WorldWideScience

Sample records for gene promoter engineered

  1. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  2. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  3. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  4. Efficiently engineered cell sheet using a complex of polyethylenimine–alginate nanocomposites plus bone morphogenetic protein 2 gene to promote new bone formation

    Science.gov (United States)

    Jin, Han; Zhang, Kai; Qiao, Chunyan; Yuan, Anliang; Li, Daowei; Zhao, Liang; Shi, Ce; Xu, Xiaowei; Ni, Shilei; Zheng, Changyu; Liu, Xiaohua; Yang, Bai; Sun, Hongchen

    2014-01-01

    Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2) gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al) nanocomposites plus human BMP-2 complementary(c)DNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI–al nanocomposites efficiently deliver the BMP-2 gene to bone marrow mesenchymal stem cells and that BMP-2 gene-engineered cell sheet is an effective way for promoting bone regeneration. PMID:24855355

  5. Pgas, a Low-pH-Induced Promoter, as a Tool for Dynamic Control of Gene Expression for Metabolic Engineering of Aspergillus niger.

    Science.gov (United States)

    Yin, Xian; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Liu, Long; Chen, Jian

    2017-03-15

    The dynamic control of gene expression is important for adjusting fluxes in order to obtain desired products and achieve appropriate cell growth, particularly when the synthesis of a desired product drains metabolites required for cell growth. For dynamic gene expression, a promoter responsive to a particular environmental stressor is vital. Here, we report a low-pH-inducible promoter, P gas , which promotes minimal gene expression at pH values above 5.0 but functions efficiently at low pHs, such as pH 2.0. First, we performed a transcriptional analysis of Aspergillus niger , an excellent platform for the production of organic acids, and we found that the promoter P gas may act efficiently at low pH. Then, a gene for synthetic green fluorescent protein ( sGFP ) was successfully expressed by P gas at pH 2.0, verifying the results of the transcriptional analysis. Next, P gas was used to express the cis -aconitate decarboxylase ( cad ) gene of Aspergillus terreus in A. niger , allowing the production of itaconic acid at a titer of 4.92 g/liter. Finally, we found that P gas strength was independent of acid type and acid ion concentration, showing dependence on pH only. IMPORTANCE The promoter P gas can be used for the dynamic control of gene expression in A. niger for metabolic engineering to produce organic acids. This promoter may also be a candidate tool for genetic engineering. Copyright © 2017 American Society for Microbiology.

  6. Efficiently engineered cell sheet using a complex of polyethylenimine–alginate nanocomposites plus bone morphogenetic protein 2 gene to promote new bone formation

    Directory of Open Access Journals (Sweden)

    Jin H

    2014-05-01

    Full Text Available Han Jin,1 Kai Zhang,2 Chunyan Qiao,1 Anliang Yuan,1 Daowei Li,1 Liang Zhao,1 Ce Shi,1 Xiaowei Xu,1 Shilei Ni,1 Changyu Zheng,3 Xiaohua Liu,4 Bai Yang,2 Hongchen Sun11Department of Pathology, School of Stomatology, Jilin University, Changchun, People’s Republic of China; 2State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry, Jilin University, Changchun, People’s Republic of China; 3Molecular Physiology and Therapeutics Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD, USA; 4Department of Biomedical Sciences, Texas A&M University Baylor College of Dentistry, Dallas, TX, USAAbstract: Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2 gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al nanocomposites plus human BMP-2 complementary(cDNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI

  7. The XylS/Pm regulator/promoter system and its use in fundamental studies of bacterial gene expression, recombinant protein production and metabolic engineering.

    Science.gov (United States)

    Gawin, Agnieszka; Valla, Svein; Brautaset, Trygve

    2017-07-01

    The XylS/Pm regulator/promoter system originating from the Pseudomonas putida TOL plasmid pWW0 is widely used for regulated low- and high-level recombinant expression of genes and gene clusters in Escherichia coli and other bacteria. Induction of this system can be graded by using different cheap benzoic acid derivatives, which enter cells by passive diffusion, operate in a dose-dependent manner and are typically not metabolized by the host cells. Combinatorial mutagenesis and selection using the bla gene encoding β-lactamase as a reporter have demonstrated that the Pm promoter, the DNA sequence corresponding to the 5' untranslated end of its cognate mRNA and the xylS coding region can be modified and improved relative to various types of applications. By combining such mutant genetic elements, altered and extended expression profiles were achieved. Due to their unique properties, obtained systems serve as a genetic toolbox valuable for heterologous protein production and metabolic engineering, as well as for basic studies aiming at understanding fundamental parameters affecting bacterial gene expression. The approaches used to modify XylS/Pm should be adaptable for similar improvements also of other microbial expression systems. In this review, we summarize constructions, characteristics, refinements and applications of expression tools using the XylS/Pm system. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  8. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...

  9. Generation of dTALEs and Libraries of Synthetic TALE-Activated Promoters for Engineering of Gene Regulatory Networks in Plants.

    Science.gov (United States)

    Schreiber, Tom; Tissier, Alain

    2017-01-01

    Transcription factors with programmable DNA-binding specificity constitute valuable tools for the design of orthogonal gene regulatory networks for synthetic biology. Transcription activator-like effectors (TALEs), as natural transcription regulators, were used to design, build, and test libraries of synthetic TALE-activated promoters (STAPs) that show a broad range of expression levels in plants. In this chapter, we present protocols for the construction of artificial TALEs and corresponding STAPs.

  10. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  11. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  12. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  13. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

    Science.gov (United States)

    Mishra, Avinash; Tanna, Bhakti

    2017-01-01

    Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  14. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  15. Various advanced design projects promoting engineering education

    Science.gov (United States)

    1994-01-01

    The Universities Space Research Association (USRA) Advanced Design Program (ADP) program promotes engineering education in the field of design by presenting students with challenging design projects drawn from actual NASA interests. In doing so, the program yields two very positive results. Firstly, the students gain a valuable experience that will prepare them for design problems with which they will be faced in their professional careers. Secondly, NASA is able to use the work done by students as an additional resource in meeting its own design objectives. The 1994 projects include: Universal Test Facility; Automated Protein Crystal Growth Facility; Stiffening of the ACES Deployable Space Boom; Launch System Design for Access to Space; LH2 Fuel Tank Design for SSTO Vehicle; and Feed System Design for a Reduced Pressure Tank.

  16. Genome engineering using a synthetic gene circuit in Bacillus subtilis.

    Science.gov (United States)

    Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun

    2015-03-31

    Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Duodenal ulcer promoting gene of Helicobacter pylori.

    Science.gov (United States)

    Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

    2005-04-01

    Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

  18. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  19. Promoting Girls' Awareness and Interest in Engineering

    Science.gov (United States)

    Lawrence, Deborah A.; Mancuso, Tina A.

    2012-01-01

    Multiple initiatives have been launched to try to widen the pipeline for women to enter engineering careers, including reviews of gender differences in enrollment in technology and pre-engineering courses from middle school through doctoral degrees. National agencies have also studied some of the social and cultural forces at play with regard to…

  20. Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

    Science.gov (United States)

    Ho, Steven C L; Yang, Yuansheng

    2014-08-01

    Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

  1. An unlikely suitor: Industrial Engineering in health promotion

    Directory of Open Access Journals (Sweden)

    Hattingh, T. S.

    2013-05-01

    Full Text Available Primary healthcare forms the foundation for transforming healthcare in South Africa. The primary healthcare system is based on five pillars, one of them being health promotion. The principles of health promotion advocate that promoting health and wellness within communities will reduce the burden of disease at both primary and higher levels of the healthcare system. The challenge in South Africa, is that the factors affecting communities often inhibit their ability to control their health. In addition, the health promotion function within clinics is underresourced: each health promoter serves impoverished communities of up to 50,000 people. This study aims to identify how industrial engineering principles can be applied to assess and improve the impact of health promotion on communities, and ultimately on the health care system as a whole. An industrial engineering approach has analysed five clinics within the Ekurhuleni Municipality in Gauteng. The results show a distinct lack of consistency between clinics. Common issues include a lack of standard processes, structures, measures, resources, and training to support health promotion. The problems identified are commonly analysed and addressed by industrial engineering in organisations, and industrial engineering could be a useful method for evaluating and improving the impact of health promotion on communities. Recommendations for improvement and further work were made based on the findings.

  2. Gene therapy for cartilage and bone tissue engineering

    CERN Document Server

    Hu, Yu-Chen

    2014-01-01

    "Gene Therapy for Cartilage and Bone Tissue Engineering" outlines the tissue engineering and possible applications of gene therapy in the field of biomedical engineering as well as basic principles of gene therapy, vectors and gene delivery, specifically for cartilage and bone engineering. It is intended for tissue engineers, cell therapists, regenerative medicine scientists and engineers, gene therapist and virologists. Dr. Yu-Chen Hu is a Distinguished Professor at the Department of Chemical Engineering, National Tsing Hua University and has received the Outstanding Research Award (National Science Council), Asia Research Award (Society of Chemical Engineers, Japan) and Professor Tsai-Teh Lai Award (Taiwan Institute of Chemical Engineers). He is also a fellow of the American Institute for Medical and Biological Engineering (AIMBE) and a member of the Tissue Engineering International & Regenerative Medicine Society (TERMIS)-Asia Pacific Council.

  3. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  4. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  5. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Li Mingji

    2012-02-01

    Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

  6. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  7. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  8. Glycerol positive promoters for tailored metabolic engineering of the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Ho, Ping-Wei; Klein, Mathias; Futschik, Matthias; Nevoigt, Elke

    2018-05-01

    Glycerol offers several advantages as a substrate for biotechnological applications. An important step toward using the popular production host Saccharomyces cerevisiae for glycerol-based bioprocesses has been the fact that in recent studies commonly used S. cerevisiae strains were engineered to grow in synthetic medium containing glycerol as the sole carbon source. For metabolic engineering projects of S. cerevisiae growing on glycerol, characterized promoters are missing. In the current study, we used transcriptome analysis and a yECitrine-based fluorescence reporter assay to select and characterize 25 useful promoters. The promoters of the genes ALD4 and ADH2 showed 4.2-fold and 3-fold higher activities compared to the well-known strong TEF1 promoter. Moreover, the collection contains promoters with graded activities in synthetic glycerol medium and different degrees of glucose repression. To demonstrate the general applicability of the promoter collection, we successfully used a subset of the characterized promoters with graded activities in order to optimize growth on glycerol in an engineered derivative of CEN.PK, in which glycerol catabolism exclusively occurs via a non-native DHA pathway.

  9. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  10. Global Engineering Teams--A Programme Promoting Teamwork in Engineering Design and Manufacturing

    Science.gov (United States)

    Oladiran, M. T.; Uziak, J.; Eisenberg, M.; Scheffer, C.

    2011-01-01

    Engineering graduates are expected to possess various competencies categorised into hard and soft skills. The hard skills are acquired through specific coursework, but the soft skills are often treated perfunctorily. Global Engineering Teams (GET) is a programme that promotes project-oriented tasks in virtual student teams working in collaboration…

  11. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  12. Genetically engineering adenoviral vectors for gene therapy.

    Science.gov (United States)

    Coughlan, Lynda

    2014-01-01

    Adenoviral (Ad) vectors are commonly used for various gene therapy applications. Significant advances in the genetic engineering of Ad vectors in recent years has highlighted their potential for the treatment of metastatic disease. There are several methods to genetically modify the Ad genome to incorporate retargeting peptides which will redirect the natural tropism of the viruses, including homologous recombination in bacteria or yeast. However, homologous recombination in yeast is highly efficient and can be achieved without the need for extensive cloning strategies. In addition, the method does not rely on the presence of unique restriction sites within the Ad genome and the reagents required for this method are widely available and inexpensive. Large plasmids containing the entire adenoviral genome (~36 kbp) can be modified within Saccharomyces cerevisiae yeast and genomes easily rescued in Escherichia coli hosts for analysis or amplification. A method for two-step homologous recombination in yeast is described in this chapter.

  13. Promoting peace in engineering education: modifying the ABET criteria.

    Science.gov (United States)

    Catalano, George D

    2006-04-01

    Modifications to the ABET Criterion 3 are suggested in support of the effort to promote the pursuit of peace in engineering education. The proposed modifications are the result of integrating the United Nations' sponsored "Integral Model of Education for Peace, Democracy and Sustainable Development" into the modern engineering curriculum. The key elements of the model are being at peace with oneself, being at peace with others, and being at peace with the planet. In addition to proposing modifications, specific classroom activities are described and implemented, and students' reactions and the effectiveness of the various exercises are discussed.

  14. Firefly luciferase gene contains a cryptic promoter

    Czech Academy of Sciences Publication Activity Database

    Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.

    2008-01-01

    Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008

  15. International cooperation for promotion of nuclear science and engineering research

    International Nuclear Information System (INIS)

    Shibata, Toshikazu; Sugiyama, Kazusuke; Nakazawa, Masaharu; Katoh, Toshio; Kimura, Itsuro.

    1993-01-01

    For promotion of nuclear science and engineering research, examinations were made on the possibilities and necessary measures to extend joint research at international level. The present article is a summary of the reports of investigations performed during FY 1986 through 1991 by the Special Committee of the AESJ for Feasibility Study on International Cooperation for Promotion of Nuclear Science and Engineering Research, under contract with Science and Technology Agency of Japan. Background information was collected on the present status of scientific research facilities in US, European and Asian countries on one hand, and on the expectations and prospects of Japanese scientists on the other hand. Based on the analysis of these data, some measures necessary to expand the international cooperation were proposed. It was emphasized that international joint research on a reciprocal basis would be effective in order to strengthen the technological basis of peaceful uses of nuclear energy. Problems to be solved for the new development were also discussed. (author)

  16. Developing a set of strong intronic promoters for robust metabolic engineering in oleaginous Rhodotorula (Rhodosporidium) yeast species.

    Science.gov (United States)

    Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui

    2016-11-25

    Red yeast species in the Rhodotorula/Rhodosporidium genus are outstanding producers of triacylglyceride and cell biomass. Metabolic engineering is expected to further enhance the productivity and versatility of these hosts for the production of biobased chemicals and fuels. Promoters with strong activity during oil-accumulation stage are critical tools for metabolic engineering of these oleaginous yeasts. The upstream DNA sequences of 6 genes involved in lipid biosynthesis or accumulation in Rhodotorula toruloides were studied by luciferase reporter assay. The promoter of perilipin/lipid droplet protein 1 gene (LDP1) displayed much stronger activity (4-11 folds) than that of glyceraldehyde-3-phosphate dehydrogenase gene (GPD1), one of the strongest promoters known in yeasts. Depending on the stage of cultivation, promoter of acetyl-CoA carboxylase gene (ACC1) and fatty acid synthase β subunit gene (FAS1) exhibited intermediate strength, displaying 50-160 and 20-90% levels of GPD1 promoter, respectively. Interestingly, introns significantly modulated promoter strength at high frequency. The incorporation of intron 1 and 2 of LDP1 (LDP1in promoter) enhanced its promoter activity by 1.6-3.0 folds. Similarly, the strength of ACC1 promoter was enhanced by 1.5-3.2 folds if containing intron 1. The intron 1 sequences of ACL1 and FAS1 also played significant regulatory roles. When driven by the intronic promoters of ACC1 and LDP1 (ACC1in and LDP1in promoter, respectively), the reporter gene expression were up-regulated by nitrogen starvation, independent of de novo oil biosynthesis and accumulation. As a proof of principle, overexpression of the endogenous acyl-CoA-dependent diacylglycerol acyltransferase 1 gene (DGA1) by LDP1in promoter was significantly more efficient than GPD1 promoter in enhancing lipid accumulation. Intronic sequences play an important role in regulating gene expression in R. toruloides. Three intronic promoters, LDP1in, ACC1in and FAS1in, are

  17. Transfer of engineered genes from crop to wild plants

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

    1996-01-01

    The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

  18. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  19. Site-specific selfish genes as tools for the control and genetic engineering of natural populations.

    Science.gov (United States)

    Burt, Austin

    2003-05-07

    Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.

  20. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  1. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  2. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  3. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  4. Introduction and expression of genes for metabolic engineering applications in Saccharomyces cerevisiae.

    Science.gov (United States)

    Da Silva, Nancy A; Srikrishnan, Sneha

    2012-03-01

    Metabolic pathway engineering in the yeast Saccharomyces cerevisiae leads to improved production of a wide range of compounds, ranging from ethanol (from biomass) to natural products such as sesquiterpenes. The introduction of multienzyme pathways requires precise control over the level and timing of expression of the associated genes. Gene number and promoter strength/regulation are two critical control points, and multiple studies have focused on modulating these in yeast. This MiniReview focuses on methods for introducing genes and controlling their copy number and on the many promoters (both constitutive and inducible) that have been successfully employed. The advantages and disadvantages of the methods will be presented, and applications to pathway engineering will be highlighted. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  5. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  6. Tissue Engineering Using Transfected Growth-Factor Genes

    Science.gov (United States)

    Madry, Henning; Langer, Robert S.; Freed, Lisa E.; Trippel, Stephen; Vunjak-Novakovic, Gordana

    2005-01-01

    A method of growing bioengineered tissues includes, as a major component, the use of mammalian cells that have been transfected with genes for secretion of regulator and growth-factor substances. In a typical application, one either seeds the cells onto an artificial matrix made of a synthetic or natural biocompatible material, or else one cultures the cells until they secrete a desired amount of an extracellular matrix. If such a bioengineered tissue construct is to be used for surgical replacement of injured tissue, then the cells should preferably be the patient s own cells or, if not, at least cells matched to the patient s cells according to a human-leucocyteantigen (HLA) test. The bioengineered tissue construct is typically implanted in the patient's injured natural tissue, wherein the growth-factor genes enhance metabolic functions that promote the in vitro development of functional tissue constructs and their integration with native tissues. If the matrix is biodegradable, then one of the results of metabolism could be absorption of the matrix and replacement of the matrix with tissue formed at least partly by the transfected cells. The method was developed for articular chondrocytes but can (at least in principle) be extended to a variety of cell types and biocompatible matrix materials, including ones that have been exploited in prior tissue-engineering methods. Examples of cell types include chondrocytes, hepatocytes, islet cells, nerve cells, muscle cells, other organ cells, bone- and cartilage-forming cells, epithelial and endothelial cells, connective- tissue stem cells, mesodermal stem cells, and cells of the liver and the pancreas. Cells can be obtained from cell-line cultures, biopsies, and tissue banks. Genes, molecules, or nucleic acids that secrete factors that influence the growth of cells, the production of extracellular matrix material, and other cell functions can be inserted in cells by any of a variety of standard transfection techniques.

  7. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  8. Global engineering teams - a programme promoting teamwork in engineering design and manufacturing

    Science.gov (United States)

    Oladiran, M. T.; Uziak, J.; Eisenberg, M.; Scheffer, C.

    2011-05-01

    Engineering graduates are expected to possess various competencies categorised into hard and soft skills. The hard skills are acquired through specific coursework, but the soft skills are often treated perfunctorily. Global Engineering Teams (GET) is a programme that promotes project-oriented tasks in virtual student teams working in collaboration with industry partners. Teamwork is a major success factor for GET as students always work in groups of varying sizes. A questionnaire-based survey of the 2008 cohort of GET students was conducted to assess teamwork, communication and conflict resolution among group members. The results confirmed that deliverables are readily achieved in teams and communication was open. A challenge of using virtual teams is the availability of high-speed Internet access. The GET programme shows that it is possible to deliver engineering design and manufacturing via industry/university collaboration. The programme also facilitates multidisciplinary teamwork at an international level.

  9. Engineering Encounters: The Cat in the Hat Builds Satellites. A Unit Promoting Scientific Literacy and the Engineering Design Process

    Science.gov (United States)

    Rehmat, Abeera P.; Owens, Marissa C.

    2016-01-01

    This column presents ideas and techniques to enhance your science teaching. This month's issue shares information about a unit promoting scientific literacy and the engineering design process. The integration of engineering with scientific practices in K-12 education can promote creativity, hands-on learning, and an improvement in students'…

  10. GOseek: a gene ontology search engine using enhanced keywords.

    Science.gov (United States)

    Taha, Kamal

    2013-01-01

    We propose in this paper a biological search engine called GOseek, which overcomes the limitation of current gene similarity tools. Given a set of genes, GOseek returns the most significant genes that are semantically related to the given genes. These returned genes are usually annotated to one of the Lowest Common Ancestors (LCA) of the Gene Ontology (GO) terms annotating the given genes. Most genes have several annotation GO terms. Therefore, there may be more than one LCA for the GO terms annotating the given genes. The LCA annotating the genes that are most semantically related to the given gene is the one that receives the most aggregate semantic contribution from the GO terms annotating the given genes. To identify this LCA, GOseek quantifies the contribution of the GO terms annotating the given genes to the semantics of their LCAs. That is, it encodes the semantic contribution into a numeric format. GOseek uses microarray experiment data to rank result genes based on their significance. We evaluated GOseek experimentally and compared it with a comparable gene prediction tool. Results showed marked improvement over the tool.

  11. From gene engineering to gene modulation and manipulation: can we prevent or detect gene doping in sports?

    Science.gov (United States)

    Fischetto, Giuseppe; Bermon, Stéphane

    2013-10-01

    During the last 2 decades, progress in deciphering the human gene map as well as the discovery of specific defective genes encoding particular proteins in some serious human diseases have resulted in attempts to treat sick patients with gene therapy. There has been considerable focus on human recombinant proteins which were gene-engineered and produced in vitro (insulin, growth hormone, insulin-like growth factor-1, erythropoietin). Unfortunately, these substances and methods also became improper tools for unscrupulous athletes. Biomedical research has focused on the possible direct insertion of gene material into the body, in order to replace some defective genes in vivo and/or to promote long-lasting endogenous synthesis of deficient proteins. Theoretically, diabetes, anaemia, muscular dystrophies, immune deficiency, cardiovascular diseases and numerous other illnesses could benefit from such innovative biomedical research, though much work remains to be done. Considering recent findings linking specific genotypes and physical performance, it is tempting to submit the young athletic population to genetic screening or, alternatively, to artificial gene expression modulation. Much research is already being conducted in order to achieve a safe transfer of genetic material to humans. This is of critical importance since uncontrolled production of the specifically coded protein, with serious secondary adverse effects (polycythaemia, acute cardiovascular problems, cancer, etc.), could occur. Other unpredictable reactions (immunogenicity of vectors or DNA-vector complex, autoimmune anaemia, production of wild genetic material) also remain possible at the individual level. Some new substances (myostatin blockers or anti-myostatin antibodies), although not gene material, might represent a useful and well-tolerated treatment to prevent progression of muscular dystrophies. Similarly, other molecules, in the roles of gene or metabolic activators [5-aminoimidazole-4

  12. Genes that cooperate with tumor promoters in transformation

    International Nuclear Information System (INIS)

    Colburn, N.H.; Smith, B.M.

    1988-01-01

    Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation

  13. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  14. Promoting a Culture of Tailoring for Systems Engineering Policy Expectations

    Science.gov (United States)

    Blankenship, Van A.

