GNPDA2 in chickens. Methods. Variant transcripts of chicken GNPDA2 and their expression were investigated using rapid amplification of cDNA ends (RACE system and real-time quantitative PCR technology. We detected the GNPDA2 expression in hypothalamic, adipose, and liver tissue of Xinghua chickens with fasting and high-glucose-fat diet treatments, and performed association analysis of variations of GNPDA2 with productive traits in chicken. The function of GNPDA2 was further studied by overexpression and small interfering RNA (siRNA methods in chicken preadipocytes. Results.Four chicken GNPDA2 transcripts (cGNPDA2-a∼cGNPDA2-d were identified in this study. The complete transcript GNPDA2-a was predominantly expressed in adipose tissue (subcutaneous fat and abdominal fat, hypothalamus, and duodenum. In fasting chickens, the mRNA level of GNPDA2 was decreased by 58.8% (P < 0.05 in hypothalamus, and returned to normal level after refeeding. Chicken fed a high-glucose-fat diet increased GNPDA2 gene expression about 2-fold higher in adipose tissue (P < 0.05 than that in the control (fed a basal diet, but decreased its expression in hypothalamus. Two single-nucleotide polymorphisms of the GNPDA2 gene were significantly associated with body weight and a number of fatness traits in chicken (P < 0.05. Conclusion. Our findings indicated that the GNPDA2 gene has a potential role in the regulation of body weight, fat and energy metabolism in chickens.

  17. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  18. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt

    2011-01-01

    Recently, two large, and independent genome wide association studies of late-onset Alzheimer's disease (AD) established association with the same rs11136000 variation in the clusterin (CLU) gene. In addition, one variation, rs3851179, in the phosphatidylinositol binding clathrin assembly protein...... (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...

  19. Population genetic structure of Japanese wild soybean (Glycine soja) based on microsatellite variation.

    Science.gov (United States)

    Kuroda, Y; Kaga, A; Tomooka, N; Vaughan, D A

    2006-04-01

    The research objectives were to determine aspects of the population dynamics relevant to effective monitoring of gene flow in the soybean crop complex in Japan. Using 20 microsatellite primers, 616 individuals from 77 wild soybean (Glycine soja) populations were analysed. All samples were of small seed size ( 10 km) events among populations, and spatial autocorrelation analysis revealed that populations within a radius of 100 km showed a close genetic relationship to one another. When analysis of graphical ordination was applied to compare the microsatellite variation of wild soybean with that of 53 widely grown Japanese varieties of cultivated soybean (Glycine max), the primary factor of genetic differentiation was based on differences between wild and cultivated soybeans and the secondary factor was geographical differentiation of wild soybean populations. Admixture analysis revealed that 6.8% of individuals appear to show introgression from cultivated soybeans. These results indicated that population genetic structure of Japanese wild soybean is (i) strongly affected by the founder effect due to seed dispersal and inbreeding strategy, (ii) generally well differentiated from cultivated soybean, but (iii) introgression from cultivated soybean occurs. The implications of the results for the release of transgenic soybeans where wild soybeans grow are discussed.

  20. Geographic variation in the structure of oak hybrid zones provides insights into the dynamics of speciation.

    Science.gov (United States)

    Zeng, Yan-Fei; Liao, Wan-Jin; Petit, Rémy J; Zhang, Da-Yong

    2011-12-01

    Studying geographic variation in the rate of hybridization between closely related species could provide a useful window on the evolution of reproductive isolation. Reinforcement theory predicts greater prezygotic isolation in areas of prolonged contact between recently diverged species than in areas of recent contact, which implies that old contact zones would be dominated by parental phenotypes with few hybrids (bimodal hybrid zones), whereas recent contact zones would be characterized by hybrid swarms (unimodal hybrid zones). Here, we investigate how the hybrid zones of two closely related Chinese oaks, Quercus mongolica and Q. liaotungensis, are structured geographically using both nuclear and chloroplast markers. We found that populations of Q. liaotungensis located around the Changbai Mountains in Northeast China, an inferred glacial refugium, were introgressed by genes from Q. mongolica, suggesting historical contact between the two species in this region. However, these introgressed populations form sharp bimodal hybrid zones with Q. mongolica. In contrast, populations of Q. liaotungensis located in North China, which show no sign of ancient introgression with Q. mongolica, form unimodal hybrid zones with Q. mongolica. These results are consistent with the hypothesis that selection against hybrids has had sufficient time to reinforce the reproductive barriers between Q. liaotungensis and Q. mongolica in Northeast China but not in North China.

  1. Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation.

    Science.gov (United States)

    Zhao, Yan; Huang, Jin; Wang, Zhizheng; Jing, Shengli; Wang, Yang; Ouyang, Yidan; Cai, Baodong; Xin, Xiu-Fang; Liu, Xin; Zhang, Chunxiao; Pan, Yufang; Ma, Rui; Li, Qiaofeng; Jiang, Weihua; Zeng, Ya; Shangguan, Xinxin; Wang, Huiying; Du, Bo; Zhu, Lili; Xu, Xun; Feng, Yu-Qi; He, Sheng Yang; Chen, Rongzhi; Zhang, Qifa; He, Guangcun

    2016-10-24

    Brown planthopper (BPH), Nilaparvata lugens Stål, is one of the most devastating insect pests of rice (Oryza sativa L.). Currently, 30 BPH-resistance genes have been genetically defined, most of which are clustered on specific chromosome regions. Here, we describe molecular cloning and characterization of a BPH-resistance gene, BPH9, mapped on the long arm of rice chromosome 12 (12L). BPH9 encodes a rare type of nucleotide-binding and leucine-rich repeat (NLR)-containing protein that localizes to the endomembrane system and causes a cell death phenotype. BPH9 activates salicylic acid- and jasmonic acid-signaling pathways in rice plants and confers both antixenosis and antibiosis to BPH. We further demonstrated that the eight BPH-resistance genes that are clustered on chromosome 12L, including the widely used BPH1, are allelic with each other. To honor the priority in the literature, we thus designated this locus as BPH1/9 These eight genes can be classified into four allelotypes, BPH1/9-1, -2, -7, and -9 These allelotypes confer varying levels of resistance to different biotypes of BPH. The coding region of BPH1/9 shows a high level of diversity in rice germplasm. Homologous fragments of the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains exist, which might have served as a repository for generating allele diversity. Our findings reveal a rice plant strategy for modifying the genetic information to gain the upper hand in the struggle against insect herbivores. Further exploration of natural allelic variation and artificial shuffling within this gene may allow breeding to be tailored to control emerging biotypes of BPH.

  2. Experimental investigation of crustacean swimming with variation of limb structures

    Science.gov (United States)

    Lai, Hong Kuan; Samaee, Milad; Donnell, Geoffrey; Santhanakrishnan, Arvind; Guy, Robert; Lewis, Timothy

    2015-11-01

    Crustaceans such as crayfish and krill swim by rhythmically paddling a set of four to five limbs (known as swimmerets or pleopods) originating from their abdomen. The limb motion in these animals has been observed to follow tail-to-head metachronal wave pattern with an approximate quarter-period inter-limb phase difference. The goal of this study is to investigate the hydrodynamics of this swimming mechanism as a function of inter-limb phase difference, inclusion of hinges in the limbs, and Reynolds number (Re). 2D PIV measurements were conducted on a scaled robotic model of metachronal paddling, consisting of a rectangular tank fitted with stepper motors coupled to a four-bar linkage that actuated four paddles immersed in water-glycerin fluid medium. The inter-limb phase difference was varied from 0% (synchronous paddling) through 50% across Re range of O(10-1000). Two types of limb models were used, including a simple flat plate and a `split-paddle' structure with two flat plates connected halfway with hinges. The results of the study show that limb models with hinges generated increased horizontal (thrust-producing direction) fluid velocity compared to the simple flat plate paddles, suggesting that asymmetry between power and return strokes is important to augment thrust.

  3. Structural Variations to a Donor Polymer with Low Energy Losses

    KAUST Repository

    Bazan, Guillermo C

    2017-08-01

    Two regioregular narrow band gap conjugated polymers with a D’-A-D-A repeat unit architecture, namely PIFCF and PSFCF, were designed and synthesized. Both polymers contain strictly organized fluorobenzo[c][1,2,5]thiadiazole (FBT) orientations and different solubilizing side chains for solution processing. Compared to the previously reported asymmetric pyridyl-[2,1,3]thiadiazole (PT) based regioregular polymer, namely PIPCP, PIFCF and PSFCF exhibit wider band gaps, tighter π-π stacking, and improved hole mobilities. When incorporated into solar cells with fullerene acceptors, the Eloss = Eg - eVoc values of PIFCF and PSFCF devices are increased compared to solar cells based on PIPCP. Determination of Ect in these solar cells reveals that, relative to PIPCP, PIFCF solar cells lose more energy from Eg - Ect, and PSFCF solar cells lose more energy from both Eg - Ect and Ect - eVoc. The close structural relationship between PIPCP and PIFCF provides an excellent framework to establish molecular features that impact the relationship between Eg and Ect. Theoretical calculations predict that Eloss of PIFCF:PC61BM would be higher than in the case of PIPCP:PC61BM, due to greater Eg - Ect. These findings provide insight into the design of high performance, low voltage loss photovoltaic polymeric materials with desirable optoelectronic properties.

  4. Ionic liquids based on dicyanamide anion: influence of structural variations in cationic structures on ionic conductivity.

    Science.gov (United States)

    Yoshida, Yukihiro; Baba, Osamu; Saito, Gunzi

    2007-05-10

    A series of dicyanamide [N(CN)2]-based ionic liquids were prepared using 1-alkyl-3-methylimidazolium cations with different alkyl chain lengths and ethyl-containing heterocyclic cations with different ring structures, and the influence of such structural variations on their thermal property, density, electrochemical window, viscosity, ionic conductivity, and solvatochromic effects was investigated. We found that the 1,3-dimethylimidazolium salt shows the highest ionic conductivity among ionic liquids free from halogenated anions (3.6 x 10(-2) S cm(-1) at 25 degrees C), and the elongation of the alkyl chain causes the pronounced depression of fluidity and ionic conductivity. Also, such an elongation gives rise to the increase in the degree of ion association in the liquids, mainly caused by the van der Waals interactions between alkyl chains. N(CN)2 salts with 1-ethyl-2-methylpyrazolium (EMP) and N-ethyl-N-methylpyrrolidinium (PY(12)) cations as well as 1-ethyl-3-methylimidazolium (EMI) cation are liquids at room temperature (RT), while the N-ethylthiazolium salt shows a melting event at higher temperature (57 degrees C). Among the three RT ionic liquids with ethyl-containing cations, RT ionic conductivity follows the order EMI > PY(12) > EMP, which does not coincide with the order of fluidity at RT (EMI > EMP > PY(12)). Such a discrepancy is originated from a high degree of ion dissociation in the PY(12) salt, which was manifested in the Walden rule deviation and solvatochromic effects. A series of N(CN)2/C(CN)3 binary mixtures of the EMI salts were also prepared. RT ionic conductivity decreases linearly with increasing the molar fraction of C(CN)3 anion.

  5. Genetic variation in exon 5 of troponin - I gene in hypertrophic cardiomyopathy cases

    Directory of Open Access Journals (Sweden)

    Annapurna S

    2007-01-01

    Full Text Available Background: Cardiomyopathies are a heterogeneous group of heart muscle disorders and are classified as 1 Hypertrophic Cardiomyopathy (HCM 2 Dilated cardiomyopathy (DCM 3 Restrictive cardiomyopathy (RCM and 4 Arrhythmogenic right ventricular dysplasia (ARVD as per WHO classification, of which HCM and DCM are common. HCM is a complex but relatively common form of inherited heart muscle disease with prevalence of 1 in 500 individuals and is commonly associated with sarcomeric gene mutations. Cardiac muscle troponin I (TNNI-3 is one such sarcomeric protein and is a subunit of the thin filament-associated troponin-tropomyosin complex involved in calcium regulation of skeletal and cardiac muscle contraction. Mutations in this gene were found to be associated with a history of sudden cardiac death in HCM patients. Aim: Therefore the present study aims to identify for mutations associated with troponin I gene in a set of HCM patients from Indian population. Materials and Methods: Mutational analyses of 92 HCM cases were carried out following PCR based SSCP analysis. Results: The study revealed band pattern variation in 3 cases from a group of 92 HCM patients. This band pattern variation, on sequencing revealed base changes, one at nt 2560 with G>T transversion in exon-5 region with a wobble and others at nt 2479 and nt 2478 with G>C and C>G transversions in the intronic region upstream of the exon 5 on sequencing. Further analysis showed that one of the probands showed apical form of hypertrophy, two others showing asymmetric septal hypertrophy. Two of these probands showed family history of the condition. Conclusions: Hence, the study supports earlier reports of involvement of TNNI-3 in the causation of apical and asymmetrical forms of hypertrophy.

  6. Genomic imprinting variations in the mouse type 3 deiodinase gene between tissues and brain regions.

    Science.gov (United States)

    Martinez, M Elena; Charalambous, Marika; Saferali, Aabida; Fiering, Steven; Naumova, Anna K; St Germain, Donald; Ferguson-Smith, Anne C; Hernandez, Arturo

    2014-11-01

    The Dio3 gene, which encodes for the type 3 deiodinase (D3), controls thyroid hormone (TH) availability. The lack of D3 in mice results in tissue overexposure to TH and a broad neuroendocrine phenotype. Dio3 is an imprinted gene, preferentially expressed from the paternally inherited allele in the mouse fetus. However, heterozygous mice with paternal inheritance of the inactivating Dio3 mutation exhibit an attenuated phenotype when compared with that of Dio3 null mice. To investigate this milder phenotype, the allelic expression of Dio3 was evaluated in different mouse tissues. Preferential allelic expression of Dio3 from the paternal allele was observed in fetal tissues and neonatal brain regions, whereas the biallelic Dio3 expression occurred in the developing eye, testes, and cerebellum and in the postnatal brain neocortex, which expresses a larger Dio3 mRNA transcript. The newborn hypothalamus manifests the highest degree of Dio3 expression from the paternal allele, compared with other brain regions, and preferential allelic expression of Dio3 in the brain relaxed in late neonatal life. A methylation analysis of two regulatory regions of the Dio3 imprinted domain revealed modest but significant differences between tissues, but these did not consistently correlate with the observed patterns of Dio3 allelic expression. Deletion of the Dio3 gene and promoter did not result in significant changes in the tissue-specific patterns of Dio3 allelic expression. These results suggest the existence of unidentified epigenetic determinants of tissue-specific Dio3 imprinting. The resulting variation in the Dio3 allelic expression between tissues likely explains the phenotypic variation that results from paternal Dio3 haploinsufficiency.