    2016-01-01

    NASA's Marshall Space Flight Center (MSFC) has developed an integrated systems engineering approach to promote a culture of tailoring for program and project policy requirements. MSFC's culture encourages and supports tailoring, with an emphasis on risk-based decision making, for enhanced affordability and efficiency. MSFC's policy structure integrates the various Agency requirements into a single, streamlined implementation approach which serves as a "one-stop-shop" for our programs and projects to follow. The engineers gain an enhanced understanding of policy and technical expectations, as well as lesson's learned from MSFC's history of spaceflight and science missions, to enable them to make appropriate, risk-based tailoring recommendations. The tailoring approach utilizes a standard methodology to classify projects into predefined levels using selected mission and programmatic scaling factors related to risk tolerance. Policy requirements are then selectively applied and tailored, with appropriate rationale, and approved by the governing authorities, to support risk-informed decisions to achieve the desired cost and schedule efficiencies. The policy is further augmented by implementation tools and lifecycle planning aids which help promote and support the cultural shift toward more tailoring. The MSFC Customization Tool is an integrated spreadsheet that ties together everything that projects need to understand, navigate, and tailor the policy. It helps them classify their project, understand the intent of the requirements, determine their tailoring approach, and document the necessary governance approvals. It also helps them plan for and conduct technical reviews throughout the lifecycle. Policy tailoring is thus established as a normal part of project execution, with the tools provided to facilitate and enable the tailoring process. MSFC's approach to changing the culture emphasizes risk-based tailoring of policy to achieve increased flexibility, efficiency

  15. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  16. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  17. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  18. The altered promoter methylation of oxytocin receptor gene in autism.

    Science.gov (United States)

    Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak

    Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.

  19. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  20. Combined protein construct and synthetic gene engineering for heterologous protein expression and crystallization using Gene Composer

    Directory of Open Access Journals (Sweden)

    Walchli John

    2009-04-01

    Full Text Available Abstract Background With the goal of improving yield and success rates of heterologous protein production for structural studies we have developed the database and algorithm software package Gene Composer. This freely available electronic tool facilitates the information-rich design of protein constructs and their engineered synthetic gene sequences, as detailed in the accompanying manuscript. Results In this report, we compare heterologous protein expression levels from native sequences to that of codon engineered synthetic gene constructs designed by Gene Composer. A test set of proteins including a human kinase (P38α, viral polymerase (HCV NS5B, and bacterial structural protein (FtsZ were expressed in both E. coli and a cell-free wheat germ translation system. We also compare the protein expression levels in E. coli for a set of 11 different proteins with greatly varied G:C content and codon bias. Conclusion The results consistently demonstrate that protein yields from codon engineered Gene Composer designs are as good as or better than those achieved from the synonymous native genes. Moreover, structure guided N- and C-terminal deletion constructs designed with the aid of Gene Composer can lead to greater success in gene to structure work as exemplified by the X-ray crystallographic structure determination of FtsZ from Bacillus subtilis. These results validate the Gene Composer algorithms, and suggest that using a combination of synthetic gene and protein construct engineering tools can improve the economics of gene to structure research.

  1. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  2. How Mockups, a Key Engineering Tool, Help to Promote Science, Technology, Engineering, and Mathematics Education

    Science.gov (United States)

    McDonald, Harry E.

    2010-01-01

    The United States ranking among the world in science, technology, engineering, and mathematics (STEM) education is decreasing. To counteract this problem NASA has made it part of its mission to promote STEM education among the nation s youth. Mockups can serve as a great tool when promoting STEM education in America. The Orion Cockpit Working Group has created a new program called Students Shaping America s Next Space Craft (SSANS) to outfit the Medium Fidelity Orion Mockup. SSANS will challenge the students to come up with unique designs to represent the flight design hardware. There are two main types of project packages created by SSANS, those for high school students and those for university students. The high school projects will challenge wood shop, metal shop and pre-engineering classes. The university projects are created mainly for senior design projects and will require the students to perform finite element analysis. These projects will also challenge the undergraduate students in material selection and safety requirements. The SSANS program will help NASA in its mission to promote STEM education, and will help to shape our nations youth into the next generation of STEM leaders.

  3. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Victoria Gonzalo

    Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant

  4. Promoter Methylation Analysis of IDH Genes in Human Gliomas

    International Nuclear Information System (INIS)

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  5. Engineering of synthetic, stress-responsive yeast promoters

    DEFF Research Database (Denmark)

    Rajkumar, Arun Stephen; Liu, Guodong; Bergenholm, David

    2016-01-01

    Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducibleby specific endogenous or environmental conditions...

  6. Gene composer: database software for protein construct design, codon engineering, and gene synthesis.

    Science.gov (United States)

    Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

    2009-04-21

    To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease

  7. Gene Composer: database software for protein construct design, codon engineering, and gene synthesis

    Directory of Open Access Journals (Sweden)

    Mixon Mark

    2009-04-01

    Full Text Available Abstract Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene

  8. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    Science.gov (United States)

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  9. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  10. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    Science.gov (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  11. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.

  12. Physical non-viral gene delivery methods for tissue engineering

    Science.gov (United States)

    Mellott, Adam J.; Forrest, M. Laird; Detamore, Michael S.

    2016-01-01

    The integration of gene therapy into tissue engineering to control differentiation and direct tissue formation is not a new concept; however, successful delivery of nucleic acids into primary cells, progenitor cells, and stem cells has proven exceptionally challenging. Viral vectors are generally highly effective at delivering nucleic acids to a variety of cell populations, both dividing and non-dividing, yet these viral vectors are marred by significant safety concerns. Non-viral vectors are preferred for gene therapy, despite lower transfection efficiencies, and possess many customizable attributes that are desirable for tissue engineering applications. However, there is no single non-viral gene delivery strategy that “fits-all” cell types and tissues. Thus, there is a compelling opportunity to examine different non-viral vectors, especially physical vectors, and compare their relative degrees of success. This review examines the advantages and disadvantages of physical non-viral methods (i.e., microinjection, ballistic gene delivery, electroporation, sonoporation, laser irradiation, magnetofection, and electric field-induced molecular vibration), with particular attention given to electroporation because of its versatility, with further special emphasis on Nucleofection™. In addition, attributes of cellular character that can be used to improve differentiation strategies are examined for tissue engineering applications. Ultimately, electroporation exhibits a high transfection efficiency in many cell types, which is highly desirable for tissue engineering applications, but electroporation and other physical non-viral gene delivery methods are still limited by poor cell viability. Overcoming the challenge of poor cell viability in highly efficient physical non-viral techniques is the key to using gene delivery to enhance tissue engineering applications. PMID:23099792

  13. Physical non-viral gene delivery methods for tissue engineering.

    Science.gov (United States)

    Mellott, Adam J; Forrest, M Laird; Detamore, Michael S

    2013-03-01

    The integration of gene therapy into tissue engineering to control differentiation and direct tissue formation is not a new concept; however, successful delivery of nucleic acids into primary cells, progenitor cells, and stem cells has proven exceptionally challenging. Viral vectors are generally highly effective at delivering nucleic acids to a variety of cell populations, both dividing and non-dividing, yet these viral vectors are marred by significant safety concerns. Non-viral vectors are preferred for gene therapy, despite lower transfection efficiencies, and possess many customizable attributes that are desirable for tissue engineering applications. However, there is no single non-viral gene delivery strategy that "fits-all" cell types and tissues. Thus, there is a compelling opportunity to examine different non-viral vectors, especially physical vectors, and compare their relative degrees of success. This review examines the advantages and disadvantages of physical non-viral methods (i.e., microinjection, ballistic gene delivery, electroporation, sonoporation, laser irradiation, magnetofection, and electric field-induced molecular vibration), with particular attention given to electroporation because of its versatility, with further special emphasis on Nucleofection™. In addition, attributes of cellular character that can be used to improve differentiation strategies are examined for tissue engineering applications. Ultimately, electroporation exhibits a high transfection efficiency in many cell types, which is highly desirable for tissue engineering applications, but electroporation and other physical non-viral gene delivery methods are still limited by poor cell viability. Overcoming the challenge of poor cell viability in highly efficient physical non-viral techniques is the key to using gene delivery to enhance tissue engineering applications.

  14. Effects of gene orientation and use of multiple promoters on the expression of XYL1 and XYL2 in Saccharomyces cerevisiae

    Science.gov (United States)

    Ju Yun Bae; Jose Laplaza; Thomas W. Jeffries

    2008-01-01

    Orientation of adjacent genes has been reported to affect their expression in eukaryotic systems, and metabolic engineering also often makes repeated use of a few promoters to obtain high expression. To improve transcriptional control in heterologous expression, we examined how these factors affect gene expression and enzymatic activity in Saccharomyces cerevisiae. We...

  15. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Engineered CRISPR Systems for Next Generation Gene Therapies.

    Science.gov (United States)

    Pineda, Michael; Moghadam, Farzaneh; Ebrahimkhani, Mo R; Kiani, Samira

    2017-09-15

    An ideal in vivo gene therapy platform provides safe, reprogrammable, and precise strategies which modulate cell and tissue gene regulatory networks with a high temporal and spatial resolution. Clustered regularly interspaced short palindromic repeats (CRISPR), a bacterial adoptive immune system, and its CRISPR-associated protein 9 (Cas9), have gained attention for the ability to target and modify DNA sequences on demand with unprecedented flexibility and precision. The precision and programmability of Cas9 is derived from its complexation with a guide-RNA (gRNA) that is complementary to a desired genomic sequence. CRISPR systems open-up widespread applications including genetic disease modeling, functional screens, and synthetic gene regulation. The plausibility of in vivo genetic engineering using CRISPR has garnered significant traction as a next generation in vivo therapeutic. However, there are hurdles that need to be addressed before CRISPR-based strategies are fully implemented. Some key issues center on the controllability of the CRISPR platform, including minimizing genomic-off target effects and maximizing in vivo gene editing efficiency, in vivo cellular delivery, and spatial-temporal regulation. The modifiable components of CRISPR systems: Cas9 protein, gRNA, delivery platform, and the form of CRISPR system delivered (DNA, RNA, or ribonucleoprotein) have recently been engineered independently to design a better genome engineering toolbox. This review focuses on evaluating CRISPR potential as a next generation in vivo gene therapy platform and discusses bioengineering advancements that can address challenges associated with clinical translation of this emerging technology.

  17. Engineering liposomal nanoparticles for targeted gene therapy.

    Science.gov (United States)

    Zylberberg, C; Gaskill, K; Pasley, S; Matosevic, S

    2017-08-01

    Recent mechanistic studies have attempted to deepen our understanding of the process by which liposome-mediated delivery of genetic material occurs. Understanding the interactions between lipid nanoparticles and cells is still largely elusive. Liposome-mediated delivery of genetic material faces systemic obstacles alongside entry into the cell, endosomal escape, lysosomal degradation and nuclear uptake. Rational design approaches for targeted delivery have been developed to reduce off-target effects and enhance transfection. These strategies, which have included the modification of lipid nanoparticles with target-specific ligands to enhance intracellular uptake, have shown significant promise at the proof-of-concept stage. Control of physical and chemical specifications of liposome composition, which includes lipid-to-DNA charge, size, presence of ester bonds, chain length and nature of ligand complexation, is integral to the performance of targeted liposomes as genetic delivery agents. Clinical advances are expected to rely on such systems in the therapeutic application of liposome nanoparticle-based gene therapy. Here, we discuss the latest breakthroughs in the development of targeted liposome-based agents for the delivery of genetic material, paying particular attention to new ligand and cationic lipid design as well as recent in vivo advances.

  18. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  19. Modularization of genetic elements promotes synthetic metabolic engineering.

    Science.gov (United States)

    Qi, Hao; Li, Bing-Zhi; Zhang, Wen-Qian; Liu, Duo; Yuan, Ying-Jin

    2015-11-15

    In the context of emerging synthetic biology, metabolic engineering is moving to the next stage powered by new technologies. Systematical modularization of genetic elements makes it more convenient to engineer biological systems for chemical production or other desired purposes. In the past few years, progresses were made in engineering metabolic pathway using synthetic biology tools. Here, we spotlighted the topic of implementation of modularized genetic elements in metabolic engineering. First, we overviewed the principle developed for modularizing genetic elements and then discussed how the genetic modules advanced metabolic engineering studies. Next, we picked up some milestones of engineered metabolic pathway achieved in the past few years. Last, we discussed the rapid raised synthetic biology field of "building a genome" and the potential in metabolic engineering. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Chitosan for gene delivery and orthopedic tissue engineering applications.

    Science.gov (United States)

    Raftery, Rosanne; O'Brien, Fergal J; Cryan, Sally-Ann

    2013-05-15

    Gene therapy involves the introduction of foreign genetic material into cells in order exert a therapeutic effect. The application of gene therapy to the field of orthopaedic tissue engineering is extremely promising as the controlled release of therapeutic proteins such as bone morphogenetic proteins have been shown to stimulate bone repair. However, there are a number of drawbacks associated with viral and synthetic non-viral gene delivery approaches. One natural polymer which has generated interest as a gene delivery vector is chitosan. Chitosan is biodegradable, biocompatible and non-toxic. Much of the appeal of chitosan is due to the presence of primary amine groups in its repeating units which become protonated in acidic conditions. This property makes it a promising candidate for non-viral gene delivery. Chitosan-based vectors have been shown to transfect a number of cell types including human embryonic kidney cells (HEK293) and human cervical cancer cells (HeLa). Aside from its use in gene delivery, chitosan possesses a range of properties that show promise in tissue engineering applications; it is biodegradable, biocompatible, has anti-bacterial activity, and, its cationic nature allows for electrostatic interaction with glycosaminoglycans and other proteoglycans. It can be used to make nano- and microparticles, sponges, gels, membranes and porous scaffolds. Chitosan has also been shown to enhance mineral deposition during osteogenic differentiation of MSCs in vitro. The purpose of this review is to critically discuss the use of chitosan as a gene delivery vector with emphasis on its application in orthopedic tissue engineering.

  1. Dynamic gene expression for metabolic engineering of mammalian cells in culture.

    Science.gov (United States)

    Le, Huong; Vishwanathan, Nandita; Kantardjieff, Anne; Doo, Inseok; Srienc, Michael; Zheng, Xiaolu; Somia, Nikunj; Hu, Wei-Shou

    2013-11-01

    Recombinant mammalian cells are the major hosts for the production of protein therapeutics. In addition to high expression of the product gene, a hyper-producer must also harbor superior phenotypic traits related to metabolism, protein secretion, and growth control. Introduction of genes endowing the relevant hyper-productivity traits is a strategy frequently used to enhance the productivity. Most of such cell engineering efforts have been performed using constitutive expression systems. However, cells respond to various environmental cues and cellular events dynamically according to cellular needs. The use of inducible systems allows for time dependent expression, but requires external manipulation. Ideally, a transgene's expression should be synchronous to the host cell's own rhythm, and at levels appropriate for the objective. To that end, we identified genes with different expression dynamics and intensity ranges using pooled transcriptome data. Their promoters may be used to drive the expression of the transgenes following the desired dynamics. We isolated the promoter of the Thioredoxin-interacting protein (Txnip) gene and demonstrated its capability to drive transgene expression in concert with cell growth. We further employed this Chinese hamster promoter to engineer dynamic expression of the mouse GLUT5 fructose transporter in Chinese hamster ovary (CHO) cells, enabling them to utilize sugar according to cellular needs rather than in excess as typically seen in culture. Thus, less lactate was produced, resulting in a better growth rate, prolonged culture duration, and higher product titer. This approach illustrates a novel concept in metabolic engineering which can potentially be used to achieve dynamic control of cellular behaviors for enhanced process characteristics. © 2013 Published by Elsevier Inc.

  2. Tissue-Engineered Skeletal Muscle Organoids for Reversible Gene Therapy

    Science.gov (United States)

    Vandenburgh, Herman; DelTatto, Michael; Shansky, Janet; Lemaire, Julie; Chang, Albert; Payumo, Francis; Lee, Peter; Goodyear, Amy; Raven, Latasha

    1996-01-01

    Genetically modified murine skeletal myoblasts were tissue engineered in vitro into organ-like structures (organoids) containing only postmitotic myofibers secreting pharmacological levels of recombinant human growth hormone (rhGH). Subcutaneous organoid Implantation under tension led to the rapid and stable appearance of physiological sera levels of rhGH for up to 12 weeks, whereas surgical removal led to its rapid disappearance. Reversible delivery of bioactive compounds from postimtotic cells in tissue engineered organs has several advantages over other forms of muscle gene therapy.

  3. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Science.gov (United States)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  4. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  5. Engineering adeno-associated viruses for clinical gene therapy.

    Science.gov (United States)

    Kotterman, Melissa A; Schaffer, David V

    2014-07-01

    Clinical gene therapy has been increasingly successful owing both to an enhanced molecular understanding of human disease and to progressively improving gene delivery technologies. Among these technologies, delivery vectors based on adeno-associated viruses (AAVs) have emerged as safe and effective and, in one recent case, have led to regulatory approval. Although shortcomings in viral vector properties will render extension of such successes to many other human diseases challenging, new approaches to engineer and improve AAV vectors and their genetic cargo are increasingly helping to overcome these barriers.

  6. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  7. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  8. Engineered nonviral nanocarriers for intracellular gene delivery applications

    International Nuclear Information System (INIS)

    Ojea-Jiménez, Isaac; Puntes, Victor F; Tort, Olivia; Lorenzo, Julia

    2012-01-01

    The efficient delivery of nucleic acids into mammalian cells is a central aspect of cell biology and of medical applications, including cancer therapy and tissue engineering. Non-viral chemical methods have been received with great interest for transfecting cells. However, further development of nanocarriers that are biocompatible, efficient and suitable for clinical applications is still required. In this paper, the different material platforms for gene delivery are comparatively addressed, and the mechanisms of interaction with biological systems are discussed carefully. (paper)

  9. Conditions for success of engineered underdominance gene drive systems.

    Science.gov (United States)

    Edgington, Matthew P; Alphey, Luke S

    2017-10-07

    Engineered underdominance is one of a number of different gene drive strategies that have been proposed for the genetic control of insect vectors of disease. Here we model a two-locus engineered underdominance based gene drive system that is based on the concept of mutually suppressing lethals. In such a system two genetic constructs are introduced, each possessing a lethal element and a suppressor of the lethal at the other locus. Specifically, we formulate and analyse a population genetics model of this system to assess when different combinations of release strategies (i.e. single or multiple releases of both sexes or males only) and genetic systems (i.e. bisex lethal or female-specific lethal elements and different strengths of suppressors) will give population replacement or fail to do so. We anticipate that results presented here will inform the future design of engineered underdominance gene drive systems as well as providing a point of reference regarding release strategies for those looking to test such a system. Our discussion is framed in the context of genetic control of insect vectors of disease. One of several serious threats in this context are Aedes aegypti mosquitoes as they are the primary vectors of dengue viruses. However, results are also applicable to Ae. aegypti as vectors of Zika, yellow fever and chikungunya viruses and also to the control of a number of other insect species and thereby of insect-vectored pathogens. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. A gene network simulator to assess reverse engineering algorithms.

    Science.gov (United States)

    Di Camillo, Barbara; Toffolo, Gianna; Cobelli, Claudio

    2009-03-01

    In the context of reverse engineering of biological networks, simulators are helpful to test and compare the accuracy of different reverse-engineering approaches in a variety of experimental conditions. A novel gene-network simulator is presented that resembles some of the main features of transcriptional regulatory networks related to topology, interaction among regulators of transcription, and expression dynamics. The simulator generates network topology according to the current knowledge of biological network organization, including scale-free distribution of the connectivity and clustering coefficient independent of the number of nodes in the network. It uses fuzzy logic to represent interactions among the regulators of each gene, integrated with differential equations to generate continuous data, comparable to real data for variety and dynamic complexity. Finally, the simulator accounts for saturation in the response to regulation and transcription activation thresholds and shows robustness to perturbations. It therefore provides a reliable and versatile test bed for reverse engineering algorithms applied to microarray data. Since the simulator describes regulatory interactions and expression dynamics as two distinct, although interconnected aspects of regulation, it can also be used to test reverse engineering approaches that use both microarray and protein-protein interaction data in the process of learning. A first software release is available at http://www.dei.unipd.it/~dicamill/software/netsim as an R programming language package.

  11. Fine tuning of the lactate and diacetyl production through promoter engineering in Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Tingting Guo

    Full Text Available Lactococcus lactis is a well-studied bacterium widely used in dairy fermentation and capable of producing metabolites with organoleptic and nutritional characteristics. For fine tuning of the distribution of glycolytic flux at the pyruvate branch from lactate to diacetyl and balancing the production of the two metabolites under aerobic conditions, a constitutive promoter library was constructed by randomizing the promoter sequence of the H(2O-forming NADH oxidase gene in L. lactis. The library consisted of 30 promoters covering a wide range of activities from 7,000 to 380,000 relative fluorescence units using a green fluorescent protein as reporter. Eleven typical promoters of the library were selected for the constitutive expression of the H(2O-forming NADH oxidase gene in L. lactis, and the NADH oxidase activity increased from 9.43 to 58.17-fold of the wild-type strain in small steps of activity change under aerobic conditions. Meanwhile, the lactate yield decreased from 21.15 ± 0.08 mM to 9.94 ± 0.07 mM, and the corresponding diacetyl production increased from 1.07 ± 0.03 mM to 4.16 ± 0.06 mM with the intracellular NADH/NAD(+ ratios varying from 0.711 ± 0.005 to 0.383 ± 0.003. The results indicated that the reduced pyruvate to lactate flux was rerouted to the diacetyl with an almost linear flux variation via altered NADH/NAD(+ ratios. Therefore, we provided a novel strategy to precisely control the pyruvate distribution for fine tuning of the lactate and diacetyl production through promoter engineering in L. lactis. Interestingly, the increased H(2O-forming NADH oxidase activity led to 76.95% lower H(2O(2 concentration in the recombinant strain than that of the wild-type strain after 24 h of aerated cultivation. The viable cells were significantly elevated by four orders of magnitude within 28 days of storage at 4°C, suggesting that the increased enzyme activity could eliminate H(2O(2 accumulation and prolong cell survival.

  12. Altered gene-expression profile in rat plasma and promoted body ...

    African Journals Online (AJOL)

    Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...

  13. Instructional design considerations promoting engineering design self-efficacy

    Science.gov (United States)

    Jackson, Andrew M.

    Engineering design activities are frequently included in technology and engineering classrooms. These activities provide an open-ended context for practicing critical thinking, problem solving, creativity, and innovation---collectively part of the 21st Century Skills which are increasingly needed for success in the workplace. Self-efficacy is a perceptual belief that impacts learning and behavior. It has been shown to directly impact each of these 21st Century Skills but its relation to engineering design is only recently being studied. The purpose of this study was to examine how instructional considerations made when implementing engineering design activities might affect student self-efficacy outcomes in a middle school engineering classroom. Student responses to two self-efficacy inventories related to design, the Engineering Design Self-Efficacy Instrument and Creative Thinking Self-Efficacy Inventory, were collected before and after participation in an engineering design curriculum. Students were also answered questions on specific factors of their experience during the curriculum which teachers may exhibit control over: teamwork and feedback. Results were analyzed using Pearson's correlation coefficients, paired and independent t-tests, and structural equation modeling to better understand patterns for self-efficacy beliefs in students. Results suggested that design self-efficacy and creative thinking self-efficacy are significantly correlated, r(1541) = .783, p classroom strategies for increasing self-efficacy and given specific recommendations related to teamwork and feedback to support students. Finally, although there were weaknesses in the study related to the survey administration, future research opportunities are presented which may build from this work.

  14. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  15. Design and engineering of intracellular-metabolite-sensing/regulation gene circuits in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Meng; Li, Sijin; Zhao, Huimin

    2016-01-01

    The development of high-throughput phenotyping tools is lagging far behind the rapid advances of genotype generation methods. To bridge this gap, we report a new strategy for design, construction, and fine-tuning of intracellular-metabolite-sensing/regulation gene circuits by repurposing bacterial transcription factors and eukaryotic promoters. As proof of concept, we systematically investigated the design and engineering of bacterial repressor-based xylose-sensing/regulation gene circuits in Saccharomyces cerevisiae. We demonstrated that numerous properties, such as induction ratio and dose-response curve, can be fine-tuned at three different nodes, including repressor expression level, operator position, and operator sequence. By applying these gene circuits, we developed a cell sorting based, rapid and robust high-throughput screening method for xylose transporter engineering and obtained a sugar transporter HXT14 mutant with 6.5-fold improvement in xylose transportation capacity. This strategy should be generally applicable and highly useful for evolutionary engineering of proteins, pathways, and genomes in S. cerevisiae. © 2015 Wiley Periodicals, Inc.

  16. Promoting Collaborative Problem-Solving Skills in a Course on Engineering Grand Challenges

    Science.gov (United States)

    Zou, Tracy X. P.; Mickleborough, Neil C.

    2015-01-01

    The ability to solve problems with people of diverse backgrounds is essential for engineering graduates. A course on engineering grand challenges was designed to promote collaborative problem-solving (CPS) skills. One unique component is that students need to work both within their own team and collaborate with the other team to tackle engineering…

  17. ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

    Directory of Open Access Journals (Sweden)

    O. I. Kit

    2016-01-01

    Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

  18. Expression of Nanog gene promotes NIH3T3 cell proliferation

    International Nuclear Information System (INIS)

    Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu

    2005-01-01

    Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion

  19. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jacob Daniela

    2005-06-01

    Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  20. Gender salary and promotion gaps in Japanese academia: Results from science and engineering

    OpenAIRE

    Ana Maria Takahashi; Shingo Takahashi; Thomas Maloney

    2015-01-01

    Using original survey data on Japanese academics in science and engineering, we examined the gender salary and promotion gaps. We found a 6\\% gender salary gap after controlling for ranks. This gap was unaffected when quality and quantity of publications were controlled for. In contrast, promotion gap disappeared when publication variables were controlled for. We failed to find negative effects of marriage and children on women's salary and promotion, though a positive sorting into motherhood...

  1. Gender salary and promotion gaps in Japanese academia: Results from science and engineering

    OpenAIRE

    Takahashi, Ana Maria; 高橋, 新吾; Maloney, Thomas

    2015-01-01

    Using original survey data on Japanese academics in science and engineering, we examined the gender salary and promotion gaps. We found a 6% gender salary gap after controlling for ranks. This gap was unaffected when quality and quantity of publications were controlled for. In contrast, promotion gap disappeared when publication variables were controlled for. We failed to find negative effects of marriage and children on women's salary and promotion, though a positive sorting into motherhood ...

  2. * Three-Dimensional Bioprinting of Polycaprolactone Reinforced Gene Activated Bioinks for Bone Tissue Engineering.

    Science.gov (United States)

    Cunniffe, Gráinne M; Gonzalez-Fernandez, Tomas; Daly, Andrew; Sathy, Binulal N; Jeon, Oju; Alsberg, Eben; Kelly, Daniel J

    2017-09-01

    Regeneration of complex bone defects remains a significant clinical challenge. Multi-tool biofabrication has permitted the combination of various biomaterials to create multifaceted composites with tailorable mechanical properties and spatially controlled biological function. In this study we sought to use bioprinting to engineer nonviral gene activated constructs reinforced by polymeric micro-filaments. A gene activated bioink was developed using RGD-γ-irradiated alginate and nano-hydroxyapatite (nHA) complexed to plasmid DNA (pDNA). This ink was combined with bone marrow-derived mesenchymal stem cells (MSCs) and then co-printed with a polycaprolactone supporting mesh to provide mechanical stability to the construct. Reporter genes were first used to demonstrate successful cell transfection using this system, with sustained expression of the transgene detected over 14 days postbioprinting. Delivery of a combination of therapeutic genes encoding for bone morphogenic protein and transforming growth factor promoted robust osteogenesis of encapsulated MSCs in vitro, with enhanced levels of matrix deposition and mineralization observed following the incorporation of therapeutic pDNA. Gene activated MSC-laden constructs were then implanted subcutaneously, directly postfabrication, and were found to support superior levels of vascularization and mineralization compared to cell-free controls. These results validate the use of a gene activated bioink to impart biological functionality to three-dimensional bioprinted constructs.

  3. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

  4. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  6. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Directory of Open Access Journals (Sweden)

    Jianqing Pan

    Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  7. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  8. Engineering Poly(ethylene glycol) Materials to Promote Cardiogenesis

    Science.gov (United States)

    Smith, Amanda Walker

    Heart failure is one of the leading causes of death worldwide, and the current costs of treatment put a significant economic burden on our societies. After an infarction, fibrotic tissue begins to form as part of the heart failure cascade. Current options to slow this process include a wide range of pharmaceutical agents, and ultimately the patient may require a heart transplant. Innovative treatment approaches are needed to bring down costs and improve quality of life. The possibility of regenerating or replacing damaged tissue with healthy cardiomyocytes is generating considerable excitement, but there are still many obstacles to overcome. First, while cell injections into the myocardium have demonstrated slight improvements in cardiac function, the actual engraftment of transplanted cells is very low. It is anticipated that improving engraftment will boost outcomes. Second, cellular differentiation and reprogramming protocols have not yet produced cells that are identical to adult cardiomyocytes, and immunogenicity continues to be a problem despite the advent of autologously derived induced pluripotent stem cells. This dissertation will explore biomaterials approaches to addressing these two obstacles. Tissue engineering scaffolds may improve cell engraftment by providing bioactive factors, preventing cell anoikis, and reducing cell washout by blood flow. Poly(ethylene glycol) (PEG) is often used as a coating to reduce implant rejection because it is highly resistant to protein adsorption. Because fibrosis of a material in contact with the myocardium could cause arrhythmias, PEG materials are highly relevant for cardiac tissue engineering applications. In Chapter 2, we describe a novel method for crosslinking PEG microspheres around cells to form a scaffold for tissue engineering. We then demonstrate that HL-1 cardiomyocyte viability and phenotype are retained throughout the fabrication process and during the first 7 weeks of culture. In the third chapter of the

  9. The progress of tumor gene-radiotherapy induced by Egr-1 promoter

    International Nuclear Information System (INIS)

    Guo Rui; Li Biao

    2010-01-01

    The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)

  10. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  11. Seed-specific increased expression of 2S albumin promoter of sesame qualifies it as a useful genetic tool for fatty acid metabolic engineering and related transgenic intervention in sesame and other oil seed crops.

    Science.gov (United States)

    Bhunia, Rupam Kumar; Chakraborty, Anirban; Kaur, Ranjeet; Gayatri, T; Bhattacharyya, Jagannath; Basu, Asitava; Maiti, Mrinal K; Sen, Soumitra Kumar

    2014-11-01

    The sesame 2S albumin (2Salb) promoter was evaluated for its capacity to express the reporter gusA gene encoding β-glucuronidase in transgenic tobacco seeds relative to the soybean fad3C gene promoter element. Results revealed increased expression of gusA gene in tobacco seed tissue when driven by sesame 2S albumin promoter. Prediction based deletion analysis of both the promoter elements confirmed the necessary cis-acting regulatory elements as well as the minimal promoter element for optimal expression in each case. The results also revealed that cis-regulatory elements might have been responsible for high level expression as well as spatio-temporal regulation of the sesame 2S albumin promoter. Transgenic over-expression of a fatty acid desaturase (fad3C) gene of soybean driven by 2S albumin promoter resulted in seed-specific enhanced level of α-linolenic acid in sesame. The present study, for the first time helped to identify that the sesame 2S albumin promoter is a promising endogenous genetic element in genetic engineering approaches requiring spatio-temporal regulation of gene(s) of interest in sesame and can also be useful as a heterologous genetic element in other important oil seed crop plants in general for which seed oil is the harvested product. The study also established the feasibility of fatty acid metabolic engineering strategy undertaken to improve quality of edible seed oil in sesame using the 2S albumin promoter as regulatory element.

  12. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  13. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  14. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    2014-12-23

    Dec 23, 2014 ... antimalarial drugs from plants that were used in traditional. Chinese medicine ...... ogy of eukaryotic promoter prediction-a review. Comput. Chem. ... Main J. J. 2006 Antiviral effect of artemisinin from Artemisia annua against a ...

  15. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering.

    Science.gov (United States)

    Niu, Zhixia; Klindworth, Daryl L; Friesen, Timothy L; Chao, Shiaoman; Jin, Yue; Cai, Xiwen; Xu, Steven S

    2011-04-01

    Chromosome engineering is a useful strategy for transfer of alien genes from wild relatives into modern crops. However, this strategy has not been extensively used for alien gene introgression in most crops due to low efficiency of conventional cytogenetic techniques. Here, we report an improved scheme of chromosome engineering for efficient elimination of a large amount of goatgrass (Aegilops speltoides) chromatin surrounding Sr39, a gene that provides resistance to multiple stem rust races, including Ug99 (TTKSK) in wheat. The wheat ph1b mutation, which promotes meiotic pairing between homoeologous chromosomes, was employed to induce recombination between wheat chromosome 2B and goatgrass 2S chromatin using a backcross scheme favorable for inducing and detecting the homoeologous recombinants with small goatgrass chromosome segments. Forty recombinants with Sr39 with reduced surrounding goatgrass chromatin were quickly identified from 1048 backcross progenies through disease screening and molecular marker analysis. Four of the recombinants carrying Sr39 with a minimal amount of goatgrass chromatin (2.87-9.15% of the translocated chromosomes) were verified using genomic in situ hybridization. Approximately 97% of the goatgrass chromatin was eliminated in one of the recombinants, in which a tiny goatgrass chromosome segment containing Sr39 was retained in the wheat genome. Localization of the goatgrass chromatin in the recombinants led to rapid development of three molecular markers tightly linked to Sr39. The new wheat lines and markers provide useful resources for the ongoing global effort to combat Ug99. This study has demonstrated great potential of chromosome engineering in genome manipulation for plant improvement.

  16. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  17. [From gene cloning to expressional analysis--practice and experience from educational reform of experimental gene engineering].

    Science.gov (United States)

    Wu, Yan-Hua; Guo, Bin; Lou, Hui-Ling; Cui, Yu-Liang; Gu, Hui-Juan; Qiao, Shou-Yi

    2012-02-01

    Experimental gene engineering is a laboratory course focusing on the molecular structure, expression pattern and biological function of genes. Providing our students with a solid knowledge base and correct ways to conduct research is very important for high-quality education of genetic engineering. Inspired by recent progresses in this field, we improved the experimental gene engineering course by adding more updated knowledge and technologies and emphasizing on the combination of teaching and research, with the aim of offering our students a good start in their scientific careers.

  18. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DEFF Research Database (Denmark)

    Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather

    2018-01-01

    regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....

  19. Transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans

    CSIR Research Space (South Africa)

    Crampton, Michael C

    2010-07-01

    Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...

  20. Suicide Gene-Engineered Stromal Cells Reveal a Dynamic Regulation of Cancer Metastasis

    Science.gov (United States)

    Shen, Keyue; Luk, Samantha; Elman, Jessica; Murray, Ryan; Mukundan, Shilpaa; Parekkadan, Biju

    2016-02-01

    Cancer-associated fibroblasts (CAFs) are a major cancer-promoting component in the tumor microenvironment (TME). The dynamic role of human CAFs in cancer progression has been ill-defined because human CAFs lack a unique marker needed for a cell-specific, promoter-driven knockout model. Here, we developed an engineered human CAF cell line with an inducible suicide gene to enable selective in vivo elimination of human CAFs at different stages of xenograft tumor development, effectively circumventing the challenge of targeting a cell-specific marker. Suicide-engineered CAFs were highly sensitive to apoptosis induction in vitro and in vivo by the addition of a simple small molecule inducer. Selection of timepoints for targeted CAF apoptosis in vivo during the progression of a human breast cancer xenograft model was guided by a bi-phasic host cytokine response that peaked at early timepoints after tumor implantation. Remarkably, we observed that the selective apoptosis of CAFs at these early timepoints did not affect primary tumor growth, but instead increased the presence of tumor-associated macrophages and the metastatic spread of breast cancer cells to the lung and bone. The study revealed a dynamic relationship between CAFs and cancer metastasis that has counter-intuitive ramifications for CAF-targeted therapy.

  1. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  2. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  3. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  4. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  5. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  6. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  7. Genetically engineered Rice with transcription factor DREB genes for abiotic stress tolerance(abstract)

    International Nuclear Information System (INIS)

    Datta, S.K.; Datta, K.

    2005-01-01

    Water stress (drought and Salinity) is the most severe limitation to rice productivity. Several breeding approaches (MAS, QTL) applied to suitable genotypes are in place at IRRI and elsewhere. Phenotyping of water stress tolerance is in progress with potential predictability. Dr. Shinozaki's group has cloned a number of transcription factor genes, which have been shown to work in Arabidopsis to achieve drought, cold, and salinity tolerant plants. None of these genes have as yet displayed their potential functioning in rice. Genetic engineering aims at cross talk between different stress signaling pathways leading to stress tolerance. Osmotic Adjustment (OA) is an effective component of abiotic stress (drought and salinity) tolerance in many plants including rice. When plant experiences water stress, OA contributes to turgor maintenance of both shoots and roots. Conventional breeding could not achieve the OA in rice excepting a few rice cultivars, which are partially adapted to water-stress conditions. Several stress-related genes have now been cloned and transferred in to enhance the osmolytes and some transgenic lines showed increased tolerance to osmotic stress. A few strategies could be effectively deployed for a better understanding of water-stress tolerance in rice and to develop transgenic rice, which can survive for a critical period of water-stress conditions: 1) Switching on of transcription factor regulating the expression of several genes related to abiotic stress, 2) Use of a suitable stress inducible promoter driving the target gene for an efficient and directed expression in plants, 3) Understanding of phenotyping and GxE in a given environment, 4) Selection of a few adaptive rice cultivars suitable in drought/salinity prone areas, 5) Microarray, proteomics, QTL and MAS may expedite the cloning and characterizing the stress induced genes, and 6) Finally, the efficient transformation system for generating a large number of transgenic rice of different

  8. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  9. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  10. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    Directory of Open Access Journals (Sweden)

    Andrea Degl'Innocenti

    Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings

  11. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  12. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  13. Computational design and application of endogenous promoters for transcriptionally targeted gene therapy for rheumatoid arthritis.

    NARCIS (Netherlands)

    Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de

    2009-01-01

    The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define

  14. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  15. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  16. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    ... were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5′-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.

  17. Overexpression and cosuppression of xylem-related genes in an early xylem differentiation stage-specific manner by the AtTED4 promoter.

    Science.gov (United States)

    Endo, Satoshi; Iwamoto, Kuninori; Fukuda, Hiroo

    2018-02-01

    Tissue-specific overexpression of useful genes, which we can design according to their cause-and-effect relationships, often gives valuable gain-of-function phenotypes. To develop genetic tools in woody biomass engineering, we produced a collection of Arabidopsis lines that possess chimeric genes of a promoter of an early xylem differentiation stage-specific gene, Arabidopsis Tracheary Element Differentiation-related 4 (AtTED4) and late xylem development-associated genes, many of which are uncharacterized. The AtTED4 promoter directed the expected expression of transgenes in developing vascular tissues from young to mature stage. Of T2 lines examined, 42%, 49% and 9% were judged as lines with the nonrepeat type insertion, the simple repeat type insertion and the other repeat type insertion of transgenes. In 174 T3 lines, overexpression lines were confirmed for 37 genes, whereas only cosuppression lines were produced for eight genes. The AtTED4 promoter activity was high enough to overexpress a wide range of genes over wild-type expression levels, even though the wild-type expression is much higher than AtTED4 expression for several genes. As a typical example, we investigated phenotypes of pAtTED4::At5g60490 plants, in which both overexpression and cosuppression lines were included. Overexpression but not cosuppression lines showed accelerated xylem development, suggesting the positive role of At5g60490 in xylem development. Taken together, this study provides valuable results about behaviours of various genes expressed under an early xylem-specific promoter and about usefulness of their lines as genetic tools in woody biomass engineering. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. A cII-dependent promoter is located within the Q gene of bacteriophage lambda.

    OpenAIRE

    Hoopes, B C; McClure, W R

    1985-01-01

    We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...

  19. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  20. To promote the engineering innovative abilities of undergraduates by taking projects as the guidance and competitions as the promotion

    Science.gov (United States)

    Xu, Yishen; Wu, Di; Chen, Daqing; Gu, Jihua; Gao, Lei

    2017-08-01

    According to the inherent requirements of education for talents' knowledge, quality and comprehensive ability and the major training goals of optoelectronics information science and engineering, in order to enhance the undergraduates' comprehensive practical ability and consciousness of innovation, we carried out the reforms of teaching method and teaching mode, which took the training programs of innovation and entrepreneurship for undergraduates, extracurricular academic research fund, "Chun-Tsung Scholar" program or research projects of their tutors as the guidance, and took the all levels of relevant discipline competitions as the promotion. And the training mainline of engineering innovation talents as "undergraduate's tutorial system ->innovative training program or tutor's research project ->academic competition ->graduation projects (thesis)" was constructed stage by stage by combining the undergraduates' graduation projects and their participated academic competition into one for improving the quality of the graduation projects (thesis). The practical results of the last several years illuminate that the proposed training model can effectively stimulate the students' awareness of autonomous learning, enhance their comprehensive ability of analyzing and solving problems and improve their ability of engineering practice and innovation as well as their teamwork spirit.

  1. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  2. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  3. Altered Levels of Aroma and Volatiles by Metabolic Engineering of Shikimate Pathway Genes in Tomato Fruits

    Directory of Open Access Journals (Sweden)

    Vered Tzin

    2015-06-01

    Full Text Available The tomato (Solanum lycopersicum fruit is an excellent source of antioxidants, dietary fibers, minerals and vitamins and therefore has been referred to as a “functional food”. Ripe tomato fruits produce a large number of specialized metabolites including volatile organic compounds. These volatiles serve as key components of the tomato fruit flavor, participate in plant pathogen and herbivore defense, and are used to attract seed dispersers. A major class of specialized metabolites is derived from the shikimate pathway followed by aromatic amino acid biosynthesis of phenylalanine, tyrosine and tryptophan. We attempted to modify tomato fruit flavor by overexpressing key regulatory genes in the shikimate pathway. Bacterial genes encoding feedback-insensitive variants of 3-Deoxy-D-Arabino-Heptulosonate 7-Phosphate Synthase (DAHPS; AroG209-9 and bi-functional Chorismate Mutase/Prephenate Dehydratase (CM/PDT; PheA12 were expressed under the control of a fruit-specific promoter. We crossed these transgenes to generate tomato plants expressing both the AroG209 and PheA12 genes. Overexpression of the AroG209-9 gene had a dramatic effect on the overall metabolic profile of the fruit, including enhanced levels of multiple volatile and non-volatile metabolites. In contrast, the PheA12 overexpression line exhibited minor metabolic effects compared to the wild type fruit. Co-expression of both the AroG209-9 and PheA12 genes in tomato resulted overall in a similar metabolic effect to that of expressing only the AroG209-9 gene. However, the aroma ranking attributes of the tomato fruits from PheA12//AroG209-9 were unique and different from those of the lines expressing a single gene, suggesting a contribution of the PheA12 gene to the overall metabolic profile. We suggest that expression of bacterial genes encoding feedback-insensitive enzymes of the shikimate pathway in tomato fruits provides a useful metabolic engineering tool for the modification of

  4. Research on the Mode of University-Enterprise Cooperation to Promote Engineering Students' Employment

    Science.gov (United States)

    Hui, Yan; Lihua, Sun

    2018-06-01

    The employment of university students has become a hot issue of concern to the whole society. Promoting the employment of university students is a top priority for higher education institutions. University-enterprise cooperation is an important trend in the development of modern higher education. It is also an important channel for promoting the employment of university students, especially for engineering students. Through an in-depth analysis of the status quo of employment of university graduates, this paper proposes four modes of university-enterprise cooperation to promote university graduates' employment: The post-employment cooperation model, the professional internship cooperation model, the second classroom expansion cooperation model and the enterprise-oriented recruitment model, and further proposed the countermeasures to strengthen the cooperation between university and enterprise in order to promote the employment of university students.

  5. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    Science.gov (United States)

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  6. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  7. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  8. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  9. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  10. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  11. Low-Dose Radiation Induces Genes Promoting Cell Survival

    International Nuclear Information System (INIS)

    Liu, Shu-Zheng; Chen, Dong; Mu, Ying

    1999-01-01

    Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

  12. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  13. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  14. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  15. Using Insights from Applied Moral Psychology to Promote Ethical Behavior Among Engineering Students and Professional Engineers.

    Science.gov (United States)

    Gelfand, Scott D

    2016-10-01

    In this essay I discuss a novel engineering ethics class that has the potential to significantly decrease the likelihood that students (and professionals) will inadvertently or unintentionally act unethically in the future. This class is different from standard engineering ethics classes in that it focuses on the issue of why people act unethically and how students (and professionals) can avoid a variety of hurdles to ethical behavior. I do not deny that it is important for students to develop cogent moral reasoning and ethical decision-making as taught in traditional college-level ethics classes, but as an educator, I aim to help students apply moral reasoning in specific, real-life situations so they are able to make ethical decisions and act ethically in their academic careers and after they graduate. Research in moral psychology provides evidence that many seemingly irrelevant situational factors affect the moral judgment of most moral agents and frequently lead agents to unintentionally or inadvertently act wrongly. I argue that, in addition to teaching college students moral reasoning and ethical decision-making, it is important to: 1. Teach students about psychological and situational factors that affect people's ethical judgments/behaviors in the sometimes stressful, emotion-laden environment of the workplace; 2. Guide students to engage in critical reflection about the sorts of situations they personally might find ethically challenging before they encounter those situations; and 3. Provide students with strategies to help them avoid future unethical behavior when they encounter these situations in school and in the workplace.

  16. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

    Science.gov (United States)

    Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

    2017-11-26

    Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

  17. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  18. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  19. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    Science.gov (United States)

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  20. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  1. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  2. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  3. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  4. Characterization of the distal promoter of the human pyruvate carboxylase gene in pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    Ansaya Thonpho

    Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.

  5. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  6. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  7. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  8. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    V Shilpa

    2014-01-01

    Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

  9. Generation of an efficient artificial promoter of bovine skeletal muscle α-actin gene (ACTA1) through addition of cis-acting element.