  7. Gene-based and semantic structure of the Gene Ontology as a complex network

    Science.gov (United States)

    Coronnello, Claudia; Tumminello, Michele; Miccichè, Salvatore

    2016-09-01

    The last decade has seen the advent and consolidation of ontology based tools for the identification and biological interpretation of classes of genes, such as the Gene Ontology. The Gene Ontology (GO) is constantly evolving over time. The information accumulated time-by-time and included in the GO is encoded in the definition of terms and in the setting up of semantic relations amongst terms. Here we investigate the Gene Ontology from a complex network perspective. We consider the semantic network of terms naturally associated with the semantic relationships provided by the Gene Ontology consortium. Moreover, the GO is a natural example of bipartite network of terms and genes. Here we are interested in studying the properties of the projected network of terms, i.e. a gene-based weighted network of GO terms, in which a link between any two terms is set if at least one gene is annotated in both terms. One aim of the present paper is to compare the structural properties of the semantic and the gene-based network. The relative importance of terms is very similar in the two networks, but the community structure changes. We show that in some cases GO terms that appear to be distinct from a semantic point of view are instead connected, and appear in the same community when considering their gene content. The identification of such gene-based communities of terms might therefore be the basis of a simple protocol aiming at improving the semantic structure of GO. Information about terms that share large gene content might also be important from a biomedical point of view, as it might reveal how genes over-expressed in a certain term also affect other biological processes, molecular functions and cellular components not directly linked according to GO semantics.

  8. Surgical anatomy and morphologic variations of umbilical structures.

    Science.gov (United States)

    Fathi, Amir H; Soltanian, Hooman; Saber, Alan A

    2012-05-01

    The umbilicus is the main access route to the abdominal cavity in laparoscopic surgeries. However, its anatomical configuration is rarely studied in the surgical and anatomical literature. With introduction of laparoendoscopic single-site surgery and considering the significant number of primary and postoperative umbilical hernias, we felt the necessity to comprehensively study the umbilical structures and analyze their protective function against hernias. Twenty-four embalmed cadavers were studied in the anatomy laboratory of Case Western Reserve University. Round hepatic, median and medial ligaments, umbilical ring, umbilical and umbilicovesicular fasciae, and pattern of attachment to the ring were dissected and measured. Mean age was 82.1 years, ranging between 56 and 96 years, with a male-to-female ratio of 1.4:1. Ninety-two per cent was white and 8 per cent black adults. According to shape and attachment pattern of ligaments, umbilical ring is classified into five types. Hernia incidence was 25 per cent. All hernia cases lacked the umbilical fascia and the round hepatic ligament was not attached to the inferior border of the ring. The umbilical ring and its morphologic relation with adjacent ligaments are described and classified into five types. In contrary to sparse existing literature, we propose that umbilical fascia is continuation and condensation of umbilicovesicular rather than transversalis fascia. It was absent in cadavers forming conjoined median and medial ligaments with a single insertion site to the ring. Round ligament insertion to the inferior border of the ring provides another protective factor. These two protective measures were absent in all the observed umbilical hernias.

  9. STUDY ON MORPHOLOGICAL VARIATIONS IN STRUCTURE OF THE JUGULAR FORAMEN

    Directory of Open Access Journals (Sweden)

    Shruthi B.N

    2015-12-01

    Full Text Available Background: The jugular foramen is difficult to understand and to access surgically; the difficulties in exposing this foramen are created by its deep location and the surrounding structures, such as the carotid artery anteriorly, the facial nerve laterally, the hypoglossal nerve medially and the vertebral artery inferiorly, all of which block access to the foramen and require careful management. It is difficult to conceptualize because it varies in size and shape in different crania, between the two sides the same cranium, from its intracranial to extracranial end in the same foramen and because of its complex irregular shape, its curved course, its formation by two bones and the numerous nerves and venous channels that pass through it. The present study is concentrated to study morphological features of jugular foramen. Material and Methods: The present study was undertaken in 250(500 sides adult south Indian skulls from different regions of south India, from different medical colleges. We have observed the size of foramen and presence of jugular fossa. Result: Out of 250 skulls in 20.8% of cases the right foramina were larger than the left, in 24.8% of cases the left foramina were larger than the right and in 8% cases were equal on both sides. The jugular fossa present bilaterally in 60%, on the right only in 21.6% cases, on the left only in 7.6% cases and was absent in 10.8% cases. Conclusion: The present study concludes that there is no significance different between size of foramen in right and left side. The jugular fossa or bulb present bilaterally in majority of cases.

  10. Copy number variations of the ATP-binding cassette transporter ABCC6 gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Kringen Marianne K

    2012-08-01

    Full Text Available Abstract Background The ATP-binding cassette transporter ABCC6 gene is located on chromosome 16 between its two pseudogenes (ABCC6P1 and ABCC6P2. Previously, we have shown that ABCC6P1 is transcribed and affects ABCC6 at the transcriptional level. In this study we aimed to determine copy number variations of ABCC6, ABCC6P1 and ABCC6P2 in different populations. Moreover, we sought to study the transcription pattern of ABCC6 and ABCC6 pseudogenes in 39 different human tissues. Findings Genomic DNA from healthy individuals from five populations, Chinese (n = 24, Middle East (n = 20, Mexicans (n = 24, Caucasians (n = 50 and Africans (n = 24, were examined for copy number variations of ABCC6 and its pseudogenes by pyrosequencing and quantitative PCR. Copy number variation of ABCC6 was very rare (2/142; 1.4%. However, one or three copies of ABCC6P1 were relatively common (3% and 8%, respectively. Only one person had a single copy of ABCC6P2 while none had three copies. In Chinese, deletions or duplications of ABCC6P1 were more frequent than in any other population (9/24; 37.5%. The transcription pattern of ABCC6P2 was highly similar to ABCC6 and ABCC6P1, with highest transcription in liver and kidney. Interestingly, the total transcription level of pseudogenes, ABCC6P1 + ABCC6P2, was higher than ABCC6 in most tissues, including liver and kidney. Conclusions Copy number variations of the ABCC6 pseudogenes are quite common, especially in populations of Chinese ancestry. The expression pattern of ABCC6P2 in 39 human tissues was highly similar to that of ABCC6 and ABCC6P1 suggesting similar regulatory mechanisms for ABCC6 and its pseudogenes.

  11. Towards Structural Analysis of Audio Recordings in the Presence of Musical Variations

    Directory of Open Access Journals (Sweden)

    Frank Kurth

    2007-01-01

    Full Text Available One major goal of structural analysis of an audio recording is to automatically extract the repetitive structure or, more generally, the musical form of the underlying piece of music. Recent approaches to this problem work well for music, where the repetitions largely agree with respect to instrumentation and tempo, as is typically the case for popular music. For other classes of music such as Western classical music, however, musically similar audio segments may exhibit significant variations in parameters such as dynamics, timbre, execution of note groups, modulation, articulation, and tempo progression. In this paper, we propose a robust and efficient algorithm for audio structure analysis, which allows to identify musically similar segments even in the presence of large variations in these parameters. To account for such variations, our main idea is to incorporate invariance at various levels simultaneously: we design a new type of statistical features to absorb microvariations, introduce an enhanced local distance measure to account for local variations, and describe a new strategy for structure extraction that can cope with the global variations. Our experimental results with classical and popular music show that our algorithm performs successfully even in the presence of significant musical variations.

  12. Genes and quantitative genetic variation involved with senescence in cells, organs and the whole plant

    Directory of Open Access Journals (Sweden)

    Benoit ePujol

    2015-02-01

    Full Text Available Senescence, the deterioration of morphological, physiological and reproductive functions with age that ends with the death of the organism, was widely studied in plants. Genes were identified that are linked to the deterioration of cells, organs and the whole plant. It is however unclear whether those genes are the source of age dependent deterioration or get activated to regulate such deterioration. Furthermore, it is also unclear whether such genes are active as a direct consequence of age or because they are specifically involved in some developmental stages. At the individual level, it is the relationship between quantitative genetic variation and age that can be used to detect the genetic signature of senescence. Surprisingly, the latter approach was only scarcely applied to plants. This may be the consequence of the demanding requirements for such approaches and/or the fact that most research interest was directed towards plants that avoid senescence. Here, I review those aspects in turn and call for an integrative genetic theory of senescence in plants. Such conceptual development would have implications for the management of plant genetic resources and generate progress on fundamental questions raised by ageing research.

  13. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    Institute of Scientific and Technical Information of China (English)

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  14. Identification of genomic indels and structural variations using split reads

    Directory of Open Access Journals (Sweden)

    Urban Alexander E

    2011-07-01

    Full Text Available Abstract Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC, a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read. All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions. A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models. This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions. We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole

  15. Gene expression in chicken reveals correlation with structural genomic features and conserved patterns of transcription in the terrestrial vertebrates.

    Directory of Open Access Journals (Sweden)

    Haisheng Nie

    Full Text Available BACKGROUND: The chicken is an important agricultural and avian-model species. A survey of gene expression in a range of different tissues will provide a benchmark for understanding expression levels under normal physiological conditions in birds. With expression data for birds being very scant, this benchmark is of particular interest for comparative expression analysis among various terrestrial vertebrates. METHODOLOGY/PRINCIPAL FINDINGS: We carried out a gene expression survey in eight major chicken tissues using whole genome microarrays. A global picture of gene expression is presented for the eight tissues, and tissue specific as well as common gene expression were identified. A Gene Ontology (GO term enrichment analysis showed that tissue-specific genes are enriched with GO terms reflecting the physiological functions of the specific tissue, and housekeeping genes are enriched with GO terms related to essential biological functions. Comparisons of structural genomic features between tissue-specific genes and housekeeping genes show that housekeeping genes are more compact. Specifically, coding sequence and particularly introns are shorter than genes that display more variation in expression between tissues, and in addition intergenic space was also shorter. Meanwhile, housekeeping genes are more likely to co-localize with other abundantly or highly expressed genes on the same chromosomal regions. Furthermore, comparisons of gene expression in a panel of five common tissues between birds, mammals and amphibians showed that the expression patterns across tissues are highly similar for orthologous genes compared to random gene pairs within each pair-wise comparison, indicating a high degree of functional conservation in gene expression among terrestrial vertebrates. CONCLUSIONS: The housekeeping genes identified in this study have shorter gene length, shorter coding sequence length, shorter introns, and shorter intergenic regions, there seems

  16. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  17. Pleistocene precession forcing of the upper ocean structure variations of the southern South China Sea

    Institute of Scientific and Technical Information of China (English)

    TIAN Jun; WANG Pinxian; CHENG Xinrong

    2004-01-01

    The precession plays a dominant role in driving the tropical monsoon variations. Our high resolution, millennial scale marine isotope records from ODP Site 1143 in the southern South China Sea (SCS) present the detailed history of the upper ocean structure variations over the past 1.56 Ma on glacial/interglacial timescale. The cross spectral analyses between the Earth's orbital variations and the isotopic differences reveal a high coherency between the East-Asian-monsoon-related thermocline and nutricline variations of the SCS and the precession. The variations of monsoon-related isotopic difference between species also demonstrate periodicities of 11-, 12- and 14- thousand years near semi-precession which originates in the tropics, highlighting the importance of the precession in driving the east Asian monsoon changes.

  18. The variation of the fine structure constant: testing the dipole model with thermonuclear supernovae

    CERN Document Server

    Kraiselburd, Lucila; Negrelli, Carolina; Berro, Enrique García

    2014-01-01

    The large-number hypothesis conjectures that fundamental constants may vary. Accordingly, the spacetime variation of fundamental constants has been an active subject of research for decades. Recently, using data obtained with large telescopes a phenomenological model in which the fine structure constant might vary spatially has been proposed. We test whether this hypothetical spatial variation of {\\alpha}, which follows a dipole law, is compatible with the data of distant thermonuclear supernovae. Unlike previous works, in our calculations we consider not only the variation of the luminosity distance when a varying {\\alpha} is adopted, but we also take into account the variation of the peak luminosity of Type Ia supernovae resulting from a variation of {\\alpha}. This is done using an empirical relation for the peak bolometric magnitude of thermonuclear supernovae that correctly reproduces the results of detailed numerical simulations. We find that there is no significant difference between the several phenome...

  19. The Structure of a Bernoulli Process Variation of the Fibonacci Sequence

    CERN Document Server

    Benson, Brian A

    2007-01-01

    We consider the structure of a variation of the Fibonacci sequence which is determined by a Bernoulli process. The associated structure of all Bernoulli variations of the Fibonacci sequence can be represented by a directed binary tree, which we denote X, with vertex labels representing the specific state of the recurrence variation. Since X is a binary tree, we can consider the term of a sequence variation given by a finite traversal of X represented by a binary code t. We then prove that the traversal of X that is the reflection of the digits of t gives exactly the integer term corresponding to t. We consider how to further this result with the statement of an additional conjecture. Finally, we give connections to Fibonacci expansions, the Stern-Brocot tree, and we apply our methods to the Three Hat Problem as seen in ``Puzzle Corner'' of the ``Technology Review'' magazine.

  20. Genotypic variation in foundation species generates network structure that may drive community dynamics and evolution.

    Science.gov (United States)

    Lau, Matthew K; Keith, Arthur R; Borrett, Stuart R; Shuster, Stephen M; Whitham, Thomas G

    2016-03-01

    Although genetics in a single species is known to impact whole communities, little is known about how genetic variation influences species interaction networks in complex ecosystems. Here, we examine the interactions in a community of arthropod species on replicated genotypes (clones) of a foundation tree species, Populus angustifolia James (narrowleaf cottonwood), in a long-term, common garden experiment using a bipartite "genotype-species" network perspective. We combine this empirical work with a simulation experiment designed to further investigate how variation among individual tree genotypes can impact network structure. Three findings emerged: (1) the empirical "genotype-species network" exhibited significant network structure with modularity being greater than the highly conservative null model; (2) as would be expected given a modular network structure, the empirical network displayed significant positive arthropod co-occurrence patterns; and (3) furthermore, the simulations of "genotype-species" networks displayed variation in network structure, with modularity in particular clearly increasing, as genotypic variation increased. These results support the conclusion that genetic variation in a single species contributes to the structure of ecological interaction networks, which could influence eco-ogical dynamics (e.g., assembly and stability) and evolution in a community context.