    Science.gov (United States)

    Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin

    2015-03-01

    The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.

  10. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  11. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  12. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  13. Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

    Science.gov (United States)

    Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J

    2018-05-01

    Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.

  14. Transfection of the IHH gene into rabbit BMSCs in a simulated microgravity environment promotes chondrogenic differentiation and inhibits cartilage aging.

    Science.gov (United States)

    Liu, Peng-Cheng; Liu, Kuan; Liu, Jun-Feng; Xia, Kuo; Chen, Li-Yang; Wu, Xing

    2016-09-27

    The effect of overexpressing the Indian hedgehog (IHH) gene on the chondrogenic differentiation of rabbit bone marrow-derived mesenchymal stem cells (BMSCs) was investigated in a simulated microgravity environment. An adenovirus plasmid encoding the rabbit IHH gene was constructed in vitro and transfected into rabbit BMSCs. Two large groups were used: conventional cell culture and induction model group and simulated microgravity environment group. Each large group was further divided into blank control group, GFP transfection group, and IHH transfection group. During differentiation induction, the expression levels of cartilage-related and cartilage hypertrophy-related genes and proteins in each group were determined. In the conventional model, the IHH transfection group expressed high levels of cartilage-related factors (Coll2 and ANCN) at the early stage of differentiation induction and expressed high levels of cartilage hypertrophy-related factors (Coll10, annexin 5, and ALP) at the late stage. Under the simulated microgravity environment, the IHH transfection group expressed high levels of cartilage-related factors and low levels of cartilage hypertrophy-related factors at all stages of differentiation induction. Under the simulated microgravity environment, transfection of the IHH gene into BMSCs effectively promoted the generation of cartilage and inhibited cartilage aging and osteogenesis. Therefore, this technique is suitable for cartilage tissue engineering.

  15. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

    DEFF Research Database (Denmark)

    Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

    2009-01-01

    reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

  17. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  18. Generation of a gene cassette for genetically engineered Salmonella Enteritidis in the specific region of the sipC gene

    Directory of Open Access Journals (Sweden)

    M Ghasemi

    2017-05-01

    Full Text Available Introduction: Salmonellosis is an infection caused by eating contaminated food with Salmonella, and it can occur in humans and other animals. Salmonella has acquired the ability to create the infection due to the presence of several virulence genes. One of the virulence genes of salmonella is sipC gene that coding the SipC protein. The aim of this study was creating the gene cassette to genetically engineered Salmonella enteritidis in the specific region of the sipC gene. Methods: In this study, after DNA extraction from Salmonella, the upstream and downstream regions of the sipC gene was amplified based on PCR method. The PCR products were cloned with T/A cloning method and they were inserted into the pGEM vector. In order to generate the final gene cassette, each of the upstream and downstream regions of the sipC gene was subcloned into the pET32 vector, and cloning accuracy was assessed by PCR and enzyme digestion methods. Results: Amplification of the 320 bp upstream and 206 bp downstream of sipC gene was successful by PCR method. T/A cloning of these fragments were caused the formation of two pGEM-up and pGEM-down recombinant vectors. Results that were confirmed the sub-cloning accuracy indicate the formation of the final pET32-up-down gene cassette. Conclusion: The generated gene cassette in this study was considered as a multi-purpose cassette that is able to specific gene manipulation of Salmonella sipC gene by homologous recombination matched. This gene cassette has the necessary potential for sipC gene deletion or insertion of any useful gene instead of sipC gene.

  19. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.

    2014-01-01

    raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted

  20. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Science.gov (United States)

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  1. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  2. CD34/CD133 enriched bone marrow progenitor cells promote neovascularization of tissue engineered constructs in vivo

    Directory of Open Access Journals (Sweden)

    Marietta Herrmann

    2014-11-01

    We demonstrate that this population of cells, isolated in a clinically relevant manner and cultured with autologous growth factors readily promoted neovascularization in tissue engineered constructs in vivo enabling a potential translation into the clinic.

  3. A search engine to identify pathway genes from expression data on multiple organisms

    Directory of Open Access Journals (Sweden)

    Zambon Alexander C

    2007-05-01

    Full Text Available Abstract Background The completion of several genome projects showed that most genes have not yet been characterized, especially in multicellular organisms. Although most genes have unknown functions, a large collection of data is available describing their transcriptional activities under many different experimental conditions. In many cases, the coregulatation of a set of genes across a set of conditions can be used to infer roles for genes of unknown function. Results We developed a search engine, the Multiple-Species Gene Recommender (MSGR, which scans gene expression datasets from multiple organisms to identify genes that participate in a genetic pathway. The MSGR takes a query consisting of a list of genes that function together in a genetic pathway from one of six organisms: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans, Saccharomyces cerevisiae, Arabidopsis thaliana, and Helicobacter pylori. Using a probabilistic method to merge searches, the MSGR identifies genes that are significantly coregulated with the query genes in one or more of those organisms. The MSGR achieves its highest accuracy for many human pathways when searches are combined across species. We describe specific examples in which new genes were identified to be involved in a neuromuscular signaling pathway and a cell-adhesion pathway. Conclusion The search engine can scan large collections of gene expression data for new genes that are significantly coregulated with a pathway of interest. By integrating searches across organisms, the MSGR can identify pathway members whose coregulation is either ancient or newly evolved.

  4. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  5. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  6. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  7. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  8. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  9. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Directory of Open Access Journals (Sweden)

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  10. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  11. Informational Reinforcement of Students’ Course Design Aimed at Promoting Engineers Training Quality in Technical Education

    Directory of Open Access Journals (Sweden)

    B. N. Guzanov

    2012-01-01

    Full Text Available Using the modern information technologies in educational process is regarded as one of the main directions in training the qualified specialists with systematic engineering thinking. The optimum combination of various educational technologies and computerized resources can improve teaching quality and promote students’ professional level. Taking as an example one of the basic technical disciplines of the engineering training curriculum at a technical higher school, the authors describe the computerized technology facilitating the course design. The technology in question - the «Reduktor» courseware - adapts the complex product of Autodesk –AutoCAD for educational purposes. The above program is the enhanced interface of AutoCAD, linked to the Microsoft Excel spreadsheet and the reference data library used for designing the reduction gear. The experimental research, based on the qualimetric approach and continuous diagnostic and prognostic monitoring of the key indices of knowledge acquisition, proves the effectiveness of informational reinforcement of students self-dependent work. 

  12. Positional RNA-Seq identifies candidate genes for phenotypic engineering of sexual traits

    NARCIS (Netherlands)

    Arbore, Roberto; Sekii, Kiyono; Beisel, Christian; Ladurner, Peter; Berezikov, Eugene; Schaerer, Lukas

    2015-01-01

    Introduction: RNA interference (RNAi) of trait-specific genes permits the manipulation of specific phenotypic traits ("phenotypic engineering") and thus represents a powerful tool to test trait function in evolutionary studies. The identification of suitable candidate genes, however, often relies on

  13. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  14. Chromosome engineering for alien gene introgression in wheat: Progress and prospective

    Science.gov (United States)

    Chromosome engineering is a useful strategy for introgression of desirable genes from wild relatives into cultivated wheat. However, it has been a challenge to transfer a small amount of alien chromatin containing the gene of interest from one genome to another non-homologous genome through classic...

  15. Gene therapy in dentistry: tool of genetic engineering. Revisited.

    Science.gov (United States)

    Gupta, Khushboo; Singh, Saurabh; Garg, Kavita Nitish

    2015-03-01

    Advances in biotechnology have brought gene therapy to the forefront of medical research. The concept of transferring genes to tissues for clinical applications has been discussed nearly half a century, but the ability to manipulate genetic material via recombinant DNA technology has brought this goal to reality. The feasibility of gene transfer was first demonstrated using tumour viruses. This led to development of viral and nonviral methods for the genetic modification of somatic cells. Applications of gene therapy to dental and oral problems illustrate the potential impact of this technology on dentistry. Preclinical trial results regarding the same have been very promising. In this review we will discuss methods, vectors involved, clinical implication in dentistry and scientific issues associated with gene therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  17. CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.

    Science.gov (United States)

    Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan

    2017-07-05

    DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20

  18. Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.

    Science.gov (United States)

    Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk

    2009-07-01

    To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.

  19. An in-house training program to promote teamwork at Combustion Engineering

    International Nuclear Information System (INIS)

    Corcoran, W.R.; Braun, J.C.; Kreps, D.A.; Grasso, D.J.

    1986-01-01

    The authors have developed and are conducting a training program to promote teamwork between individuals and groups at Combustion Engineering. It consists of a series of courses taught as part of the in-house training and personnel development program. Material dealing with transactional analysis, negotiation and problem solving skills is presented in a seminar type format. The courses are generally taught after working hours. Individuals are not paid for the time that they attend, nor is a fee charged. Since its inception in 1978, over 500 people have attended the program

  20. Development of an anhydrotetracycline-inducible gene expression system for solvent-producing Clostridium acetobutylicum: A useful tool for strain engineering.

    Science.gov (United States)

    Dong, Hongjun; Tao, Wenwen; Zhang, Yanping; Li, Yin

    2012-01-01

    Clostridium acetobutylicum is an important solvent (acetone-butanol-ethanol) producing bacterium. However, a stringent, effective, and convenient-to-use inducible gene expression system that can be used for regulating the gene expression strength in C. acetobutylicum is currently not available. Here, we report an anhydrotetracycline-inducible gene expression system for solvent-producing bacterium C. acetobutylicum. This system consists of a functional chloramphenicol acetyltransferase gene promoter containing tet operators (tetO), Pthl promoter (thiolase gene promoter from C. acetobutylicum) controlling TetR repressor expression cassette, and the chemical inducer anhydrotetracycline (aTc). The optimized system, designated as pGusA2-2tetO1, allows gene regulation in an inducer aTc concentration-dependent way, with an inducibility of over two orders of magnitude. The stringency of TetR repression supports the introduction of the genes encoding counterselective marker into C. acetobutylicum, which can be used to increase the mutant screening efficiency. This aTc-inducible gene expression system will thus increase the genetic manipulation capability for engineering C. acetobutylicum. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Step out of the groove : epigenetic gene control systems and engineered transcription factors

    NARCIS (Netherlands)

    Verschure, P.J.; Visser, A.E.; Rots, M.G.

    2006-01-01

    At the linear DNA level, gene activity is believed to be driven by binding of transcription factors, which subsequently recruit the RNA polymerase to the gene promoter region. However, it has become clear that transcriptional activation involves large complexes of many different proteins, which not

  2. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.

    2012-01-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  3. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh

    2012-07-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  4. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  5. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  6. Genetic correction using engineered nucleases for gene therapy applications.

    Science.gov (United States)

    Li, Hongmei Lisa; Nakano, Takao; Hotta, Akitsu

    2014-01-01

    Genetic mutations in humans are associated with congenital disorders and phenotypic traits. Gene therapy holds the promise to cure such genetic disorders, although it has suffered from several technical limitations for decades. Recent progress in gene editing technology using tailor-made nucleases, such as meganucleases (MNs), zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs) and, more recently, CRISPR/Cas9, has significantly broadened our ability to precisely modify target sites in the human genome. In this review, we summarize recent progress in gene correction approaches of the human genome, with a particular emphasis on the clinical applications of gene therapy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  7. MITEs in the promoters of effector genes allow prediction of novel virulence genes in Fusarium oxysporum

    NARCIS (Netherlands)

    Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M.

    2013-01-01

    Background The plant-pathogenic fungus Fusarium oxysporum f.sp.lycopersici (Fol) has accessory, lineage-specific (LS) chromosomes that can be transferred horizontally between strains. A single LS chromosome in the Fol4287 reference strain harbors all known Fol effector genes. Transfer of this

  8. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    International Nuclear Information System (INIS)

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.

    2006-01-01

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression

  9. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  10. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  11. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  12. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  13. Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

    Science.gov (United States)

    Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

    2017-10-01

    PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  15. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  16. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Inactivation of promoter 1B of APC causes partial gene silencing: evidence for a significant role of the promoter in regulation and causative of familial adenomatous polyposis

    DEFF Research Database (Denmark)

    Rohlin, A; Engwall, Y; Fritzell, K

    2011-01-01

    inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...

  18. hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro

    International Nuclear Information System (INIS)

    Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan

    2007-01-01

    Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)

  19. Methylation of class II transactivator gene promoter IV is not associated with susceptibility to Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Lincoln Matthew R

    2008-07-01

    Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.

  20. Non-viral gene therapy for bone tissue engineering

    NARCIS (Netherlands)

    Wegman, F.

    2013-01-01

    In bone tissue engineering bone morphogentic protein-2 (BMP-2) is one of the most commonly used growth factors. It induces stem cells to differentiate into the osteogenic lineage to form new bone. Clinically however, high dosages of protein are administered due to fast degradation, which is

  1. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  2. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    Directory of Open Access Journals (Sweden)

    Skiriute Daina

    2012-06-01

    Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.

  3. Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

    Science.gov (United States)

    Lee, S H; Minowa, M T; Mouradian, M M

    1996-10-11

    The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

  4. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  5. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  6. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Science.gov (United States)

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  7. Non-viral gene therapy for bone tissue engineering.

    Science.gov (United States)

    Wegman, Fiona; Oner, F Cumhur; Dhert, Wouter J A; Alblas, Jacqueline

    2013-01-01

    The possibilities of using gene therapy for bone regeneration have been extensively investigated. Improvements in the design of new transfection agents, combining vectors and delivery/release systems to diminish cytotoxicity and increase transfection efficiencies have led to several successful in vitro, ex vivo and in vivo strategies. These include growth factor or short interfering ribonucleic acid (siRNA) delivery, or even enzyme replacement therapies, and have led to increased osteogenic differentiation and bone formation in vivo. These results provide optimism to consider use in humans with some of these gene-delivery strategies in the near future.

  8. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  9. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  10. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  11. Correlation between the methylation of APC gene promoter and colon cancer.

    Science.gov (United States)

    Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua

    2017-08-01

    The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.

  12. Comparison of multiple gene assembly methods for metabolic engineering

    Science.gov (United States)

    Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

    2007-01-01

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

  13. Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

    DEFF Research Database (Denmark)

    Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

    2009-01-01

    with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....

  14. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    International Nuclear Information System (INIS)

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi

    2006-01-01

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid

  15. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    DEFF Research Database (Denmark)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal

    2013-01-01

    , isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...

  16. Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

    Science.gov (United States)

    Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

    2015-10-26

    Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null

  17. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  18. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    International Nuclear Information System (INIS)

    Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen

    2007-01-01

    Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses

  19. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  20. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  1. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  2. Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.

    Science.gov (United States)

    Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G

    2015-01-01

    CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.

  3. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    Science.gov (United States)

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  4. Directed evolution combined with synthetic biology strategies expedite semi-rational engineering of genes and genomes.

    Science.gov (United States)

    Kang, Zhen; Zhang, Junli; Jin, Peng; Yang, Sen

    2015-01-01

    Owing to our limited understanding of the relationship between sequence and function and the interaction between intracellular pathways and regulatory systems, the rational design of enzyme-coding genes and de novo assembly of a brand-new artificial genome for a desired functionality or phenotype are difficult to achieve. As an alternative approach, directed evolution has been widely used to engineer genomes and enzyme-coding genes. In particular, significant developments toward DNA synthesis, DNA assembly (in vitro or in vivo), recombination-mediated genetic engineering, and high-throughput screening techniques in the field of synthetic biology have been matured and widely adopted, enabling rapid semi-rational genome engineering to generate variants with desired properties. In this commentary, these novel tools and their corresponding applications in the directed evolution of genomes and enzymes are discussed. Moreover, the strategies for genome engineering and rapid in vitro enzyme evolution are also proposed.

  5. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    Science.gov (United States)

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-03

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  7. The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

    Science.gov (United States)

    Fu, Chunli; Xing, Yingqi; Song, Xiaonan

    2011-04-01

    To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

  8. Quantitative Methylation Profiles for Multiple Tumor Suppressor Gene Promoters in Salivary Gland Tumors

    Science.gov (United States)

    Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.

    2010-01-01

    Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817

  9. Engineering fibrin hydrogels to promote the wound healing potential of mesenchymal stem cell spheroids.

    Science.gov (United States)

    Murphy, Kaitlin C; Whitehead, Jacklyn; Zhou, Dejie; Ho, Steve S; Leach, J Kent

    2017-12-01

    Mesenchymal stem cells (MSCs) secrete endogenous factors such as vascular endothelial growth factor (VEGF) and prostaglandin E2 (PGE 2 ) that promote angiogenesis, modulate the inflammatory microenvironment, and stimulate wound repair, and MSC spheroids secrete more trophic factors than dissociated, individual MSCs. Compared to injection of cells alone, transplantation of MSCs in a biomaterial can enhance their wound healing potential by localizing cells at the defect site and upregulating trophic factor secretion. To capitalize on the therapeutic potential of spheroids, we engineered a fibrin gel delivery vehicle to simultaneously enhance the proangiogenic and anti-inflammatory potential of entrapped human MSC spheroids. We used multifactorial statistical analysis to determine the interaction between four input variables derived from fibrin gel synthesis on four output variables (gel stiffness, gel contraction, and secretion of VEGF and PGE 2 ). Manipulation of the four input variables tuned fibrin gel biophysical properties to promote the simultaneous secretion of VEGF and PGE 2 by entrapped MSC spheroids while maintaining overall gel integrity. MSC spheroids in stiffer gels secreted the most VEGF, while PGE 2 secretion was highest in more compliant gels. Simultaneous VEGF and PGE 2 secretion was greatest using hydrogels with intermediate mechanical properties, as small increases in stiffness increased VEGF secretion while maintaining PGE 2 secretion by entrapped spheroids. The fibrin gel formulation predicted to simultaneously increase VEGF and PGE 2 secretion stimulated endothelial cell proliferation, enhanced macrophage polarization, and promoted angiogenesis when used to treat a wounded three-dimensional human skin equivalent. These data demonstrate that a statistical approach is an effective strategy to formulate fibrin gel formulations that enhance the wound healing potential of human MSCs. Mesenchymal stem cells (MSCs) are under investigation for wound

  10. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  11. Strategies for improving the nutritional quality of Phaseolus beans through gene engineering

    Directory of Open Access Journals (Sweden)

    Kapila J.

    1999-01-01

    Full Text Available Although Phaseolus species are still difficult to transform, progress in this field now opens the way to engineering beans with a higher nutritional value. The opportunities for gene engineering in nutritional quality improvement, the strategies which canbe adopted and the constraints we are still facing are briefly outlined, using the enhancement of the seed methionine content and the reduction in antinutritional factors as examples.

  12. Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring

    Directory of Open Access Journals (Sweden)

    Liu Zhongjie

    2015-11-01

    Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.

  13. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  14. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  15. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  16. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  17. Engineering nucleases for gene targeting: safety and regulatory considerations.

    Science.gov (United States)

    Pauwels, Katia; Podevin, Nancy; Breyer, Didier; Carroll, Dana; Herman, Philippe

    2014-01-25

    Nuclease-based gene targeting (NBGT) represents a significant breakthrough in targeted genome editing since it is applicable from single-celled protozoa to human, including several species of economic importance. Along with the fast progress in NBGT and the increasing availability of customized nucleases, more data are available about off-target effects associated with the use of this approach. We discuss how NBGT may offer a new perspective for genetic modification, we address some aspects crucial for a safety improvement of the corresponding techniques and we also briefly relate the use of NBGT applications and products to the regulatory oversight. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. The collective biology of the gene: Towards genetic dynamics engineering

    International Nuclear Information System (INIS)

    Chela-Flores, J.

    1985-11-01

    Chromatin dynamics is studied in terms of coupled vibrations (phonon pairing); this is shown to lead to a collective variable Δ, interpreted as a gene inhibition factor, which behaves as a biological switch turned off, not only by enzymatic action or metabolic energy, but also by means of an external probe:irradiation. We discuss the inactivation of the X chromosome and puffing. The relevance of being able to modulate Δ is emphasized, since it is equivalent to controlling chromatin dynamics without interfering with chromatin structure, unlike in the usual recombinant DNA techniques. (author)

  19. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  20. Integrator element as a promoter of active learning in engineering teaching

    Science.gov (United States)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-03-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator element, called the physics elevator project. This integrator element allows us to use, in a single project, all the content taught in the course and uses several active learning strategies. In this paper, we analyse this project as: (i) a clarifying element of the contents covered in the course; (ii) a promoter element of motivation and active participation in class and finally and (iii) a link between the contents covered in the course and the 'real world'. The data were collected by a questionnaire and interviews to students. From the data collected, it seems that the integrator element improves students' motivation towards physics and develops several skills that they consider to be important to their professional future. It also acts as a clarifying element and makes the connection between the physics that is taught and the 'real world'.

  1. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  2. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  3. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    International Nuclear Information System (INIS)

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  4. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  5. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  6. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  7. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    Science.gov (United States)

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  8. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  9. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  10. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  11. Aquilegia B gene homologs promote petaloidy of the sepals and maintenance of the C domain boundary

    Directory of Open Access Journals (Sweden)

    Bharti Sharma

    2017-11-01

    Full Text Available Abstract The model Aquilegia coerulea x “Origami” possesses several interesting floral features, including petaloid sepals that are morphologically distinct from the true petals and a broad domain containing many whorls of stamens. We undertook the current study in an effort to understand the former trait, but additionally uncovered data that inform on the latter. The Aquilegia B gene homolog AqPI is shown to contribute to the production of anthocyanin in the first whorl sepals, although it has no major role in their morphology. Surprisingly, knockdown of AqPI in Aquilegia coerulea x “Origami” also reveals a role for the B class genes in maintaining the expression of the C gene homolog AqAG1 in the outer whorls of stamens. These findings suggest that the transference of pollinator function to the first whorl sepals included a non-homeotic recruitment of the B class genes to promote aspects of petaloidy. They also confirm results in several other Ranunculales that have revealed an unexpected regulatory connection between the B and C class genes.

  12. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  13. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea

    OpenAIRE

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-01-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, th...

  14. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  15. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-04-15

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging

  16. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    International Nuclear Information System (INIS)

    Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-01-01

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with

  17. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  18. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Directory of Open Access Journals (Sweden)

    Zhichun Zhang

    Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  19. GeneRank: Using search engine technology for the analysis of microarray experiments

    Directory of Open Access Journals (Sweden)

    Breitling Rainer

    2005-09-01

    Full Text Available Abstract Background Interpretation of simple microarray experiments is usually based on the fold-change of gene expression between a reference and a "treated" sample where the treatment can be of many types from drug exposure to genetic variation. Interpretation of the results usually combines lists of differentially expressed genes with previous knowledge about their biological function. Here we evaluate a method – based on the PageRank algorithm employed by the popular search engine Google – that tries to automate some of this procedure to generate prioritized gene lists by exploiting biological background information. Results GeneRank is an intuitive modification of PageRank that maintains many of its mathematical properties. It combines gene expression information with a network structure derived from gene annotations (gene ontologies or expression profile correlations. Using both simulated and real data we find that the algorithm offers an improved ranking of genes compared to pure expression change rankings. Conclusion Our modification of the PageRank algorithm provides an alternative method of evaluating microarray experimental results which combines prior knowledge about the underlying network. GeneRank offers an improvement compared to assessing the importance of a gene based on its experimentally observed fold-change alone and may be used as a basis for further analytical developments.

  20. GeneRank: using search engine technology for the analysis of microarray experiments.

    Science.gov (United States)

    Morrison, Julie L; Breitling, Rainer; Higham, Desmond J; Gilbert, David R

    2005-09-21

    Interpretation of simple microarray experiments is usually based on the fold-change of gene expression between a reference and a "treated" sample where the treatment can be of many types from drug exposure to genetic variation. Interpretation of the results usually combines lists of differentially expressed genes with previous knowledge about their biological function. Here we evaluate a method--based on the PageRank algorithm employed by the popular search engine Google--that tries to automate some of this procedure to generate prioritized gene lists by exploiting biological background information. GeneRank is an intuitive modification of PageRank that maintains many of its mathematical properties. It combines gene expression information with a network structure derived from gene annotations (gene ontologies) or expression profile correlations. Using both simulated and real data we find that the algorithm offers an improved ranking of genes compared to pure expression change rankings. Our modification of the PageRank algorithm provides an alternative method of evaluating microarray experimental results which combines prior knowledge about the underlying network. GeneRank offers an improvement compared to assessing the importance of a gene based on its experimentally observed fold-change alone and may be used as a basis for further analytical developments.

  1. Glucose metabolism in pigs expressing human genes under an insulin promoter.

    Science.gov (United States)

    Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David

    2015-01-01

    Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  3. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  4. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  5. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  6. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  7. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Directory of Open Access Journals (Sweden)

    Cynthia J Thomson

    Full Text Available Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4 influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599 that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing sensation seeking between groups. There were no significant associations between genotype(s and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  8. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Science.gov (United States)

    Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

    2014-01-01

    Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  9. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  10. Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: a combined gene therapy-cell transplantation approach.

    Science.gov (United States)

    Jabbarzadeh, Ehsan; Starnes, Trevor; Khan, Yusuf M; Jiang, Tao; Wirtel, Anthony J; Deng, Meng; Lv, Qing; Nair, Lakshmi S; Doty, Steven B; Laurencin, Cato T

    2008-08-12

    One of the fundamental principles underlying tissue engineering approaches is that newly formed tissue must maintain sufficient vascularization to support its growth. Efforts to induce vascular growth into tissue-engineered scaffolds have recently been dedicated to developing novel strategies to deliver specific biological factors that direct the recruitment of endothelial cell (EC) progenitors and their differentiation. The challenge, however, lies in orchestration of the cells, appropriate biological factors, and optimal factor doses. This study reports an approach as a step forward to resolving this dilemma by combining an ex vivo gene transfer strategy and EC transplantation. The utility of this approach was evaluated by using 3D poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds for bone tissue engineering applications. Our goal was achieved by isolation and transfection of adipose-derived stromal cells (ADSCs) with adenovirus encoding the cDNA of VEGF. We demonstrated that the combination of VEGF releasing ADSCs and ECs results in marked vascular growth within PLAGA scaffolds. We thereby delineate the potential of ADSCs to promote vascular growth into biomaterials.

  11. Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: A combined gene therapy–cell transplantation approach

    Science.gov (United States)

    Jabbarzadeh, Ehsan; Starnes, Trevor; Khan, Yusuf M.; Jiang, Tao; Wirtel, Anthony J.; Deng, Meng; Lv, Qing; Nair, Lakshmi S.; Doty, Steven B.; Laurencin, Cato T.

    2008-01-01

    One of the fundamental principles underlying tissue engineering approaches is that newly formed tissue must maintain sufficient vascularization to support its growth. Efforts to induce vascular growth into tissue-engineered scaffolds have recently been dedicated to developing novel strategies to deliver specific biological factors that direct the recruitment of endothelial cell (EC) progenitors and their differentiation. The challenge, however, lies in orchestration of the cells, appropriate biological factors, and optimal factor doses. This study reports an approach as a step forward to resolving this dilemma by combining an ex vivo gene transfer strategy and EC transplantation. The utility of this approach was evaluated by using 3D poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds for bone tissue engineering applications. Our goal was achieved by isolation and transfection of adipose-derived stromal cells (ADSCs) with adenovirus encoding the cDNA of VEGF. We demonstrated that the combination of VEGF releasing ADSCs and ECs results in marked vascular growth within PLAGA scaffolds. We thereby delineate the potential of ADSCs to promote vascular growth into biomaterials. PMID:18678895

  12. Tissue engineering of bladder using vascular endothelial growth factor gene-modified endothelial progenitor cells.

    Science.gov (United States)

    Chen, Bai-Song; Xie, Hua; Zhang, Sheng-Li; Geng, Hong-Quan; Zhou, Jun-Mei; Pan, Jun; Chen, Fang

    2011-12-01

    This study assessed the use of vascular endothelial growth factor (VEGF) gene-modified endothelial progenitor cells (EPCs) seeded onto bladder acellular matrix grafts (BAMGs), to enhance the blood supply in tissue-engineered bladders in a porcine model. Autologous porcine peripheral EPCs were isolated, cultured, expanded, characterized, and modified with the VEGF gene using an adenovirus vector. The expression of VEGF was examined using reverse transcriptase polymerase chain reaction (RT-PCR) and an enzyme-linked immunosorbent assay (ELISA). VEGF gene modified EPCs were seeded onto BAMG and cultured for 3 days before implantation into pigs for bladder tissue engineering. A partial bladder cystectomy was performed in 12 pigs. The experimental group (6 pigs) received VEGF gene-modified EPC-seeded BAMG. The control group (6 pigs) received BAMG without seeded EPCs. The resulting tissue-engineered bladders were subject to a general and histological analysis. Microvessel density (MVD) was assessed using immunohistochemistry. The ex vivo transfection efficiency of EPCs was greater than 60%-70% when concentrated adenovirus was used. The genetically modified cells expressed both VEGF and green fluorescent protein (GFP). Scanning electron microscopy (SEM) and Masson's trichrome staining of cross sections of the cultured cells seeded to BAMG showed cell attachment and proliferation on the surface of the BAMG. Histological examination revealed bladder regeneration in a time-dependent fashion. Significant increases in MVD were observed in the experimental group, in comparison with the control group. VEGF-modified EPCs significantly enhanced neovascularization, compared with BAMG alone. These results indicate that EPCs, combined with VEGF gene therapy, may be a suitable approach for increasing blood supply in the tissue engineering of bladders. Thus, a useful strategy to achieve a tissue-engineered bladder is indicated.

  13. Re-Factoring Glycolytic Genes for Targeted Engineering of Catabolism in Gram-Negative Bacteria

    DEFF Research Database (Denmark)

    Sánchez-Pascuala, Alberto; Nikel, Pablo I.; de Lorenzo, Víctor

    2018-01-01

    the potential applications of such a portable tool for targeted pathway engineering, in the present protocol we describe how the genes encoding all the enzymes of the linear EMP route have been individually recruited from the genome of E. coli K-12, edited in silico to remove their endogenous regulatory signals......The Embden-Meyerhof-Parnas (EMP) pathway is widely accepted to be the biochemical standard of glucose catabolism. The well-characterized glycolytic route of Escherichia coli, based on the EMP catabolism, is an example of an intricate pathway in terms of genomic organization of the genes involved...... and patterns of gene expression and regulation. This intrinsic genetic and metabolic complexity renders it difficult to engineer glycolytic activities and transfer them onto other microbial cell factories, thus limiting the biotechnological potential of bacterial hosts that lack the route. Taking into account...

  14. Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

    Science.gov (United States)

    Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

    2008-10-01

    The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

  15. CypA, a gene downstream of HIF-1α, promotes the development of PDAC.

    Directory of Open Access Journals (Sweden)

    Huan Zhang

    Full Text Available Hypoxia-inducible factor-1α (HIF-1α is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC. In response to tumor hypoxia, cyclophilin A (CypA is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC.

  16. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    International Nuclear Information System (INIS)

    Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.

    2016-01-01

    Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).

  17. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    Science.gov (United States)

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  18. Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

    Science.gov (United States)

    Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

    2010-01-01

    Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

  19. Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

    Directory of Open Access Journals (Sweden)

    Joan Joseph

    2010-01-01

    Full Text Available Mycobacterium bovis Bacillus Calmette-Guérin (BCG as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261 and Mycobacteria spp. α-antigen promoter (in plasmid pJH222. Among 14 rBCG:HIV-1gp120 (pMV261 colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222 colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors.

  20. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    Science.gov (United States)

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

  1. Gene promoter methylation and DNA repair capacity in monozygotic twins with discordant smoking habits.

    Science.gov (United States)

    Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca

    2015-02-01

    The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Quantitative global and gene-specific promoter methylation in relation to biological properties of neuroblastomas

    Directory of Open Access Journals (Sweden)

    Kiss Nimrod B

    2012-09-01

    Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.

  3. [Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

    Science.gov (United States)

    Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

    2016-11-23

    Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

  4. The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

    Science.gov (United States)

    Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

    2011-01-01

    Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

  5. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  6. Hydrogel Design for Supporting Neurite Outgrowth and Promoting Gene Delivery to Maximize Neurite Extension

    Science.gov (United States)

    Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.

    2012-01-01

    Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654

  7. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  8. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  9. Electroactive biodegradable polyurethane significantly enhanced Schwann cells myelin gene expression and neurotrophin secretion for peripheral nerve tissue engineering.

    Science.gov (United States)

    Wu, Yaobin; Wang, Ling; Guo, Baolin; Shao, Yongpin; Ma, Peter X

    2016-05-01

    Myelination of Schwann cells (SCs) is critical for the success of peripheral nerve regeneration, and biomaterials that can promote SCs' neurotrophin secretion as scaffolds are beneficial for nerve repair. Here we present a biomaterials-approach, specifically, a highly tunable conductive biodegradable flexible polyurethane by polycondensation of poly(glycerol sebacate) and aniline pentamer, to significantly enhance SCs' myelin gene expression and neurotrophin secretion for peripheral nerve tissue engineering. SCs are cultured on these conductive polymer films, and the biocompatibility of these films and their ability to enhance myelin gene expressions and sustained neurotrophin secretion are successfully demonstrated. The mechanism of SCs' neurotrophin secretion on conductive films is demonstrated by investigating the relationship between intracellular Ca(2+) level and SCs' myelination. Furthermore, the neurite growth and elongation of PC12 cells are induced by adding the neurotrophin medium suspension produced from SCs-laden conductive films. These data suggest that these conductive degradable polyurethanes that enhance SCs' myelin gene expressions and sustained neurotrophin secretion perform great potential for nerve regeneration applications. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Cloning and characterization of the promoter of the 9-cis-epoxycarotenoid dioxygenase gene in Arachis hypogaea L.

    Science.gov (United States)

    Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu

    2009-09-01

    We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.

  11. Reverse-engineering of gene networks for regulating early blood development from single-cell measurements.

    Science.gov (United States)

    Wei, Jiangyong; Hu, Xiaohua; Zou, Xiufen; Tian, Tianhai

    2017-12-28

    Recent advances in omics technologies have raised great opportunities to study large-scale regulatory networks inside the cell. In addition, single-cell experiments have measured the gene and protein activities in a large number of cells under the same experimental conditions. However, a significant challenge in computational biology and bioinformatics is how to derive quantitative information from the single-cell observations and how to develop sophisticated mathematical models to describe the dynamic properties of regulatory networks using the derived quantitative information. This work designs an integrated approach to reverse-engineer gene networks for regulating early blood development based on singel-cell experimental observations. The wanderlust algorithm is initially used to develop the pseudo-trajectory for the activities of a number of genes. Since the gene expression data in the developed pseudo-trajectory show large fluctuations, we then use Gaussian process regression methods to smooth the gene express data in order to obtain pseudo-trajectories with much less fluctuations. The proposed integrated framework consists of both bioinformatics algorithms to reconstruct the regulatory network and mathematical models using differential equations to describe the dynamics of gene expression. The developed approach is applied to study the network regulating early blood cell development. A graphic model is constructed for a regulatory network with forty genes and a dynamic model using differential equations is developed for a network of nine genes. Numerical results suggests that the proposed model is able to match experimental data very well. We also examine the networks with more regulatory relations and numerical results show that more regulations may exist. We test the possibility of auto-regulation but numerical simulations do not support the positive auto-regulation. In addition, robustness is used as an importantly additional criterion to select candidate

  12. Development of a flexible and potent hypoxia-inducible promoter for tumor-targeted gene expression in attenuated Salmonella

    NARCIS (Netherlands)

    Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan

    To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells

  13. Revolutionising Engineering Education in the Middle East Region to Promote Earthquake-Disaster Mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-01-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enroll on engineering courses through lenient…

  14. Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

    Science.gov (United States)

    Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

    2016-10-01

    The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  15. Enhanced contractile force generation by artificial skeletal muscle tissues using IGF-I gene-engineered myoblast cells.

    Science.gov (United States)

    Sato, Masanori; Ito, Akira; Kawabe, Yoshinori; Nagamori, Eiji; Kamihira, Masamichi

    2011-09-01

    The aim of this study was to investigate whether insulin-like growth factor (IGF)-I gene delivery to myoblast cells promotes the contractile force generated by hydrogel-based tissue-engineered skeletal muscles in vitro. Two retroviral vectors allowing doxycycline (Dox)-inducible expression of the IGF-I gene were transduced into mouse myoblast C2C12 cells to evaluate the effects of IGF-I gene expression on these cells. IGF-I gene expression stimulated the proliferation of C2C12 cells, and a significant increase in the growth rate was observed for IGF-I-transduced C2C12 cells with Dox addition, designated C2C12/IGF (Dox+) cells. Quantitative morphometric analyses showed that the myotubes induced from C2C12/IGF (Dox+) cells had a larger area and a greater width than control myotubes induced from normal C2C12 cells. Artificial skeletal muscle tissues were prepared from the respective cells using hydrogels composed of type I collagen and Matrigel. Western blot analyses revealed that the C2C12/IGF (Dox+) tissue constructs showed activation of a skeletal muscle hypertrophy marker (Akt) and enhanced expression of muscle-specific markers (myogenin, myosin heavy chain and tropomyosin). Moreover, the creatine kinase activity was increased in the C2C12/IGF (Dox+) tissue constructs. The C2C12/IGF (Dox+) tissue constructs contracted in response to electrical pulses, and generated a significantly higher physical force than the control C2C12 tissue constructs. These findings indicate that IGF-I gene transfer has the potential to yield functional skeletal muscle substitutes that are capable of in vivo restoration of the load-bearing function of injured muscle or acting as in vitro electrically-controlled bio-actuators. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    Science.gov (United States)

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  17. Using Genetically Engineered Animal Models in the Postgenomic Era to Understand Gene Function in Alcoholism

    Science.gov (United States)

    Reilly, Matthew T.; Harris, R. Adron; Noronha, Antonio

    2012-01-01

    Over the last 50 years, researchers have made substantial progress in identifying genetic variations that underlie the complex phenotype of alcoholism. Not much is known, however, about how this genetic variation translates into altered biological function. Genetic animal models recapitulating specific characteristics of the human condition have helped elucidate gene function and the genetic basis of disease. In particular, major advances have come from the ability to manipulate genes through a variety of genetic technologies that provide an unprecedented capacity to determine gene function in the living organism and in alcohol-related behaviors. Even newer genetic-engineering technologies have given researchers the ability to control when and where a specific gene or mutation is activated or deleted, allowing investigators to narrow the role of the gene’s function to circumscribed neural pathways and across development. These technologies are important for all areas of neuroscience, and several public and private initiatives are making a new generation of genetic-engineering tools available to the scientific community at large. Finally, high-throughput “next-generation sequencing” technologies are set to rapidly increase knowledge of the genome, epigenome, and transcriptome, which, combined with genetically engineered mouse mutants, will enhance insight into biological function. All of these resources will provide deeper insight into the genetic basis of alcoholism. PMID:23134044

  18. Study on the Promotion in the Citation of the Nuclear Engineering and Technology

    Energy Technology Data Exchange (ETDEWEB)

    Chun, Young Choon; Yoo, J. B.; Yi, J. H. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    The Korean journal published in English, Nuclear Engineering and Technology (here under NET) has been enlisted in the global citation database SCI E(Science Citation Index Expanded) of Thomson Reuters (past ISI), beginning with NET vol.39 No.1 (Feb. 2007). As of July 2009, the citation index of NET as reported by JCR (Journal Citation Report) based on the cumulative data from ISI (Institute for Scientific Information) reached to 0.991. This index ranks on 12{sup th} among the 33 journals in the area of nuclear science and technology in the science and technology covered by JCR, meaning fairly high impact factor. The following year 2010, however, witnessed the JCR figure dropping down to 0.465. The reason behind such drastic fall would be the decreased citation and in a lesser extent self-citation in 2010, in comparison with 2009, despite the increased number of paper publication. This study attempts to give an analysis as of the end of 2011 on the NET citation frequency in SCI Source Journal and the citation frequency by KAERI authors, together with the nationalities of NET authors and SCI journals that refer to NET most. Based on the analysis, the paper suggests some ways to promoting the position of NET as a journal in the international nuclear sector

  19. Study on the Promotion in the Citation of the Nuclear Engineering and Technology

    International Nuclear Information System (INIS)

    Chun, Young Choon; Yoo, J. B.; Yi, J. H.

    2012-01-01

    The Korean journal published in English, Nuclear Engineering and Technology (here under NET) has been enlisted in the global citation database SCI E(Science Citation Index Expanded) of Thomson Reuters (past ISI), beginning with NET vol.39 No.1 (Feb. 2007). As of July 2009, the citation index of NET as reported by JCR (Journal Citation Report) based on the cumulative data from ISI (Institute for Scientific Information) reached to 0.991. This index ranks on 12 th among the 33 journals in the area of nuclear science and technology in the science and technology covered by JCR, meaning fairly high impact factor. The following year 2010, however, witnessed the JCR figure dropping down to 0.465. The reason behind such drastic fall would be the decreased citation and in a lesser extent self-citation in 2010, in comparison with 2009, despite the increased number of paper publication. This study attempts to give an analysis as of the end of 2011 on the NET citation frequency in SCI Source Journal and the citation frequency by KAERI authors, together with the nationalities of NET authors and SCI journals that refer to NET most. Based on the analysis, the paper suggests some ways to promoting the position of NET as a journal in the international nuclear sector

  20. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  1. ΔNp73 enhances promoter activity of TGF-β induced genes.

    Directory of Open Access Journals (Sweden)

    Maarten Niemantsverdriet

    Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

  2. Pigment epithelial-derived factor gene loaded novel COOH-PEG-PLGA-COOH nanoparticles promoted tumor suppression by systemic administration

    Directory of Open Access Journals (Sweden)

    Yu T

    2016-02-01

    Full Text Available Ting Yu,1,* Bei Xu,1,* Lili He,2 Shan Xia,3 Yan Chen,1 Jun Zeng,1 Yongmei Liu,1 Shuangzhi Li,1 Xiaoyue Tan,4 Ke Ren,1 Shaohua Yao,1 Xiangrong Song1 1State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University, and Collaborative Innovation Center for Biotherapy, 2College of Chemistry and Environment Protection Engineering, Southwest University for Nationalities, 3Central Laboratory, Science Education Department, Chengdu Normal University, Chengdu, Sichuan, 4Department of Pathology/Collaborative Innovation Center of Biotherapy, Medical School of Nankai University, Tianjin, People’s Republic of China *These authors contributed equally to this work Abstract: Anti-angiogenesis has been proposed as an effective therapeutic strategy for cancer treatment. Pigment epithelium-derived factor (PEDF is one of the most powerful endogenous anti-angiogenic reagents discovered to date and PEDF gene therapy has been recognized as a promising treatment option for various tumors. There is an urgent need to develop a safe and valid vector for its systemic delivery. Herein, a novel gene delivery system based on the newly synthesized copolymer COOH-PEG-PLGA-COOH (CPPC was developed in this study, which was probably capable of overcoming the disadvantages of viral vectors and cationic lipids/polymers-based nonviral carriers. PEDF gene loaded CPPC nanoparticles (D-NPs were fabricated by a modified double-emulsion water-in-oil-in-water (W/O/W solvent evaporation method. D-NPs with uniform spherical shape had relatively high drug loading (~1.6%, probably because the introduced carboxyl group in poly (D,L-lactide-co-glycolide terminal enhanced the interaction of copolymer with the PEDF gene complexes. An excellent in vitro antitumor effect was found in both C26 and A549 cells treated by D-NPs, in which PEDF levels were dramatically elevated due to the successful transfection of PEDF gene. D-NPs also showed a strong inhibitory effect on

  3. Engineering students' and faculty perceptions of teaching methods and the level of faculty involvement that promotes academic success

    Science.gov (United States)

    Karpilo, Lacy N.

    Student academic success is a top priority of higher education institutions in the United States and the trend of students leaving school prior to finishing their degree is a serious concern. Accountability has become a large part of university and college ratings and perceived success. Retention is one component of the accountability metrics used by accreditation agencies. In addition, there are an increasing number of states allocating funds based in part on retention (Seidman, 2005). Institutions have created initiatives, programs, and even entire departments to address issues related to student academic success to promote retention. Universities and colleges have responded by focusing on methods to retain and better serve students. Retention and student academic success is a primary concern for high education institutions; however, engineering education has unique retention issues. The National Science Board (2004) reports a significant decline in the number of individuals in the United States who are training to become engineers, despite the fact that the number of jobs that utilize an engineering background continues to increase. Engineering education has responded to academic success issues by changing curriculum and pedagogical methods (Sheppard, 2001). This descriptive study investigates the perception of engineering students and faculty regarding teaching methods and faculty involvement to create a picture of what is occurring in engineering education. The population was the engineering students and faculty of Colorado State University's College of Engineering. Data from this research suggests that engaging teaching methods are not being used as often as research indicates they should and that there is a lack of student-faculty interaction outside of the classroom. This research adds to the breadth of knowledge and understanding of the current environment of engineering education. Furthermore, the data allows engineering educators and other higher

  4. Promotion of Metastasis-associated Gene Expression in Survived PANC-1 Cells Following Trichostatin A Treatment.

    Science.gov (United States)

    Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao

    2015-01-01

    Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.

  5. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China

    Directory of Open Access Journals (Sweden)

    Liu Wenzhong

    2008-10-01

    Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  6. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.

    Science.gov (United States)

    Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong

    2008-10-25

    The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  7. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  8. Methylation state of the EDA gene promoter in Chinese X-linked hypohidrotic ectodermal dysplasia carriers.

    Directory of Open Access Journals (Sweden)

    Wei Yin

    Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.

  9. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  10. Linkage mapping of candidate genes for induce resistance and growth promotion by trichoderma koningiopsis (th003) in tomato solanum lycopersicum

    International Nuclear Information System (INIS)

    Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella

    2011-01-01

    Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.

  11. Analysis of tomato gene promoters activated in syncytia induced in tomato and potato hairy roots by Globodera rostochiensis.

    Science.gov (United States)

    Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M

    2013-06-01

    The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.

  12. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  13. Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.

    Science.gov (United States)

    Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun

    2015-12-01

    Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. GeneView: a comprehensive semantic search engine for PubMed.