  1. Evolutionary evidence for alternative structure in RNA sequence co-variation.

    Directory of Open Access Journals (Sweden)

    Justin Ritz

    Full Text Available Sequence conservation and co-variation of base pairs are hallmarks of structured RNAs. For certain RNAs (e.g. riboswitches, a single sequence must adopt at least two alternative secondary structures to effectively regulate the message. If alternative secondary structures are important to the function of an RNA, we expect to observe evolutionary co-variation supporting multiple conformations. We set out to characterize the evolutionary co-variation supporting alternative conformations in riboswitches to determine the extent to which alternative secondary structures are conserved. We found strong co-variation support for the terminator, P1, and anti-terminator stems in the purine riboswitch by extending alignments to include terminator sequences. When we performed Boltzmann suboptimal sampling on purine riboswitch sequences with terminators we found that these sequences appear to have evolved to favor specific alternative conformations. We extended our analysis of co-variation to classic alignments of group I/II introns, tRNA, and other classes of riboswitches. In a majority of these RNAs, we found evolutionary evidence for alternative conformations that are compatible with the Boltzmann suboptimal ensemble. Our analyses suggest that alternative conformations are selected for and thus likely play functional roles in even the most structured of RNAs.

  2. Molecular variation at a candidate gene implicated in the regulation of fire ant social behavior.

    Directory of Open Access Journals (Sweden)

    Dietrich Gotzek

    Full Text Available The fire ant Solenopsis invicta and its close relatives display an important social polymorphism involving differences in colony queen number. Colonies are headed by either a single reproductive queen (monogyne form or multiple queens (polygyne form. This variation in social organization is associated with variation at the gene Gp-9, with monogyne colonies harboring only B-like allelic variants and polygyne colonies always containing b-like variants as well. We describe naturally occurring variation at Gp-9 in fire ants based on 185 full-length sequences, 136 of which were obtained from S. invicta collected over much of its native range. While there is little overall differentiation between most of the numerous alleles observed, a surprising amount is found in the coding regions of the gene, with such substitutions usually causing amino acid replacements. This elevated coding-region variation may result from a lack of negative selection acting to constrain amino acid replacements over much of the protein, different mutation rates or biases in coding and non-coding sequences, negative selection acting with greater strength on non-coding than coding regions, and/or positive selection acting on the protein. Formal selection analyses provide evidence that the latter force played an important role in the basal b-like lineages coincident with the emergence of polygyny. While our data set reveals considerable paraphyly and polyphyly of S. invicta sequences with respect to those of other fire ant species, the b-like alleles of the socially polymorphic species are monophyletic. An expanded analysis of colonies containing alleles of this clade confirmed the invariant link between their presence and expression of polygyny. Finally, our discovery of several unique alleles bearing various combinations of b-like and B-like codons allows us to conclude that no single b-like residue is completely predictive of polygyne behavior and, thus, potentially causally

  3. Temporal variations in internal tide multimodal structure on the continental shelf, South China Sea

    Science.gov (United States)

    Gao, Dalu; Jin, Guangzhen; Lü, Xianqing

    2017-01-01

    Temporal variations in multimodal structures of diurnal ( D 1) and semidiurnal ( D 2) internal tides were investigated on the continental slope of the Dongsha Plateau, based on 2-month moored acoustic Doppler current profiler observations. Harmonic analysis indicated that the D 1 components ( K 1 and O 1) dominated the internal tide field. The vertical structure of the K 1 constituent presented a first-mode structure while the M 2 constituent seemed to exhibit a high-mode structure. Amplitude spectra analysis of the current data revealed differences in baroclinic current amplitudes between different water depths. Temporal variations in modal structures ware analyzed, based on the D 1 and D 2 baroclinic tides extracted from the baroclinic velocity field with band-pass filters. Analysis showed that the magnitude of the D 1 internal tide current was much larger than the D 2 current, and temporal variations in the modal structure of the D 1 internal tide occurred on an approximately fortnightly cycle. The EOF analyses revealed temporal transformation of multimodal structures for D 1 and D 2 internal tides. The enhancement of the D 1 internal tide was mainly due to the superposition of K 1 and O 1, according to the temporal variation of coherent kinetic energy.

  4. Time variation of the fine structure constant in the early universe and the Bekenstein model

    CERN Document Server

    Mosquera, Mercedes E; Landau, Susana J; Vucetich, Hector

    2007-01-01

    We use observational primordial abundances of $\\De$, $\\Het$, $\\He$ and $\\Li$, recent data from the Cosmic Microwave Background and the 2dFGRS power spectrum, to put limits on the variation of the fine structure constant in the early universe. Furthermore, we use these constraints together with other astronomical and geophysical bounds from the late universe to test Bekenstein's model for the variation of $\\alpha$. The model is not able to fit all observational and experimental data.

  5. Linkage disequilibrium blocks, haplotype structure, and htSNPs of human CYP7A1 gene

    Directory of Open Access Journals (Sweden)

    Wan Yu-Jui

    2006-05-01

    Full Text Available Abstract Background Cholesterol 7-alpha-hydroxylase (CYP7A1 is the rate limiting enzyme for converting cholesterol into bile acids. Genetic variations in the CYP7A1 gene have been associated with metabolic disorders of cholesterol and bile acids, including hypercholesterolemia, hypertriglyceridemia, arteriosclerosis, and gallstone disease. Current genetic studies are focused mainly on analysis of a single nucleotide polymorphism (SNP at A-278C in the promoter region of the CYP7A1 gene. Here we report a genetic approach for an extensive analysis on linkage disequilibrium (LD blocks and haplotype structures of the entire CYP7A1 gene and its surrounding sequences in Africans, Caucasians, Asians, Mexican-Americans, and African-Americans. Result The LD patterns and haplotype blocks of CYP7A1 gene were defined in Africans, Caucasians, and Asians using genotyping data downloaded from the HapMap database to select a set of haplotype-tagging SNPs (htSNP. A low cost, microarray-based platform on thin-film biosensor chips was then developed for high-throughput genotyping to study transferability of the HapMap htSNPs to Mexican-American and African-American populations. Comparative LD patterns and haplotype block structure was defined across all test populations. Conclusion A constant genetic structure in CYP7A1 gene and its surrounding sequences was found that may lead to a better design for association studies of genetic variations in CYP7A1 gene with cholesterol and bile acid metabolism.

  6. Telomere length and variation in telomere biology genes in individuals with osteosarcoma.

    Science.gov (United States)

    Mirabello, Lisa; Richards, Elliott G; Duong, Linh M; Yu, Kai; Wang, Zhaoming; Cawthon, Richard; Berndt, Sonja I; Burdett, Laurie; Chowdhury, Salma; Teshome, Kedest; Douglass, Chester; Savage, Sharon A

    2011-01-01

    Osteosarcoma, the most common primary bone tumor, occurs most frequently in adolescents. Chromosomal aneuploidy is common in osteosarcoma cells, suggesting underlying chromosomal instability. Telomeres, located at chromosome ends, are essential for genomic stability; several studies have suggested that germline telomere length (TL) is associated with cancer risk. We hypothesized that TL and/or common genetic variation in telomere biology genes may be associated with risk of osteosarcoma. We investigated TL in peripheral blood DNA and 713 single nucleotide polymorphisms (SNPs) from 39 telomere biology genes in 98 osteosarcoma cases and 69 orthopedic controls. For the genotyping component, we added 1363 controls from the Prostate, Lung, Colorectal, and Ovarian Cancer ScreeningTrial. Short TL was not associated with osteosarcoma risk overall (OR 1.39, P=0.67), although there was a statistically significant association in females (OR 4.35, 95% Cl 1.20-15.74, P=0.03). Genotype analyses identified seven SNPs in TERF1 significantly associated with osteosarcoma risk after Bonferroni correction by gene. These SNPs were highly linked and associated with a reduced risk of osteosarcoma (OR 0.48-0.53, P=0.0001-0.0006). We also investigated associations between TL and telomere gene SNPs in osteosarcoma cases and orthopedic controls. Several SNPs were associated with TL prior to Bonferroni correction; one SNP in NOLA2 and one in MEN1 were marginally non-significant after correction (P(adj)=0.057 and 0.066, respectively). This pilot-study suggests that females with short telomeres may be at increased risk of osteosarcoma, and that SNPs in TERF1 are inversely associated with osteosarcoma risk.

  7. Genetic variation in the epidermal transglutaminase genes is not associated with atopic dermatitis.

    Directory of Open Access Journals (Sweden)

    Agne Liedén

    Full Text Available BACKGROUND: Atopic dermatitis (AD is a common chronic inflammatory skin disorder where epidermal barrier dysfunction is a major factor in the pathogenesis. The identification of AD susceptibility genes related to barrier dysfunction is therefore of importance. The epidermal transglutaminases (TGM1, TGM3 and TGM5 encodes essential cross-linking enzymes in the epidermis. OBJECTIVE: To determine whether genetic variability in the epidermal transglutaminases contributes to AD susceptibility. METHODS: Forty-seven single nucleotide polymorphisms (SNPs in the TGM1, TGM3 and TGM5 gene region were tested for genetic association with AD, independently and in relation to FLG genotype, using a pedigree disequilibrium test (PDT in a Swedish material consisting of 1753 individuals from 539 families. In addition, a German case-control material, consisting of 533 AD cases and 1996 controls, was used for in silico analysis of the epidermal TGM regions. Gene expression of the TGM1, TGM3 and TGM5 gene was investigated by relative quantification with Real Time PCR (qRT-PCR. Immunohistochemical (IHC analysis was performed to detect TG1, TG3 and TG5 protein expression in the skin of patients and healthy controls. RESULTS: PDT analysis identified a significant association between the TGM1 SNP rs941505 and AD with allergen-specific IgE in the Swedish AD family material. However, the association was not replicated in the German case-control material. No significant association was detected for analyzed SNPs in relation to FLG genotype. TG1, TG3 and TG5 protein expression was detected in AD skin and a significantly increased TGM3 mRNA expression was observed in lesional skin by qRT-PCR. CONCLUSION: Although TGM1 and TGM3 may be differentially expressed in AD skin, the results from the genetic analysis suggest that genetic variation in the epidermal transglutaminases is not an important factor in AD susceptibility.

  8. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Directory of Open Access Journals (Sweden)

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  9. Evolutionary variations in the expression of dorso-ventral patterning genes and the conservation of pioneer neurons in Tribolium castaneum.

    Science.gov (United States)

    Biffar, Lucia; Stollewerk, Angelika

    2015-04-01

    Insects are ideally suited for gaining insight into the evolutionary developmental mechanisms that have led to adaptive changes of the nervous system since the specific structure of the nervous system can be directly linked to the neural stem cell (neuroblast) lineages, which in turn can be traced back to the last common ancestor of insects. The recent comparative analysis of the Drosophila melanogaster and Tribolium castaneum neuroblast maps revealed substantial differences in the expression profiles of neuroblasts. Here we show that despite the overall conservation of the dorso-ventral expression domains of muscle segment homeobox, intermediate neuroblasts defective and ventral nervous system defective, the expression of these genes relative to the neuroblasts in the respective domains has changed considerably during insect evolution. Furthermore, functional studies show evolutionary changes in the requirement of ventral nervous system defective in the formation of neuroblast 1-1 and the correct differentiation of its presumptive progeny, the pioneer neurons aCC and pCC. The inclusion of the expression data of the dorso-ventral genes into the recently established T. castaneum neuroblast map further increases the differences in the neuroblast expression profiles between D. melanogaster and T. castaneum. Despite these molecular variations, the Even-skipped positive pioneer neurons show an invariant arrangement, except for an additional Even-skipped positive cluster that we discovered in T. castaneum. Given the importance of these pioneer neurons in establishing the intersegmental nerves and the longitudinal tracts, which are part of the conserved axonal scaffold of arthropods, we discuss internal buffering mechanisms that might ensure that neuroblast lineages invariantly generate pioneer neurons over a wide range of molecular variations.

  10. SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

    Directory of Open Access Journals (Sweden)

    Parida Swarup K

    2012-08-01

    Full Text Available Abstract Background Single nucleotide polymorphism (SNP validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%. Of these 325 (84.6% showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice.

  11. Circadian variations of clock gene Per2 and cell cycle genes in different stages of carcinogenesis in golden hamster buccal mucosa.

    Science.gov (United States)

    Tan, Xue-Mei; Ye, Hua; Yang, Kai; Chen, Dan; Wang, Qing-Qing; Tang, Hong; Zhao, Ning-Bo

    2015-05-07

    Previous studies have suggested that the expression of clock genes have circadian rhythms, and many cell cycle genes are regulated by clock genes. The disruption of circadian rhythms appears to be associated with the acceleration of cancer development. To investigate the circadian patterns of the clock gene Per2 and of cell cycle genes p53, Cyclin D1, CDK1 and Cyclin B1 in different stages of carcinogenesis, the daily mRNA profiles of these genes were detected by real-time RT-PCR in dimethylbenzanthracene-induced cancer, in precancerous lesions and in normal tissues. Per2, p53, Cyclin D1 and CDK1 showed circadian rhythms in the 3 different stages of carcinogenesis, whereas the circadian rhythm of Cyclin B1 was absent in the precancerous lesions. The mesors and amplitudes of Per2 and p53 were decreased (P circadian pattern variations of these genes in different stages of carcinogenesis.