    Science.gov (United States)

    Thomas, Philippe; Starlinger, Johannes; Vowinkel, Alexander; Arzt, Sebastian; Leser, Ulf

    2012-07-01

    Research results are primarily published in scientific literature and curation efforts cannot keep up with the rapid growth of published literature. The plethora of knowledge remains hidden in large text repositories like MEDLINE. Consequently, life scientists have to spend a great amount of time searching for specific information. The enormous ambiguity among most names of biomedical objects such as genes, chemicals and diseases often produces too large and unspecific search results. We present GeneView, a semantic search engine for biomedical knowledge. GeneView is built upon a comprehensively annotated version of PubMed abstracts and openly available PubMed Central full texts. This semi-structured representation of biomedical texts enables a number of features extending classical search engines. For instance, users may search for entities using unique database identifiers or they may rank documents by the number of specific mentions they contain. Annotation is performed by a multitude of state-of-the-art text-mining tools for recognizing mentions from 10 entity classes and for identifying protein-protein interactions. GeneView currently contains annotations for >194 million entities from 10 classes for ∼21 million citations with 271,000 full text bodies. GeneView can be searched at http://bc3.informatik.hu-berlin.de/.

  15. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Li

    2018-05-01

    Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

  16. USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy

    Science.gov (United States)

    Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.

    2014-01-01

    Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308

  17. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  18. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    Science.gov (United States)

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik

    2014-01-01

    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  19. Bovine glycomacropeptide promotes the growth of Bifidobacterium longum ssp. infantis and modulates its gene expression.

    Science.gov (United States)

    O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M

    2018-05-23

    Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  20. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  1. Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.

    Science.gov (United States)

    Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P

    2016-11-01

    Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10 m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10 +/+ mice. After total body irradiation (TBI), Grb10 m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10 +/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Networking of institutions in India to promote research and education in nuclear science and engineering

    International Nuclear Information System (INIS)

    Puri, R.R.

    2007-01-01

    will pool together the strength of each of its CI to accelerate the pace of basic research and its translation in to technology development. It would provide unique opportunity to students to learn from, and work with people having hands-on experience in the environment of highly advanced research facilities hardly available elsewhere in the country. It would promote interdisciplinary research essential for development of nuclear science and technology. The setting-up of HBNI is expected to attract those talented youngsters to nuclear science and engineering who are looking for intellectual challenges and recognition of their efforts in terms of formal degrees. The networking of the DAE Institutes under the umbrella of HBNI is a unique experiment to promote research and education in nuclear science and engineering in India. In the years to come, admission to HBNI may be opened to students from other countries. (author)

  3. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir

    2014-10-02

    Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

  4. Histone Deacetylase 7 Promotes Toll-like Receptor 4-dependent Proinflammatory Gene Expression in Macrophages*

    Science.gov (United States)

    Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.

    2013-01-01

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092

  5. Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages.

    Science.gov (United States)

    Shakespear, Melanie R; Hohenhaus, Daniel M; Kelly, Greg M; Kamal, Nabilah A; Gupta, Praveer; Labzin, Larisa I; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A; Reid, Robert C; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2013-08-30

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target.

  6. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  7. Association between promoter polymorphisms of OPN gene and cancer risk: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Liu JW

    2015-12-01

    Full Text Available Jingwei Liu,1–2 Caiyun He,1–2 Quan Yuan,1–2 Zhenning Wang,1–2 Chengzhong Xing,1–2 Yuan Yuan1–2 1Tumor Etiology and Screening Department of Cancer Institute and General Surgery, The First Affiliated Hospital of China Medical University, 2Key Laboratory of Cancer Etiology and Prevention, China Medical University, Liaoning Provincial Education Department, Shenyang, People’s Republic of China Background: Results of the association between polymorphisms of osteopontin (OPN gene promoter region and risk of cancer were inconclusive. The aim of this meta-analysis was to elucidate whether OPN promoter polymorphisms were associated with cancer risk.Methods: Electronic databases including PubMed, Web of Science, and Chinese National Knowledge Infrastructure were systematically searched. Odd ratios (ORs and their 95% confidential interval (CI were used to assess the strength of association between OPN promoter polymorphisms and cancer risks.Results: Nine studies were finally included in this meta-analysis. For OPN rs17524488 polymorphism, carriers of GG or -/G genotype were significantly associated with increased cancer risk compared with wild-type -/- carriers, respectively (GG vs -/-: OR =1.40, 95% CI =1.03–1.91, P=0.033; -/G vs -/-: OR =1.22, 95% CI =1.07–1.40, P=0.002. Additionally, G allele was significantly associated with increased cancer risk compared with (- allele (OR =1.21, 95% CI =1.04–1.40, P=0.016. However, no significant association was observed of OPN rs11730582 polymorphism and cancer risk (CC vs TT: OR =0.98, 95% CI =0.49–1.97, P=0.964; CT vs TT: OR =0.88, 95% CI =0.54–1.43, P=0.610.Conclusion: Carriers of GG or -/G genotype of OPN promoter rs17524488 (-156-/G polymorphism might be associated with increased risk of cancer compared with wild-type -/- carriers, respectively. However, no significant association was observed between OPN promoter rs11730582 (-443C/T polymorphism and risk of cancer. Keywords: OPN

  8. A Course to Promote Informed Selection of an Engineering Major Using a Partially Flipped Classroom Model

    Science.gov (United States)

    Meyers, Kerry Lynn

    2016-01-01

    A 1 credit hour First-Year Engineering Course which provides background to students on the engineering disciplinary options available to them was redesigned to help inform the selection of their engineering major for future study. Initially, course administration was a large lecture class but was transformed into smaller classes that were…

  9. Results of Summer Enrichment Program to Promote High School Students' Interest in Engineering

    Science.gov (United States)

    Hart, Brenda; McAnulty, Kate

    2014-01-01

    For more than thirty years, personnel from the University of Louisville J.B. Speed School of Engineering have presented a summer program targeting high school students historically underrepresented in engineering fields. INSPIRE provides these students with an introduction to careers in engineering and assists the students in planning their…

  10. Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

    Science.gov (United States)

    Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

    2008-05-01

    Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

  11. Re-Factoring Glycolytic Genes for Targeted Engineering of Catabolism in Gram-Negative Bacteria.

    Science.gov (United States)

    Sánchez-Pascuala, Alberto; Nikel, Pablo I; de Lorenzo, Víctor

    2018-01-01

    The Embden-Meyerhof-Parnas (EMP) pathway is widely accepted to be the biochemical standard of glucose catabolism. The well-characterized glycolytic route of Escherichia coli, based on the EMP catabolism, is an example of an intricate pathway in terms of genomic organization of the genes involved and patterns of gene expression and regulation. This intrinsic genetic and metabolic complexity renders it difficult to engineer glycolytic activities and transfer them onto other microbial cell factories, thus limiting the biotechnological potential of bacterial hosts that lack the route. Taking into account the potential applications of such a portable tool for targeted pathway engineering, in the present protocol we describe how the genes encoding all the enzymes of the linear EMP route have been individually recruited from the genome of E. coli K-12, edited in silico to remove their endogenous regulatory signals, and synthesized de novo following a standard (i.e., GlucoBrick) that facilitates their grouping in the form of functional modules that can be combined at the user's will. This novel genetic tool allows for the à la carte implementation or boosting of EMP pathway activities into different Gram-negative bacteria. The potential of the GlucoBrick platform is further illustrated by engineering novel glycolytic activities in the most representative members of the Pseudomonas genus (Pseudomonas putida and Pseudomonas aeruginosa).

  12. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    Energy Technology Data Exchange (ETDEWEB)

    Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which

  13. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    International Nuclear Information System (INIS)

    Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi

    2012-01-01

    Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the

  14. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  15. Antibody Fc engineering improves frequency and promotes kinetic boosting of serial killing mediated by NK cells

    Science.gov (United States)

    Romain, Gabrielle; Senyukov, Vladimir; Rey-Villamizar, Nicolas; Merouane, Amine; Kelton, William; Liadi, Ivan; Mahendra, Ankit; Charab, Wissam; Georgiou, George; Roysam, Badrinath; Lee, Dean A.

    2014-01-01

    The efficacy of most therapeutic monoclonal antibodies (mAbs) targeting tumor antigens results primarily from their ability to elicit potent cytotoxicity through effector-mediated functions. We have engineered the fragment crystallizable (Fc) region of the immunoglobulin G (IgG) mAb, HuM195, targeting the leukemic antigen CD33, by introducing the triple mutation Ser293Asp/Ala330Leu/Ile332Glu (DLE), and developed Time-lapse Imaging Microscopy in Nanowell Grids to analyze antibody-dependent cell-mediated cytotoxicity kinetics of thousands of individual natural killer (NK) cells and mAb-coated target cells. We demonstrate that the DLE-HuM195 antibody increases both the quality and the quantity of NK cell-mediated antibody-dependent cytotoxicity by endowing more NK cells to participate in cytotoxicity via accrued CD16-mediated signaling and by increasing serial killing of target cells. NK cells encountering targets coated with DLE-HuM195 induce rapid target cell apoptosis by promoting simultaneous conjugates to multiple target cells and induce apoptosis in twice the number of target cells within the same period as the wild-type mAb. Enhanced target killing was also associated with increased frequency of NK cells undergoing apoptosis, but this effect was donor-dependent. Antibody-based therapies targeting tumor antigens will benefit from a better understanding of cell-mediated tumor elimination, and our work opens further opportunities for the therapeutic targeting of CD33 in the treatment of acute myeloid leukemia. PMID:25232058

  16. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    Science.gov (United States)

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells.

  17. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  18. Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

    2013-10-11

    Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

  19. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    International Nuclear Information System (INIS)

    Depto, A.S.; Stenberg, R.M.

    1989-01-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

  20. Evaluation of promoter methylation status of MLH1 gene in Iranian patients with colorectal tumors and adenoma polyps.

    Science.gov (United States)

    Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid

    2017-01-01

    The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of  MLH1  promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.

  1. Horizontal gene transfer promoted evolution of the ability to propagate under anaerobic conditions in yeasts

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Knecht, Wolfgang; Warneboldt, J.

    2004-01-01

    The ability to propagate under anaerobic conditions is an essential and unique trait of brewer's or baker's yeast (Saccharomyces cervisiae). To understand the evolution of facultative anaerobiosis we studied the dependence of de novo pyrimidine biosynthesis, more precisely the fourth enzymic...... activity catalysed by dihydroorotate dehydrogenase (DHODase), on the enzymes of the respiratory chain in several yeast species. While the majority of yeasts possess a mitochondrial DHODase, Saccharomyces cerevisiae has a cytoplasmatic enzyme, whose activity is independent of the presence of oxygen. From....... We show that these two S. kluyveri enzymes, and their coding genes, differ in their dependence on the presence of oxygen. Only the cytoplasmic DHODase promotes growth in the absence of oxygen. Apparently a Saccharomyces yeast progenitor which had a eukaryotic-like mitochondrial DHODase acquired...

  2. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Directory of Open Access Journals (Sweden)

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  3. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

    Science.gov (United States)

    Naito, Yuki; Bono, Hidemasa

    2012-07-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

  4. Engineering synthetic TALE and CRISPR/Cas9 transcription factors for regulating gene expression.

    Science.gov (United States)

    Kabadi, Ami M; Gersbach, Charles A

    2014-09-01

    Engineered DNA-binding proteins that can be targeted to specific sites in the genome to manipulate gene expression have enabled many advances in biomedical research. This includes generating tools to study fundamental aspects of gene regulation and the development of a new class of gene therapies that alter the expression of endogenous genes. Designed transcription factors have entered clinical trials for the treatment of human diseases and others are in preclinical development. High-throughput and user-friendly platforms for designing synthetic DNA-binding proteins present innovative methods for deciphering cell biology and designing custom synthetic gene circuits. We review two platforms for designing synthetic transcription factors for manipulating gene expression: Transcription activator-like effectors (TALEs) and the RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. We present an overview of each technology and a guide for designing and assembling custom TALE- and CRISPR/Cas9-based transcription factors. We also discuss characteristics of each platform that are best suited for different applications. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  6. Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

    Science.gov (United States)

    Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

    2018-05-15

    The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is

  7. Dragon (repulsive guidance molecule b, RGMb) is a novel gene that promotes colorectal cancer growth.

    Science.gov (United States)

    Shi, Ying; Chen, Guo-Bin; Huang, Xiao-Xiao; Xiao, Chuan-Xing; Wang, Huan-Huan; Li, Ye-Sen; Zhang, Jin-Fang; Li, Shao; Xia, Yin; Ren, Jian-Lin; Guleng, Bayasi

    2015-08-21

    Colorectal cancer (CRC) is one of the most commonly diagnosed cancers and a major cause of cancer death. However, the molecular mechanisms underlying CRC initiation, growth and metastasis are poorly understood. Dragon (RGMb), a member of the repulsive guidance molecule (RGM) family, has been recently identified as a co-receptor for bone morphogenetic protein (BMP) signaling, but the role of Dragon in CRC development is undefined. Here, we show that Dragon expression was increased in colon cancer tissues compared to control tissues in CAC mouse model and in human patients. Dragon promoted proliferation of CT26.WT and CMT93 colon cancer cells and accelerated tumor growth in the xenograft mouse model. Dragon's action on colon cancer development was mediated via the BMP4-Smad1/5/8 and Erk1/2 pathways. Therefore, our results have revealed that Dragon is a novel gene that promotes CRC growth through the BMP pathway. Dragon may be exploited as a potential therapeutic target for CRC treatment.

  8. PROMOTER POLYMORPHISM OF IL-1β GENE IN PATIENTS WITH A HISTORY OF ACUTE MYOCARDIAL INFARCTION

    Directory of Open Access Journals (Sweden)

    A. V. Shevchenko

    2010-01-01

    Full Text Available We have performed analysis of associations between IL-1β gene promoter polymorphism (-511C/T and -31 T/C variants, and conventional cardiovascular risk factors in the patients living in the West Siberia who had previously a history of myocardial infarction (MI. We are shown a strong linkage disequilibrium between IL-1β -31C/T (rs1143627, and IL-1β-511T/C (rs16944. Significant differences in frequency distributions of some compound genotypes were observed between healthy and patients with a history of MI. E.g., frequency of IL-1β-31CC/-511CT genotype was detected in 5.5 % of healthy population, while being absent among MI patients. A frequency of IL-1β (-31/-511 CC/CT genotype showed significant differences between MI patients under 55 years, as compared to healthy persons. Hence, the analyzed IL-1β promoter polymorphisms may be considered as an additional constitutional factor predisposing for vascular alterations.

  9. Cloning and functional analysis of promoters of three GnRH genes in a cichlid

    International Nuclear Information System (INIS)

    Kitahashi, Takashi; Sato, Hideki; Sakuma, Yasuo; Parhar, Ishwar S.

    2005-01-01

    Mechanisms regulating gonadotropin-releasing hormone (GnRH) types, a key molecule for reproductive physiology, remain unclear. In the present study, we cloned the promoters of GnRH1, GnRH2, and GnRH3 genes in the tilapia, Oreochromis niloticus; and found putative binding sites for glucocorticoid receptors, Sp1, C/EBP, GATA, and Oct-1, but not for androgen receptors in all three GnRH promoters using computer analysis. The presence of binding sites for progesterone receptors in GnRH1, estrogen receptors in GnRH1 and GnRH2, and thyroid hormone receptors in GnRH1 and GnRH3 suggests direct action of steroid hormones on GnRH types. Our observation of SOX and LINE-like sequences exclusively in GnRH1, COUP in GnRH2, and retinoid X receptors in GnRH3 suggests their role in sexual differentiation, midbrain segmentation, and visual cue integration, respectively. Thus, the characteristic binding sites for nuclear receptors and transcription factors support the notion that each GnRH type is regulated differently and has distinct physiological roles

  10. Reverse engineering validation using a benchmark synthetic gene circuit in human cells.

    Science.gov (United States)

    Kang, Taek; White, Jacob T; Xie, Zhen; Benenson, Yaakov; Sontag, Eduardo; Bleris, Leonidas

    2013-05-17

    Multicomponent biological networks are often understood incompletely, in large part due to the lack of reliable and robust methodologies for network reverse engineering and characterization. As a consequence, developing automated and rigorously validated methodologies for unraveling the complexity of biomolecular networks in human cells remains a central challenge to life scientists and engineers. Today, when it comes to experimental and analytical requirements, there exists a great deal of diversity in reverse engineering methods, which renders the independent validation and comparison of their predictive capabilities difficult. In this work we introduce an experimental platform customized for the development and verification of reverse engineering and pathway characterization algorithms in mammalian cells. Specifically, we stably integrate a synthetic gene network in human kidney cells and use it as a benchmark for validating reverse engineering methodologies. The network, which is orthogonal to endogenous cellular signaling, contains a small set of regulatory interactions that can be used to quantify the reconstruction performance. By performing successive perturbations to each modular component of the network and comparing protein and RNA measurements, we study the conditions under which we can reliably reconstruct the causal relationships of the integrated synthetic network.

  11. Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia

    Energy Technology Data Exchange (ETDEWEB)

    Law, Alice Y.S. [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong); Wong, Chris K.C., E-mail: ckcwong@hkbu.edu.hk [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong)

    2010-02-01

    Stanniocalcin-2 (STC2), the paralog of STC1, has been suggested as a novel target of oxidative stress response to protect cells from apoptosis. The expression of STC2 has been reported to be highly correlated with human cancer development. In this study, we reported that STC2 is a HIF-1 target gene and is involved in the regulation of cell proliferation. STC2 was shown to be up-regulated in different breast and ovarian cancer cells, following exposure to hypoxia. Using ovarian cancer cells (SKOV3), the underlying mechanism of HIF-1 mediated STC2 gene transactivation was characterized. Hypoxia-induced STC2 expression was found to be HIF-1{alpha} dependent and required the recruitment of p300 and HDAC7. Using STC2 promoter deletion constructs and site-directed mutagenesis, two authentic consensus HIF-1 binding sites were identified. Under hypoxic condition, the silencing of STC2 reduced while the overexpression of STC2 increased the levels of phosphorylated retinoblastoma and cyclin D in both SKOV3 and MCF7 cells. The change in cell cycle proteins correlated with the data of the serial cell counts. The results indicated that cell proliferation was reduced in STC2-silenced cells but was increased in STC2-overexpressing hypoxic cells. Solid tumor progression is usually associated with hypoxia. The identification and functional analysis of STC2 up-regulation by hypoxia, a feature of the tumor microenvironment, sheds light on a possible role for STC2 in tumors.

  12. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

    Science.gov (United States)

    Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

    2001-08-01

    Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

  13. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    International Nuclear Information System (INIS)

    Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

    2011-01-01

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  14. Abhydrolase domain containing 2, an androgen target gene, promotes prostate cancer cell proliferation and migration.

    Science.gov (United States)

    Obinata, Daisuke; Takada, Shogo; Takayama, Ken-ichi; Urano, Tomohiko; Ito, Akiko; Ashikari, Daisaku; Fujiwara, Kyoko; Yamada, Yuta; Murata, Taro; Kumagai, Jinpei; Fujimura, Tetsuya; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Homma, Yukio; Takahashi, Satoru; Inoue, Satoshi

    2016-04-01

    The androgen receptor (AR) plays a key role in the development of prostate cancer. AR signalling mediates the expression of androgen-responsive genes, which are involved in prostate cancer development and progression. Our previous chromatin immunoprecipitation study showed that the region of abhydrolase domain containing 2 (ABHD2) includes a functional androgen receptor binding site. In this study, we demonstrated that ABHD2 is a novel androgen-responsive gene that is overexpressed in human prostate cancer tissues. The expression levels of ABHD2 in androgen-sensitive cells were evaluated by quantitative reverse transcription polymerase chain reaction and western-blot analyses. LNCaP and VCaP cells with ABHD2 overexpression or short interfering RNA (siRNA) knockdown were used for functional analyses. ABHD2 expression was examined in clinical samples of prostate cancer by immunohistochemistry. We showed that ABHD2 expression is increased by androgen in LNCaP and VCaP cells. This androgen-induced ABHD2 expression was diminished by bicalutamide. While stable expression of ABHD2 affected the enhancement of LNCaP cell proliferation and migration, siRNA-mediated ABHD2 knockdown suppressed cell proliferation and migration. In addition, the siRNA treatment significantly repressed the tumour growth derived from LNCaP cells in athymic mice. Immunohistochemical analysis of ABHD2 expression in tumour specimens showed a positive correlation of ABHD2 immunoreactivity with high Gleason score and pathological N stage. Moreover, patients with high immunoreactivity of ABHD2 showed low cancer-specific survival rates and a resistance to docetaxel-based chemotherapy. ABHD2 is a novel androgen-regulated gene that can promote prostate cancer growth and resistance to chemotherapy, and is a novel target for diagnosis and treatment of prostate cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    International Nuclear Information System (INIS)

    Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun

    2015-01-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  16. Induction of interferon-stimulated genes by IRF3 promotes replication of Toxoplasma gondii.

    Science.gov (United States)

    Majumdar, Tanmay; Chattopadhyay, Saurabh; Ozhegov, Evgeny; Dhar, Jayeeta; Goswami, Ramansu; Sen, Ganes C; Barik, Sailen

    2015-03-01

    Innate immunity is the first line of defense against microbial insult. The transcription factor, IRF3, is needed by mammalian cells to mount innate immune responses against many microbes, especially viruses. IRF3 remains inactive in the cytoplasm of uninfected cells; upon virus infection, it gets phosphorylated and then translocates to the nucleus, where it binds to the promoters of antiviral genes and induces their expression. Such genes include type I interferons (IFNs) as well as Interferon Stimulated Genes (ISGs). IRF3-/- cells support enhanced replication of many viruses and therefore, the corresponding mice are highly susceptible to viral pathogenesis. Here, we provide evidence for an unexpected pro-microbial role of IRF3: the replication of the protozoan parasite, Toxoplasma gondii, was significantly impaired in IRF3-/- cells. In exploring whether the transcriptional activity of IRF3 was important for its pro-parasitic function, we found that ISGs induced by parasite-activated IRF3 were indeed essential, whereas type I interferons were not important. To delineate the signaling pathway that activates IRF3 in response to parasite infection, we used genetically modified human and mouse cells. The pro-parasitic signaling pathway, which we termed PISA (Parasite-IRF3 Signaling Activation), activated IRF3 without any involvement of the Toll-like receptor or RIG-I-like receptor pathways, thereby ruling out a role of parasite-derived RNA species in activating PISA. Instead, PISA needed the presence of cGAS, STING, TBK1 and IRF3, indicating the necessity of DNA-triggered signaling. To evaluate the physiological significance of our in vitro findings, IRF3-/- mice were challenged with parasite infection and their morbidity and mortality were measured. Unlike WT mice, the IRF3-/- mice did not support replication of the parasite and were resistant to pathogenesis caused by it. Our results revealed a new paradigm in which the antiviral host factor, IRF3, plays a cell

  17. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  18. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Jing; Chen, Xi; Liu, Yanan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Xie, Qunhui [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Zhao, Bin, E-mail: binzhao@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Tang, Naijun, E-mail: tangnaijun@tijmu.edu.cn [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China)

    2015-12-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  19. Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

    Science.gov (United States)

    Lintas, Carla; Sacco, Roberto; Persico, Antonio M

    2016-01-01

    Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

  20. The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: 
a Meta-analysis

    Directory of Open Access Journals (Sweden)

    Yichang SUN

    2014-03-01

    Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.

  1. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-09-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  2. Is Graphene a Promising Nano-Material for Promoting Surface Modification of Implants or Scaffold Materials in Bone Tissue Engineering?

    Science.gov (United States)

    Gu, Ming; Liu, Yunsong; Chen, Tong; Du, Feng; Zhao, Xianghui; Xiong, Chunyang

    2014-01-01

    Bone tissue engineering promises to restore bone defects that are caused by severe trauma, congenital malformations, tumors, and nonunion fractures. How to effectively promote the proliferation and osteogenic differentiation of mesenchymal stem cells (MSCs) or seed cells has become a hot topic in this field. Many researchers are studying the ways of conferring a pro-osteodifferentiation or osteoinductive capability on implants or scaffold materials, where osteogenesis of seed cells is promoted. Graphene (G) provides a new kind of coating material that may confer the pro-osteodifferentiation capability on implants and scaffold materials by surface modification. Here, we review recent studies on the effects of graphene on surface modifications of implants or scaffold materials. The ability of graphene to improve the mechanical and biological properties of implants or scaffold materials, such as nitinol and carbon nanotubes, and its ability to promote the adhesion, proliferation, and osteogenic differentiation of MSCs or osteoblasts have been demonstrated in several studies. Most previous studies were performed in vitro, but further studies will explore the mechanisms of graphene's effects on bone regeneration, its in vivo biocompatibility, its ability to promote osteodifferentiation, and its potential applications in bone tissue engineering. PMID:24447041

  3. Is graphene a promising nano-material for promoting surface modification of implants or scaffold materials in bone tissue engineering?

    Science.gov (United States)

    Gu, Ming; Liu, Yunsong; Chen, Tong; Du, Feng; Zhao, Xianghui; Xiong, Chunyang; Zhou, Yongsheng

    2014-10-01

    Bone tissue engineering promises to restore bone defects that are caused by severe trauma, congenital malformations, tumors, and nonunion fractures. How to effectively promote the proliferation and osteogenic differentiation of mesenchymal stem cells (MSCs) or seed cells has become a hot topic in this field. Many researchers are studying the ways of conferring a pro-osteodifferentiation or osteoinductive capability on implants or scaffold materials, where osteogenesis of seed cells is promoted. Graphene (G) provides a new kind of coating material that may confer the pro-osteodifferentiation capability on implants and scaffold materials by surface modification. Here, we review recent studies on the effects of graphene on surface modifications of implants or scaffold materials. The ability of graphene to improve the mechanical and biological properties of implants or scaffold materials, such as nitinol and carbon nanotubes, and its ability to promote the adhesion, proliferation, and osteogenic differentiation of MSCs or osteoblasts have been demonstrated in several studies. Most previous studies were performed in vitro, but further studies will explore the mechanisms of graphene's effects on bone regeneration, its in vivo biocompatibility, its ability to promote osteodifferentiation, and its potential applications in bone tissue engineering.

  4. Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2006-01-01

    In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

  5. THE ABERRANT PROMOTER HYPERMETHYLATION PATTERN OF THE ANTI - ANGIOGENIC TSP1 GENE IN EPITHELIAL OVARIAN CARCINOMA: AN INDIAN STUDY

    Directory of Open Access Journals (Sweden)

    Ramesh

    2015-06-01

    Full Text Available PURPOSE: The promoter hypermethylation patterns of Thrombospodin - 1 gene in 50 EOC patients were studied and the methylation pattern was correlated with various clinic pathological parameters. METHODS: The promoter hypermethylation pattern of the TSP - 1 gene was assessed using nested PCR and Methylation specific PCR. STATISTICAL ANALYSIS: All the available data was statistically analyzed using the Chi square test or Fisher Exact Test on the SPSS software version 22.0 and a value <0.0 5 was considered statistically significant. RESULTS: Forty of the fifty ovarian carcinoma samples reported positive for methylation corresponding to a methylation frequency of 80%. A methylation frequency of 89.2%, 83.3% and 42.8% was observed in malignant , Low malignant potential (borderline and benign sample cohorts. CONCLUSION: From the results drawn from this study, it clearly shows that the anti angiogenic protein TSP - 1 is extensively hypermethylated in ovarian carcinoma and that it accumulates over t he progression of the disease from benign to malignant. As previous reports suggest that there is no evidence of mutation of this gene, promoter hypermethylation may be a crucial factor for the down regulation of the gene. Further by clubbing together the promoter hypermethylation pattern of TSP - 1 gene with hypermethylation patterns of other TSG may provide a better insight into the application of using methylation profiles of TSG as a biomarker in the detection of ovarian carcinoma.

  6. Latent Transforming Growth Factor-beta1 Functionalised Electrospun Scaffolds Promote Human Cartilage Differentiation: Towards an Engineered Cartilage Construct

    Directory of Open Access Journals (Sweden)

    Erh-Hsuin Lim

    2013-11-01

    Full Text Available BackgroundTo overcome the potential drawbacks of a short half-life and dose-related adverse effects of using active transforming growth factor-beta 1 for cartilage engineering, a cell-mediated latent growth factor activation strategy was developed incorporating latent transforming growth factor-β1 (LTGF into an electrospun poly(L-lactide scaffold.MethodsThe electrospun scaffold was surface modified with NH3 plasma and biofunctionalised with LTGF to produce both random and orientated biofunctionalised electrospun scaffolds. Scaffold surface chemical analysis and growth factor bioavailability assays were performed. In vitro biocompatibility and human nasal chondrocyte gene expression with these biofunctionalised electrospun scaffold templates were assessed. In vivo chondrogenic activity and chondrocyte gene expression were evaluated in athymic rats.ResultsChemical analysis demonstrated that LTGF anchored to the scaffolds was available for enzymatic, chemical and cell activation. The biofunctionalised scaffolds were non-toxic. Gene expression suggested chondrocyte re-differentiation after 14 days in culture. By 6 weeks, the implanted biofunctionalised scaffolds had induced highly passaged chondrocytes to re-express Col2A1 and produce type II collagen.ConclusionsWe have demonstrated a proof of concept for cell-mediated activation of anchored growth factors using a novel biofunctionalised scaffold in cartilage engineering. This presents a platform for development of protein delivery systems and for tissue engineering.

  7. The expanding universe of transposon technologies for gene and cell engineering.

    Science.gov (United States)

    Ivics, Zoltán; Izsvák, Zsuzsanna

    2010-12-07

    Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons) can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (sh)RNA expression cassette, a mutagenic gene trap or a therapeutic gene construct) cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB) was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB), discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.

  8. Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.

    Directory of Open Access Journals (Sweden)

    Francesca Grespi

    2011-03-01

    Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.

  9. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  10. Integrator Element as a Promoter of Active Learning in Engineering Teaching

    Science.gov (United States)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-01-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator…

  11. Promoting Reflection on Science, Technology, and Society among Engineering Students through an EAP Online Learning Environment

    Science.gov (United States)

    Arno-Macia, Elisabet; Rueda-Ramos, Carmen

    2011-01-01

    With the new European framework, as EAP lecturers in an engineering college, we are reappraising our teaching and the position of our courses. From the perspective of engineering education in the 21st century, we believe that EAP teaching can focus not only on language and communication needs, but also on developing critical thinking about science…

  12. Biopolymer-Based Nanoparticles for Drug/Gene Delivery and Tissue Engineering

    Science.gov (United States)

    Nitta, Sachiko Kaihara; Numata, Keiji

    2013-01-01

    There has been a great interest in application of nanoparticles as biomaterials for delivery of therapeutic molecules such as drugs and genes, and for tissue engineering. In particular, biopolymers are suitable materials as nanoparticles for clinical application due to their versatile traits, including biocompatibility, biodegradability and low immunogenicity. Biopolymers are polymers that are produced from living organisms, which are classified in three groups: polysaccharides, proteins and nucleic acids. It is important to control particle size, charge, morphology of surface and release rate of loaded molecules to use biopolymer-based nanoparticles as drug/gene delivery carriers. To obtain a nano-carrier for therapeutic purposes, a variety of materials and preparation process has been attempted. This review focuses on fabrication of biocompatible nanoparticles consisting of biopolymers such as protein (silk, collagen, gelatin, β-casein, zein and albumin), protein-mimicked polypeptides and polysaccharides (chitosan, alginate, pullulan, starch and heparin). The effects of the nature of the materials and the fabrication process on the characteristics of the nanoparticles are described. In addition, their application as delivery carriers of therapeutic drugs and genes and biomaterials for tissue engineering are also reviewed. PMID:23344060

  13. Biopolymer-Based Nanoparticles for Drug/Gene Delivery and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Keiji Numata

    2013-01-01

    Full Text Available There has been a great interest in application of nanoparticles as biomaterials for delivery of therapeutic molecules such as drugs and genes, and for tissue engineering. In particular, biopolymers are suitable materials as nanoparticles for clinical application due to their versatile traits, including biocompatibility, biodegradability and low immunogenicity. Biopolymers are polymers that are produced from living organisms, which are classified in three groups: polysaccharides, proteins and nucleic acids. It is important to control particle size, charge, morphology of surface and release rate of loaded molecules to use biopolymer-based nanoparticles as drug/gene delivery carriers. To obtain a nano-carrier for therapeutic purposes, a variety of materials and preparation process has been attempted. This review focuses on fabrication of biocompatible nanoparticles consisting of biopolymers such as protein (silk, collagen, gelatin, β-casein, zein and albumin, protein-mimicked polypeptides and polysaccharides (chitosan, alginate, pullulan, starch and heparin. The effects of the nature of the materials and the fabrication process on the characteristics of the nanoparticles are described. In addition, their application as delivery carriers of therapeutic drugs and genes and biomaterials for tissue engineering are also reviewed.

  14. Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters

    OpenAIRE

    Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.

    2011-01-01

    The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...

  15. An approach for reduction of false predictions in reverse engineering of gene regulatory networks.

    Science.gov (United States)

    Khan, Abhinandan; Saha, Goutam; Pal, Rajat Kumar

    2018-05-14

    A gene regulatory network discloses the regulatory interactions amongst genes, at a particular condition of the human body. The accurate reconstruction of such networks from time-series genetic expression data using computational tools offers a stiff challenge for contemporary computer scientists. This is crucial to facilitate the understanding of the proper functioning of a living organism. Unfortunately, the computational methods produce many false predictions along with the correct predictions, which is unwanted. Investigations in the domain focus on the identification of as many correct regulations as possible in the reverse engineering of gene regulatory networks to make it more reliable and biologically relevant. One way to achieve this is to reduce the number of incorrect predictions in the reconstructed networks. In the present investigation, we have proposed a novel scheme to decrease the number of false predictions by suitably combining several metaheuristic techniques. We have implemented the same using a dataset ensemble approach (i.e. combining multiple datasets) also. We have employed the proposed methodology on real-world experimental datasets of the SOS DNA Repair network of Escherichia coli and the IMRA network of Saccharomyces cerevisiae. Subsequently, we have experimented upon somewhat larger, in silico networks, namely, DREAM3 and DREAM4 Challenge networks, and 15-gene and 20-gene networks extracted from the GeneNetWeaver database. To study the effect of multiple datasets on the quality of the inferred networks, we have used four datasets in each experiment. The obtained results are encouraging enough as the proposed methodology can reduce the number of false predictions significantly, without using any supplementary prior biological information for larger gene regulatory networks. It is also observed that if a small amount of prior biological information is incorporated here, the results improve further w.r.t. the prediction of true positives

  16. Non-viral gene delivery strategies for cancer therapy, tissue engineering and regenerative medicine

    Science.gov (United States)

    Bhise, Nupura S.

    Gene therapy involves the delivery of deoxyribonucleic acid (DNA) into cells to override or replace a malfunctioning gene for treating debilitating genetic diseases, including cancer and neurodegenerative diseases. In addition to its use as a therapeutic, it can also serve as a technology to enable regenerative medicine strategies. The central challenge of the gene therapy research arena is developing a safe and effective delivery agent. Since viral vectors have critical immunogenic and tumorogenic safety issues that limit their clinical use, recent efforts have focused on developing non-viral biomaterial based delivery vectors. Cationic polymers are an attractive class of gene delivery vectors due to their structural versatility, ease of synthesis, biodegradability, ability to self-complex into nanoparticles with negatively charged DNA, capacity to carry large cargo, cellular uptake and endosomal escape capacity. In this thesis, we hypothesized that developing a biomaterial library of poly(betaamino esters) (PBAE), a newer class of cationic polymers consisting of biodegradable ester groups, would allow investigating vector design parameters and formulating effective non-viral gene delivery strategies for cancer drug delivery, tissue engineering and stem cell engineering. Consequently, a high-throughput transfection assay was developed to screen the PBAE-based nanoparticles in hard to transfect fibroblast cell lines. To gain mechanistic insights into the nanoparticle formulation process, biophysical properties of the vectors were characterized in terms of molecular weight (MW), nanoparticle size, zeta potential and plasmid per particle count. We report a novel assay developed for quantifying the plasmid per nanoparticle count and studying its implications for co-delivery of multiple genes. The MW of the polymers ranged from 10 kDa to 100 kDa, nanoparticle size was about 150 run, zeta potential was about 30 mV in sodium acetate buffer (25 mM, pH 5) and 30 to 100

  17. Mediator, TATA-binding Protein, and RNA Polymerase II Contribute to Low Histone Occupancy at Active Gene Promoters in Yeast*

    Science.gov (United States)

    Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.

    2014-01-01

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477

  18. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    International Nuclear Information System (INIS)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-01-01

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  19. Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter

    Science.gov (United States)

    Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.

    2011-01-01

    Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are

  20. Functional Characterization of the Tau Class Glutathione-S-Transferases Gene (SbGSTU) Promoter of Salicornia brachiata under Salinity and Osmotic Stress.

    Science.gov (United States)

    Tiwari, Vivekanand; Patel, Manish Kumar; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2016-01-01

    Reactive oxygen or nitrogen species are generated in the plant cell during the extreme stress condition, which produces toxic compounds after reacting with the organic molecules. The glutathione-S-transferase (GST) enzymes play a significant role to detoxify these toxins and help in excretion or sequestration of them. In the present study, we have cloned 1023 bp long promoter region of tau class GST from an extreme halophyte Salicornia brachiata and functionally characterized using the transgenic approach in tobacco. Computational analysis revealed the presence of abiotic stress responsive cis-elements like ABRE, MYB, MYC, GATA, GT1 etc., phytohormones, pathogen and wound responsive motifs. Three 5'-deletion constructs of 730 (GP2), 509 (GP3) and 348 bp (GP4) were made from 1023 (GP1) promoter fragment and used for tobacco transformation. The single event transgenic plants showed notable GUS reporter protein expression in the leaf tissues of control as well as treated plants. The expression level of the GUS gradually decreases from GP1 to GP4 in leaf tissues, whereas the highest level of expression was detected with the GP2 construct in root and stem under control condition. The GUS expression was found higher in leaves and stems of salinity or osmotic stress treated transgenic plants than that of the control plants, but, lower in roots. An efficient expression level of GUS in transgenic plants suggests that this promoter can be used for both constitutive as well as stress inducible expression of gene(s). And this property, make it as a potential candidate to be used as an alternative promoter for crop genetic engineering.

  1. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  2. Valsartan Promoting Atherosclerotic Plaque Stabilization by Upregulating Renalase: A Potential-Related Gene of Atherosclerosis.

    Science.gov (United States)

    Zhou, Mingxue; Ma, Chao; Liu, Weihong; Liu, Hongxu; Wang, Ning; Kang, Qunfu; Li, Ping

    2015-09-01

    Renalase is a protein that can regulate sympathetic nerve activity by metabolizing catecholamines, while redundant catecholamines are thought to contribute to atherosclerosis (As). Catecholamine release can be facilitated by angiotensin (Ang) II by binding to Ang II type 1 (AT1) receptors. Valsartan, a special AT1 antagonist, can dilate blood vessels and reduce blood pressure, but it remained unclear whether valsartan can promote the stability of atherosclerotic plaque by affecting renalase. This study examined the tissue distribution of renalase in ApoE(-/-) mice fed with a high-fat diet and the effect of valsartan on expression of renalase. ApoE(-/-) mice were fed with a high-fat diet for 13 or 26 weeks. As a control, 10 C57BL mice were fed with a standard chow diet. After 13 weeks on the high-fat diet, the ApoE(-/-) mice were randomized (10 mice/group) and treated with valsartan, simvastatin, or distilled water (control group) for an additional 13 weeks accompanied by a high-fat diet. Knockout of ApoE caused a dramatic increase in expression of renalase in mice adipose tissue. With the disturbance of lipid metabolism induced by a high-fat diet, renalase expression decreased in the liver. Renalase can be expressed in smooth muscle cells and M2 macrophages in atherosclerotic plaque, and its expression gradually decreases in the fibrous cap during the transition from stable to vulnerable atherosclerotic plaque. Valsartan, an AT1 receptor antagonist, promotes the stabilization of atherosclerotic plaque by increasing the levels of renalase in serum and the expression of renalase in the fibrous cap of atherosclerotic plaque. It also reduces triglyceride levels in serum and increases the expression of renalase in the liver. Renalase may be a potential-related gene of lipid metabolism and As, and it may be the possible molecular target of valsartan to help stabilize atherosclerotic plaque. © The Author(s) 2015.

  3. Tissue-engineered human bioartificial muscles expressing a foreign recombinant protein for gene therapy

    Science.gov (United States)

    Powell, C.; Shansky, J.; Del Tatto, M.; Forman, D. E.; Hennessey, J.; Sullivan, K.; Zielinski, B. A.; Vandenburgh, H. H.

    1999-01-01

    Murine skeletal muscle cells transduced with foreign genes and tissue engineered in vitro into bioartificial muscles (BAMs) are capable of long-term delivery of soluble growth factors when implanted into syngeneic mice (Vandenburgh et al., 1996b). With the goal of developing a therapeutic cell-based protein delivery system for humans, similar genetic tissue-engineering techniques were designed for human skeletal muscle stem cells. Stem cell myoblasts were isolated, cloned, and expanded in vitro from biopsied healthy adult (mean age, 42 +/- 2 years), and elderly congestive heart failure patient (mean age, 76 +/- 1 years) skeletal muscle. Total cell yield varied widely between biopsies (50 to 672 per 100 mg of tissue, N = 10), but was not significantly different between the two patient groups. Percent myoblasts per biopsy (73 +/- 6%), number of myoblast doublings prior to senescence in vitro (37 +/- 2), and myoblast doubling time (27 +/- 1 hr) were also not significantly different between the two patient groups. Fusion kinetics of the myoblasts were similar for the two groups after 20-22 doublings (74 +/- 2% myoblast fusion) when the biopsy samples had been expanded to 1 to 2 billion muscle cells, a number acceptable for human gene therapy use. The myoblasts from the two groups could be equally transduced ex vivo with replication-deficient retroviral expression vectors to secrete 0.5 to 2 microg of a foreign protein (recombinant human growth hormone, rhGH)/10(6) cells/day, and tissue engineered into human BAMs containing parallel arrays of differentiated, postmitotic myofibers. This work suggests that autologous human skeletal myoblasts from a potential patient population can be isolated, genetically modified to secrete foreign proteins, and tissue engineered into implantable living protein secretory devices for therapeutic use.

  4. Contribution of the Pmra Promoter to Expression of Genes in the Escherichia coli mra Cluster of Cell Envelope Biosynthesis and Cell Division Genes

    Science.gov (United States)

    Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi

    1998-01-01

    Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276

  5. Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2005-01-01

    In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

  6. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site

    DEFF Research Database (Denmark)

    Schulze, A; Zerfass, K; Spitkovsky, D

    1995-01-01

    Cyclin A is involved in the control of S phase and mitosis in mammalian cells. Expression of the cyclin A gene in nontransformed cells is characterized by repression of its promoter during the G1 phase of the cell cycle and its induction at S-phase entry. We show that this mode of regulation...

  7. Key tumor suppressor genes inactivated by "greater promoter" methylation and somatic mutations in head and neck cancer

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David

    Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing

  8. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    Science.gov (United States)

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  9. Clinical Utility of promoter methylation of the tumor suppressor genes DKK3, and RASSF1A in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Marwa H. Saied

    2018-04-01

    Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1

  10. A compact dual promoter adeno-associated viral vector for efficient delivery of two genes to dorsal root ganglion neurons

    NARCIS (Netherlands)

    Fagoe, N D; Eggers, R; Verhaagen, J; Mason, M R J

    Adeno-associated viral (AAV) vectors based on serotype 5 are an efficient means to target dorsal root ganglia (DRG) to study gene function in the primary sensory neurons of the peripheral nervous system. In this study, we have developed a compact AAV dual promoter vector composed of the

  11. Exploring the potential of the glycerol-3-phosphate dehydrogenase 2 (GPD2) promoter for recombinant gene expression in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna

    2015-01-01

    A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...

  12. Tissue-specific production of limonene in Camelina sativa with the Arabidopsis promoters of genes BANYULS and FRUITFULL

    NARCIS (Netherlands)

    Borghi, Monica; Xie, De Yu

    2016-01-01

    Main conclusion: Arabidopsis promoters of genesBANYULSandFRUITFULLare transcribed in Camelina. They triggered the transcription oflimonene synthaseand induced higher limonene production in seeds and fruits thanCaMV 35Spromoter.Camelina sativa (Camelina) is an oilseed crop of relevance for the

  13. DNA Methyltransferase 3B Gene Promoter and Interleukin-1 Receptor Antagonist Polymorphisms in Childhood Immune Thrombocytopenia

    Directory of Open Access Journals (Sweden)

    Margarita Pesmatzoglou

    2012-01-01

    Full Text Available Primary immune thrombocytopenia (ITP is one of the most common blood diseases as well as the commonest acquired bleeding disorder in childhood. Although the etiology of ITP is unclear, in the pathogenesis of the disease, both environmental and genetic factors including polymorphisms of TNF-a, IL-10, and IL-4 genes have been suggested to be involved. In this study, we investigated the rs2424913 single-nucleotide polymorphism (SNP (C46359T in DNA methyltransferase 3B (DNMT3B gene promoter and the VNTR polymorphism of IL-1 receptor antagonist (IL-1 Ra intron-2 in 32 children (17 boys with the diagnosis of ITP and 64 healthy individuals. No significant differences were found in the genotype distribution of DNMT3B polymorphism between the children with ITP and the control group, whereas the frequency of allele T appeared significantly increased in children with ITP (P = 0.03, OR = 2, 95% CI: 1.06–3.94. In case of IL-1 Ra polymorphism, children with ITP had a significantly higher frequency of genotype I/II, compared to control group (P = 0.043, OR = 2.60, 95% CI: 1.02–6.50. Moreover, genotype I/I as well as allele I was overrepresented in the control group, suggesting that allele I may have a decreased risk for development of ITP. Our findings suggest that rs2424913 DNMT3B SNP as well as IL-1 Ra VNTR polymorphism may contribute to the susceptibility to ITP.

  14. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  15. Retention and promotion of women and underrepresented minority faculty in science and engineering at four large land grant institutions.