  12. Genetic regulation of tissue-specific expression of amylase structural genes in Drosophila melanogaster.

    Science.gov (United States)

    Abraham, I; Doane, W W

    1978-01-01

    Laboratory strains of Drosophila melanogaster were screened for spatial variations in adult midgut alpha-amylase (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1) expression. No strain-specific differences were found anteriorly, but three patterns of activity were discerned in the posterior midgut: A, activity throughout most of the region; B, activity in the anterior part of the region; and C, little or no activity. Alleles of a control gene, map, are responsible for this tissue-specific regulation of activity; e.g., mapA homozygotes produce the A pattern and mapC homozygotes the C pattern. The map locus was placed at 2--80 +/- on the genetic map of chromosome 2R, about two crossover units distal to the Amy structural gene region for alpha-amylase. Electrophoretic studies showed that mapA is trans acting in mapA/mapC flies, allowing expression of amylase isozymes coded for by genes on the opposite chromosome. The map gene behaves as a temporal gene that is clearly separable from the tightly linked, duplicated Amy structural genes. Images PMID:100784

  13. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Directory of Open Access Journals (Sweden)

    Antoine Claessens

    2014-12-01

    Full Text Available The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1 that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs were scattered across the genome, structural variants (deletions, duplications, translocations were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4% yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  14. Coordinated effects of sequence variation on DNA binding, chromatin structure, and transcription.

    Science.gov (United States)

    Kilpinen, Helena; Waszak, Sebastian M; Gschwind, Andreas R; Raghav, Sunil K; Witwicki, Robert M; Orioli, Andrea; Migliavacca, Eugenia; Wiederkehr, Michaël; Gutierrez-Arcelus, Maria; Panousis, Nikolaos I; Yurovsky, Alisa; Lappalainen, Tuuli; Romano-Palumbo, Luciana; Planchon, Alexandra; Bielser, Deborah; Bryois, Julien; Padioleau, Ismael; Udin, Gilles; Thurnheer, Sarah; Hacker, David; Core, Leighton J; Lis, John T; Hernandez, Nouria; Reymond, Alexandre; Deplancke, Bart; Dermitzakis, Emmanouil T

    2013-11-08

    DNA sequence variation has been associated with quantitative changes in molecular phenotypes such as gene expression, but its impact on chromatin states is poorly characterized. To understand the interplay between chromatin and genetic control of gene regulation, we quantified allelic variability in transcription factor binding, histone modifications, and gene expression within humans. We found abundant allelic specificity in chromatin and extensive local, short-range, and long-range allelic coordination among the studied molecular phenotypes. We observed genetic influence on most of these phenotypes, with histone modifications exhibiting strong context-dependent behavior. Our results implicate transcription factors as primary mediators of sequence-specific regulation of gene expression programs, with histone modifications frequently reflecting the primary regulatory event.

  15. Variation of the fine structure constant and the electron mass at early Universe

    CERN Document Server

    Scóccola, Claudia G

    2009-01-01

    In this thesis, we focus on the study of the variation of the electron mass $m_e$, and the fine structure constant $\\alpha$, at different cosmic times. We analyze the details of the recombination physics, including helium recombination, in order to find the dependences of the physical quantities on the fundamental constants. Using up-to-date CMB data, and the final 2dFGRS power spectrum, we set limits to the possible variation of the constants at recombination. We analyze the variation of $\\alpha$ and $m_e$ independently, and the case in which both variations are allowed, fitting also a set of cosmological parameters. We find a fenomenological relationship between the variation of $\\alpha$ and the variation of $m_e$, between decoupling and present time. We analyze the Barrow-Magueijo fenomenological model, which propose a variation in the electron mass induced by changes in a space-time scalar field. We present improved solutions and we estimate the model parameters using bounds on the variation of the electr...

  16. Oxytocin receptor gene sequences in owl monkeys and other primates show remarkable interspecific regulatory and protein coding variation.

    Science.gov (United States)

    Babb, Paul L; Fernandez-Duque, Eduardo; Schurr, Theodore G

    2015-10-01

    The oxytocin (OT) hormone pathway is involved in numerous physiological processes, and one of its receptor genes (OXTR) has been implicated in pair bonding behavior in mammalian lineages. This observation is important for understanding social monogamy in primates, which occurs in only a small subset of taxa, including Azara's owl monkey (Aotus azarae). To examine the potential relationship between social monogamy and OXTR variation, we sequenced its 5' regulatory (4936bp) and coding (1167bp) regions in 25 owl monkeys from the Argentinean Gran Chaco, and examined OXTR sequences from 1092 humans from the 1000 Genomes Project. We also assessed interspecific variation of OXTR in 25 primate and rodent species that represent a set of phylogenetically and behaviorally disparate taxa. Our analysis revealed substantial variation in the putative 5' regulatory region of OXTR, with marked structural differences across primate taxa, particularly for humans and chimpanzees, which exhibited unique patterns of large motifs of dinucleotide A+T repeats upstream of the OXTR 5' UTR. In addition, we observed a large number of amino acid substitutions in the OXTR CDS region among New World primate taxa that distinguish them from Old World primates. Furthermore, primate taxa traditionally defined as socially monogamous (e.g., gibbons, owl monkeys, titi monkeys, and saki monkeys) all exhibited different amino acid motifs for their respective OXTR protein coding sequences. These findings support the notion that monogamy has evolved independently in Old World and New World primates, and that it has done so through different molecular mechanisms, not exclusively through the oxytocin pathway.

  17. Association between common variation in 120 candidate genes and breast cancer risk.

    Directory of Open Access Journals (Sweden)

    Paul D P Pharoah

    2007-03-01

    Full Text Available Association studies in candidate genes have been widely used to search for common low penetrance susceptibility alleles, but few definite associations have been established. We have conducted association studies in breast cancer using an empirical single nucleotide polymorphism (SNP tagging approach to capture common genetic variation in genes that are candidates for breast cancer based on their known function. We genotyped 710 SNPs in 120 candidate genes in up to 4,400 breast cancer cases and 4,400 controls using a staged design. Correction for population stratification was done using the genomic control method, on the basis of data from 280 genomic control SNPs. Evidence for association with each SNP was assessed using a Cochran-Armitage trend test (p-trend and a two-degrees of freedom chi(2 test for heterogeneity (p-het. The most significant single SNP (p-trend = 8 x 10(-5 was not significant at a nominal 5% level after adjusting for population stratification and multiple testing. To evaluate the overall evidence for an excess of positive associations over the proportion expected by chance, we applied two global tests: the admixture maximum likelihood (AML test and the rank truncated product (RTP test corrected for population stratification. The admixture maximum likelihood experiment-wise test for association was significant for both the heterogeneity test (p = 0.0031 and the trend test (p = 0.017, but no association was observed using the rank truncated product method for either the heterogeneity test or the trend test (p = 0.12 and p = 0.24, respectively. Genes in the cell-cycle control pathway and genes involved in steroid hormone metabolism and signalling were the main contributors to the association. These results suggest that a proportion of SNPs in these candidate genes are associated with breast cancer risk, but that the effects of individual SNPs is likely to be small. Large sample sizes from multicentre collaboration will be needed

  18. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas

    2008-01-01

    . Furthermore, human AFAR1 catalyses the rate limiting step in the synthesis of the neuromodulator gamma-hydroxybutyrate (GHB) and was found elevated in neurodegenerative diseases such as Alzheimer's and dementia with Lewy bodies (DLB). The human AFAR gene family maps to a genomic region in 1p36 of frequent...... samples, we identified nine different amino acid changes; two were in AFAR1 and seven in AFAR2. In AFAR1, we found genetic variation in the proposed substrate-binding amino acid 113, encoding Ala(113) or Thr(113). An AFAR2 variant had a Glu(55) substituted by Lys(55) at a position that is conserved among...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  19. Plasma Fetuin-A concentration, genetic variation in the AHSG gene and risk of colorectal cancer

    DEFF Research Database (Denmark)

    Nimptsch, Katharina; Aleksandrova, Krasimira; Boeing, Heiner

    2015-01-01

    .93-1.22) in women, 1.13 (1.00-1.27) for colon cancer and 1.12 (0.94-1.32) for rectal cancer. To improve causal inference in a Mendelian Randomization approach, five tagging single nucleotide polymorphisms of the AHSG gene were genotyped in a subset of 456 case-control pairs. The AHSG allele-score explained 21......% of the interindividual variation in plasma fetuin-A concentrations. In instrumental variable analysis, genetically raised fetuin-A was not associated with colorectal cancer risk (relative risk per 40 µg/mL genetically determined higher fetuin-A was 0.98, 95% confidence interval: 0.73-1.33). The findings of our study...

  20. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    DEFF Research Database (Denmark)

    Meidtner, Karina; Fisher, Eva; Angquist, Lars

    2014-01-01

    ) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were followed up...... for 6.9 ± 2.5 years. Association of 69 tagSNPs with baseline BMI and annual changes in weight as well as waist circumference were investigated using linear regression analysis. Interactions with sex, GI and intake of carbohydrates, fat as well as saturated, monounsaturated and polyunsaturated fatty...... acids were examined by including multiplicative SNP-covariate terms into the regression model. Neither baseline BMI nor annual weight or waist circumference changes were significantly associated with variation in the selected genes in the entire study population after correction for multiple testing...

  1. Genetic Variations in Inflammatory Response Genes and Their Association with the Risk of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Xin Cui

    2015-01-01

    Full Text Available Prostate cancer is a common cancer in men. Genetic variations in inflammatory response genes can potentially influence the risk of prostate cancer. We aimed to examine the association between PPARG Pro12Ala, NFKB1 -94 ins/del, NFKBIA -826C/T, COX-1 (50C>T, and COX-2 (-1195G>A polymorphisms on prostate cancer risk. The genotypes of the polymorphisms were ascertained in 543 prostate cancer patients and 753 controls through PCR-RFLP and the risk association was evaluated statistically using logistic regression analysis. The NFKB1 -94 polymorphism was shown to decrease prostate cancer risk in both heterozygous and homozygous comparison models (odds ratios of 0.74 (95% CI = 0.58–0.96 (P=0.02 and 0.57 (95% CI = 0.42–0.78 (PA polymorphisms may be, respectively, associated with decreased and increased prostate cancer risk in the Chinese population.

  2. Structural basis of eukaryotic gene transcription.

    Science.gov (United States)

    Boeger, Hinrich; Bushnell, David A; Davis, Ralph; Griesenbeck, Joachim; Lorch, Yahli; Strattan, J Seth; Westover, Kenneth D; Kornberg, Roger D

    2005-02-07

    An RNA polymerase II promoter has been isolated in transcriptionally activated and repressed states. Topological and nuclease digestion analyses have revealed a dynamic equilibrium between nucleosome removal and reassembly upon transcriptional activation, and have further shown that nucleosomes are removed by eviction of histone octamers rather than by sliding. The promoter, once exposed, assembles with RNA polymerase II, general transcription factors, and Mediator in a approximately 3 MDa transcription initiation complex. X-ray crystallography has revealed the structure of RNA polymerase II, in the act of transcription, at atomic resolution. Extension of this analysis has shown how nucleotides undergo selection, polymerization, and eventual release from the transcribing complex. X-ray and electron crystallography have led to a picture of the entire transcription initiation complex, elucidating the mechanisms of promoter recognition, DNA unwinding, abortive initiation, and promoter escape.

  3. The architecture of gene regulatory variation across multiple human tissues: the MuTHER study.

    Directory of Open Access Journals (Sweden)

    Alexandra C Nica

    Full Text Available While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL, skin, and fat. The samples (156 LCL, 160 skin, 166 fat were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes. In addition, we apply factor analysis (FA to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes. The unique study design (Matched Co-Twin Analysis--MCTA permits immediate replication of eQTLs using co-twins (93%-98% and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%-20% have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits.

  4. The Architecture of Gene Regulatory Variation across Multiple Human Tissues: The MuTHER Study

    Science.gov (United States)

    Nica, Alexandra C.; Parts, Leopold; Glass, Daniel; Nisbet, James; Barrett, Amy; Sekowska, Magdalena; Travers, Mary; Potter, Simon; Grundberg, Elin; Small, Kerrin; Hedman, Åsa K.; Bataille, Veronique; Tzenova Bell, Jordana; Surdulescu, Gabriela; Dimas, Antigone S.; Ingle, Catherine; Nestle, Frank O.; di Meglio, Paola; Min, Josine L.; Wilk, Alicja; Hammond, Christopher J.; Hassanali, Neelam; Yang, Tsun-Po; Montgomery, Stephen B.; O'Rahilly, Steve; Lindgren, Cecilia M.; Zondervan, Krina T.; Soranzo, Nicole; Barroso, Inês; Durbin, Richard; Ahmadi, Kourosh; Deloukas, Panos; McCarthy, Mark I.; Dermitzakis, Emmanouil T.; Spector, Timothy D.

    2011-01-01

    While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL), skin, and fat. The samples (156 LCL, 160 skin, 166 fat) were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes). In addition, we apply factor analysis (FA) to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes). The unique study design (Matched Co-Twin Analysis—MCTA) permits immediate replication of eQTLs using co-twins (93%–98%) and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%–20%) have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits. PMID:21304890

  5. Allelic Variation in the Perennial Ryegrass FLOWERING LOCUS T Gene is Associated with Changes in Flowering Time across a Range of Populations

    DEFF Research Database (Denmark)

    Skøt, Leif; Sanderson, Ruth; Thomas, Ann

    2011-01-01

    The Arabidopsis (Arabidopsis thaliana) FLOWERING LOCUS T (FT) gene and its orthologs in other plant species (e.g. rice [Oryza sativa] OsFTL2/Hd3a) have an established role in the photoperiodic induction of flowering response. The genomic and phenotypic variations associated with the perennial...... ryegrass (Lolium perenne) ortholog of FT, designated LpFT3, was assessed in a diverse collection of nine European germplasm populations, which together constituted an association panel of 864 plants. Sequencing and genotyping of a series of amplicons derived from the nine populations, containing...... or structured association with further correction using genomic control indicated significant associations between LpFT3 and variation in flowering time. These associations were corroborated in a validation population segregating for the same major alleles. The most "diagnostic" region of genomic variation...

  6. FREQUENT STRUCTURE ALTERATIONS OF p53 GENE IN NASOPHARYNGEAL CARCINOMA

    Institute of Scientific and Technical Information of China (English)

    龙江斌; 区宝祥; 梁启万; 李辉梅

    1998-01-01

    By southern hybridization with 1.8 kb cDNA probe,a high freqnency (40.5%) of structural abnormality of p 53 gene was observed in primary nasopharyngeal carcinoma (NPC) biopsies. The regioas of exons 1 to 4 of the gene were examined by poiymerase chain reaction-single strand conformation polymorphism, no point nmtation was found. Because very low rate of point mutation had been reported in exons 5 to 8,we considered that structural ahnormality in the region of exons 1 to 8 of the gene might be uncommon in NPC. The speetrophotometer scaaning analysis of outoradiograms and rehybridization investigation of nitrocellulose filter with exon 11 probe indicated that most of structure aberrations we observed might be rearrangement occurring in exon ll.

  7. Adaptive potential of genomic structural variation in human and mammalian evolution.

    Science.gov (United States)

    Radke, David W; Lee, Charles

    2015-09-01

    Because phenotypic innovations must be genetically heritable for biological evolution to proceed, it is natural to consider new mutation events as well as standing genetic variation as sources for their birth. Previous research has identified a number of single-nucleotide polymorphisms that underlie a subset of adaptive traits in organisms. However, another well-known class of variation, genomic structural variation, could have even greater potential to produce adaptive phenotypes, due to the variety of possible types of alterations (deletions, insertions, duplications, among others) at different genomic positions and with variable lengths. It is from these dramatic genomic alterations, and selection on their phenotypic consequences, that adaptations leading to biological diversification could be derived. In this review, using studies in humans and other mammals, we highlight examples of how phenotypic variation from structural variants might become adaptive in populations and potentially enable biological diversification. Phenotypic change arising from structural variants will be described according to their immediate effect on organismal metabolic processes, immunological response and physical features. Study of population dynamics of segregating structural variation can therefore provide a window into understanding current and historical biological diversification.

  8. Variation in oxytocin receptor gene (OXTR) polymorphisms is associated with emotional and behavioral reactions to betrayal.

    Science.gov (United States)

    Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L

    2014-06-01

    Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction.

  9. Variation at genes influencing facial morphology are not associated with developmental imprecision in human faces.

    Directory of Open Access Journals (Sweden)

    Sonja Windhager

    Full Text Available Facial asymmetries are commonly used as a proxy for human developmental imprecision resulting from inbreeding, and thus reduced genetic heterozygosity. Several environmental factors influence human facial asymmetry (e.g., health care, parasites, but the generalizability of findings on genetic stressors has been limited in humans by sample characteristics (island populations, endogamy and indirect genetic assessment (inference from pedigrees. In a sample of 3215 adult humans from the Rotterdam Study, we therefore studied the relationship of facial asymmetry, estimated from nine mid-facial landmarks, with genetic variation at 102 single nucleotide polymorphism (SNP loci recently associated with facial shape variation. We further tested whether the degree of individual heterozygosity is negatively correlated with facial asymmetry. An ANOVA tree regression did not identify any SNP relating to either fluctuating asymmetry or total asymmetry. In a general linear model, only age and sex--but neither heterozygosity nor any SNP previously reported to covary with facial shape--was significantly related to total or fluctuating asymmetry of the midface. Our study does not corroborate the common assumption in evolutionary and behavioral biology that morphological asymmetries reflect heterozygosity. Our results, however, may be affected by a relatively small degree of inbreeding, a relatively stable environment, and an advanced age in the Rotterdam sample. Further large-scale genetic studies, including gene expression studies, are necessary to validate the genetic and developmental origin of morphological asymmetries.

  10. Post-polyploidisation morphotype diversification associates with gene copy number variation

    Science.gov (United States)

    Schiessl, Sarah; Huettel, Bruno; Kuehn, Diana; Reinhardt, Richard; Snowdon, Rod

    2017-01-01

    Genetic models for polyploid crop adaptation provide important information relevant for future breeding prospects. A well-suited model is Brassica napus, a recent allopolyploid closely related to Arabidopsis thaliana. Flowering time is a major adaptation trait determining life cycle synchronization with the environment. Here we unravel natural genetic variation in B. napus flowering time regulators and investigate associations with evolutionary diversification into different life cycle morphotypes. Deep sequencing of 35 flowering regulators was performed in 280 diverse B. napus genotypes. High sequencing depth enabled high-quality calling of single-nucleotide polymorphisms (SNPs), insertion-deletions (InDels) and copy number variants (CNVs). By combining these data with genotyping data from the Brassica 60 K Illumina® Infinium SNP array, we performed a genome-wide marker distribution analysis across the 4 ecogeographical morphotypes. Twelve haplotypes, including Bna.FLC.A10, Bna.VIN3.A02 and the Bna.FT promoter on C02_random, were diagnostic for the diversification of winter and spring types. The subspecies split between oilseed/kale (B. napus ssp. napus) and swedes/rutabagas (B. napus ssp. napobrassica) was defined by 13 haplotypes, including genomic rearrangements encompassing copies of Bna.FLC, Bna.PHYA and Bna.GA3ox1. De novo variation in copies of important flowering-time genes in B. napus arose during allopolyploidisation, enabling sub-functionalisation that allowed different morphotypes to appropriately fine-tune their lifecycle. PMID:28165502

  11. Intra-retinal variation of opsin gene expression in the guppy (Poecilia reticulata).

    Science.gov (United States)

    Rennison, Diana J; Owens, Gregory L; Allison, W Ted; Taylor, John S

    2011-10-01

    Although behavioural experiments demonstrate that colouration influences mate choice in many species, a complete understanding of this form of signalling requires information about colour vision in the species under investigation. The guppy (Poecilia reticulata) has become a model species for the study of colour-based sexual selection. To investigate the role of opsin gene duplication and divergence in the evolution of colour-based mate choice, we used in situ hybridization to determine where the guppy's nine cone opsins are expressed in the retina. Long wavelength-sensitive (LWS) opsins were more abundant in the dorsal retina than in the ventral retina. One of the middle wavelength-sensitive opsins (RH2-1) exhibited the opposite pattern, while the other middle wavelength-sensitive opsin (RH2-2) and the short wavelength-sensitive opsins (SWS1, SWS2A and SWS2B) were expressed throughout the retina. We also found variation in LWS opsin expression among individuals. These observations suggest that regions of the guppy retina are specialized with respect to wavelength discrimination and/or sensitivity. Intra-retinal variability in opsin expression, which has been observed in several fish species, might be an adaptation to variation in the strength and spectral composition of light entering the eye from above and below. The discovery that opsin expression varies in the guppy retina may motivate new behavioural experiments designed to study its role in mate choice.

  12. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  13. The association between ace gene variation and aerobic capacity in winter endurance disciplines.

    Science.gov (United States)

    Orysiak, J; Zmijewski, P; Klusiewicz, A; Kaliszewski, P; Malczewska-Lenczowska, J; Gajewski, J; Pokrywka, A

    2013-12-01

    The aim of the study was to examine the possible relationship between I/D polymorphism of ACE gene and selected indices of aerobic capacity among male and female athletes practising winter endurance sports. Sixty-six well-trained athletes (female n = 26, male n = 40), aged 18.4 ± 2.8 years, representing winter endurance sports (cross-country skiing, n = 48; biathlon, n = 8; Nordic combined, n = 10) participated in the study. Genotyping for ACE I/D polymorphism was performed using polymerase chain reaction. Maximal oxygen consumption (VO2max), maximal running velocity (Vmax) and running velocity at anaerobic threshold (VAT4) were determined in an incremental test to volitional exhaustion on a motorized treadmill. The ACE genotype had no significant effect on absolute VO2max, relative VO2max (divided by body mass or fat free body mass), VAT4 or Vmax. No interaction effect of gender x ACE genotype was found for each of the examined aerobic capacity indices. ACE gene variation was not found to be a determinant of aerobic capacity in either female or male Polish, well-trained endurance athletes participating in winter sports.

  14. Variation in the Oxytocin Receptor Gene Is Associated with Face Recognition and its Neural Correlates

    Science.gov (United States)

    Westberg, Lars; Henningsson, Susanne; Zettergren, Anna; Svärd, Joakim; Hovey, Daniel; Lin, Tian; Ebner, Natalie C.; Fischer, Håkan

    2016-01-01

    The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala—a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR) has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging (fMRI) during incidental encoding of faces. The OXTR 3′ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors. PMID:27713694

  15. Variation in the Oxytocin Receptor Gene is associated with Face Recognition and its neural correlates

    Directory of Open Access Journals (Sweden)

    Lars Westberg

    2016-09-01

    Full Text Available The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala – a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging during incidental encoding of faces. The OXTR 3’ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors.

  16. Chromosomal localisation and genetic variation of the SLC11A1 gene in goats (Capra hircus).

    Science.gov (United States)

    Vacca, G M; Pazzola, M; Pisano, C; Carcangiu, V; Diaz, M L; Nieddu, M; Robledo, R; Mezzanotte, R; Dettori, M L

    2011-10-01

    The solute carrier family 11 member A1 (SLC11A1) gene is associated with resistance to infectious diseases. Chromosomal localisation, genomic regions corresponding to functional domains and the genetic variability of microsatellites in the 3' untranslated region (3'-UTR) of this gene were investigated in 427 goats (Capra hircus) of six breeds. Using dual colour fluorescence in situ hybridisation, SLC11A1 was localised to goat chromosome 2. Single strand conformation polymorphism was used to screen for polymorphisms in SLC11A1 exons 2, 10 and 15. There was no variation among goat breeds in the sarcoma homology 3 (SH3) binding motif, the protein kinase C phosphorylation site or the two N-linked glycosylation sites. Exon 15 exhibited variability due to the presence of two polymorphic microsatellites. Genotyping of the upstream guanine-thymine repeat (GTn) at 3'-UTR revealed eight alleles (GT11, GT12, GT14-GT19) in goats, whereas GT13 (present in cattle) was absent. Most goats carried the GT16 allele and no allele was found to be exclusive to only one breed. The coefficient of genetic differentiation value (G(ST)) was 0.084. This microsatellite appears to be an informative DNA marker for genetic linkage analysis in goats.

  17. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  18. Clinical associations of host genetic variations in the genes of cytokines in critically ill patients.

    Science.gov (United States)

    Belopolskaya, O B; Smelaya, T V; Moroz, V V; Golubev, A M; Salnikova, L E

    2015-06-01

    Host genetic variations may influence a changing profile of biochemical markers and outcome in patients with trauma/injury. The objective of this study was to assess clinical associations of single nucleotide polymorphisms (SNPs) in the genes of cytokines in critically ill patients. A total of 430 patients were genotyped for SNPs in the genes of pro- (IL1B, IL6, IL8) and anti-inflammatory (IL4, IL10, IL13) cytokines. The main end-points were sepsis, mortality and adult respiratory distress syndrome (ARDS). We evaluated the dynamic levels of bilirubin, blood urea nitrogen, creatine kinase, creatinine and lactate dehydrogenase in five points of measurements (between 1 and 14 days after admission) and correlated them with SNPs. High-producing alleles of proinflammatory cytokines protected patients against sepsis (IL1B -511A and IL8 -251A) and mortality (IL1B -511A). High-producing alleles of anti-inflammatory cytokines IL4 -589T and IL13 431A (144Gln) were less frequent in ARDS patients. The carriers of IL6 -174C/C genotypes were prone to the increased levels of biochemical markers and acute kidney and liver insufficiency. Genotype-dependent differences in the levels of biochemical indicators gradually increased to a maximal value on the 14th day after admission. These findings suggest that genetic variability in pro- and anti-inflammatory cytokines may contribute to different clinical phenotypes in patients at high risk of critical illness.

  19. Genetic variations in the KIR gene family may contribute to susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Zuo, Hai-Ning; Wang, Zhi-Long; Cui, Dao-Ran; Xin, Da-Jiang

    2014-08-01

    The present meta-analysis of relevant case-control studies was conducted to investigate the possible relationships between genetic variations in the killer cell immunoglobulin-like receptor (KIR) gene clusters of the human KIR gene family and susceptibility to ankylosing spondylitis (AS). The following electronic databases were searched for relevant articles without language restrictions: the Web of Science, the Cochrane Library Database, PubMed, EMBASE, CINAHL, the Chinese Biomedical Database (CBM) and Chinese National Knowledge Infrastructure (CNKI) databases, covering all papers published until 2013. STATA statistical software was adopted in this meta-analysis as well. We also calculated the crude odds ratios (OR) and its 95% confidence intervals (95 % CI). Seven case-control studies with 1,004 patients diagnosed with AS and 2,138 healthy cases were implicated in our meta-analysis, and 15 genes in the KIR gene family were also evaluated. The results of our meta-analysis show statistical significance between the genetic variations in the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes and an increased susceptibility to AS (KIR2DL1: OR 7.82, 95% CI 3.87-15.81, P0.05). The current meta-analysis provides reliable evidence that genetic variations in the KIR gene family may contribute to susceptibility to AS, especially for the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes.

  20. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  1. The maintenance of genetic variation due to asymmetric gene flow in dendritic metapopulations.

    Science.gov (United States)

    Morrissey, Michael B; de Kerckhove, Derrick T

    2009-12-01

    Dendritic landscapes can have ecological properties that differ importantly from simpler spatial arrangements of habitats. Most dendritic landscapes are structured by elevation, and therefore, migration is likely to be directionally biased. While the population-genetic consequences of both dendritic landscape arrangements and asymmetric migration have begun to be studied, these processes have not been considered together. Simple conceptual models predict that if migration into branch (headwater) populations is limited, such populations can act as reservoirs for potentially unique alleles. As a consequence of the fact that dendritic landscapes have, by definition, more branches than internal habitat patches, this process may lead to the maintenance of higher overall genetic diversities in metapopulations inhabiting dendritic networks where migration is directionally biased. Here we begin to address the generality of these simple predictions using genetic models and a review of empirical literature. We show, for a range of demographic parameters, that dendritic systems with asymmetric migration can maintain levels of genetic variation that are very different, sometimes very elevated, compared with more classical models of geographical population structure. Furthermore, predicted patterns of genetic variation within metapopulations--that is, stepwise increases in genetic diversity at nodes--do occur in some empirical data.

  2. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  3. Genetic variation of the Fc gamma receptor 3B gene and association with rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Rute B Marques

    Full Text Available BACKGROUND: Fc gamma receptors (FcγRs play a crucial role in immunity by linking IgG antibody-mediated responses with cellular effector and regulatory functions. Genetic variants in these receptors have been previously identified as risk factors for several chronic inflammatory conditions. The present study aimed to investigate the presence of copy number variations (CNVs in the FCGR3B gene and its potential association with the autoimmune disease rheumatoid arthritis (RA. METHODOLOGY/PRINCIPAL FINDINGS: CNV of the FCGR3B gene was studied using Multiplex Ligation Dependent Probe Amplification (MLPA in 518 Dutch RA patients and 304 healthy controls. Surprisingly, three independent MLPA probes targeting the FCGR3B promoter measured different CNV frequencies, with probe#1 and #2 measuring 0 to 5 gene copies and probe#3 showing little evidence of CNV. Quantitative-PCR correlated with the copy number results from MLPA probe#2, which detected low copy number (1 copy in 6.7% and high copy number (≥3 copies in 9.4% of the control population. No significant difference was observed between RA patients and the healthy controls, neither in the low copy nor the high copy number groups (p-values = 0.36 and 0.71, respectively. Sequencing of the FCGR3B promoter region revealed an insertion/deletion (indel that explained the disparate CNV results of MLPA probe#1. Finally, a non-significant trend was found between the novel -256A>TG indel and RA (40.7% in healthy controls versus 35.9% in RA patients; P = 0.08. CONCLUSIONS/SIGNIFICANCE: The current study highlights the complexity and poor characterization of the FCGR3B gene sequence, indicating that the design and interpretation of genotyping assays based on specific probe sequences must be performed with caution. Nonetheless, we confirmed the presence of CNV and identified novel polymorphisms in the FCGR3B gene in the Dutch population. Although no association was found between RA and FCGR3B CNV, the

  4. Genetic and epigenetic variation in the DNMT3B and MTHFR genes and colorectal adenoma risk.

    Science.gov (United States)

    Ho, Vikki; Ashbury, Janet E; Taylor, Sherryl; Vanner, Stephen; King, Will D

    2016-05-01

    Polymorphisms in DNMT3B and MTHFR have been implicated in cancer etiology; however, it is increasingly clear that gene-specific DNA methylation also affects gene expression. A cross-sectional study (N = 272) investigated the main and joint effects of polymorphisms and DNA methylation in DNMT3B and MTHFR on colorectal adenoma risk. Polymorphisms examined included DNMT3B c.-6-1045G > T, and MTHFR c.665C > T and c.1286A > C. DNA methylation of 66 and 28 CpG sites in DNMT3B and MTHFR, respectively, was quantified in blood leukocytes using Sequenom EpiTYPER®. DNA methylation was conceptualized using two approaches: (1) average methylation and (2) unsupervised principal component analysis to identify variables that represented methylation around the transcription start site and the gene coding area of both genes. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) associated with the main and joint effects of polymorphisms and DNA methylation. DNA methyltransferase 3B (DNMT3B) TT versus GG/GT genotypes was associated with increased colorectal adenoma risk (OR = 2.12; 95% CI: 1.03-4.34). In addition, increasing DNA methylation in the gene-coding area of DNMT3B was associated with higher risk of colorectal adenomas (OR = 1.34; 95% CI: 1.01-1.79 per SD). In joint effect analyses, synergistic effects were observed among those with both the DNMT3B TT genotype and higher DNMT3B methylation levels compared to those with GT/GG genotypes and lower methylation levels (OR = 4.19; 95% CI: 1.45-12.13 for average methylation; OR = 4.26; 95%CI: 1.31-13.87 for methylation in the transcription start site). This research provides novel evidence that genetic and epigenetic variations contribute to colorectal adenoma risk, precursor to the majority of colorectal cancer (CRC).

  5. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors.

    Science.gov (United States)

    Fontanesi, L; Beretti, F; Riggio, V; Gómez González, E; Dall'Olio, S; Davoli, R; Russo, V; Portolano, B

    2009-01-01

    In goats, classical genetic studies reported a large number of alleles at the Agouti locus with effects on coat color and pattern distribution. From these early studies, the dominant A(Wt) (white/tan) allele was suggested to cause the white color of the Saanen breed. Here, we sequenced the coding region of the goat ASIP gene in 6 goat breeds (Girgentana, Maltese, Derivata di Siria, Murciano-Granadina, Camosciata delle Alpi, and Saanen), with different coat colors and patterns. Five single nucleotide polymorphisms (SNPs) were identified, 3 of which caused missense mutations in conserved positions of the cysteine-rich carboxy-terminal domain of the protein (p.Ala96Gly, p.Cys126Gly, and p.Val128Gly). Allele and genotype frequencies suggested that these mutations are not associated or not completely associated with coat color in the investigated goat breeds. Moreover, genotyping and sequencing results, deviation from Hardy-Weinberg equilibrium, as well as allele copy number evaluation from semiquantitative fluorescent multiplex PCR, indicated the presence of copy number variation (CNV) in all investigated breeds. To confirm the presence of CNV and evaluate its extension, we applied a bovine-goat cross-species array comparative genome hybridization (aCGH) experiment using a custom tiling array based on bovine chromosome 13. aCGH results obtained for 8 goat DNA samples confirmed the presence of CNV affecting a region of less that 100 kb including the ASIP and AHCY genes. In Girgentana and Saanen breeds, this CNV might cause the A(Wt) allele, as already suggested for a similar structural mutation in sheep affecting the ASIP and AHCY genes, providing evidence for a recurrent interspecies CNV. However, other mechanisms may also be involved in determining coat color in these 2 breeds.

  6. Melanopsin gene variations interact with season to predict sleep onset and chronotype.

    Science.gov (United States)

    Roecklein, Kathryn A; Wong, Patricia M; Franzen, Peter L; Hasler, Brant P; Wood-Vasey, W Michael; Nimgaonkar, Vishwajit L; Miller, Megan A; Kepreos, Kyle M; Ferrell, Robert E; Manuck, Stephen B

    2012-10-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30-54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p sleep onset among those with the TT genotype was later in the day when individuals were assessed on longer days and earlier in the day on shorter days, whereas individuals in the other genotype groups (i.e., CC and CT) did not show this interaction effect. P10L genotype also interacted in an analogous way with daylength to predict self-reported morningness (interaction p sleep onset and chronotype as a function of daylength, whereas other genotypes at P10L do not seem to have effects that vary by daylength. A better understanding of how melanopsin confers heightened responsivity to daylength may improve our understanding of a broad range of

  7. Genetic variations of the porcine PRKAG3 gene in Chinese indigenous pig breeds

    Directory of Open Access Journals (Sweden)

    Zhou Li-Hua

    2004-07-01

    Full Text Available Abstract Four missense substitutions (T30N, G52S, V199I and R200Q in the porcine PRKAG3 gene were considered as the likely candidate loci affecting meat quality. In this study, the R200Q substitution was investigated in a sample of 62 individuals from Hampshire, Chinese Min and Erhualian pigs, and the genetic variations of T30N, G52S and V199I substitutions were detected in 1505 individuals from 21 Chinese indigenous breeds, 5 Western commercial pig breeds, and the wild pig. Allele 200R was fixed in Chinese Min and Erhualian pigs. Haplotypes II-QQ and IV-QQ were not observed in the Hampshire population, supporting the hypothesis that allele 200Q is tightly linked with allele 199V. Significant differences in allele frequencies of the three substitutions (T30N, G52S and V199I between Chinese indigenous pigs and Western commercial pigs were observed. Obvious high frequencies of the "favorable" alleles 30T and 52G in terms of meat quality were detected in Chinese indigenous pigs, which are well known for high meat quality. However, the frequency of the "favorable" allele 199I, which was reported to have a greater effect on meat quality in comparison with 30T and 52G, was very low in all of the Chinese indigenous pigs except for the Min pig. The reasons accounting for this discrepancy remain to be addressed. The presence of the three substitutions in purebred Chinese Tibetan pigs indicates that the three substitutions were ancestral mutations. A novel A/G substitution at position 51 in exon 1 was identified. The results suggest that further studies are required to investigate the associations of these substitutions in the PRKAG3 gene with meat quality of Chinese indigenous pigs, and to uncover other polymorphisms in the PRKAG3 gene with potential effects on meat quality in Chinese indigenous pigs.

  8. The influence of genetic variations in HHEX gene on insulin metabolism in the German MESYBEPO cohort.

    Science.gov (United States)

    Pivovarova, Olga; Nikiforova, Victoria J; Pfeiffer, Andreas F H; Rudovich, Natalia

    2009-02-01

    In the present study, we aimed to validate the type 2 diabetes (T2DM) susceptibility alleles identified in the first genome-wide association study in the hematopoietically expressed homeobox protein (HHEX) gene region (rs1111875 and rs7923837). Furthermore, we investigated quantitative metabolic risk phenotypes of these two variants for association with three key components of the insulin metabolism: insulin secretion, insulin sensitivity and insulin degradation. Two HHEX polymorphisms were genotyped in 1026 subjects from the German MESYBEPO cohort. Complete OGTT data were available for a subset of 420 with normal glucose tolerance (NGT), 282 with impaired glucose tolerance/impaired fasting glucose (IGT/IFG) and 146 diabetic subjects. We validated association of both HHEX polymorphisms with T2DM. In the non-diabetic subcohort including NGT and IFG/IGT subjects, the risk alleles of rs7923837 and rs1111875 were significantly associated with decreased first and second phases of insulin secretion and lower insulinogenic index after oral glucose loading. In healthy, normal glucose-tolerant subjects, the same association of HHEX SNP rs1111875 with OGTT-derived phases of insulin secretion were detectable, however, rs7923837 was only weakly associated with reduced insulinogenic index. For both polymorphisms, no significant correlations with insulin sensitivity were obtained. Reduced insulin clearance was also observed in heterozygous carriers of rs1111875. We validated the association of polymorphisms of the HHEX gene with T2DM in the MESYBEPO cohort. Importantly, variations within the HHEX gene conferred the impaired insulin secretion and changes of insulin degradation but no alteration in insulin sensitivity in carriers of risk alleles. Copyright (c) 2008 John Wiley & Sons, Ltd.

  9. Variations of the angiotensin II type 1 receptor gene are associated with extreme human longevity.

    Science.gov (United States)

    Benigni, Ariela; Orisio, Silvia; Noris, Marina; Iatropoulos, Paraskevas; Castaldi, Davide; Kamide, Kei; Rakugi, Hiromi; Arai, Yasumichi; Todeschini, Marta; Ogliari, Giulia; Imai, Enyu; Gondo, Yasuyuki; Hirose, Nobuyoshi; Mari, Daniela; Remuzzi, Giuseppe

    2013-06-01

    Longevity phenotype in humans results from the influence of environmental and genetic factors. Few gene polymorphisms have been identified so far with a modest effect on lifespan leaving room for the search of other players in the longevity game. It has been recently demonstrated that targeted disruption of the mouse homolog of the human angiotensin II type 1 receptor (AT1R) gene (AGTR1) translates into marked prolongation of animal lifespan (Benigni et al., J Clin Invest 119(3):524-530, 2009). Based on the above study in mice, here we sought to search for AGTR1 variations associated to reduced AT1 receptor protein levels and to prolonged lifespan in humans. AGTR1 was sequenced in 173 Italian centenarians and 376 younger controls. A novel non-synonymous mutation was detected in a centenarian. Two polymorphisms in AGTR1 promoter, rs422858 and rs275653, in complete linkage disequilibrium, were significantly associated with the ability to attain extreme old age. We then replicated the study of rs275653 in a large independent cohort of Japanese origin (598 centenarians and semi-supercentenarians, 422 younger controls) and indeed confirmed its association with exceptional old age. In combined analyses, rs275653 was associated to extreme longevity either at recessive model (P = 0.007, odds ratio (OR) 3.57) or at genotype level (P = 0.015). Significance was maintained after correcting for confounding factors. Fluorescence activated cell sorting analysis revealed that subjects homozygous for the minor allele of rs275653 had less AT1R-positive peripheral blood polymorphonuclear cells. Moreover, rs275653 was associated to lower blood pressure in centenarians. These findings highlight the role of AGTR1 as a possible candidate among longevity-enabling genes.

  10. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Directory of Open Access Journals (Sweden)

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  11. The variation of the fine structure constant: an update of statistical analysis with recent data

    CERN Document Server

    Kraiselburd, Lucila; Simeone, Claudio

    2013-01-01

    We analyze different astronomical data of the variation in the fine structure constant obtained with KECK and VLT to check their consistency. We test consistency using the Student test and confidence intervals. We split the data sets in smaller intervals and group them by i) redshift and ii) angular position. Another statistical analysis is proposed considering phenomenological models for the variation in \\alpha\\ . Results show consistency for reduced intervals for each pair of data sets considered and suggest that the variation in \\alpha\\ is important at higher redshifts.Even though the "dipole model" proposed by Webb et al. seems to be the most accurate phenomenological model, the statistical analyses indicates that the variation in \\alpha\\ might be depending both on redshift and angular position.

  12. Mining the protein data bank to differentiate error from structural variation in clustered static structures: an examination of HIV protease.

    Science.gov (United States)

    Venkatakrishnan, Balasubramanian; Palii, Miorel-Lucian; Agbandje-McKenna, Mavis; McKenna, Robert

    2012-03-01

    The Protein Data Bank (PDB) contains over 71,000 structures. Extensively studied proteins have hundreds of submissions available, including mutations, different complexes, and space groups, allowing for application of data-mining algorithms to analyze an array of static structures and gain insight about a protein's structural variation and possibly its dynamics. This investigation is a case study of HIV protease (PR) using in-house algorithms for data mining and structure superposition through generalized formulæ that account for multiple conformations and fractional occupancies. Temperature factors (B-factors) are compared with spatial displacement from the mean structure over the entire study set and separately over bound and ligand-free structures, to assess the significance of structural deviation in a statistical context. Space group differences are also examined.

  13. Constraints on field theoretical models for variation of the fine structure constant

    Science.gov (United States)

    Steinhardt, Charles L.

    2005-02-01

    Recent theoretical ideas and observational claims suggest that the fine structure constant α may be variable. We examine a spectrum of models in which α is a function of a scalar field. Specifically, we consider three scenarios: oscillating α, monotonic time variation of α, and time-independent α that is spatially varying. We examine the constraints imposed upon these theories by cosmological observations, particle detector experiments, and “fifth force” experiments. These constraints are very strong on models involving oscillation but cannot compete with bounds from the Oklo subnuclear reactor on models with monotonic timelike variation of α. One particular model with spatial variation is consistent with all current experimental and observational measurements, including those from two seemingly conflicting measurements of the fine structure constant using the many multiplet method on absorption lines.

  14. Length variations amongst protein domain superfamilies and consequences on structure and function.

    Directory of Open Access Journals (Sweden)

    Sankaran Sandhya

    Full Text Available BACKGROUND: Related protein domains of a superfamily can be specified by proteins of diverse lengths. The structural and functional implications of indels in a domain scaffold have been examined. METHODOLOGY: In this study, domain superfamilies with large length variations (more than 30% difference from average domain size, referred as 'length-deviant' superfamilies and 'length-rigid' domain superfamilies (<10% length difference from average domain size were analyzed for the functional impact of such structural differences. Our delineated dataset, derived from an objective algorithm, enables us to address indel roles in the presence of peculiar structural repeats, functional variation, protein-protein interactions and to examine 'domain contexts' of proteins tolerant to large length variations. Amongst the top-10 length-deviant superfamilies analyzed, we found that 80% of length-deviant superfamilies possess distant internal structural repeats and nearly half of them acquired diverse biological functions. In general, length-deviant superfamilies have higher chance, than length-rigid superfamilies, to be engaged in internal structural repeats. We also found that approximately 40% of length-deviant domains exist as multi-domain proteins involving interactions with domains from the same or other superfamilies. Indels, in diverse domain superfamilies, were found to participate in the accretion of structural and functional features amongst related domains. With specific examples, we discuss how indels are involved directly or indirectly in the generation of oligomerization interfaces, introduction of substrate specificity, regulation of protein function and stability. CONCLUSIONS: Our data suggests a multitude of roles for indels that are specialized for domain members of different domain superfamilies. These specialist roles that we observe and trends in the extent of length variation could influence decision making in modeling of new superfamily

  15. Three Nodes Acoustic Element for Fluid-Structure Interaction Based on a Parameterized Variational Principle

    Directory of Open Access Journals (Sweden)

    Correa S.

    2011-10-01

    Full Text Available This article presents a finite element formulation based on a parameterized variational principle for solving plane problems of fluid-structure interaction using the displacements as state variable for both solid and fluid media. The circular spurious modes, typical of displacement formulations are avoided. The penalty parameter is not random because it is selected according to energy criterion. Finally the formulation is not sensible to the definition of the normal direction in the fluid-structure interface.

  16. Variation in xylem structure from tropics to tundra: Evidence from vestured pits

    NARCIS (Netherlands)

    Jansen, S.; Baas, P.; Gasson, P.; Lens, F.; Smets, E.

    2004-01-01

    Bordered pits play an important role in permitting water flow among adjacent tracheary elements in flowering plants. Variation in the bordered pit structure is suggested to be adaptive in optimally balancing the conflict between hydraulic efficiency (conductivity) and safety from air entry at the

  17. Phosphorylation Variation during the Cell Cycle Scales with Structural Propensities of Proteins

    DEFF Research Database (Denmark)

    Tyanova, S.; Frishman, D.; Cox, J.;

    2013-01-01

    of the cell division cycle we investigate how the variation of the amount of phosphorylation correlates with the protein structure in the vicinity of the modified site. We find two distinct phosphorylation site groups: intrinsically disordered regions tend to contain sites with dynamically varying levels...

  18. Unconventional Hamilton-type variational principles for nonlinear elastodynamics of orthogonal cable-net structures

    Institute of Scientific and Technical Information of China (English)

    LI Wei-hua; LUO En; HUANG Wei-jiang

    2007-01-01

    According to the basic idea of classical yin-yang complementarity and modem dual-complementarity, in a simple and unified new way proposed by Luo, the unconventional Hamilton-type variational principles for geometrically nonlinear elastodynamics of orthogonal cable-net structures are established systematically, which can fully characterize the initial-boundary-value problem of this kind of dynamics. An important integral relation is made, which can be considered as the generalized principle of virtual work for geometrically nonlinear dynamics of orthogonal cable-net structures in mechanics. Based on such relationship, it is possible not only to obtain the principle of virtual work for geometrically nonlinear dynamics of orthogonal cable-net structures, but also to derive systematically the complementary functionals for five-field, four-field, three-field and two-field unconventional Hamilton-type variational principles, and the functional for the unconventional Hamilton-type variational principle in phase space and the potential energy functional for one-field unconventional Hamilton-type variational principle for geometrically nonlinear elastodynamics of orthogonal cable-net structures by the generalized Legendre transformation given in this paper. Furthermore, the intrinsic relationship among various principles can be explained clearly with this approach.

  19. The determination of the in situ structure by nuclear spin contrast variation

    Energy Technology Data Exchange (ETDEWEB)

    Stuhrmann, H.B. [GKSS Forschungszentrum, Geesthacht (Germany); Nierhaus, K.H. [Max-Planch-Institut fuer Molekulare Genetik, Berlin (Germany)

    1994-12-31

    Polarized neutron scattering from polarized nuclear spins in hydrogenous substances opens a new way of contrast variation. The enhanced contrast due to proton spin polarization was used for the in situ structure determination of tRNA of the functional complex of the E.coli ribosome.

  20. SV-AUTOPILOT: optimized, automated construction of structural variation discovery and benchmarking pipelines

    NARCIS (Netherlands)

    Leung, W.Y.; Marschall, T.; Paudel, Y.; Falquet, L.; Mei, H.; Schönhuth, A.; Maoz, T.Y.

    2015-01-01

    Background Many tools exist to predict structural variants (SVs), utilizing a variety of algorithms. However, they have largely been developed and tested on human germline or somatic (e.g. cancer) variation. It seems appropriate to exploit this wealth of technology available for humans also for othe

  1. Precambrian crustal structure in Africa and Arabia : Evidence lacking for secular variation

    NARCIS (Netherlands)

    Tugume, Fred; Nyblade, Andrew; Julia, Jordi; Meijde, van der Mark

    2013-01-01

    We review the thickness and shear wave velocity structure of Precambrian crust in Africa and Arabia, where over 90% of the landmass is comprised of Archean and Proterozoic terranes, and examine the data for evidence of secular variation. The data come from many published 1D shear wave velocity profi

  2. Patterns of human genetic variation inferred from comparative analysis of allelic mutations in blood group antigen genes.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Blumenfeld, Olga O

    2011-03-01

    Comparative analysis of allelic variation of a gene sheds light on the pattern and process of its diversification at the population level. Gene families for which a large number of allelic forms have been verified by sequencing provide a useful resource for such studies. In this regard, human blood group-encoding genes are unique in that differences of cell surface traits among individuals and populations can be readily detected by serological screening, and correlation between the variant cell surface phenotype and the genotype is, in most cases, unequivocal. Here, we perform a comprehensive analysis of allelic forms, compiled in the Blood Group Antigen Gene Mutation database, of ABO, RHD/CE, GYPA/B/E and FUT1/2 gene families that encode the ABO, RH, MNS, and H/h blood group system antigens, respectively. These genes are excellent illustrative examples showing distinct mutational patterns among the alleles, and leading to speculation on how their origin may have been driven by recurrent but different molecular mechanisms. We illustrate how alignment of alleles of a gene may provide an additional insight into the DNA variation process and its pathways, and how this approach may serve to catalog alleles of a gene, simplifying the task and content of mutation databases.

  3. Association between a variation in the phosphodiesterase 4D gene and bone mineral density

    Directory of Open Access Journals (Sweden)

    Sambrook Philip N

    2005-03-01

    Full Text Available Abstract Background Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown. Methods We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (2, n = 319 and high (> 1.11 g/cm2, n = 321 BMD at the lumbar spine. Significant findings were verified in two additional sample collections. Results Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4D gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (2 and 138 females with high (>1.04 g/cm2 lumbar spine BMD. Odds ratios were 1.5 (P = 0.035 in the original sample and 2.1 (P = 0.018 in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09. We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD. Conclusion This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in

  4. Variation in mangrove forest structure and sediment characteristics in Bocas del Toro, Panama

    Science.gov (United States)

    Lovelock, C.E.; Feller, Ilka C.; McKee, K.L.; Thompson, R.

    2005-01-01

    Mangrove forest structure and sediment characteristics were examined in the extensive mangroves of Bocas del Toro, Republic of Panama. Forest structure was characterized to determine if spatial vegetation patterns were repeated over the Bocas del Toro landscape. Using a series of permanent plots and transects we found that the forests of Bocas del Toro were dominated by Rhizophora mangle with very few individuals of Avicennia germinans and Laguncularia racemosa. Despite this low species diversity, there was large variation in forest structure and in edaphic conditions (salinity, concentration of available phosphorus, Eh and sulphide concentration). Aboveground biomass varied 20-fold, from 6.8 Mg ha-1 in dwarf forests to 194.3 Mg ha-1 in the forests fringing the land. But variation in forest structure was predictable across the intertidal zone. There was a strong tree height gradient from seaward fringe (mean tree height 3.9 m), decreasing in stature in the interior dwarf forests (mean tree height 0.7 m), and increasing in stature in forests adjacent to the terrestrial forest (mean tree height 4.1 m). The predictable variation in forest structure emerges due to the complex interactions among edaphic and plant factors. Identifying predictable patterns in forest structure will aid in scaling up the ecosystem services provided by mangrove forests in coastal landscapes. Copyright 2005 College of Arts and Sciences.

  5. Microsatellite variation reveals high levels of genetic variability and population structure in the gorgonian coral Pseudopterogorgia elisabethae across the Bahamas.

    Science.gov (United States)

    Gutierrez-Rodriguez, Carla; Lasker, Howard R

    2004-08-01

    The primary mechanism of gene flow in marine sessile invertebrates is larval dispersal. In Pseudopterogorgia elisabethae, a commercially important Caribbean gorgonian coral, a proportion of the larvae drop to the substratum within close proximity to the maternal colony, and most matings occur between individuals in close proximity to each other. Such limited dispersal of reproductive propagules suggests that gene flow is limited in this gorgonian. In this study, we characterized the population genetic structure of P. elisabethae across the Bahamas using six microsatellite loci. P. elisabethae was collected from 18 sites across the Bahamas. Significant deviations from Hardy-Weinberg equilibrium due to deficits of heterozygotes within populations were detected for all 18 populations in at least one of the six screened loci. Levels of genetic structure among populations of P. elisabethae were high and significant. A distance analysis placed populations within three groups, one formed by populations located within Exuma Sound, a semi-isolated basin, another consisting of populations located outside the basin and a third group comprising two populations from San Salvador Island. The patterns of genetic variation found in this study are concordant with the life-history traits of the species and in part with the geography of the Bahamas. Conservation and management plans developed for P. elisabethae should considered the high degree of genetic structure observed among populations of the species, as well as the high genetic diversity found in the San Salvador and the Exuma Sound populations. Copyright 2004 Blackwell Publishing Ltd

  6. vsp gene expression by Giardia lamblia clone GS/M-83-H7 during antigenic variation in vivo and in vitro.

    Science.gov (United States)

    Bienz, M; Siles-Lucas, M; Wittwer, P; Müller, N

    2001-09-01

    Giardia lamblia infections are associated with antigenic variation of the parasite, which is generated by a continuous change of the variant-specific surface proteins (VSPs). Many investigations on the process of antigenic variation were based on the use of G. lamblia clone GS/M-83-H7, which expresses VSP H7 as its major surface antigen. In the present study, mice were infected with the aforementioned clonal line to investigate vsp gene expression during the complex process of antigenic variation of the parasite. Trophozoites collected from the intestines of individual animals at different time points postinfection (p.i.) were analyzed directly for their vsp gene expression patterns, i.e., without cultivating the recovered parasites in vitro. Because few trophozoites were recovered at late time points p.i., a combined 5' rapid amplification of cDNA ends-reverse transcription-PCR approach was utilized. This allowed detection and subsequent sequence analysis of vsp gene transcripts upon generation of amplified cDNA analogues. The same PCR approach was applied for analysis of vsp gene expression in variants obtained after negative selection of axenic GS/M-83-H7 trophozoites by treatment with a cytotoxic, VSP H7-specific monoclonal antibody. In an overall view of the entire panel of in vivo- and in vitro-derived parasite populations, expression of 29 different vsp gene sequences could be demonstrated. In vivo antigenic variation of G. lamblia clone GS/M-83-H7 was shown to be a continuous process involving the consecutive appearance of relatively distinct sets of vsp transcripts. During the 42-day infection period investigated, this process activated at least 22 different vsp genes. Comparative molecular analyses of the amino acid level demonstrated that all cDNA segments identified encode structural elements typical of the terminal segment of Giardia VSP. The similarity of most of the GS/M-83-H7 VSP sequences identified in the present study supports previous

  7. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    Institute of Scientific and Technical Information of China (English)

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  8. Genetic variation in AKT1 is linked to dopamine-associated prefrontal cortical structure and function in humans

    Science.gov (United States)

    Tan, Hao-Yang; Nicodemus, Kristin K.; Chen, Qiang; Li, Zhen; Brooke, Jennifer K.; Honea, Robyn; Kolachana, Bhaskar S.; Straub, Richard E.; Meyer-Lindenberg, Andreas; Sei, Yoshitasu; Mattay, Venkata S.; Callicott, Joseph H.; Weinberger, Daniel R.

    2008-01-01

    AKT1-dependent molecular pathways control diverse aspects of cellular development and adaptation, including interactions with neuronal dopaminergic signaling. If AKT1 has an impact on dopaminergic signaling, then genetic variation in AKT1 would be associated with brain phenotypes related to cortical dopaminergic function. Here, we provide evidence that a coding variation in AKT1 that affects protein expression in human B lymphoblasts influenced several brain measures related to dopaminergic function. Cognitive performance linked to frontostriatal circuitry, prefrontal physiology during executive function, and frontostriatal gray-matter volume on MRI were altered in subjects with the AKT1 variation. Moreover, on neuroimaging measures with a main effect of the AKT1 genotype, there was significant epistasis with a functional polymorphism (Val158Met) in catechol-O-methyltransferase [COMT], a gene that indexes cortical synaptic dopamine. This genetic interaction was consistent with the putative role of AKT1 in dopaminergic signaling. Supportive of an earlier tentative association of AKT1 with schizophrenia, we also found that this AKT1 variant was associated with risk for schizophrenia. These data implicate AKT1 in modulating human prefrontal-striatal structure and function and suggest that the mechanism of this effect may be coupled to dopaminergic signaling and relevant to the expression of psychosis. PMID:18497887

  9. Variation of land use structure in Chuzhou City, China: 1996-2005

    Institute of Scientific and Technical Information of China (English)

    Zhang Jian

    2007-01-01

    Nowadays the fast economic development has brought about serious conflicts between the limited land resources and the increasing land demand in Chuzhou City.The changes of land use structure also restrict economic development and society progress in this area.Because different cities have different functional localization,the city area and each county (city) have formed characteristic land utilization structure.It is of great significance to make rational use of land resources and ensure the sustainable use of land resources by analyzing the variation of land use structure in the city area and each county (city) in Chuzhou City.Based on the data of land use modification of Chuzhou City from 1996 to 2005 and adopting the quantitative analysis of landscape ecology,this paper studies quantitatively the temporal division of regional land use structure and its dynamic changes.The results indicate that: (1) this method can reveal the law of the variation; (2) the variation of land use structure in Chuzhou City: increasing diversification,evenness and heterogeneity; (3) the intensity of change in land use from 1996 to 2005 in the city appeared in the sequence: grass land>traffic land>garden land>virgin land>forest land>industrial and residential land>cultivated land>other agricultural land>water facility land; (4) there were remarkable differences between the city area and each county (city) in the relative change and the land use structure change from 1996 to 2005.This paper analyzes the variation of land use structure in Chuzhou City,and finally proposes related countermeasures and suggestions.

  10. Scale-dependent variation in forest structures in naturally dynamic boreal forest landscapes

    Science.gov (United States)

    Kulha, Niko; Pasanen, Leena; De Grandpré, Louis; Kuuluvainen, Timo; Aakala, Tuomas

    2017-04-01

    Natural forest structures vary at multiple spatial scales. This variation reflects the occurrence of driving factors, such as disturbances and variation in soil or topography. To explore and understand the linkages of forest structural characteristics and factors driving their variation, we need to recognize how the structural characteristics vary in relation to spatial scale. This can be achieved by identifying scale-dependent features in forest structure within unmanaged forest landscapes. By identifying these features and examining their relationship with potential driving factors, we can better understand the dynamics of forest structural development. Here, we examine the spatial variation in forest structures at multiple spatial scales, utilizing data from old-growth boreal forests in two regions with contrasting disturbance regimes: northern Finland and north-eastern Québec, Canada ( 67° 45'N, 29° 36'E, 49° 39'N, 67° 55'W, respectively). The three landscapes (4 km2 each) in Finland are dominated by Pinus sylvestris and Picea abies, whereas the two landscapes in Québec are dominated by Abies balsamea and Picea mariana. Québec's forests are a subject to cyclic outbreaks of the eastern spruce budworm, causing extensive mortality especially in A. balsamea-dominated stands. In the Finnish landscapes, gap- to patch-scale disturbances due to tree senescence, fungi and wind, as well as infrequent surface fires in areas dominated by P. sylvestris, prevail. Owing to the differences in the species compositions and the disturbance regimes, we expect differing scales of variation between the landscapes. To quantify patterns of variation, we visually interpret stereopairs of recent aerial photographs. From the photographs, we collect information on forest canopy coverage, species composition and dead wood. For the interpretation, each 4 km2 plot is divided into 0.1ha square cells (4096 per plot). Interpretations are validated against field observations and compiled

  11. Comparison of Affymetrix Gene Array with the Exon Array shows potential application for detection of transcript isoform variation

    Directory of Open Access Journals (Sweden)

    Coulombe-Huntington Jasmin

    2009-11-01

    Full Text Available Abstract Background The emergence of isoform-sensitive microarrays has helped fuel in-depth studies of the human transcriptome. The Affymetrix GeneChip Human Exon 1.0 ST Array (Exon Array has been previously shown to be effective in profiling gene expression at the isoform level. More recently, the Affymetrix GeneChip Human Gene 1.0 ST Array (Gene Array has been released for measuring gene expression and interestingly contains a large subset of probes from the Exon Array. Here, we explore the potential of using Gene Array probes to assess expression variation at the sub-transcript level. Utilizing datasets of the high quality Microarray Quality Control (MAQC RNA samples previously assayed on the Exon Array and Gene Array, we compare the expression measurements of the two platforms to determine the performance of the Gene Array in detecting isoform variations. Results Overall, we show that the Gene Array is comparable to the Exon Array in making gene expression calls. Moreover, to examine expression of different isoforms, we modify the Gene Array probe set definition file to enable summarization of probe intensity values at the exon level and show that the expression profiles between the two platforms are also highly correlated. Next, expression calls of previously known differentially spliced genes were compared and also show concordant results. Splicing index analysis, representing estimates of exon inclusion levels, shows a lower but good correlation between platforms. As the Gene Array contains a significant subset of probes from the Exon Array, we note that, in comparison, the Gene Array overlaps with fewer but still a high proportion of splicing events annotated in the Known Alt Events UCSC track, with abundant coverage of cassette exons. We discuss the ability of the Gene Array to detect alternative splicing and isoform variation and address its limitations. Conclusion The Gene Array is an effective expression profiling tool at gene and

  12. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  13. Spatial and spatiotemporal variation in metapopulation structure affects population dynamics in a passively dispersing arthropod.

    Science.gov (United States)

    De Roissart, Annelies; Wang, Shaopeng; Bonte, Dries

    2015-11-01

    The spatial and temporal variation in the availability of suitable habitat within metapopulations determines colonization-extinction events, regulates local population sizes and eventually affects local population and metapopulation stability. Insights into the impact of such a spatiotemporal variation on the local population and metapopulation dynamics are principally derived from classical metapopulation theory and have not been experimentally validated. By manipulating spatial structure in artificial metapopulations of the spider mite Tetranychus urticae, we test to which degree spatial (mainland-island metapopulations) and spatiotemporal variation (classical metapopulations) in habitat availability affects the dynamics of the metapopulations relative to systems where habitat is constantly available in time and space (patchy metapopulations). Our experiment demonstrates that (i) spatial variation in habitat availability decreases variance in metapopulation size and decreases density-dependent dispersal at the metapopulation level, while (ii) spatiotemporal variation in habitat availability increases patch extinction rates, decreases local population and metapopulation sizes and decreases density dependence in population growth rates. We found dispersal to be negatively density dependent and overall low in the spatial variable mainland-island metapopulation. This demographic variation subsequently impacts local and regional population dynamics and determines patterns of metapopulation stability. Both local and metapopulation-level variabilities are minimized in mainland-island metapopulations relative to classical and patchy ones.

  14. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    Institute of Scientific and Technical Information of China (English)

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  15. Case Study of Somaclonal Variation in Resistance Genes Mlo and Pme3 in Flaxseed (Linum usitatissimum L.) Induced by Nanoparticles

    Science.gov (United States)

    Kokina, Inese; Jermaļonoka, Marija; Bankovska, Linda; Gerbreders, Vjačeslavs; Ogurcovs, Andrejs; Jahundoviča, Inese

    2017-01-01

    Nanoparticles influence on genome is investigated worldwide. The appearance of somaclonal variation is a cause of great concern for any micropropagation system. Somaclonal variation describes the tissue-culture-induced phenotypic and genotypic variations. This paper shows the results of somaclonal variation in two resistance genes pectin methylesterase and Mlo-like protein in all tissue culture development stages, as donor plant, calluses, and regenerants of Linum usitatissimum induced by gold and silver nanoparticles. In this paper, it was essential to obtain DNA material from all tissue culture development stages from one donor plant to record changes in each nucleotide sequence. Gene region specific primers were developed for resistance genes such as Mlo and Pme3 to define the genetic variability in tissue culture of L. usitatissimum. In recent years, utilization of gold and silver nanoparticles in tissue culture is increased and the mechanisms of changes in genome induced by nanoparticles still remain unclear. Obtained data show the somaclonal variation increase in calluses obtained from one donor plant and grown on medium supplemented by gold nanoparticles (Mlo 14.68 ± 0.98; Pme3 2.07 ± 0.87) or silver nanoparticles (Mlo 12.01 ± 0.43; Pme3 10.04 ± 0.46) and decrease in regenerants. Morphological parameters of calluses showed a number of differences between each investigated culture group. PMID:28326314

  16. Common Variation in the NOS1AP Gene Is Associated With Drug-Induced QT Prolongation and Ventricular Arrhythmia

    NARCIS (Netherlands)

    Jamshidi, Yalda; Nolte, Ilja M.; Dalageorgou, Chrysoula; Zheng, Dongling; Johnson, Toby; Bastiaenen, Rachel; Ruddy, Suzanne; Talbott, Daniel; Norris, Kris J.; Snieder, Harold; George, Alfred L.; Marshall, Vanessa; Shakir, Saad; Kannankeril, Prince J.; Munroe, Patricia B.; Camm, A. John; Jeffery, Steve; Roden, Dan M.; Behr, Elijah R.

    2012-01-01

    Objectives This study sought to determine whether variations in NOS1AP affect drug-induced long QT syndrome (LQTS). Background Use of antiarrhythmic drugs is limited by the high incidence of serious adverse events including QT prolongation and torsades de pointes. NOS1AP gene variants play a role in

  17. Genetic Variation and the Risk of Haloperidol-Related Parkinsonism in Elderly Patients A Candidate Gene Approach

    NARCIS (Netherlands)

    Knol, Wilma; van Marum, Rob J.; Jansen, Paul A. F.; Strengman, Eric; Al Hadithy, Asmar F. Y.; Wilffert, Bob; Schobben, Alfred F. A. M.; Ophoff, Roel A.; Egberts, Toine C. G.

    2013-01-01

    Factors that influence the variation in occurrence of antipsychotic-related parkinsonism in elderly have not been well elucidated. The aim of this study was to investigate whether previous identified and studied genetic polymorphisms at DRD2, ANKK1, DRD3, HTR2A, HTR2C, RGS2, COMT, and BDNF genes are

  18. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, L S; Wod, M; Grarup, Niels;

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...... diabetes susceptibility or influences diabetes-related metabolic traits....

  19. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas;

    2012-01-01

    3918342 and rs1421292, were significantly associated with CSF HVA concentrations. Rs3918342 was found to be nominally associated with CSF 5-HIAA concentrations. None of the polymorphisms were significantly associated with MHPG concentrations. Our results indicate that DAOA gene variation affects dopamine...

  20. Common genetic variation in the Estrogen Receptor Beta (ESR2) gene and osteoarthritis: Results of a meta-analysis

    NARCIS (Netherlands)

    J.M. Kerkhof (Hanneke); I. Meulenbelt (Ingrid); A. Gonzalez (Antonio); D.J. Hart (Deborah); A. Hofman (Albert); M. Kloppenburg (Margreet); N.E. Lane; J. Loughlin (John); M.C. Nevitt (Michael); H.A.P. Pols (Huib); F. Rivadeneira Ramirez (Fernando); E. Slagboom (Eline); T.D. Spector (Tim); L. Stolk (Lisette); A. Tsezou (Aspasia); A.G. Uitterlinden (André); A.M. Valdes (Ana Maria); J.B.J. van Meurs (Joyce); A.J. Carr (Andrew Jonathan)

    2010-01-01

    textabstractBackground: The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis.Methods: In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs) were genotyped and tested for association with hip

  1. Variations in potassium channel genes are associated with breast pain in women prior to breast cancer surgery.

    Science.gov (United States)

    Langford, Dale J; West, Claudia; Elboim, Charles; Cooper, Bruce A; Abrams, Gary; Paul, Steven M; Schmidt, Brian L; Levine, Jon D; Merriman, John D; Dhruva, Anand; Neuhaus, John; Leutwyler, Heather; Baggott, Christina; Sullivan, Carmen Ward; Aouizerat, Bradley E; Miaskowski, Christine

    2014-01-01

    Preoperative breast pain in women with breast cancer may result from a number of causes. Previous work from our team found that breast pain occurred in 28.2% of women (n = 398) who were about to undergo breast cancer surgery. The occurrence of preoperative breast pain was associated with a number of demographic and clinical characteristics, as well as variation in two cytokine genes. Given that ion channels regulate excitability of sensory neurons, we hypothesized that variations in potassium channel genes would be associated with preoperative breast pain in these patients. Therefore, in this study, we evaluated for associations between single-nucleotide polymorphisms and inferred haplotypes among 10 potassium channel genes and the occurrence of preoperative breast pain in patients scheduled to undergo breast cancer surgery. Multivariable logistic regression analyses were used to identify those genetic variations that were associated with the occurrence of preoperative breast pain while controlling for age and genomic estimates of and self-reported race/ethnicity. Variations in four potassium channel genes: (1) potassium voltage-gated channel, delayed rectifier, subfamily S, member 1 (KCNS1); (2) potassium inwardly rectifying channel, subfamily J, member 3 (KCNJ3); (3) KCNJ6; and (4) potassium channel, subfamily K, member 9 (KCNK9) were associated with the occurrence of breast pain. Findings from this study warrant replication in an independent sample of women who report breast pain following one or more breast biopsies.

  2. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  3. Gene variations of nitric oxide synthase regulate the effects of a saturated fat rich meal on endothelial function

    Science.gov (United States)

    Objective: Endothelial nitric oxide synthase gene variations have been linked to a higher risk for cardiovascular diseases by unknown mechanisms. Our aim was to determine if two SNPs located in NOS3 (E298D and i19342) interfere with microvascular endothelial function (MEF) and/or oxidative stress du...

  4. Inter- and intra-industry variations of capital structure in the Czech manufacturing industry

    Directory of Open Access Journals (Sweden)

    Pavlína Pinková

    2013-01-01

    Full Text Available The objective of the paper is to investigate the existence of inter-industry variations in the capital structure of enterprises of the Czech manufacturing industry and to identify the intra-industry causes of these differences. Three measures of capital structure are employed to determine the inter-industry variations. These are total debt ratio, long-term debt and short-term debt ratios. The set of explanatory variables is included to clarify the intra-industry variations. These explanatory variables are size, asset structure, asset utilization, profitability, non-debt tax shield and growth. The paper reports the analysis of capital structure of five distinctive industrial branches, namely the manuf