    Science.gov (United States)

    Gumpertz, Marcia; Durodoye, Raifu; Griffith, Emily; Wilson, Alyson

    2017-01-01

    In the most recent cohort, 2002-2015, the experiences of men and women differed substantially among STEM disciplines. Female assistant professors were more likely than men to leave the institution and to leave without tenure in engineering, but not in the agricultural, biological and biomedical sciences and natural resources or physical and mathematical sciences. In contrast, the median times to promotion from associate to full professor were similar for women and men in engineering and the physical and mathematical sciences, but one to two years longer for women than men in the agricultural, biological and biomedical sciences and natural resources. URM faculty hiring is increasing, but is well below the proportions earning doctoral degrees in STEM disciplines. The results are variable and because of the small numbers of URM faculty, the precision and power for comparing URM faculty to other faculty were low. In three of the four institutions, lower fractions of URM faculty than other faculty hired in the 2002-2006 time frame left without tenure. Also, in the biological and biomedical and physical and mathematical sciences no URM faculty left without tenure. On the other hand, at two of the institutions, significantly more URM faculty left before their tenth anniversary than other faculty and in engineering significantly more URM faculty than other faculty left before their tenth anniversary. We did not find significant differences in promotion patterns between URM and other faculty.

  16. Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer. | Office of Cancer Genomics

    Science.gov (United States)

    Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK, and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in TCGA datasets.

  17. A comparison of educational factors promoting or discouraging the intent to remain in engineering by gender

    Science.gov (United States)

    Amelink, Catherine T.; Meszaros, Peggy S.

    2011-03-01

    This study seeks to examine key extrinsic and intrinsic factors that encourage or discourage persistence in attaining an engineering degree and pursuing an engineering-related career among both male and female undergraduates. Quantitative and qualitative findings from nine participating undergraduate degree programmes reveal that career expectations formulated through educational experiences as undergraduates play a key role in motivating students. Among females, faculty interaction in the classroom, such as feedback received and the degree to which the faculty treat them with respect, is an important encouraging factor. For both males and females, discouraging elements of the undergraduate experience include the amount of time for coursework, competition in engineering classes and grades. The findings have several practical implications that faculty and administrators can employ in shaping the undergraduate experience to encourage short- and long-term interest in engineering among both male and female students.

  18. Natural and modified promoters for tailored metabolic engineering of the yeast Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Hubmann, Georg; Thevelein, Johan M; Nevoigt, Elke

    2014-01-01

    The ease of highly sophisticated genetic manipulations in the yeast Saccharomyces cerevisiae has initiated numerous initiatives towards development of metabolically engineered strains for novel applications beyond its traditional use in brewing, baking, and wine making. In fact, baker's yeast has

  19. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    Science.gov (United States)

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  20. Lessons learned in promoting new technologies and engineering in girls through a girls hackathon and mentoring

    OpenAIRE

    Ruiz-Garcia, Aurelio; Subirats, Laia; Freire, Ana

    2016-01-01

    The under-representation of women in engineering is becoming a matter of concern as it has implications both for the women themselves and for the development of the digital economy sector. To address this issue, a girls hackathon and a mentorship program have been held at Universitat Pompeu Fabra (Barcelona, Spain) with the aim of bringing more women into computing. Questionnaires deployed after the event indicate that it was a powerful initiative to encourage girls to study engineering degre...

  1. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  2. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  3. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  4. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  5. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita

    2017-06-01

    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  6. Significant association between polymorphism of the erythropoietin gene promoter and myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    O'Brien Susan

    2010-11-01

    Full Text Available Abstract Background Myelodysplastic syndrome (MDS may be induced by certain mutagenic environmental or chemotherapeutic toxins; however, the role of susceptibility genes remains unclear. The G/G genotype of the single-nucleotide polymorphism (SNP rs1617640 in the erythropoietin (EPO promoter has been shown to be associated with decreased EPO expression. We examined the association of rs1617640 genotype with MDS. Methods We genotyped the EPO rS1617640 SNP in 189 patients with MDS, 257 with acute myeloid leukemia (AML, 106 with acute lymphoblastic leukemia, 97 with chronic lymphocytic leukemia, 353 with chronic myeloid leukemia, and 95 healthy controls. Results The G/G genotype was significantly more common in MDS patients (47/187; 25.1% than in controls (6/95; 6.3% or in patients with other leukemias (101/813; 12.4% (all P P = 0.03. Time to neutrophils recovery after therapy was significantly longer in MDS patients with the G/G genotype (P = 0.02. Conclusions These findings suggest a strong association between the rs1617640 G/G genotype and MDS. Further studies are warranted to investigate the utility of screening for this marker in individuals exposed to environmental toxins or chemotherapy.

  7. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  8. Promoter Methylation and BDNF and DAT1 Gene Expression Profiles in Patients with Drug Addiction.

    Science.gov (United States)

    Kordi-Tamandani, Dor Mohammad; Tajoddini, Shahrad; Salimi, Farzaneh

    2015-01-01

    Drug addiction is a brain disorder that has negative consequences for individuals and society. Addictions are chronic relapsing diseases of the brain that are caused by direct drug-induced effects and persevering neuroadaptations at the epigenetic, neuropeptide and neurotransmitter levels. Because the dopaminergic system has a significant role in drug abuse, the purpose of this study was to analyze the methylation and expression profile of brain-derived neurotrophic factor (BDNF) and dopamine transporter (DAT1) genes in individuals with drug addiction. BDNF and DAT1 promoter methylation were investigated with a methylation-specific polymerase chain reaction (PCR) technique in blood samples from 75 individuals with drug addiction and 65 healthy controls. The expression levels of BDNF and DAT1 were assessed in 12 mRNA samples from the blood of patients and compared to the samples of healthy controls (n = 12) with real-time quantitative reverse transcription PCR. No significant differences were found in the methylation of BDNF and DAT1 between patients and controls, but the relative levels of expression of BDNF and DAT1 mRNA differed significantly in the patients compared to controls (p drug addiction.

  9. Association between a promoter dopamine D2 receptor gene variant and the personality trait detachment.

    Science.gov (United States)

    Jönsson, Erik G; Cichon, Sven; Gustavsson, J Petter; Grünhage, Frank; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Farde, Lars; Propping, Peter; Nöthen, Markus M

    2003-04-01

    Personality traits have shown considerable heritable components. Striatal dopamine D(2) receptor density, as determined by positron-emission tomography, has been associated with detached personality, as assessed by the Karolinska Scales of Personality. A putative functional promoter polymorphism in the dopamine D(2) receptor gene (DRD2), -141C ins/del, has been associated with dopamine D(2) receptor density. In this study healthy subjects (n = 235) who filled in at least one of several personality questionnaires (Karolinska Scales of Personality, Swedish Universities Scales of Personality, Health-relevant Five-factor Personality Inventory, and Temperament and Character Inventory) were analyzed with regard to the DRD2 -141C ins/del variant. There was an association (p =.001) between the DRD2 -141C ins/del variant and Karolinska Scales of Personality Detachment scale, indicating higher scores in subjects with the -141C del variant. There were also associations between the DRD2 -141C ins/del variant and a number of Karolinska Scales of Personality and Swedish Universities Scales of Personality Neuroticism-related scales, but of these only Swedish Universities Scales of Personality Lack of Assertiveness scale (p =.001) survived correction for multiple testing. These results add further support for the involvement of dopamine D(2) receptor in certain personality traits. The results should be treated with caution until replicated.

  10. Upregulated Expression of a Unique Gene by Hepatitis B x Antigen Promotes Hepatocellular Growth and Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Zhaorui Lian

    2003-05-01

    Full Text Available Hepatitis B x antigen (HBxAg is a trans-activating protein that may be involved in hepatocarcinogenesis, although few natural effectors of HBxAg that participate in this process have been identified. To identify additional effectors, whole cell RNA isolated from HBxAg-positive and HBxAg-negative HepG2 cells were compared by polymerase chain reaction select cDNA subtraction, and one clone, upregulated gene, clone 11 (URG11, was chosen for further characterization. Elevated levels of URG11 mRNA and protein were observed in HBxAg-positive compared to HBxAg-negative HepG2 cells. Costaining was observed in infected liver (P<.01. URG11 stimulated cell growth in culture (P<.01, anchorage-independent growth in soft agar (P<.001, and accelerated tumor formation (P<.01, and yielded larger tumors (P<.02 in SCID mice injected subcutaneously with HepG2 cells. These data suggest that URG11 is a natural effector of HBxAg that may promote the development of hepatocellular carcinoma.

  11. Mono-(2-Ethylhexyl Phthalate Promotes Pro-Labor Gene Expression in the Human Placenta.

    Directory of Open Access Journals (Sweden)

    Ximi K Wang

    Full Text Available Women exposed to phthalates during pregnancy are at increased risk for delivering preterm, but the mechanism behind this relationship is unknown. Placental corticotropin-releasing hormone (CRH and cyclooxygenase-2 (COX-2 are key mediators of parturition and are regulated by the non-canonical NF-kB (RelB/p52 signaling pathway. In this study, we demonstrate that one of the major phthalate metabolites, mono-(2-ethylhexyl-phthalate (MEHP, increased CRH and COX-2 mRNA and protein abundance in a dose-dependent manner in primary cultures of cytotrophoblast. This was coupled with an increase in nuclear import of RelB/p52 and its association with the CRH and COX-2 promoters. Silencing of NF-kB inducing kinase, a central signaling component of the non-canonical NF-kB pathway, blocked MEHP-induced upregulation of CRH and COX-2. These results suggest a potential mechanism mediated by RelB/p52 by which phthalates could prematurely induce pro-labor gene activity and lead to preterm birth.

  12. Pseudogene PHBP1 promotes esophageal squamous cell carcinoma proliferation by increasing its cognate gene PHB expression.

    Science.gov (United States)

    Feng, Feiyue; Qiu, Bin; Zang, Ruochuan; Song, Peng; Gao, Shugeng

    2017-04-25

    Natural antisense transcripts (NATs) as one of the most diverse classes of long noncoding RNAs (lncRNAs), have been demonstrated involved in fundamental biological processes in human. Here, we reported that human prohibitin gene pseudogene 1 (PHBP1) was upregulated in ESCC, and increased PHBP1 expression in ESCC was associated with clinical advanced stage. Functional experiments showed that PHBP1 knockdown inhibited ESCC cells proliferation, colony formation and xenograft tumor growth in vitro and in vivo by causing cell-cycle arrest at the G1-G0 phase. Mechanisms analysis revealed that PHBP1 transcript as an antisense transcript of PHB is partially complementary to PHB mRNA and formed an RNA-RNA hybrid with PHB, consequently inducing an increase of PHB expression at both the mRNA and protein levels. Furthermore, PHBP1 expression is strongly correlated with PHB expression in ESCC tissues. Collectively, this study elucidates an important role of PHBP1 in promoting ESCC partly via increasing PHB expression.

  13. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others

    2011-09-09

    Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  14. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    International Nuclear Information System (INIS)

    Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua

    2011-01-01

    Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  15. Gene Amplification on Demand Accelerates Cellobiose Utilization in Engineered Saccharomyces cerevisiae.

    Science.gov (United States)

    Oh, Eun Joong; Skerker, Jeffrey M; Kim, Soo Rin; Wei, Na; Turner, Timothy L; Maurer, Matthew J; Arkin, Adam P; Jin, Yong-Su

    2016-06-15

    Efficient microbial utilization of cellulosic sugars is essential for the economic production of biofuels and chemicals. Although the yeast Saccharomyces cerevisiae is a robust microbial platform widely used in ethanol plants using sugar cane and corn starch in large-scale operations, glucose repression is one of the significant barriers to the efficient fermentation of cellulosic sugar mixtures. A recent study demonstrated that intracellular utilization of cellobiose by engineered yeast expressing a cellobiose transporter (encoded by cdt-1) and an intracellular β-glucosidase (encoded by gh1-1) can alleviate glucose repression, resulting in the simultaneous cofermentation of cellobiose and nonglucose sugars. Here we report enhanced cellobiose fermentation by engineered yeast expressing cdt-1 and gh1-1 through laboratory evolution. When cdt-1 and gh1-1 were integrated into the genome of yeast, the single copy integrant showed a low cellobiose consumption rate. However, cellobiose fermentation rates by engineered yeast increased gradually during serial subcultures on cellobiose. Finally, an evolved strain exhibited a 15-fold-higher cellobiose fermentation rate. To identify the responsible mutations in the evolved strain, genome sequencing was performed. Interestingly, no mutations affecting cellobiose fermentation were identified, but the evolved strain contained 9 copies of cdt-1 and 23 copies of gh1-1 We also traced the copy numbers of cdt-1 and gh1-1 of mixed populations during the serial subcultures. The copy numbers of cdt-1 and gh1-1 in the cultures increased gradually with similar ratios as cellobiose fermentation rates of the cultures increased. These results suggest that the cellobiose assimilation pathway (transport and hydrolysis) might be a rate-limiting step in engineered yeast and copies of genes coding for metabolic enzymes might be amplified in yeast if there is a growth advantage. This study indicates that on-demand gene amplification might be an

  16. Development of an angiogenesis-promoting microvesicle-alginate-polycaprolactone composite graft for bone tissue engineering applications

    Directory of Open Access Journals (Sweden)

    Hui Xie

    2016-05-01

    Full Text Available One of the major challenges of bone tissue engineering applications is to construct a fully vascularized implant that can adapt to hypoxic environments in vivo. The incorporation of proangiogenic factors into scaffolds is a widely accepted method of achieving this goal. Recently, the proangiogenic potential of mesenchymal stem cell-derived microvesicles (MSC-MVs has been confirmed in several studies. In the present study, we incorporated MSC-MVs into alginate-polycaprolactone (PCL constructs that had previously been developed for bone tissue engineering applications, with the aim of promoting angiogenesis and bone regeneration. MSC-MVs were first isolated from the supernatant of rat bone marrow-derived MSCs and characterized by scanning electron microscopic, confocal microscopic, and flow cytometric analyses. The proangiogenic potential of MSC-MVs was demonstrated by the stimulation of tube formation of human umbilical vein endothelial cells in vitro. MSC-MVs and osteodifferentiated MSCs were then encapsulated with alginate and seeded onto porous three-dimensional printed PCL scaffolds. When combined with osteodifferentiated MSCs, the MV-alginate-PCL constructs enhanced vessel formation and tissue-engineered bone regeneration in a nude mouse subcutaneous bone formation model, as demonstrated by micro-computed tomographic, histological, and immunohistochemical analyses. This MV-alginate-PCL construct may offer a novel, proangiogenic, and cost-effective option for bone tissue engineering.

  17. Factors promoting increased rate of tissue regeneration: the zebrafish fin as a tool for examining tissue engineering design concepts.

    Science.gov (United States)

    Boominathan, Vijay P; Ferreira, Tracie L

    2012-12-01

    Student interest in topics of tissue engineering is increasing exponentially as the number of universities offering programs in bioengineering are on the rise. Bioengineering encompasses all of the STEM categories: Science, Technology, Engineering, and Math. Inquiry-based learning is one of the most effective techniques for promoting student learning and has been demonstrated to have a high impact on learning outcomes. We have designed program outcomes for our bioengineering program that require tiered activities to develop problem solving skills, peer evaluation techniques, and promote team work. While it is ideal to allow students to ask unique questions and design their own experiments, this can be difficult for instructors to have reagents and supplies available for a variety of activities. Zebrafish can be easily housed, and multiple variables can be tested on a large enough group to provide statistical value, lending them well to inquiry-based learning modules. We have designed a laboratory activity that takes observation of fin regeneration to the next level: analyzing conditions that may impact regeneration. Tissue engineers seek to define the optimum conditions to grow tissue for replacement parts. The field of tissue engineering is likely to benefit from understanding natural mechanisms of regeneration and the factors that influence the rate of regeneration. We have outlined the results of varying temperature on fin regeneration and propose other inquiry modules such as the role of pH in fin regeneration. Furthermore, we have provided useful tools for developing critical thinking and peer review of research ideas, assessment guidelines, and grading rubrics for the activities associated with this exercise.

  18. Nonsense and missense mutation of mitochondrial ND6 gene promotes cell migration and invasion in human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong

    2015-01-01

    Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS

  19. Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation: indicators of tumor staging and metastasis in adenocarcinomatous sporadic colorectal cancer in Indian population.

    Directory of Open Access Journals (Sweden)

    Rupal Sinha

    Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.

  20. The expanding universe of transposon technologies for gene and cell engineering

    Directory of Open Access Journals (Sweden)

    Ivics Zoltán

    2010-12-01

    Full Text Available Abstract Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (shRNA expression cassette, a mutagenic gene trap or a therapeutic gene construct cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB, discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.

  1. Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

    Science.gov (United States)

    Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

    2017-07-01

    Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

  2. Promoting entrepreneurship among informatics engineering students: insights from a case study

    Science.gov (United States)

    Fernandes, João M.; Afonso, Paulo; Fonte, Victor; Alves, Victor; Ribeiro, António Nestor

    2017-01-01

    Universities seek to promote entrepreneurship through effective education approaches, which need to be in permanent evolution. Nevertheless, the literature in entrepreneurship education lacks empirical evidence. This article discusses relevant issues related to promoting entrepreneurship in the software field, based on the experience of a 15-European Credit Transfer and Accumulation System course. This course seeks to instil in the students the recognition of the need to reconcile technical and business visions, organisational and commercial aspects, most of which have never been addressed previously. A series of semi-structured interviews made it possible to obtain relevant insights about the teaching-learning process underlying this course and its evolution over a seven-year period. Materials related with this course have been analysed, namely guidelines produced by the teachers and deliverables produced by the students. This article discusses the dimensions that were identified as fundamental for promoting entrepreneurship skills in the field of software, namely teamwork, project engagement, and contact with the market.

  3. Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.

    Science.gov (United States)

    Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T

    2017-08-01

    X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Dynamic O-GlcNAc cycling at promoters of Caenorhabditis elegans genes regulating longevity, stress, and immunity.

    Science.gov (United States)

    Love, Dona C; Ghosh, Salil; Mondoux, Michelle A; Fukushige, Tetsunari; Wang, Peng; Wilson, Mark A; Iser, Wendy B; Wolkow, Catherine A; Krause, Michael W; Hanover, John A

    2010-04-20

    Nutrient-driven O-GlcNAcylation of key components of the transcription machinery may epigenetically modulate gene expression in metazoans. The global effects of GlcNAcylation on transcription can be addressed directly in C. elegans because knockouts of the O-GlcNAc cycling enzymes are viable and fertile. Using anti-O-GlcNAc ChIP-on-chip whole-genome tiling arrays on wild-type and mutant strains, we detected over 800 promoters where O-GlcNAc cycling occurs, including microRNA loci and multigene operons. Intriguingly, O-GlcNAc-marked promoters are biased toward genes associated with PIP3 signaling, hexosamine biosynthesis, and lipid/carbohydrate metabolism. These marked genes are linked to insulin-like signaling, metabolism, aging, stress, and pathogen-response pathways in C. elegans. Whole-genome transcriptional profiling of the O-GlcNAc cycling mutants confirmed dramatic deregulation of genes in these key pathways. As predicted, the O-GlcNAc cycling mutants show altered lifespan and UV stress susceptibility phenotypes. We propose that O-GlcNAc cycling at promoters participates in a molecular program impacting nutrient-responsive pathways in C. elegans, including stress, pathogen response, and adult lifespan. The observed impact of O-GlcNAc cycling on both signaling and transcription in C. elegans has important implications for human diseases of aging, including diabetes and neurodegeneration.

  5. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    Science.gov (United States)

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  6. Lactoferrin gene promoter variants and their association with clinical and subclinical mastitis in indigenous and crossbred cattle.

    Science.gov (United States)

    Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V

    2015-01-01

    Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (pmastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.

  7. Engineering low-cadmium rice through stress-inducible expression of OXS3-family member genes.

    Science.gov (United States)

    Wang, Changhu; Guo, Weili; Cai, Xingzhe; Li, Ruyu; Ow, David W

    2018-04-21

    Cadmium (Cd) as a carcinogen poses a great threat to food security and public health through plant-derived foods such as rice, the staple for nearly half of the world's population. We have previously reported that overexpression of truncated gene fragments derived from the rice genes OsO3L2 and OsO3L3 could reduce Cd accumulation in transgenic rice. However, we did not test the full length genes due to prior work in Arabidopsis where overexpression of these genes caused seedling lethality. Here, we report on limiting the overexpression of OsO3L2 and OsO3L3 through the use of the stress- inducible promoter RD29B. However, despite generating 625 putative transformants, only 7 lines survived as T1 seedlings and only 1 line of each overexpressed OsO3L2 or OsO3L3-produced T2 progeny. The T2 homozygotes from these 2 lines showed the same effect of reducing accumulation of Cd in root and shoot as well as in T3 grain. As importantly, the concentrations of essential metals copper (Cu), iron (Fe), manganese (Mn) and zinc (Zn) were unaffected. Analysis of the expression profile suggested that low Cd accumulation may be due to high expression of OsO3L2 and OsO3L3 in the root tip region. Cellular localization of OsO3L2 and OsO3L3 indicate that they are histone H2A interacting nuclear proteins in vascular cells and especially in the root tip region. It is possible that interaction with histone H2A modifies chromatin to regulate downstream gene expression. Copyright © 2018. Published by Elsevier B.V.

  8. Assessment of clusters of transcription factor binding sites in relationship to human promoter, CpG islands and gene expression

    Directory of Open Access Journals (Sweden)

    Sakaki Yoshiyuki

    2004-02-01

    Full Text Available Abstract Background Gene expression is regulated mainly by transcription factors (TFs that interact with regulatory cis-elements on DNA sequences. To identify functional regulatory elements, computer searching can predict TF binding sites (TFBS using position weight matrices (PWMs that represent positional base frequencies of collected experimentally determined TFBS. A disadvantage of this approach is the large output of results for genomic DNA. One strategy to identify genuine TFBS is to utilize local concentrations of predicted TFBS. It is unclear whether there is a general tendency for TFBS to cluster at promoter regions, although this is the case for certain TFBS. Also unclear is the identification of TFs that have TFBS concentrated in promoters and to what level this occurs. This study hopes to answer some of these questions. Results We developed the cluster score measure to evaluate the correlation between predicted TFBS clusters and promoter sequences for each PWM. Non-promoter sequences were used as a control. Using the cluster score, we identified a PWM group called PWM-PCP, in which TFBS clusters positively correlate with promoters, and another PWM group called PWM-NCP, in which TFBS clusters negatively correlate with promoters. The PWM-PCP group comprises 47% of the 199 vertebrate PWMs, while the PWM-NCP group occupied 11 percent. After reducing the effect of CpG islands (CGI against the clusters using partial correlation coefficients among three properties (promoter, CGI and predicted TFBS cluster, we identified two PWM groups including those strongly correlated with CGI and those not correlated with CGI. Conclusion Not all PWMs predict TFBS correlated with human promoter sequences. Two main PWM groups were identified: (1 those that show TFBS clustered in promoters associated with CGI, and (2 those that show TFBS clustered in promoters independent of CGI. Assessment of PWM matches will allow more positive interpretation of TFBS in

  9. Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

    Science.gov (United States)

    Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin

    2016-01-01

    Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB