WorldWideScience

Sample records for gene promoter affects

  1. A Single Nucleotide Polymorphism in the Bax Gene Promoter Affects Transcription and Influences Retinal Ganglion Cell Death

    Directory of Open Access Journals (Sweden)

    Sheila J Semaan

    2010-03-01

    Full Text Available Pro-apoptotic Bax is essential for RGC (retinal ganglion cell death. Gene dosage experiments in mice, yielding a single wild-type Bax allele, indicated that genetic background was able to influence the cell death phenotype. DBA/2J Bax+/− mice exhibited complete resistance to nerve damage after 2 weeks (similar to Bax −/− mice, but 129B6 Bax+/− mice exhibited significant cell loss (similar to wild-type mice. The different cell death phenotype was associated with the level of Bax expression, where 129B6 neurons had twice the level of endogenous Bax mRNA and protein as DBA/2J neurons. Sequence analysis of the Bax promoters between these strains revealed a single nucleotide polymorphism (T129B6 to CDBA/2J at position −515. A 1.5- to 2.5-fold increase in transcriptional activity was observed from the 129B6 promoter in transient transfection assays in a variety of cell types, including RGC5 cells derived from rat RGCs. Since this polymorphism occurred in a p53 half-site, we investigated the requirement of p53 for the differential transcriptional activity. Differential transcriptional activity from either 129B6 or DBA/2J Bax promoters were unaffected in p53−/− cells, and addition of exogenous p53 had no further effect on this difference, thus a role for p53 was excluded. Competitive electrophoretic mobility-shift assays identified two DNA-protein complexes that interacted with the polymorphic region. Those forming Complex 1 bound with higher affinity to the 129B6 polymorphic site, suggesting that these proteins probably comprised a transcriptional activator complex. These studies implicated quantitative expression of the Bax gene as playing a possible role in neuronal susceptibility to damaging stimuli.

  2. Early life adversity and serotonin transporter gene variation interact to affect DNA methylation of the corticotropin-releasing factor gene promoter region in the adult rat brain

    NARCIS (Netherlands)

    Doelen, R.H.A. van der; Arnoldussen, I.A.C.; Ghareh, H.; Och, L. van; Homberg, J.R.; Kozicz, L.T.

    2015-01-01

    The interaction between childhood maltreatment and the serotonin transporter (5-HTT) gene linked polymorphic region has been associated with increased risk to develop major depression. This Gene x Environment interaction has furthermore been linked with increased levels of anxiety and glucocorticoid

  3. Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

    Directory of Open Access Journals (Sweden)

    Jukka S Alasaari

    Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional

  4. Knockdown of menin affects pre-mRNA processing and promoter fidelity at the interferon-gamma inducible IRF1 gene

    Directory of Open Access Journals (Sweden)

    Auriemma Lauren B

    2012-01-01

    Full Text Available Abstract Background The tumor suppressor menin (MEN1 is mutated in the inherited disease multiple endocrine neoplasia type I, and has several documented cellular roles, including the activation and repression of transcription effected by several transcription factors. As an activator, MEN1 is a component of the Set1-like mixed lineage leukemia (MLL MLL1/MLL2 methyltransferase complex that methylates histone H3 lysine 4 (H3K4. MEN1 is localized to the signal transducer and activator of transcription 1 (STAT1-dependent gene, interferon regulatory factor 1 (IRF1, and is further recruited when IRF1 transcription is triggered by interferon-γ signaling. Results RNAi-mediated knockdown of MEN1 alters the H3K4 dimethylation and H3 acetylation profiles, and the localization of histone deacetylase 3, at IRF1. While MEN1 knockdown does not impact the rate of transcription, IRF1 heteronuclear transcripts become enriched in MEN1-depleted cells. The processed mRNA and translated protein product are concomitantly reduced, and the antiviral state is attenuated. Additionally, the transcription start site at the IRF1 promoter is disrupted in the MEN1-depleted cells. The H3K4 demethylase, lysine specific demethylase 1, is also associated with IRF1, and its inhibition alters H3K4 methylation and disrupts the transcription start site as well. Conclusions Taken together, the data indicate that MEN1 contributes to STAT1-activated gene expression in a novel manner that includes defining the transcription start site and RNA processing.

  5. Methamphetamine abuse affects gene expression in brain-derived microglia of SIV-infected macaques to enhance inflammation and promote virus targets

    KAUST Repository

    Najera, Julia A.; Bustamante, Eduardo A.; Bortell, Nikki; Morsey, Brenda; Fox, Howard S.; Ravasi, Timothy; Marcondes, Maria Cecilia Garibaldi

    2016-01-01

    /function of innate immune cells and increase brain viral loads. Here, we examined changes in the gene expression profile of neuron-free microglial cell preparations isolated from the brain of macaques infected with the Simian Immunodeficiency Virus (SIV), a model

  6. Supplementary Material for: Methamphetamine abuse affects gene expression in brain-derived microglia of SIV-infected macaques to enhance inflammation and promote virus targets

    KAUST Repository

    Najera, Julia; Bustamante, Eduardo; Bortell, Nikki; Morsey, Brenda; Fox, Howard; Ravasi, Timothy; Marcondes, Maria

    2016-01-01

    /function of innate immune cells and increase brain viral loads. Here, we examined changes in the gene expression profile of neuron-free microglial cell preparations isolated from the brain of macaques infected with the Simian Immunodeficiency Virus (SIV), a model

  7. Methamphetamine abuse affects gene expression in brain-derived microglia of SIV-infected macaques to enhance inflammation and promote virus targets

    KAUST Repository

    Najera, Julia A.

    2016-04-23

    Background Methamphetamine (Meth) abuse is a major health problem linked to the aggravation of HIV- associated complications, especially within the Central Nervous System (CNS). Within the CNS, Meth has the ability to modify the activity/function of innate immune cells and increase brain viral loads. Here, we examined changes in the gene expression profile of neuron-free microglial cell preparations isolated from the brain of macaques infected with the Simian Immunodeficiency Virus (SIV), a model of neuroAIDS, and exposed to Meth. We aimed to identify molecular patterns triggered by Meth that could explain the detection of higher brain viral loads and the development of a pro-inflammatory CNS environment in the brain of infected drug abusers. Results We found that Meth alone has a strong effect on the transcription of genes associated with immune pathways, particularly inflammation and chemotaxis. Systems analysis led to a strong correlation between Meth exposure and enhancement of molecules associated with chemokines and chemokine receptors, especially CXCR4 and CCR5, which function as co-receptors for viral entry. The increase in CCR5 expression was confirmed in the brain in correlation with increased brain viral load. Conclusions Meth enhances the availability of CCR5-expressing cells for SIV in the brain, in correlation with increased viral load. This suggests that Meth is an important factor in the susceptibility to the infection and to the aggravated CNS inflammatory pathology associated with SIV in macaques and HIV in humans.

  8. Supplementary Material for: Methamphetamine abuse affects gene expression in brain-derived microglia of SIV-infected macaques to enhance inflammation and promote virus targets

    KAUST Repository

    Najera, Julia

    2016-01-01

    Abstract Background Methamphetamine (Meth) abuse is a major health problem linked to the aggravation of HIV- associated complications, especially within the Central Nervous System (CNS). Within the CNS, Meth has the ability to modify the activity/function of innate immune cells and increase brain viral loads. Here, we examined changes in the gene expression profile of neuron-free microglial cell preparations isolated from the brain of macaques infected with the Simian Immunodeficiency Virus (SIV), a model of neuroAIDS, and exposed to Meth. We aimed to identify molecular patterns triggered by Meth that could explain the detection of higher brain viral loads and the development of a pro-inflammatory CNS environment in the brain of infected drug abusers. Results We found that Meth alone has a strong effect on the transcription of genes associated with immune pathways, particularly inflammation and chemotaxis. Systems analysis led to a strong correlation between Meth exposure and enhancement of molecules associated with chemokines and chemokine receptors, especially CXCR4 and CCR5, which function as co-receptors for viral entry. The increase in CCR5 expression was confirmed in the brain in correlation with increased brain viral load. Conclusions Meth enhances the availability of CCR5-expressing cells for SIV in the brain, in correlation with increased viral load. This suggests that Meth is an important factor in the susceptibility to the infection and to the aggravated CNS inflammatory pathology associated with SIV in macaques and HIV in humans.

  9. Altered gene-expression profile in rat plasma and promoted body ...

    African Journals Online (AJOL)

    Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...

  10. A parasitic selfish gene that affects host promiscuity.

    Science.gov (United States)

    Giraldo-Perez, Paulina; Goddard, Matthew R

    2013-11-07

    Selfish genes demonstrate transmission bias and invade sexual populations despite conferring no benefit to their hosts. While the molecular genetics and evolutionary dynamics of selfish genes are reasonably well characterized, their effects on hosts are not. Homing endonuclease genes (HEGs) are one well-studied family of selfish genes that are assumed to be benign. However, we show that carrying HEGs is costly for Saccharomyces cerevisiae, demonstrating that these genetic elements are not necessarily benign but maybe parasitic. We estimate a selective load of approximately 1-2% in 'natural' niches. The second aspect we examine is the ability of HEGs to affect hosts' sexual behaviour. As all selfish genes critically rely on sex for spread, then any selfish gene correlated with increased host sexuality will enjoy a transmission advantage. While classic parasites are known to manipulate host behaviour, we are not aware of any evidence showing a selfish gene is capable of affecting host promiscuity. The data presented here show a selfish element may increase the propensity of its eukaryote host to undergo sex and along with increased rates of non-Mendelian inheritance, this may counterbalance mitotic selective load and promote spread. Demonstration that selfish genes are correlated with increased promiscuity in eukaryotes connects with ideas suggesting that selfish genes promoted the evolution of sex initially.

  11. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  12. Genes affecting β-cell function in type 1 diabetes

    DEFF Research Database (Denmark)

    Fløyel, Tina; Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Type 1 diabetes (T1D) is a multifactorial disease resulting from an immune-mediated destruction of the insulin-producing pancreatic β cells. Several environmental and genetic risk factors predispose to the disease. Genome-wide association studies (GWAS) have identified around 50 genetic regions...... that affect the risk of developing T1D, but the disease-causing variants and genes are still largely unknown. In this review, we discuss the current status of T1D susceptibility loci and candidate genes with focus on the β cell. At least 40 % of the genes in the T1D susceptibility loci are expressed in human...... islets and β cells, where they according to recent studies modulate the β-cell response to the immune system. As most of the risk variants map to noncoding regions of the genome, i.e., promoters, enhancers, intergenic regions, and noncoding genes, their possible involvement in T1D pathogenesis as gene...

  13. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

    Science.gov (United States)

    Mishra, Avinash; Tanna, Bhakti

    2017-01-01

    Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  14. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  15. Duodenal ulcer promoting gene of Helicobacter pylori.

    Science.gov (United States)

    Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

    2005-04-01

    Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

  16. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  17. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  18. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...

  19. Overexpression of maize anthocyanin regulatory gene Lc affects rice fertility.

    Science.gov (United States)

    Li, Yuan; Zhang, Tao; Shen, Zhong-Wei; Xu, Yu; Li, Jian-Yue

    2013-01-01

    Seventeen independent transgenic rice plants with the maize anthocyanin regulatory gene Lc under control of the CaMV 35S promoter were obtained and verified by molecular identification. Ten plants showed red spikelets during early development of florets, and the degenerate florets were still red after heading. Additionally, these plants exhibited intense pigmentation on the surface of the anther and the bottom of the ovary. They were unable to properly bloom and were completely sterile. Following pollination with normal pollen, these plants yielded red caryopses but did not mature normally. QRT-PCR analysis indicated that mRNA accumulation of the CHS-like gene encoding a chalcone synthase-related protein was increased significantly in the sterile plant. This is the first report to suggest that upregulation of the CHS gene expression may result in rice sterility and affect the normal development of rice seeds.

  20. MDM2 promoter SNP344T>A (rs1196333) status does not affect cancer risk

    NARCIS (Netherlands)

    S. Knappskog (Stian); L.B. Gansmo (Liv); P. Romundstad (Pål); M. Bjørnslett (Merete); J. Trovik (Jone); J. Sommerfelt-Pettersen (Jan); E. Løkkevik (Erik); R.A.E.M. Tollenaar (Rob); C.M. Seynaeve (Caroline); P. Devilee (Peter); H.B. Salvesen (Helga); A. Dørum (Anne); K. Hveem (Kristian); L.J. Vatten (Lars); P.E. Lønning (Per )

    2012-01-01

    textabstractThe MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms

  1. Promoter Methylation Analysis of IDH Genes in Human Gliomas

    International Nuclear Information System (INIS)

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  2. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  3. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  4. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  5. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  6. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  7. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  8. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  9. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    Directory of Open Access Journals (Sweden)

    Coppée Jean-Yves

    2010-02-01

    Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.

  10. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  11. Health Promotion Behaviors of Women and Affecting Factors

    Directory of Open Access Journals (Sweden)

    Naile Bilgili

    2009-12-01

    Full Text Available AIM: Women should be healthy and have health promotion behaviors, so they can accomplish both their maternal and social tasks. This descriptive study was conducted to determine the healthy life-style behaviors of married women and the factors which could affect those behaviors. METHOD: The population comprised all married women older than 15 years and who live in Ankara Kale region. Three hundred-sixty five married women were included in the study. The questionnaire form and the healthy life-style behaviors scale was used for data collection. RESULTS: The mean score taken from scale was 112.2±19.4. The scores of the women who graduated from middle school / high school, who have sufficient income and good socio-economic status, who have a perception of physical health fairly good and who have any chronic disease in their families, have significantly higher mean scores from healthy life-style behaviors scale and subgroups (p<0.05 CONCLUSION: Health promotion behaviors of the women was low and some factors like education level, income, socioeconomic status, perception of health, having any chronic illness and using regular medicine affected healthy life-style behaviors. It is recommended that nurses, who have education and consultation roles, should inform the women about health promotion behaviors and encourage them to use that information in their lives. [TAF Prev Med Bull 2009; 8(6.000: 497-502

  12. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  13. Firefly luciferase gene contains a cryptic promoter

    Czech Academy of Sciences Publication Activity Database

    Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.

    2008-01-01

    Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008

  14. Patterns of prokaryotic lateral gene transfers affecting parasitic microbial eukaryotes

    DEFF Research Database (Denmark)

    Alsmark, Cecilia; Foster, Peter G; Sicheritz-Pontén, Thomas

    2013-01-01

    BACKGROUND: The influence of lateral gene transfer on gene origins and biology in eukaryotes is poorly understood compared with those of prokaryotes. A number of independent investigations focusing on specific genes, individual genomes, or specific functional categories from various eukaryotes have...... approach to systematically investigate lateral gene transfer affecting the proteomes of thirteen, mainly parasitic, microbial eukaryotes, representing four of the six eukaryotic super-groups. All of the genomes investigated have been significantly affected by prokaryote-to-eukaryote lateral gene transfers...... indicated that lateral gene transfer does indeed affect eukaryotic genomes. However, the lack of common methodology and criteria in these studies makes it difficult to assess the general importance and influence of lateral gene transfer on eukaryotic genome evolution. RESULTS: We used a phylogenomic...

  15. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  16. Promoter polymorphism -119C/G in MYG1 (C12orf10) gene is related to vitiligo susceptibility and Arg4Gln affects mitochondrial entrance of Myg1

    DEFF Research Database (Denmark)

    Philips, Mari-Anne; Kingo, Külli; Karelson, Maire

    2010-01-01

    MYG1 (Melanocyte proliferating gene 1, also C12orf10 in human) is a ubiquitous nucleo-mitochondrial protein, involved in early developmental processes and in adult stress/illness conditions. We recently showed that MYG1 mRNA expression is elevated in the skin of vitiligo patients. Our aim...... was to examine nine known polymorphisms in the MYG1 gene, to investigate their functionality, and to study their association with vitiligo susceptibility....

  17. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    Science.gov (United States)

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  18. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  19. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  20. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  1. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  2. Promoter polymorphism -119C/G in MYG1 (C12orf10) gene is related to vitiligo susceptibility and Arg4Gln affects mitochondrial entrance of Myg1

    DEFF Research Database (Denmark)

    Philips, Mari-Anne; Kingo, Külli; Karelson, Maire

    2010-01-01

    MYG1 (Melanocyte proliferating gene 1, also C12orf10 in human) is a ubiquitous nucleo-mitochondrial protein, involved in early developmental processes and in adult stress/illness conditions. We recently showed that MYG1 mRNA expression is elevated in the skin of vitiligo patients. Our aim...

  3. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    Directory of Open Access Journals (Sweden)

    Brandi L Gancarz

    Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  4. Genes that cooperate with tumor promoters in transformation

    International Nuclear Information System (INIS)

    Colburn, N.H.; Smith, B.M.

    1988-01-01

    Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation

  5. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  6. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  7. The altered promoter methylation of oxytocin receptor gene in autism.

    Science.gov (United States)

    Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak

    Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.

  8. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  9. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.

    2012-01-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  10. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh

    2012-07-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  11. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Victoria Gonzalo

    Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant

  12. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  13. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  14. Huntingtin gene repeat size variations affect risk of lifetime depression

    DEFF Research Database (Denmark)

    Gardiner, Sarah L.; van Belzen, Martine J.; Boogaard, Merel W.

    2017-01-01

    Huntington disease (HD) is a severe neuropsychiatric disorder caused by a cytosine-adenine-guanine (CAG) repeat expansion in the HTT gene. Although HD is frequently complicated by depression, it is still unknown to what extent common HTT CAG repeat size variations in the normal range could affect...

  15. Subinhibitory concentrations of antibiotics affect stress and virulence gene expression in Listeria monocytogenes and cause enhanced stress sensitivity but do not affect Caco‐2 cell invasion

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Holch, Anne; Gram, Lone

    2012-01-01

    with promoter fusions, 14 of 16 antibiotics induced or repressed expression of one or more stress and/or virulence genes. Despite ampicillin‐induced up‐regulation of PinlA‐lacZ expression, Caco‐2 cell invasion was not affected. Subinhibitory concentrations of ampicillin and tetracycline caused up‐ and down...

  16. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  17. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    Science.gov (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  18. Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

    Science.gov (United States)

    Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

    2017-01-01

    The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

  19. Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins.

    Directory of Open Access Journals (Sweden)

    Stefano Varrella

    Full Text Available Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure.

  20. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Downregulation of RWA genes in hybrid aspen affects xylan acetylation and wood saccharification.

    Science.gov (United States)

    Pawar, Prashant Mohan-Anupama; Ratke, Christine; Balasubramanian, Vimal K; Chong, Sun-Li; Gandla, Madhavi Latha; Adriasola, Mathilda; Sparrman, Tobias; Hedenström, Mattias; Szwaj, Klaudia; Derba-Maceluch, Marta; Gaertner, Cyril; Mouille, Gregory; Ezcurra, Ines; Tenkanen, Maija; Jönsson, Leif J; Mellerowicz, Ewa J

    2017-06-01

    High acetylation of angiosperm wood hinders its conversion to sugars by glycoside hydrolases, subsequent ethanol fermentation and (hence) its use for biofuel production. We studied the REDUCED WALL ACETYLATION (RWA) gene family of the hardwood model Populus to evaluate its potential for improving saccharification. The family has two clades, AB and CD, containing two genes each. All four genes are expressed in developing wood but only RWA-A and -B are activated by master switches of the secondary cell wall PtNST1 and PtMYB21. Histochemical analysis of promoter::GUS lines in hybrid aspen (Populus tremula × tremuloides) showed activation of RWA-A and -B promoters in the secondary wall formation zone, while RWA-C and -D promoter activity was diffuse. Ectopic downregulation of either clade reduced wood xylan and xyloglucan acetylation. Suppressing both clades simultaneously using the wood-specific promoter reduced wood acetylation by 25% and decreased acetylation at position 2 of Xylp in the dimethyl sulfoxide-extracted xylan. This did not affect plant growth but decreased xylose and increased glucose contents in the noncellulosic monosaccharide fraction, and increased glucose and xylose yields of wood enzymatic hydrolysis without pretreatment. Both RWA clades regulate wood xylan acetylation in aspen and are promising targets to improve wood saccharification. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  2. Effects of gene orientation and use of multiple promoters on the expression of XYL1 and XYL2 in Saccharomyces cerevisiae

    Science.gov (United States)

    Ju Yun Bae; Jose Laplaza; Thomas W. Jeffries

    2008-01-01

    Orientation of adjacent genes has been reported to affect their expression in eukaryotic systems, and metabolic engineering also often makes repeated use of a few promoters to obtain high expression. To improve transcriptional control in heterologous expression, we examined how these factors affect gene expression and enzymatic activity in Saccharomyces cerevisiae. We...

  3. Neurocultural evidence that ideal affect match promotes giving.

    Science.gov (United States)

    Park, BoKyung; Blevins, Elizabeth; Knutson, Brian; Tsai, Jeanne L

    2017-07-01

    Why do people give to strangers? We propose that people trust and give more to those whose emotional expressions match how they ideally want to feel ("ideal affect match"). European Americans and Koreans played multiple trials of the Dictator Game with recipients who varied in emotional expression (excited, calm), race (White, Asian) and sex (male, female). Consistent with their culture's valued affect, European Americans trusted and gave more to excited than calm recipients, whereas Koreans trusted and gave more to calm than excited recipients. These findings held regardless of recipient race and sex. We then used fMRI to probe potential affective and mentalizing mechanisms. Increased activity in the nucleus accumbens (associated with reward anticipation) predicted giving, as did decreased activity in the right temporo-parietal junction (rTPJ; associated with reduced belief prediction error). Ideal affect match decreased rTPJ activity, suggesting that people may trust and give more to strangers whom they perceive to share their affective values. © The Author (2017). Published by Oxford University Press.

  4. MDM2 promoter SNP344T>A (rs1196333 status does not affect cancer risk.

    Directory of Open Access Journals (Sweden)

    Stian Knappskog

    Full Text Available The MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms (SNP309T>G; rs2279744 facilitates Sp1 transcription factor binding to the promoter and is associated with increased cancer risk. In contrast, SNP285G>C (rs117039649, located 24 bp upstream of rs2279744, and in complete linkage disequilibrium with the SNP309G allele, reduces Sp1 recruitment and lowers cancer risk. Thus, fine tuning of MDM2 expression has proven to be of significant importance with respect to tumorigenesis. We assessed the potential functional effects of a third MDM2 promoter P2 polymorphism (SNP344T>A; rs1196333 located on the SNP309T allele. While in silico analyses indicated SNP344A to modulate TFAP2A, SPIB and AP1 transcription factor binding, we found no effect of SNP344 status on MDM2 expression levels. Assessing the frequency of SNP344A in healthy Caucasians (n = 2,954 and patients suffering from ovarian (n = 1,927, breast (n = 1,271, endometrial (n = 895 or prostatic cancer (n = 641, we detected no significant difference in the distribution of this polymorphism between any of these cancer forms and healthy controls (6.1% in healthy controls, and 4.9%, 5.0%, 5.4% and 7.2% in the cancer groups, respectively. In conclusion, our findings provide no evidence indicating that SNP344A may affect MDM2 transcription or cancer risk.

  5. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  6. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Science.gov (United States)

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  7. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    Directory of Open Access Journals (Sweden)

    Skiriute Daina

    2012-06-01

    Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.

  8. Gardening promotes neuroendocrine and affective restoration from stress.

    Science.gov (United States)

    Van Den Berg, Agnes E; Custers, Mariëtte H G

    2011-01-01

    Stress-relieving effects of gardening were hypothesized and tested in a field experiment. Thirty allotment gardeners performed a stressful Stroop task and were then randomly assigned to 30 minutes of outdoor gardening or indoor reading on their own allotment plot. Salivary cortisol levels and self-reported mood were repeatedly measured. Gardening and reading each led to decreases in cortisol during the recovery period, but decreases were significantly stronger in the gardening group. Positive mood was fully restored after gardening, but further deteriorated during reading. These findings provide the first experimental evidence that gardening can promote relief from acute stress.

  9. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  10. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Science.gov (United States)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  11. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  12. Evolutionary rate of a gene affected by chromosomal position.

    Science.gov (United States)

    Perry, J; Ashworth, A

    1999-09-09

    Genes evolve at different rates depending on the strength of selective pressure to maintain their function. Chromosomal position can also have an influence [1] [2]. The pseudoautosomal region (PAR) of mammalian sex chromosomes is a small region of sequence identity that is the site of an obligatory pairing and recombination event between the X and Y chromosomes during male meiosis [3] [4] [5] [6]. During female meiosis, X chromosomes can pair and recombine along their entire length. Recombination in the PAR is therefore approximately 10 times greater in male meiosis compared with female meiosis [4] [5] [6]. The gene Fxy (also known as MID1 [7]) spans the pseudoautosomal boundary (PAB) in the laboratory mouse (Mus musculus domesticus, C57BL/6) such that the 5' three exons of the gene are located on the X chromosome but the seven exons encoding the carboxy-terminal two-thirds of the protein are located within the PAR and are therefore present on both the X and Y chromosomes [8]. In humans [7] [9], the rat, and the wild mouse species Mus spretus, the gene is entirely X-unique. Here, we report that the rate of sequence divergence of the 3' end of the Fxy gene is much higher (estimated at 170-fold higher for synonymous sites) when pseudoautosomal (present on both the X and Y chromosomes) than when X-unique. Thus, chromosomal position can directly affect the rate of evolution of a gene. This finding also provides support for the suggestion that regions of the genome with a high recombination frequency, such as the PAR, may have an intrinsically elevated rate of sequence divergence.

  13. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  14. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  15. Identification of genes affecting vacuole membrane fragmentation in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Lydie Michaillat

    Full Text Available The equilibrium of membrane fusion and fission influences the volume and copy number of organelles. Fusion of yeast vacuoles has been well characterized but their fission and the mechanisms determining vacuole size and abundance remain poorly understood. We therefore attempted to systematically characterize factors necessary for vacuole fission. Here, we present results of an in vivo screening for deficiencies in vacuolar fragmentation activity of an ordered collection deletion mutants, representing 4881 non-essential genes of the yeast Saccharomyces cerevisiae. The screen identified 133 mutants with strong defects in vacuole fragmentation. These comprise numerous known fragmentation factors, such as the Fab1p complex, Tor1p, Sit4p and the V-ATPase, thus validating the approach. The screen identified many novel factors promoting vacuole fragmentation. Among those are 22 open reading frames of unknown function and three conspicuous clusters of proteins with known function. The clusters concern the ESCRT machinery, adaptins, and lipases, which influence the production of diacylglycerol and phosphatidic acid. A common feature of these factors of known function is their capacity to change membrane curvature, suggesting that they might promote vacuole fragmentation via this property.

  16. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  17. Mechanisms for Promoting the Development of Cognitive, Social and Affective Graduate Attributes

    Science.gov (United States)

    Kember, David; Hong, Celina; Yau, Vickie W. K.; Ho, Shun Amaly

    2017-01-01

    The aim of this study was to help universities promote graduate attributes by investigating mechanisms for promoting the development of cognitive, social and affective attributes which could impact upon all undergraduate students. Small group interviews were conducted with 90 final year students at a university in Hong Kong. Interview transcripts…

  18. A Study of Predictive Factors Affecting Health: Promoting Behaviors of North Korean Adolescent Refugees

    OpenAIRE

    Jin-Won Noh; Hyo-Young Yun; Hyunchun Park; Shi-Eun Yu

    2015-01-01

    Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p

  19. ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

    Directory of Open Access Journals (Sweden)

    O. I. Kit

    2016-01-01

    Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

  20. Changes in gravitational force affect gene expression in developing organ systems at different developmental times

    Directory of Open Access Journals (Sweden)

    Moorman Stephen J

    2005-05-01

    Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.

  1. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jacob Daniela

    2005-06-01

    Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  2. The Affect Of Sales Promotion On Consumer Interest To Purchase In IKCO Automotive Company

    OpenAIRE

    Shahriar Ansari CHAHARSOUGHI

    2011-01-01

    Sales promotion has become a vital tool for marketing and its importance has been increasing significantly over the years. One of the purposes of a sales promotion is to elicit a direct impact on the purchase behavior of the firm’s consumers. Firms have to rethink the relationship between attitude and behavior of their consumers. Sales promotions are highly affective in exposing consumers to products for the first time and can serve as key promotional components in the early stages of new pro...

  3. The Affect Of Sales Promotion On Consumer Interest To Purchase In IKCO Automotive Company

    OpenAIRE

    Jamia Hamdard; Shahriar Ansari CHAHARSOUGHI

    2011-01-01

    Sales promotion has become a vital tool for marketing and its importance has been increasing significantly over the years. One of the purposes of a sales promotion is to elicit a direct impact on the purchase behavior of the firm’s consumers. Firms have to rethink the relationship between attitude and behavior of their consumers.Sales promotions are highly affective in exposing consumers to products for the first time and can serve as key promotional components in the early stages of new prod...

  4. Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

    Science.gov (United States)

    Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

    2008-10-01

    The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

  5. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  6. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

  7. The FRIABLE1 gene product affects cell adhesion in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lutz Neumetzler

    Full Text Available Cell adhesion in plants is mediated predominantly by pectins, a group of complex cell wall associated polysaccharides. An Arabidopsis mutant, friable1 (frb1, was identified through a screen of T-DNA insertion lines that exhibited defective cell adhesion. Interestingly, the frb1 plants displayed both cell and organ dissociations and also ectopic defects in organ separation. The FRB1 gene encodes a Golgi-localized, plant specific protein with only weak sequence similarities to known proteins (DUF246. Unlike other cell adhesion deficient mutants, frb1 mutants do not have reduced levels of adhesion related cell wall polymers, such as pectins. Instead, FRB1 affects the abundance of galactose- and arabinose-containing oligosaccharides in the Golgi. Furthermore, frb1 mutants displayed alteration in pectin methylesterification, cell wall associated extensins and xyloglucan microstructure. We propose that abnormal FRB1 action has pleiotropic consequences on wall architecture, affecting both the extensin and pectin matrices, with consequent changes to the biomechanical properties of the wall and middle lamella, thereby influencing cell-cell adhesion.

  8. Neonicotinoid clothianidin adversely affects insect immunity and promotes replication of a viral pathogen in honey bees.

    Science.gov (United States)

    Di Prisco, Gennaro; Cavaliere, Valeria; Annoscia, Desiderato; Varricchio, Paola; Caprio, Emilio; Nazzi, Francesco; Gargiulo, Giuseppe; Pennacchio, Francesco

    2013-11-12

    Large-scale losses of honey bee colonies represent a poorly understood problem of global importance. Both biotic and abiotic factors are involved in this phenomenon that is often associated with high loads of parasites and pathogens. A stronger impact of pathogens in honey bees exposed to neonicotinoid insecticides has been reported, but the causal link between insecticide exposure and the possible immune alteration of honey bees remains elusive. Here, we demonstrate that the neonicotinoid insecticide clothianidin negatively modulates NF-κB immune signaling in insects and adversely affects honey bee antiviral defenses controlled by this transcription factor. We have identified in insects a negative modulator of NF-κB activation, which is a leucine-rich repeat protein. Exposure to clothianidin, by enhancing the transcription of the gene encoding this inhibitor, reduces immune defenses and promotes the replication of the deformed wing virus in honey bees bearing covert infections. This honey bee immunosuppression is similarly induced by a different neonicotinoid, imidacloprid, but not by the organophosphate chlorpyriphos, which does not affect NF-κB signaling. The occurrence at sublethal doses of this insecticide-induced viral proliferation suggests that the studied neonicotinoids might have a negative effect at the field level. Our experiments uncover a further level of regulation of the immune response in insects and set the stage for studies on neural modulation of immunity in animals. Furthermore, this study has implications for the conservation of bees, as it will contribute to the definition of more appropriate guidelines for testing chronic or sublethal effects of pesticides used in agriculture.

  9. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  11. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Directory of Open Access Journals (Sweden)

    Jianqing Pan

    Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  12. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    Science.gov (United States)

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. The progress of tumor gene-radiotherapy induced by Egr-1 promoter

    International Nuclear Information System (INIS)

    Guo Rui; Li Biao

    2010-01-01

    The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)

  14. Mediator, TATA-binding Protein, and RNA Polymerase II Contribute to Low Histone Occupancy at Active Gene Promoters in Yeast*

    Science.gov (United States)

    Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.

    2014-01-01

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477

  15. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  16. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  17. A parasitic selfish gene that affects host promiscuity

    OpenAIRE

    Giraldo-Perez, Paulina; Goddard, Matthew R.

    2013-01-01

    Selfish genes demonstrate transmission bias and invade sexual populations despite conferring no benefit to their hosts. While the molecular genetics and evolutionary dynamics of selfish genes are reasonably well characterized, their effects on hosts are not. Homing endonuclease genes (HEGs) are one well-studied family of selfish genes that are assumed to be benign. However, we show that carrying HEGs is costly for Saccharomyces cerevisiae, demonstrating that these genetic elements are not nec...

  18. Negative affect promotes encoding of and memory for details at the expense of the gist: affect, encoding, and false memories.

    Science.gov (United States)

    Storbeck, Justin

    2013-01-01

    I investigated whether negative affective states enhance encoding of and memory for item-specific information reducing false memories. Positive, negative, and neutral moods were induced, and participants then completed a Deese-Roediger-McDermott (DRM) false-memory task. List items were presented in unique spatial locations or unique fonts to serve as measures for item-specific encoding. The negative mood conditions had more accurate memories for item-specific information, and they also had fewer false memories. The final experiment used a manipulation that drew attention to distinctive information, which aided learning for DRM words, but also promoted item-specific encoding. For the condition that promoted item-specific encoding, false memories were reduced for positive and neutral mood conditions to a rate similar to that of the negative mood condition. These experiments demonstrated that negative affective cues promote item-specific processing reducing false memories. People in positive and negative moods encode events differently creating different memories for the same event.

  19. Factors affecting expression of the recF gene of Escherichia coli K-12.

    Science.gov (United States)

    Sandler, S J; Clark, A J

    1990-01-31

    This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

  20. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  1. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  2. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  3. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  4. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    2014-12-23

    Dec 23, 2014 ... antimalarial drugs from plants that were used in traditional. Chinese medicine ...... ogy of eukaryotic promoter prediction-a review. Comput. Chem. ... Main J. J. 2006 Antiviral effect of artemisinin from Artemisia annua against a ...

  5. Huntingtin gene repeat size variations affect risk of lifetime depression.

    Science.gov (United States)

    Gardiner, Sarah L; van Belzen, Martine J; Boogaard, Merel W; van Roon-Mom, Willeke M C; Rozing, Maarten P; van Hemert, Albert M; Smit, Johannes H; Beekman, Aartjan T F; van Grootheest, Gerard; Schoevers, Robert A; Oude Voshaar, Richard C; Roos, Raymund A C; Comijs, Hannie C; Penninx, Brenda W J H; van der Mast, Roos C; Aziz, N Ahmad

    2017-12-11

    Huntington disease (HD) is a severe neuropsychiatric disorder caused by a cytosine-adenine-guanine (CAG) repeat expansion in the HTT gene. Although HD is frequently complicated by depression, it is still unknown to what extent common HTT CAG repeat size variations in the normal range could affect depression risk in the general population. Using binary logistic regression, we assessed the association between HTT CAG repeat size and depression risk in two well-characterized Dutch cohorts─the Netherlands Study of Depression and Anxiety and the Netherlands Study of Depression in Older Persons─including 2165 depressed and 1058 non-depressed persons. In both cohorts, separately as well as combined, there was a significant non-linear association between the risk of lifetime depression and HTT CAG repeat size in which both relatively short and relatively large alleles were associated with an increased risk of depression (β = -0.292 and β = 0.006 for the linear and the quadratic term, respectively; both P < 0.01 after adjustment for the effects of sex, age, and education level). The odds of lifetime depression were lowest in persons with a HTT CAG repeat size of 21 (odds ratio: 0.71, 95% confidence interval: 0.52 to 0.98) compared to the average odds in the total cohort. In conclusion, lifetime depression risk was higher with both relatively short and relatively large HTT CAG repeat sizes in the normal range. Our study provides important proof-of-principle that repeat polymorphisms can act as hitherto unappreciated but complex genetic modifiers of depression.

  6. Affective Education: A Teacher's Manual to Promote Student Self-Actualization and Human Relations Skills.

    Science.gov (United States)

    Snyder, Thomas R.

    This teacher's manual presents affective education as a program to promote student self-actualization and human relations skills. Abraham Maslow's hierarchy of needs and Erik Erikson's life stages of psychosocial development form the conceptual base for this program. The goals and objectives of this manual are concerned with problem-solving…

  7. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita

    2017-06-01

    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  8. Gene expression profiling of placentas affected by pre-eclampsia

    DEFF Research Database (Denmark)

    Hoegh, Anne Mette; Borup, Rehannah; Nielsen, Finn Cilius

    2010-01-01

    Several studies point to the placenta as the primary cause of pre-eclampsia. Our objective was to identify placental genes that may contribute to the development of pre-eclampsia. RNA was purified from tissue biopsies from eleven pre-eclamptic placentas and eighteen normal controls. Messenger RNA...... expression from pooled samples was analysed by microarrays. Verification of the expression of selected genes was performed using real-time PCR. A surprisingly low number of genes (21 out of 15,000) were identified as differentially expressed. Among these were genes not previously associated with pre-eclampsia...... as bradykinin B1 receptor and a 14-3-3 protein, but also genes that have already been connected with pre-eclampsia, for example, inhibin beta A subunit and leptin. A low number of genes were repeatedly identified as differentially expressed, because they may represent the endpoint of a cascade of events...

  9. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  10. Transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans

    CSIR Research Space (South Africa)

    Crampton, Michael C

    2010-07-01

    Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...

  11. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  12. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  13. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  14. Productive Love Promotion Via Affective Technology: An Approach Based On Social Psychology And Philosophy

    Directory of Open Access Journals (Sweden)

    Ramon Solves Pujol

    2010-01-01

    Full Text Available This paper proposes the use of social psychological and philosophical foundations for designing affective technology that promotes the experience of love. The adopted theoretical basis is the concept of productive love, which is heavily based on Enrich Fromm but also includes theories and scientific findings of numerous psychoanalysts, social psychologists, and philosophers. We conducted a review of the theory about the nature of love and found that social psychological and philosophical approaches differ regarding peoples' understandings. The findings were used to elaborate eight principles of productive love. Based on these principles, we derived criteria for designing affective technology when the objective is to promote productive love. We reviewed the existent studies on affective technologies and implemented the criteria into a system design, the Pictures' Call. A prototype of the system was pretested to illustrate how productive love technology could be based on established criteria.

  15. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  16. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  17. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  18. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  19. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  20. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  1. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    Directory of Open Access Journals (Sweden)

    Andrea Degl'Innocenti

    Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings

  2. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  3. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  4. Directed mutagenesis affects recombination in Azospirillum brasilense nif genes

    Directory of Open Access Journals (Sweden)

    C.P. Nunes

    2000-12-01

    Full Text Available In order to improve the gene transfer/mutagenesis system for Azospirillum brasilense, gene-cartridge mutagenesis was used to replace the nifD gene with the Tn5 kanamycin resistance gene. The construct was transferred to A. brasilense by electrotransformation. Of the 12 colonies isolated using the suicide plasmid pSUP202 as vector, only four did not show vector integration into the chromosome. Nevertheless, all 12 colonies were deficient in acetylene reduction, indicating an Nif- phenotype. Four Nif- mutants were analyzed by Southern blot, using six different probes spanning the nif and Km r genes and the plasmid vector. Apparently, several recombination events occurred in the mutant genomes, probably caused mainly by gene disruption owing to the mutagenesis technique used: resistance gene-cartridge mutagenesis combined with electrotransformation.Com o objetivo de melhorar os sistemas de transferência gênica e mutagênese para Azospirillum brasilense, a técnica de mutagênese através do uso de um gene marcador ("gene-cartridge mutagenesis" foi utilizada para substituir a região genômica de A. brasilense correspondente ao gene nifD por um segmento de DNA do transposon Tn5 contendo o gene que confere resistência ao antibiótico canamicina. A construção foi transferida para a linhagem de A. brasilense por eletrotransformação. Doze colônias transformantes foram isoladas com o plasmídeo suicida pSUP202 servindo como vetor. Dessas, somente quatro não possuíam o vetor integrado no cromossomo da bactéria. Independentemente da integração ou não do vetor, as 12 colônias foram deficientes na redução do gás acetileno, evidenciando o fenótipo Nif -. Quatro mutantes Nif - foram analisados através da técnica de Southern blot, utilizando-se seis diferentes fragmentos contendo genes nif, de resistência à canamicina e do vetor como sondas. Os resultados sugerem a ocorrência de eventos recombinacionais variados no genoma dos mutantes. A

  5. A Study of Predictive Factors Affecting Health: Promoting Behaviors of North Korean Adolescent Refugees.

    Science.gov (United States)

    Noh, Jin-Won; Yun, Hyo-Young; Park, Hyunchun; Yu, Shi-Eun

    2015-09-01

    The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Statistically significant differences were found in religion (t=2.30, pKorea (t=2.02, preligion (t=2.17, preligion (t=4.21, pKorea (t=2.04, pNorth Korean adolescent refugees.

  6. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  7. Computational design and application of endogenous promoters for transcriptionally targeted gene therapy for rheumatoid arthritis.

    NARCIS (Netherlands)

    Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de

    2009-01-01

    The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define

  8. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  9. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  10. Microarray analysis of genes affected by salt stress in tomato

    African Journals Online (AJOL)

    LANDA

    isoforms of cytochrome P450, genes for polyamine biosynthesis (putrescine and proline) ..... CAB97048 mitochondrial half-ABC transporter [Arabidopsis thaliana] up .... AAC72194 pyruvate dehydrogenase E1 beta subunit isoform 3 [Zea mays].

  11. Diaphanous gene mutation affects spiral cleavage and chirality in snails

    Science.gov (United States)

    Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

    2016-01-01

    L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

  12. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    ... were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5′-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.

  13. A cII-dependent promoter is located within the Q gene of bacteriophage lambda.

    OpenAIRE

    Hoopes, B C; McClure, W R

    1985-01-01

    We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...

  14. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  15. Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ilchung [Ames Laboratory; Ray, Judhajeet [Ames Laboratory; Gupta, Vinayak [Iowa State University; Ilgu, Muslum [Ames Laboratory; Beasley, Jonathan [Iowa State University; Bendickson, Lee [Ames Laboratory; Mehanovic, Samir [Molecular Express; Kraus, George A. [Iowa State University; Nilsen-Hamilton, Marit [Ames Laboratory

    2014-04-20

    We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from the GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.

  16. Oxygen and tissue culture affect placental gene expression.

    Science.gov (United States)

    Brew, O; Sullivan, M H F

    2017-07-01

    Placental explant culture is an important model for studying placental development and functions. We investigated the differences in placental gene expression in response to tissue culture, atmospheric and physiologic oxygen concentrations. Placental explants were collected from normal term (38-39 weeks of gestation) placentae with no previous uterine contractile activity. Placental transcriptomic expressions were evaluated with GeneChip ® Human Genome U133 Plus 2.0 arrays (Affymetrix). We uncovered sub-sets of genes that regulate response to stress, induction of apoptosis programmed cell death, mis-regulation of cell growth, proliferation, cell morphogenesis, tissue viability, and protection from apoptosis in cultured placental explants. We also identified a sub-set of genes with highly unstable pattern of expression after exposure to tissue culture. Tissue culture irrespective of oxygen concentration induced dichotomous increase in significant gene expression and increased enrichment of significant pathways and transcription factor targets (TFTs) including HIF1A. The effect was exacerbated by culture at atmospheric oxygen concentration, where further up-regulation of TFTs including PPARA, CEBPD, HOXA9 and down-regulated TFTs such as JUND/FOS suggest intrinsic heightened key biological and metabolic mechanisms such as glucose use, lipid biosynthesis, protein metabolism; apoptosis, inflammatory responses; and diminished trophoblast proliferation, differentiation, invasion, regeneration, and viability. These findings demonstrate that gene expression patterns differ between pre-culture and cultured explants, and the gene expression of explants cultured at atmospheric oxygen concentration favours stressed, pro-inflammatory and increased apoptotic transcriptomic response. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  18. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  19. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  20. HFE gene variants affect iron in the brain.

    Science.gov (United States)

    Nandar, Wint; Connor, James R

    2011-04-01

    Iron accumulation in the brain and increased oxidative stress are consistent observations in many neurodegenerative diseases. Thus, we have begun examination into gene mutations or allelic variants that could be associated with loss of iron homeostasis. One of the mechanisms leading to iron overload is a mutation in the HFE gene, which is involved in iron metabolism. The 2 most common HFE gene variants are C282Y (1.9%) and H63D (8.9%). The C282Y HFE variant is more commonly associated with hereditary hemochromatosis, which is an autosomal recessive disorder, characterized by iron overload in a number of systemic organs. The H63D HFE variant appears less frequently associated with hemochromatosis, but its role in the neurodegenerative diseases has received more attention. At the cellular level, the HFE mutant protein resulting from the H63D HFE gene variant is associated with iron dyshomeostasis, increased oxidative stress, glutamate release, tau phosphorylation, and alteration in inflammatory response, each of which is under investigation as a contributing factor to neurodegenerative diseases. Therefore, the HFE gene variants are proposed to be genetic modifiers or a risk factor for neurodegenerative diseases by establishing an enabling milieu for pathogenic agents. This review will discuss the current knowledge of the association of the HFE gene variants with neurodegenerative diseases: amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and ischemic stroke. Importantly, the data herein also begin to dispel the long-held view that the brain is protected from iron accumulation associated with the HFE mutations.

  1. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Li Mingji

    2012-02-01

    Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

  2. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  3. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  4. Transcription factor organic cation transporter 1 (OCT-1 affects the expression of porcine Klotho (KL gene

    Directory of Open Access Journals (Sweden)

    Yan Li

    2016-07-01

    Full Text Available Klotho (KL, originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp as the porcine KL core promoter. MARC0022311SNP (A or G in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1, which was confirmed using electrophoretic mobility shift assays (EMSA and chromatin immune-precipitation (ChIP. Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1.

  5. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  6. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  7. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  8. Development of a gene therapy strategy to target hepatocellular carcinoma based inhibition of protein phosphatase 2A using the α-fetoprotein promoter enhancer and pgk promoter: an in vitro and in vivo study

    International Nuclear Information System (INIS)

    Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran

    2012-01-01

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC

  9. Low-Dose Radiation Induces Genes Promoting Cell Survival

    International Nuclear Information System (INIS)

    Liu, Shu-Zheng; Chen, Dong; Mu, Ying

    1999-01-01

    Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

  10. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  11. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  12. Abhydrolase domain containing 2, an androgen target gene, promotes prostate cancer cell proliferation and migration.

    Science.gov (United States)

    Obinata, Daisuke; Takada, Shogo; Takayama, Ken-ichi; Urano, Tomohiko; Ito, Akiko; Ashikari, Daisaku; Fujiwara, Kyoko; Yamada, Yuta; Murata, Taro; Kumagai, Jinpei; Fujimura, Tetsuya; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Homma, Yukio; Takahashi, Satoru; Inoue, Satoshi

    2016-04-01

    The androgen receptor (AR) plays a key role in the development of prostate cancer. AR signalling mediates the expression of androgen-responsive genes, which are involved in prostate cancer development and progression. Our previous chromatin immunoprecipitation study showed that the region of abhydrolase domain containing 2 (ABHD2) includes a functional androgen receptor binding site. In this study, we demonstrated that ABHD2 is a novel androgen-responsive gene that is overexpressed in human prostate cancer tissues. The expression levels of ABHD2 in androgen-sensitive cells were evaluated by quantitative reverse transcription polymerase chain reaction and western-blot analyses. LNCaP and VCaP cells with ABHD2 overexpression or short interfering RNA (siRNA) knockdown were used for functional analyses. ABHD2 expression was examined in clinical samples of prostate cancer by immunohistochemistry. We showed that ABHD2 expression is increased by androgen in LNCaP and VCaP cells. This androgen-induced ABHD2 expression was diminished by bicalutamide. While stable expression of ABHD2 affected the enhancement of LNCaP cell proliferation and migration, siRNA-mediated ABHD2 knockdown suppressed cell proliferation and migration. In addition, the siRNA treatment significantly repressed the tumour growth derived from LNCaP cells in athymic mice. Immunohistochemical analysis of ABHD2 expression in tumour specimens showed a positive correlation of ABHD2 immunoreactivity with high Gleason score and pathological N stage. Moreover, patients with high immunoreactivity of ABHD2 showed low cancer-specific survival rates and a resistance to docetaxel-based chemotherapy. ABHD2 is a novel androgen-regulated gene that can promote prostate cancer growth and resistance to chemotherapy, and is a novel target for diagnosis and treatment of prostate cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    International Nuclear Information System (INIS)

    Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun

    2015-01-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  14. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Jing; Chen, Xi; Liu, Yanan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Xie, Qunhui [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Zhao, Bin, E-mail: binzhao@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Tang, Naijun, E-mail: tangnaijun@tijmu.edu.cn [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China)

    2015-12-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  15. Neurospora crassa glucose - repressible gene -1(Grg-1) promoter controls the expression of neurospora tyrosinase gene in a clock-controlled manner

    International Nuclear Information System (INIS)

    Tarawneh, A. K

    1997-01-01

    In this study sphareroplastes of white Neurospora crassa mutant auxotroph for aromatic am no acids a rom 9 q a-2 inv, was transformed by the pKF-Tyr7-wt DNA construct. This construct contains the promoter of neurospora crassa glucose-repressible gene-1 (G rg-1) usp stream of Neurospora tyrosinase gene. The co transformation of this mutant with pKF-Tyr-7-wt cincture's and the pKAL-1, a plasmid which contains the Neurospora q a-2+ gene transform it to photophor. The transform ant contains the tyrosinase gene which catalyzes the unique step in the synthesis of the black pigment melanin. The activity of the tyrosinase in this transform ant was followed by measuring the absorbance of the dark coloured pigment at 332 nm. The maximum of the tyrosinase activity was shown at 16.36 and 56 hours after the shift of the transformed mycelia from constant light (L L) to constant dark (Dd). The rate of the enzyme activity was changed according to ci radian cycle of 20 hours. This G rg 1/tyrosinase construct provides a good system to study to study the temporal control of gene expression and the interaction between the different environmental c uses that affects gene expression. (author). 20 refs., 4 figs

  16. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  17. Study of the Role of siRNA Mediated Promoter Methylation in DNMT3B Knockdown and Alteration of Promoter Methylation of CDH1, GSTP1 Genes in MDA-MB -453 Cell Line.

    Science.gov (United States)

    Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas

    2017-01-01

    Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.

  18. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

    Science.gov (United States)

    Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

    2017-11-26

    Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

  19. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  20. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  1. Evidence that phosphatidylcholine-specific phospholipase C is a key molecule mediating insulin-induced enhancement of gene expression from human cytomegalovirus promoter in CHO cells

    OpenAIRE

    Zhang, Yingpei; Katakura, Yoshinori; Seto, Perry; Shirahata, Sanetaka

    1997-01-01

    The signal transduction from insulin to its receptors and Ras has been extensively studied, while little has been reported beyond these steps. We found that the expression of human interleukin 6 gene under the control of immediate early gene promoter of human cytomegalovirus was enhanced by insulin sitmulation in Chinese hamster ovary cells. The induction effect of insulin was not significantly affected by inhibitors or activators of conventional protein kinase C, cAMP dependent protein kinas...

  2. Land use type significantly affects microbial gene transcription in soil.

    Science.gov (United States)

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  3. Mediator, TATA-binding protein, and RNA polymerase II contribute to low histone occupancy at active gene promoters in yeast.

    Science.gov (United States)

    Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H

    2014-05-23

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Environmental Growth Conditions of Trichoderma spp. Affects Indole Acetic Acid Derivatives, Volatile Organic Compounds, and Plant Growth Promotion

    Science.gov (United States)

    Nieto-Jacobo, Maria F.; Steyaert, Johanna M.; Salazar-Badillo, Fatima B.; Nguyen, Dianne Vi; Rostás, Michael; Braithwaite, Mark; De Souza, Jorge T.; Jimenez-Bremont, Juan F.; Ohkura, Mana; Stewart, Alison

    2017-01-01

    Trichoderma species are soil-borne filamentous fungi widely utilized for their many plant health benefits, such as conferring improved growth, disease resistance and abiotic stress tolerance to their hosts. Many Trichoderma species are able to produce the auxin phytohormone indole-3-acetic acid (IAA), and its production has been suggested to promote root growth. Here we show that the production of IAA is strain dependent and diverse external stimuli are associated with its production. In in vitro assays, Arabidopsis primary root length was negatively affected by the interaction with some Trichoderma strains. In soil experiments, a continuum effect on plant growth was shown and this was also strain dependent. In plate assays, some strains of Trichoderma spp. inhibited the expression of the auxin reporter gene DR5 in Arabidopsis primary roots but not secondary roots. When Trichoderma spp. and A. thaliana were physically separated, enhancement of both shoot and root biomass, increased root production and chlorophyll content were observed, which strongly suggested that volatile production by the fungus influenced the parameters analyzed. Trichoderma strains T. virens Gv29.8, T. atroviride IMI206040, T. sp. “atroviride B” LU132, and T. asperellum LU1370 were demonstrated to promote plant growth through volatile production. However, contrasting differences were observed with LU1370 which had a negative effect on plant growth in soil but a positive effect in plate assays. Altogether our results suggest that the mechanisms and molecules involved in plant growth promotion by Trichoderma spp. are multivariable and are affected by the environmental conditions. PMID:28232840

  5. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  6. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  7. Children affected by HIV/AIDS: SAFE, a model for promoting their security, health, and development.

    Science.gov (United States)

    Betancourt, Theresa S; Fawzi, Mary K S; Bruderlein, Claude; Desmond, Chris; Kim, Jim Y

    2010-05-01

    A human security framework posits that individuals are the focus of strategies that protect the safety and integrity of people by proactively promoting children's well being, placing particular emphasis on prevention efforts and health promotion. This article applies this framework to a rights-based approach in order to examine the health and human rights of children affected by HIV/AIDS. The SAFE model describes sources of insecurity faced by children across four fundamental dimensions of child well-being and the survival strategies that children and families may employ in response. The SAFE model includes: Safety/protection; Access to health care and basic physiological needs; Family/connection to others; and Education/livelihoods. We argue that it is critical to examine the situation of children through an integrated lens that effectively looks at human security and children's rights through a holistic approach to treatment and care rather than artificially limiting our scope of work to survival-oriented interventions for children affected by HIV/AIDS. Interventions targeted narrowly at children, in isolation of their social and communal environment as outlined in the SAFE model, may in fact undermine protective resources in operation in families and communities and present additional threats to children's basic security. An integrated approach to the basic security and care of children has implications for the prospects of millions of children directly infected or indirectly affected by HIV/AIDS around the world. The survival strategies that young people and their families engage in must be recognized as a roadmap for improving their protection and promoting healthy development. Although applied to children affected by HIV/AIDS in the present analysis, the SAFE model has implications for guiding the care and protection of children and families facing adversity due to an array of circumstances from armed conflict and displacement to situations of extreme poverty.

  8. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  9. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  10. Characterization of the distal promoter of the human pyruvate carboxylase gene in pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    Ansaya Thonpho

    Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.

  11. Ionizing Radiation Affects Gene Expression in Mouse Skin and Bone

    Science.gov (United States)

    Terada, Masahiro; Tahimic, Candice; Sowa, Marianne B.; Schreurs, Ann-Sofie; Shirazi-Fard, Yasaman; Alwood, Joshua; Globus, Ruth K.

    2017-01-01

    Future long-duration space exploration beyond low earth orbit will increase human exposure to space radiation and microgravity conditions as well as associated risks to skeletal health. In animal studies, radiation exposure (greater than 1 Gy) is associated with pathological changes in bone structure, enhanced bone resorption, reduced bone formation and decreased bone mineral density, which can lead to skeletal fragility. Definitive measurements and detection of bone loss typically require large and specialized equipment which can make their application to long duration space missions logistically challenging. Towards the goal of developing non-invasive and less complicated monitoring methods to predict astronauts' health during spaceflight, we examined whether radiation induced gene expression changes in skin may be predictive of the responses of skeletal tissue to radiation exposure. We examined oxidative stress and growth arrest pathways in mouse skin and long bones by measuring gene expression levels via quantitative polymerase chain reaction (qPCR) after exposure to total body irradiation (IR). To investigate the effects of irradiation on gene expression, we used skin and femora (cortical shaft) from the following treatment groups: control (normally loaded, sham-irradiated), and IR (0.5 Gy 56Fe 600 MeV/n and 0.5 Gy 1H 150 MeV/n), euthanized at one and 11 days post-irradiation (IR). To determine the extent of bone loss, tibiae were harvested and cancellous microarchitecture in the proximal tibia quantified ex vivo using microcomputed tomography (microCT). Statistical analysis was performed using Student's t-test. At one day post-IR, expression of FGF18 in skin was significantly greater (3.8X) than sham-irradiated controls, but did not differ at 11 days post IR. Expression levels of other genes associated with antioxidant response (Nfe2l2, FoxO3 and Sod1) and the cell cycle (Trp53, Cdkn1a, Gadd45g) did not significantly differ between the control and IR groups

  12. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  13. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  14. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    V Shilpa

    2014-01-01

    Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

  15. Prohibition of antibiotic growth promoters has affected the genomic profiles of Lactobacillus salivarius inhabiting the swine intestine.

    Directory of Open Access Journals (Sweden)

    Jun-Yeong Lee

    Full Text Available After the introduction of a ban on the use of antibiotic growth promoters (AGPs for livestock, the feeding environment, including the composition of animal intestinal microbiota, has changed rapidly. We hypothesized that the microbial genomes have also been affected by this legal prohibition, and investigated an important member of the swine gut microbiota, Lactobacillus salivarius, with a pan-genomic approach. Here, we isolated 21 L. salivarius strains composed of 6 strains isolated before the AGP prohibition (SBPs and 15 strains isolated after the AGP prohibition (SAPs at an interval of a decade, and the draft genomes were generated de novo. Several genomic differences between SBPs and SAPs were identified, although the number and function of antibiotic resistance genes were not different. SBPs showed larger genome size and a higher number of orthologs, as well as lower genetic diversity, than SAPs. SBPs had genes associated with the utilization of L-rhamnose and D-tagatose for energy production. Because these sugars are also used in exopolysaccharide (EPS synthesis, we tried to identify differences in biofilm formation-associated genes. The genes for the production of EPSs and extracellular proteins were different in terms of amino acid sequences. Indeed, SAPs formed dense biofilm and survived better than SBPs in the swine intestinal environment. These results suggest that SAPs have evolved and adapted to protect themselves from new selection pressure of the swine intestinal microenvironment by forming dense biofilms, adopting a distinct antibiotic resistance strategy. This finding is particularly important to understand the evolutionary changes in host-microbe interaction and provide detailed insight for the development of effective probiotics for livestock.

  16. Prohibition of antibiotic growth promoters has affected the genomic profiles of Lactobacillus salivarius inhabiting the swine intestine.

    Science.gov (United States)

    Lee, Jun-Yeong; Han, Geon Goo; Lee, Ho-Bin; Lee, Sang-Mok; Kang, Sang-Kee; Jin, Gwi-Deuk; Park, Jongbin; Chae, Byung Jo; Choi, Yo Han; Kim, Eun Bae; Choi, Yun-Jaie

    2017-01-01

    After the introduction of a ban on the use of antibiotic growth promoters (AGPs) for livestock, the feeding environment, including the composition of animal intestinal microbiota, has changed rapidly. We hypothesized that the microbial genomes have also been affected by this legal prohibition, and investigated an important member of the swine gut microbiota, Lactobacillus salivarius, with a pan-genomic approach. Here, we isolated 21 L. salivarius strains composed of 6 strains isolated before the AGP prohibition (SBPs) and 15 strains isolated after the AGP prohibition (SAPs) at an interval of a decade, and the draft genomes were generated de novo. Several genomic differences between SBPs and SAPs were identified, although the number and function of antibiotic resistance genes were not different. SBPs showed larger genome size and a higher number of orthologs, as well as lower genetic diversity, than SAPs. SBPs had genes associated with the utilization of L-rhamnose and D-tagatose for energy production. Because these sugars are also used in exopolysaccharide (EPS) synthesis, we tried to identify differences in biofilm formation-associated genes. The genes for the production of EPSs and extracellular proteins were different in terms of amino acid sequences. Indeed, SAPs formed dense biofilm and survived better than SBPs in the swine intestinal environment. These results suggest that SAPs have evolved and adapted to protect themselves from new selection pressure of the swine intestinal microenvironment by forming dense biofilms, adopting a distinct antibiotic resistance strategy. This finding is particularly important to understand the evolutionary changes in host-microbe interaction and provide detailed insight for the development of effective probiotics for livestock.

  17. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  18. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  19. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  20. Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

    International Nuclear Information System (INIS)

    Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

    2007-01-01

    Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

  1. Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

    Science.gov (United States)

    Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J

    2018-05-01

    Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.

  2. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  4. Valsartan Promoting Atherosclerotic Plaque Stabilization by Upregulating Renalase: A Potential-Related Gene of Atherosclerosis.

    Science.gov (United States)

    Zhou, Mingxue; Ma, Chao; Liu, Weihong; Liu, Hongxu; Wang, Ning; Kang, Qunfu; Li, Ping

    2015-09-01

    Renalase is a protein that can regulate sympathetic nerve activity by metabolizing catecholamines, while redundant catecholamines are thought to contribute to atherosclerosis (As). Catecholamine release can be facilitated by angiotensin (Ang) II by binding to Ang II type 1 (AT1) receptors. Valsartan, a special AT1 antagonist, can dilate blood vessels and reduce blood pressure, but it remained unclear whether valsartan can promote the stability of atherosclerotic plaque by affecting renalase. This study examined the tissue distribution of renalase in ApoE(-/-) mice fed with a high-fat diet and the effect of valsartan on expression of renalase. ApoE(-/-) mice were fed with a high-fat diet for 13 or 26 weeks. As a control, 10 C57BL mice were fed with a standard chow diet. After 13 weeks on the high-fat diet, the ApoE(-/-) mice were randomized (10 mice/group) and treated with valsartan, simvastatin, or distilled water (control group) for an additional 13 weeks accompanied by a high-fat diet. Knockout of ApoE caused a dramatic increase in expression of renalase in mice adipose tissue. With the disturbance of lipid metabolism induced by a high-fat diet, renalase expression decreased in the liver. Renalase can be expressed in smooth muscle cells and M2 macrophages in atherosclerotic plaque, and its expression gradually decreases in the fibrous cap during the transition from stable to vulnerable atherosclerotic plaque. Valsartan, an AT1 receptor antagonist, promotes the stabilization of atherosclerotic plaque by increasing the levels of renalase in serum and the expression of renalase in the fibrous cap of atherosclerotic plaque. It also reduces triglyceride levels in serum and increases the expression of renalase in the liver. Renalase may be a potential-related gene of lipid metabolism and As, and it may be the possible molecular target of valsartan to help stabilize atherosclerotic plaque. © The Author(s) 2015.

  5. Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

    DEFF Research Database (Denmark)

    Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

    2009-01-01

    reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

  6. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  7. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  8. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.

    2014-01-01

    raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted

  9. Identification of nonviable genes affecting touch sensitivity in Caenorhabditis elegans using neuronally enhanced feeding RNA interference.

    Science.gov (United States)

    Chen, Xiaoyin; Cuadros, Margarete Diaz; Chalfie, Martin

    2015-01-09

    Caenorhabditis elegans senses gentle touch along the body via six touch receptor neurons. Although genetic screens and microarray analyses have identified several genes needed for touch sensitivity, these methods miss pleiotropic genes that are essential for the viability, movement, or fertility of the animals. We used neuronally enhanced feeding RNA interference to screen genes that cause lethality or paralysis when mutated, and we identified 61 such genes affecting touch sensitivity, including five positive controls. We confirmed 18 genes by using available alleles, and further studied one of them, tag-170, now renamed txdc-9. txdc-9 preferentially affects anterior touch response but is needed for tubulin acetylation and microtubule formation in both the anterior and posterior touch receptor neurons. Our results indicate that neuronally enhanced feeding RNA interference screens complement traditional mutageneses by identifying additional nonviable genes needed for specific neuronal functions. Copyright © 2015 Chen et al.

  10. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  11. Interactions between SNPs affecting inflammatory response genes are associated with multiple myeloma disease risk and survival

    DEFF Research Database (Denmark)

    Nielsen, Kaspar René; Rodrigo-Domingo, Maria; Steffensen, Rudi

    2017-01-01

    The origin of multiple myeloma depends on interactions with stromal cells in the course of normal B-cell differentiation and evolution of immunity. The concept of the present study is that genes involved in MM pathogenesis, such as immune response genes, can be identified by screening for single......3L1 gene promoters. The occurrence of single polymorphisms, haplotypes and SNP-SNP interactions were statistically analyzed for association with disease risk and outcome following high-dose therapy. Identified genes that carried SNPs or haplotypes that were identified as risk or prognostic factors......= .005). The 'risk genes' were analyzed for expression in normal B-cell subsets (N = 6) from seven healthy donors and we found TNFA and IL-6 expressed both in naïve and in memory B cells when compared to preBI, II, immature and plasma cells. The 'prognosis genes' CHI3L1, IL-6 and IL-10 were differential...

  12. Promoter polymorphisms in two overlapping 6p25 genes implicate mitochondrial proteins in cognitive deficit in schizophrenia.

    LENUS (Irish Health Repository)

    Jablensky, A

    2011-10-04

    In a previous study, we detected a 6p25-p24 region linked to schizophrenia in families with high composite cognitive deficit (CD) scores, a quantitative trait integrating multiple cognitive measures. Association mapping of a 10 Mb interval identified a 260 kb region with a cluster of single-nucleotide polymorphisms (SNPs) significantly associated with CD scores and memory performance. The region contains two colocalising genes, LYRM4 and FARS2, both encoding mitochondrial proteins. The two tagging SNPs with strongest evidence of association were located around the overlapping putative promoters, with rs2224391 predicted to alter a transcription factor binding site (TFBS). Sequencing the promoter region identified 22 SNPs, many predicted to affect TFBSs, in a tight linkage disequilibrium block. Luciferase reporter assays confirmed promoter activity in the predicted promoter region, and demonstrated marked downregulation of expression in the LYRM4 direction under the haplotype comprising the minor alleles of promoter SNPs, which however is not driven by rs2224391. Experimental evidence from LYRM4 expression in lymphoblasts, gel-shift assays and modelling of DNA breathing dynamics pointed to two adjacent promoter SNPs, rs7752203-rs4141761, as the functional variants affecting expression. Their C-G alleles were associated with higher transcriptional activity and preferential binding of nuclear proteins, whereas the G-A combination had opposite effects and was associated with poor memory and high CD scores. LYRM4 is a eukaryote-specific component of the mitochondrial biogenesis of Fe-S clusters, essential cofactors in multiple processes, including oxidative phosphorylation. LYRM4 downregulation may be one of the mechanisms involved in inefficient oxidative phosphorylation and oxidative stress, increasingly recognised as contributors to schizophrenia pathogenesis.Molecular Psychiatry advance online publication, 4 October 2011; doi:10.1038\\/mp.2011.129.

  13. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  14. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  15. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  16. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  17. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

    Directory of Open Access Journals (Sweden)

    Lucie Kosinová

    Full Text Available The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3 in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information

  18. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  19. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Directory of Open Access Journals (Sweden)

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  20. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  1. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  2. MiR529a modulates panicle architecture through regulating SQUAMOSA PROMOTER BINDING-LIKE genes in rice (Oryza sativa).

    Science.gov (United States)

    Yue, Erkui; Li, Chao; Li, Yu; Liu, Zhen; Xu, Jian-Hong

    2017-07-01

    MiR529a affects rice panicle architecture by targeting OsSPL2,OsSPL14 and OsSPL17 genes that could regulate their downstream panicle related genes. The panicle architecture determines the grain yield and quality of rice, which could be regulated by many transcriptional factors. The SQUAMOSA PROMOTER BINDING-LIKE (SPL) transcription factors are involved in the regulation of panicle development, which are targeted by miR156 and miR529. The expression profile demonstrated that miR529a is preferentially expressed in the early panicle of rice and it might regulate panicle development in rice. However, the regulation mechanism of miR529-SPL is still not clear. In this study, we predicted five miR529a putative target genes, OsSPL2, OsSPL14, OsSPL16, OsSPL17 and OsSPL18, while only the expression of OsSPL2, OsSPL14, and OsSPL17 was regulated by miR529a in the rice panicle. Overexpression of miR529a dramatically affected panicle architecture, which was regulated by OsSPL2, OsSPL14, and OsSPL17. Furthermore, the 117, 35, and 25 pathway genes associated with OsSPL2, OsSPL14 and OsSPL17, respectively, were predicted, and they shared 20 putative pathway genes. Our results revealed that miR529a could play a vital role in the regulation of panicle architecture through regulating OsSPL2, OsSPL14, OsSPL17 and the complex networks formed by their pathway and downstream genes. These findings will provide new genetic resources for reshaping ideal plant architecture and breeding high yield rice varieties.

  3. A variant on promoter of the cannabinoid receptor 1 gene (CNR1) moderates the effect of valence on working memory.

    Science.gov (United States)

    Fairfield, Beth; Mammarella, Nicola; Franzago, Marica; Di Domenico, Alberto; Stuppia, Liborio; Gatta, Valentina

    2018-02-01

    Cannabinoid receptor 1 gene (CNR1) variants have been related to affective information processing and, in particular, to stress release. Here, we aimed to examine whether the endocannabinoid system via CNR1 signaling modulates affective working memory, the memory system that transiently maintains and manipulates emotionally charged material. We focused on rs2180619 (A > G) polymorphism and examined genotype data collected from 231 healthy females. Analyses showed how a general positivity bias in working memory (i.e., better memory for positive words) emerged as task strings lengthened only in carriers of the major allele (AA/AG). Differently, GG carriers showed better memory for affective items in general (i.e., positive and negative words). These findings are some of the first to directly highlight the role of variant on promoter of the CNR1 gene in affective working memory and to evidence a differentiation among CNR1 genotypes in terms of larger difficulties in disengaging from negative stimuli in GG carriers.

  4. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  5. CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.

    Science.gov (United States)

    Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan

    2017-07-05

    DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20

  6. Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.

    Science.gov (United States)

    Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk

    2009-07-01

    To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.

  7. A mutation in a functional Sp1 binding site of the telomerase RNA gene (hTERC promoter in a patient with Paroxysmal Nocturnal Haemoglobinuria

    Directory of Open Access Journals (Sweden)

    Mason Philip J

    2004-06-01

    Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.

  8. Tumor-specific mutations in low-frequency genes affect their functional properties

    NARCIS (Netherlands)

    L. Erdem-Eraslan (Lale); D. Heijsman (Daphne); M. De Wit (Maurice); A.E. Kremer (Andreas); A. Sacchetti (Andrea); P.J. van der Spek (Peter); P.A.E. Sillevis Smitt (Peter); P.J. French (Pim)

    2015-01-01

    textabstractCausal genetic changes in oligodendrogliomas (OD) with 1p/19q co-deletion include mutations in IDH1, IDH2, CIC, FUBP1, TERT promoter and NOTCH1. However, it is generally assumed that more somatic mutations are required for tumorigenesis. This study aimed to establish whether genes

  9. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  10. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  11. MITEs in the promoters of effector genes allow prediction of novel virulence genes in Fusarium oxysporum

    NARCIS (Netherlands)

    Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M.

    2013-01-01

    Background The plant-pathogenic fungus Fusarium oxysporum f.sp.lycopersici (Fol) has accessory, lineage-specific (LS) chromosomes that can be transferred horizontally between strains. A single LS chromosome in the Fol4287 reference strain harbors all known Fol effector genes. Transfer of this

  12. The Role of S P2, SP3 AND SP4 in The Transcriptional Regulation of The Promoter of Nuclear Encoded Mitochondrial Genes

    International Nuclear Information System (INIS)

    Zaid, A.; Salem, Gh.

    2012-01-01

    The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.

  13. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    International Nuclear Information System (INIS)

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.

    2006-01-01

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression

  14. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  15. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  16. Leptin promoter gene polymorphism on -2549 position decreases plasma leptin and increases appetite in normal weight volunteers

    Directory of Open Access Journals (Sweden)

    Sandra Bragança Coelho

    2014-05-01

    Full Text Available Introduction: Investigate whether polymorphism in the promoter region encoding leptin and leptin receptor gene, in normal weight individuals, affects hormonal and appetite responses to peanuts.Materials and methods: Appetite, anthropometric indices, body composition, physical activity, dietary intake and leptin, ghrelin and insulin levels were monitored. Polymorphism analyses were also carried out.Results: None of the treatments led to statistical differences in the analyzed hormones. No polymorphism was found for leptin receptor gene, while for leptin gene, 50% of the volunteers presented one polymorphic allele and 13% presented both polymorphic alleles. These last ones presented lower body fat mass, leptin and ghrelin plasma concentrations, and fullness rates. They also presented higher hunger, desire to eat, and desire to eat sweet and salty foods.Conclusions: Peanut did not affect appetite and presented no different hormonal responses, compared to other foods studied. Polymorphic allele carriers in both alleles presented higher probability to develop obesity. However, the magnitude of this probability could not be measured.

  17. How does network structure affect partnerships for promoting physical activity? Evidence from Brazil and Colombia.

    Science.gov (United States)

    Parra, Diana C; Dauti, Marsela; Harris, Jenine K; Reyes, Lissette; Malta, Deborah C; Brownson, Ross C; Quintero, Mario A; Pratt, Michael

    2011-11-01

    The objective of this study was to describe the network structure and factors associated with collaboration in two networks that promote physical activity (PA) in Brazil and Colombia. Organizations that focus on studying and promoting PA in Brazil (35) and Colombia (53) were identified using a modified one-step reputational snowball sampling process. Participants completed an on-line survey between December 2008 and March 2009 for the Brazil network, and between April and June 2009 for the Colombia network. Network stochastic modeling was used to investigate the likelihood of reported inter-organizational collaboration. While structural features of networks were significant predictors of collaboration within each network, the coefficients and other network characteristics differed. Brazil's PA network was decentralized with a larger number of shared partnerships. Colombia's PA network was centralized and collaboration was influenced by perceived importance of peer organizations. On average, organizations in the PA network of Colombia reported facing more barriers (1.5 vs. 2.5 barriers) for collaboration. Future studies should focus on how these different network structures affect the implementation and uptake of evidence-based PA interventions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  19. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  20. Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

    Science.gov (United States)

    Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

    2017-10-01

    PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  2. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  3. Analysis of the AHR gene proximal promoter GGGGC-repeat polymorphism in lung, breast, and colon cancer

    International Nuclear Information System (INIS)

    Spink, Barbara C.; Bloom, Michael S.; Wu, Susan; Sell, Stewart; Schneider, Erasmus; Ding, Xinxin; Spink, David C.

    2015-01-01

    The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC) n , located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC) 2 alleles were observed; however, in western gorilla, (GGGGC) n alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC) n was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC) n alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC) 2 was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC) n short tandem repeats are inherited, and that the (GGGGC) 2 allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC) n , where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC) n microsatellite instability • AHR promoter activity of a construct with (GGGGC) 2 was lower than that of (GGGGC) 4 • The frequency of (GGGGC) 2 in lung cancer patients was 8-fold higher than in neonates • The

  4. Analysis of the AHR gene proximal promoter GGGGC-repeat polymorphism in lung, breast, and colon cancer

    Energy Technology Data Exchange (ETDEWEB)

    Spink, Barbara C. [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Bloom, Michael S. [Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Wu, Susan [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Sell, Stewart; Schneider, Erasmus [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Ding, Xinxin [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Spink, David C., E-mail: spink@wadsworth.org [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States)

    2015-01-01

    The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC){sub n}, located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC){sub 2} alleles were observed; however, in western gorilla, (GGGGC){sub n} alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC){sub n} was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC){sub n} alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC){sub 2} was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC){sub n} short tandem repeats are inherited, and that the (GGGGC){sub 2} allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC){sub n}, where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC){sub n} microsatellite instability • AHR promoter activity of a construct with (GGGGC){sub 2} was lower than that of (GGGGC){sub 4} • The frequency of (GGGGC){sub 2} in lung

  5. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Inactivation of promoter 1B of APC causes partial gene silencing: evidence for a significant role of the promoter in regulation and causative of familial adenomatous polyposis

    DEFF Research Database (Denmark)

    Rohlin, A; Engwall, Y; Fritzell, K

    2011-01-01

    inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...

  7. hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro

    International Nuclear Information System (INIS)

    Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan

    2007-01-01

    Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)

  8. Methylation of class II transactivator gene promoter IV is not associated with susceptibility to Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Lincoln Matthew R

    2008-07-01

    Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.

  9. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  10. Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

    Science.gov (United States)

    Lee, S H; Minowa, M T; Mouradian, M M

    1996-10-11

    The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

  11. A Study of Predictive Factors Affecting Health: Promoting Behaviors of North Korean Adolescent Refugees

    Directory of Open Access Journals (Sweden)

    Jin-Won Noh

    2015-09-01

    Full Text Available Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p<0.05, having family members in South Korea (t=2.02, p<0.05, and subjective health status (t=4.96, p<0.01. Scores on health-responsible behaviors were higher with higher age (t=2.90, p<0.01 and for subjects without family or friends (t=2.43, p<0.05. Higher physical-activity behaviors were observed in males (t=3.32, p<0.01, in those with better subjective health status (t=3.46, p<0.05 and lower body mas index (t=3.48, p<0.05, and in smokers (t=3.17, p<0.01. Nutritional behaviors were higher in those who followed a religion (t=2.17, p<0.05. Spiritual growth behaviors were higher in those who followed a religion (t=4.21, p<0.001, had no family in South Korea (t=2.04, p<0.05, and had higher subjective health status (t=5.74, p<0.01. Scores on interpersonal relationships and stress-management behaviors were higher for those with higher subjective health status. A multiple regression analysis showed greater effects on health-promoting behaviors when subjective health status was better. Older people and non-smokers exhibited more health-responsible behaviors, while more physical-activity behaviors and spiritual growth activities were observed when subjective health status was better. Interpersonal relationship behaviors had positive effects on those with good subjective heath status and on non-smokers. Conclusions: Based on the results of the current study, an alternative was suggested for promoting health in North Korean adolescent refugees.

  12. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Science.gov (United States)

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  13. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  14. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  15. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  16. Correlation between the methylation of APC gene promoter and colon cancer.

    Science.gov (United States)

    Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua

    2017-08-01

    The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.

  17. Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

    DEFF Research Database (Denmark)

    Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

    2009-01-01

    with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....

  18. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    International Nuclear Information System (INIS)

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi

    2006-01-01

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid

  19. A Phyletically Rare Gene Promotes the Niche-specific Fitness of an E. coli Pathogen during Bacteremia

    Science.gov (United States)

    Wiles, Travis J.; Lewis, Adam J.; Mobley, Harry L. T.; Casjens, Sherwood R.; Mulvey, Matthew A.

    2013-01-01

    In bacteria, laterally acquired genes are often concentrated within chromosomal regions known as genomic islands. Using a recently developed zebrafish infection model, we set out to identify unique factors encoded within genomic islands that contribute to the fitness and virulence of a reference urosepsis isolate—extraintestinal pathogenic Escherichia coli strain CFT073. By screening a series of deletion mutants, we discovered a previously uncharacterized gene, neaT, that is conditionally required by the pathogen during systemic infections. In vitro assays indicate that neaT can limit bacterial interactions with host phagocytes and alter the aggregative properties of CFT073. The neaT gene is localized within an integrated P2-like bacteriophage in CFT073, but was rarely found within other proteobacterial genomes. Sequence-based analyses revealed that neaT homologues are present, but discordantly conserved, within a phyletically diverse set of bacterial species. In CFT073, neaT appears to be unameliorated, having an exceptionally A+T-rich composition along with a notably altered codon bias. These data suggest that neaT was recently brought into the proteobacterial pan-genome from an extra-phyletic source. Interestingly, even in G+C-poor genomes, as found within the Firmicutes lineage, neaT-like genes are often unameliorated. Sequence-level features of neaT homologues challenge the common supposition that the A+T-rich nature of many recently acquired genes reflects the nucleotide composition of their genomes of origin. In total, these findings highlight the complexity of the evolutionary forces that can affect the acquisition, utilization, and assimilation of rare genes that promote the niche-dependent fitness and virulence of a bacterial pathogen. PMID:23459509

  20. Modification of epigenetic patterns in low birth weight children: importance of hypomethylation of the ACE gene promoter.

    Science.gov (United States)

    Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C; Ierardi, Daniela Filippini; Franco, Maria do Carmo

    2014-01-01

    There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (PACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (PACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels.

  1. Interspecies systems biology uncovers metabolites affecting C. elegans gene expression and life history traits.

    Science.gov (United States)

    Watson, Emma; MacNeil, Lesley T; Ritter, Ashlyn D; Yilmaz, L Safak; Rosebrock, Adam P; Caudy, Amy A; Walhout, Albertha J M

    2014-02-13

    Diet greatly influences gene expression and physiology. In mammals, elucidating the effects and mechanisms of individual nutrients is challenging due to the complexity of both the animal and its diet. Here, we used an interspecies systems biology approach with Caenorhabditis elegans and two of its bacterial diets, Escherichia coli and Comamonas aquatica, to identify metabolites that affect the animal's gene expression and physiology. We identify vitamin B12 as the major dilutable metabolite provided by Comamonas aq. that regulates gene expression, accelerates development, and reduces fertility but does not affect lifespan. We find that vitamin B12 has a dual role in the animal: it affects development and fertility via the methionine/S-Adenosylmethionine (SAM) cycle and breaks down the short-chain fatty acid propionic acid, preventing its toxic buildup. Our interspecies systems biology approach provides a paradigm for understanding complex interactions between diet and physiology. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Interspecies Systems Biology Uncovers Metabolites Affecting C. elegans Gene Expression and Life History Traits

    Science.gov (United States)

    Watson, Emma; MacNeil, Lesley T.; Ritter, Ashlyn D.; Yilmaz, L. Safak; Rosebrock, Adam P.; Caudy, Amy A.; Walhout, Albertha J. M.

    2014-01-01

    SUMMARY Diet greatly influences gene expression and physiology. In mammals, elucidating the effects and mechanisms of individual nutrients is challenging due to the complexity of both the animal and its diet. Here we used an interspecies systems biology approach with Caenorhabditis elegans and two if its bacterial diets, Escherichia coli and Comamonas aquatica, to identify metabolites that affect the animal’s gene expression and physiology. We identify vitamin B12 as the major dilutable metabolite provided by Comamonas aq. that regulates gene expression, accelerates development and reduces fertility, but does not affect lifespan. We find that vitamin B12 has a dual role in the animal: it affects development and fertility via the methionine/S-Adenosylmethionine (SAM) cycle and breaks down the short-chain fatty acid propionic acid preventing its toxic buildup. Our interspecies systems biology approach provides a paradigm for understanding complex interactions between diet and physiology. PMID:24529378

  3. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    DEFF Research Database (Denmark)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal

    2013-01-01

    , isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...

  4. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  5. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    International Nuclear Information System (INIS)

    Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen

    2007-01-01

    Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses

  6. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  7. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  8. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  9. Identification of genes that promote or inhibit olfactory memory formation in Drosophila.

    Science.gov (United States)

    Walkinshaw, Erica; Gai, Yunchao; Farkas, Caitlin; Richter, Daniel; Nicholas, Eric; Keleman, Krystyna; Davis, Ronald L

    2015-04-01

    Genetic screens in Drosophila melanogaster and other organisms have been pursued to filter the genome for genetic functions important for memory formation. Such screens have employed primarily chemical or transposon-mediated mutagenesis and have identified numerous mutants including classical memory mutants, dunce and rutabaga. Here, we report the results of a large screen using panneuronal RNAi expression to identify additional genes critical for memory formation. We identified >500 genes that compromise memory when inhibited (low hits), either by disrupting the development and normal function of the adult animal or by participating in the neurophysiological mechanisms underlying memory formation. We also identified >40 genes that enhance memory when inhibited (high hits). The dunce gene was identified as one of the low hits and further experiments were performed to map the effects of the dunce RNAi to the α/β and γ mushroom body neurons. Additional behavioral experiments suggest that dunce knockdown in the mushroom body neurons impairs memory without significantly affecting acquisition. We also characterized one high hit, sickie, to show that RNAi knockdown of this gene enhances memory through effects in dopaminergic neurons without apparent effects on acquisition. These studies further our understanding of two genes involved in memory formation, provide a valuable list of genes that impair memory that may be important for understanding the neurophysiology of memory or neurodevelopmental disorders, and offer a new resource of memory suppressor genes that will aid in understanding restraint mechanisms employed by the brain to optimize resources. Copyright © 2015 by the Genetics Society of America.

  10. Over-expression of KdSOC1 gene affected plantlet morphogenesis in Kalanchoe daigremontiana.

    Science.gov (United States)

    Zhu, Chen; Wang, Li; Chen, Jinhua; Liu, Chenglan; Zeng, Huiming; Wang, Huafang

    2017-07-17

    Kalanchoe daigremontiana reproduces asexually by producing plantlets along the leaf margin. The aim of this study was to identify the function of the SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 gene in Kalanchoe daigremontiana (KdSOC1) during plantlet morphogenesis. In this study, KdSOC1 gene expression was detected at stem cell niche during in vitro somatic embryogenesis and plantlet morphogenesis. Disrupting endogenous auxin transportation suppressed the KdSOC1 gene response. Knockdown of the KdSOC1 gene caused a defect in cotyledon formation during the early heart stage of somatic embryogenesis. Over-expression (OE) of the KdSOC1 gene resulted in asymmetric plantlet distribution, a reduced number of plantlets, thicker leaves, and thicker vascular fibers. Higher KdPIN1 gene expression and auxin content were found in OE plant compared to those of wild-type plant leaves, which indicated possible KdSOC1 gene role in affecting auxin distribution and accumulation. KdSOC1 gene OE in DR5-GUS Arabidopsis reporting lines resulted in an abnormal auxin response pattern during different stages of somatic embryogenesis. In summary, the KdSOC1 gene OE might alter auxin distribution and accumulation along leaf margin to initiate plantlet formation and distribution, which is crucial for plasticity during plantlet formation under various environmental conditions.

  11. Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.

    Science.gov (United States)

    Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G

    2015-01-01

    CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.

  12. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    Science.gov (United States)

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  13. Identification of susceptibility genes for bipolar affective disorder and schizophrenia on chromosome 22q13

    DEFF Research Database (Denmark)

    Severinsen, Jacob Eg

    2006-01-01

    Linkage analyses suggest that chromosome 22q12-13 may harbor one or more shared susceptibility loci for bipolar affective disorder (BPD) and schizophrenia (SZ). In a study of distantly related cases and control individuals from the Faeroe Islands our group has previously reported that chromosome 22...... samples (total of 1,751 individuals), and by bioinformatic and expression analyses of a subset of disease associated genes and gene variants. In total 67 single nucleotide polymorphisms (SNPs) located in 18 positional candidate genes, and 4 microsattelite markers were investigated, using a Scottish case...

  14. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

    1990-01-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

  15. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    Science.gov (United States)

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-03

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  17. The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

    Science.gov (United States)

    Fu, Chunli; Xing, Yingqi; Song, Xiaonan

    2011-04-01

    To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

  18. Quantitative Methylation Profiles for Multiple Tumor Suppressor Gene Promoters in Salivary Gland Tumors

    Science.gov (United States)

    Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.

    2010-01-01

    Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817

  19. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  20. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  1. Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring

    Directory of Open Access Journals (Sweden)

    Liu Zhongjie

    2015-11-01

    Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.

  2. The Varicella-Zoster Virus Immediate-Early 63 protein affects chromatin controlled gene transcription in a cell-type dependent manner

    Directory of Open Access Journals (Sweden)

    Bontems Sébastien

    2007-10-01

    Full Text Available Abstract Background Varicella Zoster Virus Immediate Early 63 protein (IE63 has been shown to be essential for VZV replication, and critical for latency establishment. The activity of the protein as a transcriptional regulator is not fully clear yet. Using transient transfection assays, IE63 has been shown to repress viral and cellular promoters containing typical TATA boxes by interacting with general transcription factors. Results In this paper, IE63 regulation properties on endogenous gene expression were evaluated using an oligonucleotide-based micro-array approach. We found that IE63 modulates the transcription of only a few genes in HeLa cells including genes implicated in transcription or immunity. Furthermore, we showed that this effect is mediated by a modification of RNA POL II binding on the promoters tested and that IE63 phosphorylation was essential for these effects. In MeWo cells, the number of genes whose transcription was modified by IE63 was somewhat higher, including genes implicated in signal transduction, transcription, immunity, and heat-shock signalling. While IE63 did not modify the basal expression of several NF-κB dependent genes such as IL-8, ICAM-1, and IκBα, it modulates transcription of these genes upon TNFα induction. This effect was obviously correlated with the amount of p65 binding to the promoter of these genes and with histone H3 acetylation and HDAC-3 removal. Conclusion While IE63 only affected transcription of a small number of cellular genes, it interfered with the TNF-inducibility of several NF-κB dependent genes by the accelerated resynthesis of the inhibitor IκBα.

  3. Tumor SHB gene expression affects disease characteristics in human acute myeloid leukemia.

    Science.gov (United States)

    Jamalpour, Maria; Li, Xiujuan; Cavelier, Lucia; Gustafsson, Karin; Mostoslavsky, Gustavo; Höglund, Martin; Welsh, Michael

    2017-10-01

    The mouse Shb gene coding for the Src Homology 2-domain containing adapter protein B has recently been placed in context of BCRABL1-induced myeloid leukemia in mice and the current study was performed in order to relate SHB to human acute myeloid leukemia (AML). Publicly available AML databases were mined for SHB gene expression and patient survival. SHB gene expression was determined in the Uppsala cohort of AML patients by qPCR. Cell proliferation was determined after SHB gene knockdown in leukemic cell lines. Despite a low frequency of SHB gene mutations, many tumors overexpressed SHB mRNA compared with normal myeloid blood cells. AML patients with tumors expressing low SHB mRNA displayed longer survival times. A subgroup of AML exhibiting a favorable prognosis, acute promyelocytic leukemia (APL) with a PMLRARA translocation, expressed less SHB mRNA than AML tumors in general. When examining genes co-expressed with SHB in AML tumors, four other genes ( PAX5, HDAC7, BCORL1, TET1) related to leukemia were identified. A network consisting of these genes plus SHB was identified that relates to certain phenotypic characteristics, such as immune cell, vascular and apoptotic features. SHB knockdown in the APL PMLRARA cell line NB4 and the monocyte/macrophage cell line MM6 adversely affected proliferation, linking SHB gene expression to tumor cell expansion and consequently to patient survival. It is concluded that tumor SHB gene expression relates to AML survival and its subgroup APL. Moreover, this gene is included in a network of genes that plays a role for an AML phenotype exhibiting certain immune cell, vascular and apoptotic characteristics.

  4. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  5. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  6. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  7. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  8. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  9. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  10. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    International Nuclear Information System (INIS)

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  11. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  12. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  13. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  14. [miR-182 promotes cell proliferation of cervical cancer cells by targeting adenomatous polyposis coli (APC) gene].

    Science.gov (United States)

    Li, Pei; Hu, Jing; Zhang, Ying; Li, Jianping; Dang, Yunzhi; Zhang, Rui; Wei, Lichun; Shi, Mei

    2018-02-01

    Objective To investigate the role and mechanism of microRNA-182 (miR-182) in the proliferation of cervical cancer cells. Methods With liposome-mediated transient transfection method, the level of miR-182 in HeLa and SiHa cells was increased or decreased. CCK-8 assay and colony formation assay were used to observe the effect of miR-182 on the proliferation of cervical cancer cells. Using bioinformatics predictions, real-time quantitative PCR, and dual luciferase reporter assay, we clarified the role of miR-182 in posttranscriptional regulation of adenomatous polyposis coli (APC) gene and its effect on the downstream molecules (c-Myc and cyclin D1) of Wnt singling pathway. Results Up-regulation of miR-182 significantly promoted the proliferation of cervical cancer cells, while down-regulation of miR-182 significantly inhibited the proliferation of cervical cancer cells. Over-expression of miR-182 inhibited the expression of APC gene in cervical cancer cells and the regulation of miR-182 affected the expression of canonical Wnt signaling pathway downstream molecules in cervical cancer cells. Conclusion The miR-182 stimulates canonical Wnt signaling pathway by targeting APC gene and enhances the proliferation of cervical cancer cells.

  15. The Anaphase-Promoting Complex (APC) ubiquitin ligase affects chemosensory behavior in C. elegans.

    Science.gov (United States)

    Wang, Julia; Jennings, Alexandra K; Kowalski, Jennifer R

    2016-01-01

    The regulation of fundamental aspects of neurobiological function has been linked to the ubiquitin signaling system (USS), which regulates the degradation and activity of proteins and is catalyzed by E1, E2, and E3 enzymes. The Anaphase-Promoting Complex (APC) is a multi-subunit E3 ubiquitin ligase that controls diverse developmental and signaling processes in post-mitotic neurons; however, potential roles for the APC in sensory function have yet to be explored. In this study, we examined the effect of the APC ubiquitin ligase on chemosensation in Caenorhabditis elegans by testing chemotaxis to the volatile odorants, diacetyl, pyrazine, and isoamyl alcohol, to which wild-type worms are attracted. Animals with loss of function mutations in either of two alleles (g48 and ye143) of the gene encoding the APC subunit EMB-27 APC6 showed increased chemotaxis towards diacetyl and pyrazine, odorants sensed by AWA neurons, but exhibited normal chemotaxis to isoamyl alcohol, which is sensed by AWC neurons. The statistically significant increase in chemotaxis in the emb-27 APC6 mutants suggests that the APC inhibits AWA-mediated chemosensation in C. elegans. Increased chemotaxis to pyrazine was also seen with mutants lacking another essential APC subunit, MAT-2 APC1; however, mat-2 APC1 mutants exhibited wild type responses to diacetyl. The difference in responsiveness of these two APC subunit mutants may be due to differential strength of these hypomorphic alleles or may indicate the presence of functional sub-complexes of the APC at work in this process. These findings are the first evidence for APC-mediated regulation of chemosensation and lay the groundwork for further studies aimed at identifying the expression levels, function, and targets of the APC in specific sensory neurons. Because of the similarity between human and C. elegans nervous systems, the role of the APC in sensory neurons may also advance our understanding of human sensory function and disease.

  16. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    Science.gov (United States)

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  17. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  18. Embedded promotions in online services: how goal-relevance ambiguity shapes response and affect.

    Science.gov (United States)

    Brasel, S Adam

    2010-09-01

    Adding promotions to online services is increasingly commonplace, yet consumers may have difficulty determining whether service-embedded promotions are goal-relevant, due to the linear and transactional nature of online services. This contextual effect of goal-relevance ambiguity on promotions is explored across three studies. An exploratory study utilizing actual service websites and a broad range of consumers as participants showed promotional elements in online services generated considerable confusion, and instructions labeling promotions as optional did little to relieve goal-relevance ambiguity. A second study using student participants inserted promotions into an online airline ticket service, a shopping site, a local news blog, and a news headline aggregator, to explore how linear and transactional sites such as online services compared to more exploratory or informational online environments. Results showed that service-embedded promotions enjoyed initial compliance far beyond promotions in traditional websites but also generated increased confusion, frustration, and anger. A third study utilizing student participants explored how varying levels of online service experience created differing responses to promotions in services; novices were less able to judge promotional goal-relevance and experienced more confusion, whereas experienced searchers were more likely to respond with frustration and anger. Many participants complied with promotional offers at the time of the service transaction, but stated intentions to use the promotion postservice were very low. The overall results spotlight goal-relevance ambiguity as an important driver of consumer response to online promotions, and highlight the role website context can play in the processing of online promotional elements. PsycINFO Database Record (c) 2010 APA, all rights reserved.

  19. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  20. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  1. Aquilegia B gene homologs promote petaloidy of the sepals and maintenance of the C domain boundary

    Directory of Open Access Journals (Sweden)

    Bharti Sharma

    2017-11-01

    Full Text Available Abstract The model Aquilegia coerulea x “Origami” possesses several interesting floral features, including petaloid sepals that are morphologically distinct from the true petals and a broad domain containing many whorls of stamens. We undertook the current study in an effort to understand the former trait, but additionally uncovered data that inform on the latter. The Aquilegia B gene homolog AqPI is shown to contribute to the production of anthocyanin in the first whorl sepals, although it has no major role in their morphology. Surprisingly, knockdown of AqPI in Aquilegia coerulea x “Origami” also reveals a role for the B class genes in maintaining the expression of the C gene homolog AqAG1 in the outer whorls of stamens. These findings suggest that the transference of pollinator function to the first whorl sepals included a non-homeotic recruitment of the B class genes to promote aspects of petaloidy. They also confirm results in several other Ranunculales that have revealed an unexpected regulatory connection between the B and C class genes.

  2. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  3. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  4. Feeding-Related Traits Are Affected by Dosage of the foraging Gene in Drosophila melanogaster.

    Science.gov (United States)

    Allen, Aaron M; Anreiter, Ina; Neville, Megan C; Sokolowski, Marla B

    2017-02-01

    Nutrient acquisition and energy storage are critical parts of achieving metabolic homeostasis. The foraging gene in Drosophila melanogaster has previously been implicated in multiple feeding-related and metabolic traits. Before foraging's functions can be further dissected, we need a precise genetic null mutant to definitively map its amorphic phenotypes. We used homologous recombination to precisely delete foraging, generating the for 0 null allele, and used recombineering to reintegrate a full copy of the gene, generating the {for BAC } rescue allele. We show that a total loss of foraging expression in larvae results in reduced larval path length and food intake behavior, while conversely showing an increase in triglyceride levels. Furthermore, varying foraging gene dosage demonstrates a linear dose-response on these phenotypes in relation to foraging gene expression levels. These experiments have unequivocally proven a causal, dose-dependent relationship between the foraging gene and its pleiotropic influence on these feeding-related traits. Our analysis of foraging's transcription start sites, termination sites, and splicing patterns using rapid amplification of cDNA ends (RACE) and full-length cDNA sequencing, revealed four independent promoters, pr1-4, that produce 21 transcripts with nine distinct open reading frames (ORFs). The use of alternative promoters and alternative splicing at the foraging locus creates diversity and flexibility in the regulation of gene expression, and ultimately function. Future studies will exploit these genetic tools to precisely dissect the isoform- and tissue-specific requirements of foraging's functions and shed light on the genetic control of feeding-related traits involved in energy homeostasis. Copyright © 2017 by the Genetics Society of America.

  5. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-04-15

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging

  6. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    International Nuclear Information System (INIS)

    Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-01-01

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with

  7. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  8. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Directory of Open Access Journals (Sweden)

    Zhichun Zhang

    Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  9. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  10. Glucose metabolism in pigs expressing human genes under an insulin promoter.

    Science.gov (United States)

    Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David

    2015-01-01

    Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  12. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  13. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  14. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  15. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  16. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Directory of Open Access Journals (Sweden)

    Cynthia J Thomson

    Full Text Available Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4 influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599 that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing sensation seeking between groups. There were no significant associations between genotype(s and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  17. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Science.gov (United States)

    Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

    2014-01-01

    Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  18. Vitrification affects nuclear maturation and gene expression of immature human oocytes

    Directory of Open Access Journals (Sweden)

    Abbas Shahedi

    2017-02-01

    Full Text Available Background: Vitrification of oocytes is a fast-freezing technique, which may affect the quality of the human oocyte, and consequently affects the embryo development, pregnancy and birth. The aim of the current study was to investigate the consequence of in-vitro vitrification on maturation status of immature human oocytes, additionally, expression levels of stress, and apoptosis related genes. Materials and Methods: The total of 213 human immature oocytes which routinely discarded from assisted reproduction clinics were collected and divided into two groups including: (I fresh germinal vesicle (GV oocytes (n=106 (matured in-vitro  (fIVM , and  (II GV oocytes (n=107 that initially vitrified, then matured in  in-vitro (vIVM. After 36 hours of incubation, the oocytes were evaluated for nuclear maturation and expression level of DNA methyltransferase (DNMT1, stress related genes (Sod1 and Hsp70, and apoptotic related genes (Bax and Bcl-2 by quantitative Real-Time PCR. Results: Oocyte maturation rates were reduced in vIVM compared to fIVM oocytes (P=0.001. The expression of stress (Sod1 and Hsp70, and apoptotic-related genes (Bax and Bcl-2 in vIVM were significantly higher compared to the fIVM group. Additionally, pro-apoptotic gene up-regulated 4.3 times more than anti-apoptotic gene in vIVM oocyte. However, DNMT1 gene expression was reduced in vIVM oocyte (P = 0.047. Conclusions: The low survival rate of vitrified In-vitro matured GV oocytes could definitely be explained by the alterations of their gene expression profile. 

  19. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  20. Distinct mutations in yeast TAF(II)25 differentially affect the composition of TFIID and SAGA complexes as well as global gene expression patterns.

    Science.gov (United States)

    Kirschner, Doris B; vom Baur, Elmar; Thibault, Christelle; Sanders, Steven L; Gangloff, Yann-Gaël; Davidson, Irwin; Weil, P Anthony; Tora, Làszlò

    2002-05-01

    The RNA polymerase II transcription factor TFIID, composed of the TATA-binding protein (TBP) and TBP-associated factors (TAF(II)s), nucleates preinitiation complex formation at protein-coding gene promoters. SAGA, a second TAF(II)-containing multiprotein complex, is involved in transcription regulation in Saccharomyces cerevisiae. One of the essential protein components common to SAGA and TFIID is yTAF(II)25. We define a minimal evolutionarily conserved 91-amino-acid region of TAF(II)25 containing a histone fold domain that is necessary and sufficient for growth in vivo. Different temperature-sensitive mutations of yTAF(II)25 or chimeras with the human homologue TAF(II)30 arrested cell growth at either the G(1) or G(2)/M cell cycle phase and displayed distinct phenotypic changes and gene expression patterns. Immunoprecipitation studies revealed that TAF(II)25 mutation-dependent gene expression and phenotypic changes correlated at least partially with the integrity of SAGA and TFIID. Genome-wide expression analysis revealed that the five TAF(II)25 temperature-sensitive mutant alleles individually affect the expression of between 18 and 33% of genes, whereas taken together they affect 64% of all class II genes. Thus, different yTAF(II)25 mutations induce distinct phenotypes and affect the regulation of different subsets of genes, demonstrating that no individual TAF(II) mutant allele reflects the full range of its normal functions.

  1. CypA, a gene downstream of HIF-1α, promotes the development of PDAC.

    Directory of Open Access Journals (Sweden)

    Huan Zhang

    Full Text Available Hypoxia-inducible factor-1α (HIF-1α is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC. In response to tumor hypoxia, cyclophilin A (CypA is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC.

  2. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    International Nuclear Information System (INIS)

    Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.

    2016-01-01

    Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).

  3. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    Science.gov (United States)

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  4. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng, E-mail: oxyccc@163.com

    2015-12-04

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. - Highlights: • TLX overexpression in MIN6 cell causes significant expression changes of 225 genes. • TLX overexpression promotes MIN6 cell proliferation and decreases cell apoptosis. • TLX overexpression does not cause impairment of insulin secretion.

  5. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells

    International Nuclear Information System (INIS)

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

    2015-01-01

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. - Highlights: • TLX overexpression in MIN6 cell causes significant expression changes of 225 genes. • TLX overexpression promotes MIN6 cell proliferation and decreases cell apoptosis. • TLX overexpression does not cause impairment of insulin secretion.

  6. Polymorphism screening and haplotype analysis of the tryptophan hydroxylase gene (TPH1 and association with bipolar affective disorder in Taiwan

    Directory of Open Access Journals (Sweden)

    Lin Yi-Mei J

    2005-03-01

    Full Text Available Abstract Background Disturbances in serotonin neurotransmission are implicated in the etiology of many psychiatric disorders, including bipolar affective disorder (BPD. The tryptophan hydroxylase gene (TPH, which codes for the enzyme catalyzing the rate-limiting step in serotonin biosynthetic pathway, is one of the leading candidate genes for psychiatric and behavioral disorders. In a preliminary study, we found that TPH1 intron7 A218C polymorphism was associated with BPD. This study was designed to investigate sequence variants of the TPH1 gene in Taiwanese and to test whether the TPH1 gene is a susceptibility factor for the BPD. Methods Using a systematic approach, we have searched the exons and promoter region of the TPH1 gene for sequence variants in Taiwanese Han and have identified five variants, A-1067G, G-347T, T3804A, C27224T, and A27237G. These five variants plus another five taken from the literature and a public database were examined for an association in 108 BPD patients and 103 controls; no association was detected for any of the 10 variants. Results Haplotype constructions using these 10 SNPs showed that the 3 most common haplotypes in both patients and controls were identical. One of the fourth common haplotype in the patient group (i.e. GGGAGACCCA was unique and showed a trend of significance with the disease (P = 0.028. However, the significance was abolished after Bonferroni correction thus suggesting the association is weak. In addition, three haplotype-tagged SNPs (htSNPs were selected to represent all haplotypes with frequencies larger than 2% in the Taiwanese Han population. The defined TPH1 htSNPs significantly reduce the marker number for haplotype analysis thus provides useful information for future association studies in our population. Conclusion Results of this study did not support the role of TPH1 gene in BPD etiology. As the current studies found the TPH1 gene under investigation belongs to the peripheral

  7. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    Science.gov (United States)

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

  8. Gene promoter methylation and DNA repair capacity in monozygotic twins with discordant smoking habits.

    Science.gov (United States)

    Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca

    2015-02-01

    The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Quantitative global and gene-specific promoter methylation in relation to biological properties of neuroblastomas

    Directory of Open Access Journals (Sweden)

    Kiss Nimrod B

    2012-09-01

    Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.

  10. [Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

    Science.gov (United States)

    Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

    2016-11-23

    Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

  11. The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

    Science.gov (United States)

    Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

    2011-01-01

    Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

  12. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  13. CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo.

    Directory of Open Access Journals (Sweden)

    Minyan Li

    Full Text Available Mammalian spermatogenesis is a highly regulated multistage process of sperm generation. It is hard to uncover the real function of a testis specific gene in vitro since the in vitro model is not yet mature. With the development of the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 system, we can now rapidly generate knockout mouse models of testis specific genes to study the process of spermatogenesis in vivo. SYCP3-like X-linked 2 (SLX2 is a germ cell specific component, which contains a Cor1 domain and belongs to the XLR (X-linked, lymphocyte regulated family. Previous studies suggested that SLX2 might play an important role in mouse spermatogenesis based on its subcellular localization and interacting proteins. However, the function of SLX2 in vivo is still elusive. Here, to investigate the functions of SLX2 in spermatogenesis, we disrupted the Slx2 gene by using the CRISPR/Cas9 system. Since Slx2 is a testis specific X-linked gene, we obtained knockout male mice in the first generation and accelerated the study process. Compared with wild-type mice, Slx2 knockout mice have normal testis and epididymis. Histological observation of testes sections showed that Slx2 knockout affected none of the three main stages of spermatogenesis: mitosis, meiosis and spermiogenesis. In addition, we further confirmed that disruption of Slx2 did not affect the number of spermatogonial stem cells, meiosis progression or XY body formation by immunofluorescence analysis. As spermatogenesis was normal in Slx2 knockout mice, these mice were fertile. Taken together, we showed that Slx2 itself is not an essential gene for mouse spermatogenesis and CRISPR/Cas9 technique could speed up the functional study of testis specific X-linked gene in vivo.

  14. The garlic allelochemical diallyl disulfide affects tomato root growth by influencing cell division, phytohormone balance and expansin gene expression

    Directory of Open Access Journals (Sweden)

    Fang Cheng

    2016-08-01

    Full Text Available Diallyl disulfide (DADS is a volatile organosulfur compound derived from garlic (Allium sativum L., and it is known as an allelochemical responsible for the strong allelopathic potential of garlic. The anticancer properties of DADS have been studied in experimental animals and various types of cancer cells, but to date, little is known about its mode of action as an allelochemical at the cytological level. The current research presents further studies on the effects of DADS on tomato (Solanum lycopersicum L. seed germination, root growth, mitotic index and cell size in root meristem, as well as the phytohormone levels and expression profile of auxin biosynthesis genes (FZYs, auxin transport genes (SlPINs and expansin genes (EXPs in tomato root. The results showed a biphasic, dose-dependent effect on tomato seed germination and root growth under different DADS concentrations. Lower concentrations (0.01-0.62 mM of DADS significantly promoted root growth, whereas higher levels (6.20-20.67 mM showed inhibitory effects. Cytological observations showed that the cell length of root meristem was increased and that the mitotic activity of meristematic cells in seedling root tips was enhanced at lower concentrations of DADS. In contrast, DADS at higher concentrations inhibited root growth by affecting both the length and division activity of meristematic cells. However, the cell width of the root meristem was not affected. Additionally, DADS increased the IAA and ZR contents of seedling roots in a dose-dependent manner. The influence on IAA content may be mediated by the up-regulation of FZYs and PINs. Further investigation into the underlying mechanism revealed that the expression levels of tomato EXPs were significantly affected by DADS. The expression levels of EXPB2 and beta-expansin precursor were increased after 3 d, and those of EXP1, EXPB3 and EXLB1 were increased after 5 d of DADS treatment (0.41 mM. This result suggests that tomato root growth

  15. Factors affecting quality and health promoting compounds during growth and postharvest life of sweet cherry (Prunus avium L.)

    NARCIS (Netherlands)

    Correia, Sofia; Schouten, Rob; Silva, Ana P.; Gonçalves, Berta

    2017-01-01

    Sweet cherries are attractive fruits due to their taste, color, nutritional value, and beneficial health effects. Sweet cherry is a highly perishable fruit and all quality attributes and the level of health promoting compounds are affected by growth conditions, picking, packing, transport, and

  16. Functional Gene Discovery and Characterization of Genes and Alleles Affecting Wood Biomass Yield and Quality in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Busov, Victor [Michigan Technological Univ., Houghton, MI (United States)

    2017-02-12

    Adoption of biofuels as economically and environmentally viable alternative to fossil fuels would require development of specialized bioenergy varieties. A major goal in the breeding of such varieties is the improvement of lignocellulosic biomass yield and quality. These are complex traits and understanding the underpinning molecular mechanism can assist and accelerate their improvement. This is particularly important for tree bioenergy crops like poplars (species and hybrids from the genus Populus), for which breeding progress is extremely slow due to long generation cycles. A variety of approaches have been already undertaken to better understand the molecular bases of biomass yield and quality in poplar. An obvious void in these undertakings has been the application of mutagenesis. Mutagenesis has been instrumental in the discovery and characterization of many plant traits including such that affect biomass yield and quality. In this proposal we use activation tagging to discover genes that can significantly affect biomass associated traits directly in poplar, a premier bioenergy crop. We screened a population of 5,000 independent poplar activation tagging lines under greenhouse conditions for a battery of biomass yield traits. These same plants were then analyzed for changes in wood chemistry using pyMBMS. As a result of these screens we have identified nearly 800 mutants, which are significantly (P<0.05) different when compared to wild type. Of these majority (~700) are affected in one of ten different biomass yield traits and 100 in biomass quality traits (e.g., lignin, S/G ration and C6/C5 sugars). We successfully recovered the position of the tag in approximately 130 lines, showed activation in nearly half of them and performed recapitulation experiments with 20 genes prioritized by the significance of the phenotype. Recapitulation experiments are still ongoing for many of the genes but the results are encouraging. For example, we have shown successful

  17. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    Science.gov (United States)

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  18. Hydrogel Design for Supporting Neurite Outgrowth and Promoting Gene Delivery to Maximize Neurite Extension

    Science.gov (United States)

    Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.

    2012-01-01

    Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654

  19. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  20. Methyl jasmonate affects phenolic metabolism and gene expression in blueberry (Vaccinium corymbosum).

    Science.gov (United States)

    Cocetta, Giacomo; Rossoni, Mara; Gardana, Claudio; Mignani, Ilaria; Ferrante, Antonio; Spinardi, Anna

    2015-02-01

    Blueberry (Vaccinium corymbosum) is a fruit very much appreciated by consumers for its antioxidant potential and health-promoting traits. Its beneficial potential properties are mainly due to a high content of anthocyanins and their amount can change after elicitation with methyl jasmonate. The aim of this work is to evaluate the changes in expression of several genes, accumulation of phenolic compounds and alterations in antioxidant potential in two different blueberry cultivars ('Duke' and 'Blueray') in response to methyl jasmonate (0.1 mM). Results showed that 9 h after treatment, the expression of phenylalanine ammonium lyase, chalcone synthase and anthocyanidin synthase genes was stimulated more in the 'Blueray' variety. Among the phenols measured an increase was recorded also for epicatechin and anthocyanin concentrations. 'Duke' is a richer sourche of anthocyanins compared to 'Blueray', treatment with methyl jasmonate promoted in 'Blueray' an increase in pigments as well as in the antioxidant potential, especially in fully ripe berries, but treated 'Duke' berries had greater levels, which were not induced by methyl jasmonate treatment. In conclusion, methyl jasmonate was, in some cases, an effective elicitor of phenolic metabolism and gene expression in blueberry, though with different intensity between cultivars. © 2014 Scandinavian Plant Physiology Society.

  1. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  2. Linkage of the VNTR/insulin-gene and type I diabetes mellitus: Increased gene sharing in affected sibling pairs

    Energy Technology Data Exchange (ETDEWEB)

    Owerbach, D.; Gabbay, K.H. (Baylor College of Medicine, Houston, TX (United States))

    1994-05-01

    Ninety-six multiplex type I diabetic families were typed at the 5' flanking region of the insulin gene by using a PCR assay that better resolves the VNTR into multiple alleles. Affected sibling pairs shared 2, 1, and 0 VNTR alleles - identical by descent - at a frequency of .47, .45, and .08, respectively, a ratio that deviated from the expected 1:2:1 ratio (P<.001). These results confirm linkage of the chromosome 11p15.5 region with type I diabetes mellitus susceptibility. 20 refs., 2 tabs.

  3. Cloning and characterization of the promoter of the 9-cis-epoxycarotenoid dioxygenase gene in Arachis hypogaea L.

    Science.gov (United States)

    Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu

    2009-09-01

    We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.

  4. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    Directory of Open Access Journals (Sweden)

    Anastasia V. Ponasenko

    2017-01-01

    Full Text Available Infective endocarditis (IE is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE.

  5. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    Science.gov (United States)

    Rutkovskaya, Natalia V.; Kondyukova, Natalia V.; Odarenko, Yuri N.; Kazachek, Yana V.; Tsepokina, Anna V.; Barbarash, Leonid S.

    2017-01-01

    Infective endocarditis (IE) is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE. PMID:28659664

  6. Development of a flexible and potent hypoxia-inducible promoter for tumor-targeted gene expression in attenuated Salmonella

    NARCIS (Netherlands)

    Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan

    To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells

  7. Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

    Science.gov (United States)

    Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

    2016-10-01

    The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  8. Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication.

    Science.gov (United States)

    Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G

    2011-05-06

    B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in Igh promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated Igh promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3' enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3' enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    Science.gov (United States)

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  10. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  11. ΔNp73 enhances promoter activity of TGF-β induced genes.

    Directory of Open Access Journals (Sweden)

    Maarten Niemantsverdriet

    Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

  12. Activation tagging of the two closely linked genes LEP and VAS independently affects vascular cell number

    DEFF Research Database (Denmark)

    van der Graaff, Eric; Hooykaas, Paul J J; Keller, Beat

    2002-01-01

    report that in addition to this leafy petiole phenotype, the size of the vascular bundles is increased in all aerial organs in let as a result of an increase in the number of xylem, phloem (pro)cambial and pericycle cells. This vascular phenotype is caused by activation tagging of the two genes VASCULAR......-promoting factor. The activation tagging of VAS only resulted in a specific increase in phloem (pro)cambial and pericycle cells. We conclude that activation tagging of LEP and VAS results in additive phenotypes. Insertional mutants for LEP and VAS display wild-type vascular development, indicating the relevance...... of activation tagging for functional analysis of novel genes involved in plant development....

  13. Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3'-5'-bisdiphosphate and activation by sigma factor 5.

    Science.gov (United States)

    Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas

    2015-06-01

    Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  14. Candidate genes affecting fat deposition, carcass composition and meat quality traits in pigs

    OpenAIRE

    Gandolfi, Greta

    2011-01-01

    Pig meat quality is determined by several parameters, such as lipid content, tenderness, water-holding capacity, pH, color and flavor, that affect consumers’ acceptance and technological properties of meat. Carcass quality parameters are important for the production of fresh and dry-cure high-quality products, in particular the fat deposition and the lean cut yield. The identification of genes and markers associated with meat and carcass quality traits is of prime interest, for the possibilit...

  15. A Key Gene, PLIN1, Can Affect Porcine Intramuscular Fat Content Based on Transcriptome Analysis

    Directory of Open Access Journals (Sweden)

    Bojiang Li

    2018-04-01

    Full Text Available Intramuscular fat (IMF content is an important indicator for meat quality evaluation. However, the key genes and molecular regulatory mechanisms affecting IMF deposition remain unclear. In the present study, we identified 75 differentially expressed genes (DEGs between the higher (H and lower (L IMF content of pigs using transcriptome analysis, of which 27 were upregulated and 48 were downregulated. Notably, Kyoto Encyclopedia of Genes and Genomes (KEGG enrichment analysis indicated that the DEG perilipin-1 (PLIN1 was significantly enriched in the fat metabolism-related peroxisome proliferator-activated receptor (PPAR signaling pathway. Furthermore, we determined the expression patterns and functional role of porcine PLIN1. Our results indicate that PLIN1 was highly expressed in porcine adipose tissue, and its expression level was significantly higher in the H IMF content group when compared with the L IMF content group, and expression was increased during adipocyte differentiation. Additionally, our results confirm that PLIN1 knockdown decreases the triglyceride (TG level and lipid droplet (LD size in porcine adipocytes. Overall, our data identify novel candidate genes affecting IMF content and provide new insight into PLIN1 in porcine IMF deposition and adipocyte differentiation.

  16. A Key Gene, PLIN1, Can Affect Porcine Intramuscular Fat Content Based on Transcriptome Analysis.

    Science.gov (United States)

    Li, Bojiang; Weng, Qiannan; Dong, Chao; Zhang, Zengkai; Li, Rongyang; Liu, Jingge; Jiang, Aiwen; Li, Qifa; Jia, Chao; Wu, Wangjun; Liu, Honglin

    2018-04-04

    Intramuscular fat (IMF) content is an important indicator for meat quality evaluation. However, the key genes and molecular regulatory mechanisms affecting IMF deposition remain unclear. In the present study, we identified 75 differentially expressed genes (DEGs) between the higher (H) and lower (L) IMF content of pigs using transcriptome analysis, of which 27 were upregulated and 48 were downregulated. Notably, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis indicated that the DEG perilipin-1 ( PLIN1 ) was significantly enriched in the fat metabolism-related peroxisome proliferator-activated receptor (PPAR) signaling pathway. Furthermore, we determined the expression patterns and functional role of porcine PLIN1. Our results indicate that PLIN1 was highly expressed in porcine adipose tissue, and its expression level was significantly higher in the H IMF content group when compared with the L IMF content group, and expression was increased during adipocyte differentiation. Additionally, our results confirm that PLIN1 knockdown decreases the triglyceride (TG) level and lipid droplet (LD) size in porcine adipocytes. Overall, our data identify novel candidate genes affecting IMF content and provide new insight into PLIN1 in porcine IMF deposition and adipocyte differentiation.

  17. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  18. Promotion of Metastasis-associated Gene Expression in Survived PANC-1 Cells Following Trichostatin A Treatment.

    Science.gov (United States)

    Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao

    2015-01-01

    Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.

  19. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China

    Directory of Open Access Journals (Sweden)

    Liu Wenzhong

    2008-10-01

    Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  20. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.

    Science.gov (United States)

    Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong

    2008-10-25

    The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  1. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer's Disease Affected Brain Regions.

    Directory of Open Access Journals (Sweden)

    Nisha Puthiyedth

    Full Text Available Alzheimer's disease (AD is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation.The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD from the Entorhinal Cortex (EC, Hippocampus (HIP, Middle temporal gyrus (MTG, Posterior cingulate cortex (PC, Superior frontal gyrus (SFG and visual cortex (VCX brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets.We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD. In addition, we

  2. Single Nucleotide Polymorphisms in the HIRA Gene Affect Litter Size in Small Tail Han Sheep

    Directory of Open Access Journals (Sweden)

    Mei Zhou

    2018-05-01

    Full Text Available Maintenance of appropriate levels of fecundity is critical for efficient sheep production. Opportunities to increase sheep litter size include identifying single gene mutations with major effects on ovulation rate and litter size. Whole-genome sequencing (WGS data of 89 Chinese domestic sheep from nine different geographical locations and ten Australian sheep were analyzed to detect new polymorphisms affecting litter size. Comparative genomic analysis of sheep with contrasting litter size detected a novel set of candidate genes. Two SNPs, g.71874104G>A and g.71833755T>C, were genotyped in 760 Small Tail Han sheep and analyzed for association with litter size. The two SNPs were significantly associated with litter size, being in strong linkage disequilibrium in the region 71.80–71.87 Mb. This haplotype block contains one gene that may affect litter size, Histone Cell Cycle Regulator (HIRA. HIRA mRNA levels in sheep with different lambing ability were significantly higher in ovaries of Small Tail Han sheep (high fecundity than in Sunite sheep (low fecundity. Moreover, the expression levels of HIRA in eight tissues of uniparous Small Tail Han sheep were significantly higher than in multiparous Small Tail Han sheep (p < 0.05. HIRA SNPs significantly affect litter size in sheep and are useful as genetic markers for litter size.

  3. Methylation state of the EDA gene promoter in Chinese X-linked hypohidrotic ectodermal dysplasia carriers.

    Directory of Open Access Journals (Sweden)

    Wei Yin

    Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.

  4. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  5. Linkage mapping of candidate genes for induce resistance and growth promotion by trichoderma koningiopsis (th003) in tomato solanum lycopersicum

    International Nuclear Information System (INIS)

    Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella

    2011-01-01

    Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.

  6. Analysis of tomato gene promoters activated in syncytia induced in tomato and potato hairy roots by Globodera rostochiensis.

    Science.gov (United States)

    Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M

    2013-06-01

    The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.

  7. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  8. Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.

    Science.gov (United States)

    Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun

    2015-12-01

    Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Abundance and genetic diversity of nifH gene sequences in anthropogenically affected Brazilian mangrove sediments.

    Science.gov (United States)

    Dias, Armando Cavalcante Franco; Pereira e Silva, Michele de Cassia; Cotta, Simone Raposo; Dini-Andreote, Francisco; Soares, Fábio Lino; Salles, Joana Falcão; Azevedo, João Lúcio; van Elsas, Jan Dirk; Andreote, Fernando Dini

    2012-11-01

    Although mangroves represent ecosystems of global importance, the genetic diversity and abundance of functional genes that are key to their functioning scarcely have been explored. Here, we present a survey based on the nifH gene across transects of sediments of two mangrove systems located along the coast line of São Paulo state (Brazil) which differed by degree of disturbance, i.e., an oil-spill-affected and an unaffected mangrove. The diazotrophic communities were assessed by denaturing gradient gel electrophoresis (DGGE), quantitative PCR (qPCR), and clone libraries. The nifH gene abundance was similar across the two mangrove sediment systems, as evidenced by qPCR. However, the nifH-based PCR-DGGE profiles revealed clear differences between the mangroves. Moreover, shifts in the nifH gene diversities were noted along the land-sea transect within the previously oiled mangrove. The nifH gene diversity depicted the presence of nitrogen-fixing bacteria affiliated with a wide range of taxa, encompassing members of the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Firmicutes, and also a group of anaerobic sulfate-reducing bacteria. We also detected a unique mangrove-specific cluster of sequences denoted Mgv-nifH. Our results indicate that nitrogen-fixing bacterial guilds can be partially endemic to mangroves, and these communities are modulated by oil contamination, which has important implications for conservation strategies.

  10. Abundance and Genetic Diversity of nifH Gene Sequences in Anthropogenically Affected Brazilian Mangrove Sediments

    Science.gov (United States)

    Dias, Armando Cavalcante Franco; Pereira e Silva, Michele de Cassia; Cotta, Simone Raposo; Dini-Andreote, Francisco; Soares, Fábio Lino; Salles, Joana Falcão; Azevedo, João Lúcio; van Elsas, Jan Dirk

    2012-01-01

    Although mangroves represent ecosystems of global importance, the genetic diversity and abundance of functional genes that are key to their functioning scarcely have been explored. Here, we present a survey based on the nifH gene across transects of sediments of two mangrove systems located along the coast line of São Paulo state (Brazil) which differed by degree of disturbance, i.e., an oil-spill-affected and an unaffected mangrove. The diazotrophic communities were assessed by denaturing gradient gel electrophoresis (DGGE), quantitative PCR (qPCR), and clone libraries. The nifH gene abundance was similar across the two mangrove sediment systems, as evidenced by qPCR. However, the nifH-based PCR-DGGE profiles revealed clear differences between the mangroves. Moreover, shifts in the nifH gene diversities were noted along the land-sea transect within the previously oiled mangrove. The nifH gene diversity depicted the presence of nitrogen-fixing bacteria affiliated with a wide range of taxa, encompassing members of the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Firmicutes, and also a group of anaerobic sulfate-reducing bacteria. We also detected a unique mangrove-specific cluster of sequences denoted Mgv-nifH. Our results indicate that nitrogen-fixing bacterial guilds can be partially endemic to mangroves, and these communities are modulated by oil contamination, which has important implications for conservation strategies. PMID:22941088

  11. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore Cattle Are Modulators of Growth.

    Directory of Open Access Journals (Sweden)

    Anirene G T Pereira

    Full Text Available Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS, were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1 as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1, IGF2 (insulin like growth factor 2, GH1 (growth hormone 1, IGF1R (insulin like growth factor 1 receptor and GHR (growth hormone receptor, suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway.

  12. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Li

    2018-05-01

    Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

  13. USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy

    Science.gov (United States)

    Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.

    2014-01-01

    Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308

  14. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    Science.gov (United States)

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik

    2014-01-01

    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  15. Bovine glycomacropeptide promotes the growth of Bifidobacterium longum ssp. infantis and modulates its gene expression.

    Science.gov (United States)

    O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M

    2018-05-23

    Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  17. Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.

    Science.gov (United States)

    Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P

    2016-11-01

    Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10 m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10 +/+ mice. After total body irradiation (TBI), Grb10 m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10 +/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir

    2014-10-02

    Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

  19. Histone Deacetylase 7 Promotes Toll-like Receptor 4-dependent Proinflammatory Gene Expression in Macrophages*

    Science.gov (United States)

    Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.

    2013-01-01

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092

  20. Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages.

    Science.gov (United States)

    Shakespear, Melanie R; Hohenhaus, Daniel M; Kelly, Greg M; Kamal, Nabilah A; Gupta, Praveer; Labzin, Larisa I; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A; Reid, Robert C; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2013-08-30

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target.

  1. Methods for interpreting lists of affected genes obtained in a DNA microarray experiment

    Directory of Open Access Journals (Sweden)

    Hedegaard Jakob

    2009-07-01

    Full Text Available Abstract Background The aim of this paper was to describe and compare the methods used and the results obtained by the participants in a joint EADGENE (European Animal Disease Genomic Network of Excellence and SABRE (Cutting Edge Genomics for Sustainable Animal Breeding workshop focusing on post analysis of microarray data. The participating groups were provided with identical lists of microarray probes, including test statistics for three different contrasts, and the normalised log-ratios for each array, to be used as the starting point for interpreting the affected probes. The data originated from a microarray experiment conducted to study the host reactions in broilers occurring shortly after a secondary challenge with either a homologous or heterologous species of Eimeria. Results Several conceptually different analytical approaches, using both commercial and public available software, were applied by the participating groups. The following tools were used: Ingenuity Pathway Analysis, MAPPFinder, LIMMA, GOstats, GOEAST, GOTM, Globaltest, TopGO, ArrayUnlock, Pathway Studio, GIST and AnnotationDbi. The main focus of the approaches was to utilise the relation between probes/genes and their gene ontology and pathways to interpret the affected probes/genes. The lack of a well-annotated chicken genome did though limit the possibilities to fully explore the tools. The main results from these analyses showed that the biological interpretation is highly dependent on the statistical method used but that some common biological conclusions could be reached. Conclusion It is highly recommended to test different analytical methods on the same data set and compare the results to obtain a reliable biological interpretation of the affected genes in a DNA microarray experiment.

  2. Association between promoter polymorphisms of OPN gene and cancer risk: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Liu JW

    2015-12-01

    Full Text Available Jingwei Liu,1–2 Caiyun He,1–2 Quan Yuan,1–2 Zhenning Wang,1–2 Chengzhong Xing,1–2 Yuan Yuan1–2 1Tumor Etiology and Screening Department of Cancer Institute and General Surgery, The First Affiliated Hospital of China Medical University, 2Key Laboratory of Cancer Etiology and Prevention, China Medical University, Liaoning Provincial Education Department, Shenyang, People’s Republic of China Background: Results of the association between polymorphisms of osteopontin (OPN gene promoter region and risk of cancer were inconclusive. The aim of this meta-analysis was to elucidate whether OPN promoter polymorphisms were associated with cancer risk.Methods: Electronic databases including PubMed, Web of Science, and Chinese National Knowledge Infrastructure were systematically searched. Odd ratios (ORs and their 95% confidential interval (CI were used to assess the strength of association between OPN promoter polymorphisms and cancer risks.Results: Nine studies were finally included in this meta-analysis. For OPN rs17524488 polymorphism, carriers of GG or -/G genotype were significantly associated with increased cancer risk compared with wild-type -/- carriers, respectively (GG vs -/-: OR =1.40, 95% CI =1.03–1.91, P=0.033; -/G vs -/-: OR =1.22, 95% CI =1.07–1.40, P=0.002. Additionally, G allele was significantly associated with increased cancer risk compared with (- allele (OR =1.21, 95% CI =1.04–1.40, P=0.016. However, no significant association was observed of OPN rs11730582 polymorphism and cancer risk (CC vs TT: OR =0.98, 95% CI =0.49–1.97, P=0.964; CT vs TT: OR =0.88, 95% CI =0.54–1.43, P=0.610.Conclusion: Carriers of GG or -/G genotype of OPN promoter rs17524488 (-156-/G polymorphism might be associated with increased risk of cancer compared with wild-type -/- carriers, respectively. However, no significant association was observed between OPN promoter rs11730582 (-443C/T polymorphism and risk of cancer. Keywords: OPN

  3. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    Energy Technology Data Exchange (ETDEWEB)

    Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which

  4. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    International Nuclear Information System (INIS)

    Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi

    2012-01-01

    Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the

  5. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  6. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  7. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.

  8. Get a taste of your goals: promoting motive-goal congruence through affect-focus goal fantasy.

    Science.gov (United States)

    Job, Veronika; Brandstätter, Veronika

    2009-10-01

    Studies show that motive-goal congruence is an important predictor of well-being (Baumann, Kaschel, & Kuhl, 2005; Brunstein, Schultheiss, & Grässmann, 1998). However, little is known about the factors that promote congruence between implicit motives and goals. Relying on McClelland's (1985) concept of implicit motives and the theory of fantasy realization (Oettingen, 1999), we postulated that goal fantasies focusing on motive-specific affective incentives promote motive-congruent goal setting. This hypothesis was tested in 3 experimental studies. In Study 1 (n=46) and Study 2 (n=48), participants were asked to select goals in a hypothetical scenario. In Study 3 (n=179), they rated their commitment to personal goals for their actual life situation. The results of all 3 studies supported our hypothesis that participants who focus on motive-specific affective incentives in their goal fantasies set their goals in line with their corresponding implicit motive dispositions.

  9. Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

    2013-10-11

    Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

  10. Sales promotion by wholesalers affects general practitioners' prescription behaviours in Japan.

    Science.gov (United States)

    Shimura, Hirohisa

    2018-01-01

    Background : One method for promoting drugs in Japan has been utilizing wholesalers for promotion; however, the effectiveness of the sales promotion has been brought into question. Methods : A total of 74,552 responses were collected from an internet survey of 511 prescribing doctors in hospitals with less than 19 beds, which recalled the visits by wholesalers' sales representatives (MS) in 2014. Each assessed the degree to which MS and/or sales representatives from a pharmaceutical company (MR) influenced a decision to prescribe each drug. The responses were analysed using the chi-square test and Goodman-Kruskal's gamma to evaluate the association between MS calls and doctors' prescription orders. Results : Results showed a significant effect of the MS calls on doctors' behaviours in terms of new drug prescriptions and subsequent behaviours. The results by therapeutic category showed a similar strong influence of the joint calls on new prescriptions on some therapeutic classes. The MS calls significantly influenced doctors to maintain and increase the prescription volume (p sales promotion on the part of MSs and MRs adds value to the prescription decisions. Moreover, results suggest that MSs enhance prescription outcomes in competitive therapeutic categories.

  11. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    International Nuclear Information System (INIS)

    Depto, A.S.; Stenberg, R.M.

    1989-01-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

  12. Progranulin gene variation affects serum progranulin levels differently in Danish bipolar individuals compared with healthy controls.

    Science.gov (United States)

    Buttenschøn, Henriette N; Nielsen, Marit N; Thotakura, Gangadaar; Lee, Chris W; Nykjær, Anders; Mors, Ole; Glerup, Simon

    2017-06-01

    The identification of peripheral biomarkers for bipolar disorder is of great importance and has the potential to improve diagnosis, treatment and prognosis. Recent studies have reported lower plasma progranulin levels in bipolar individuals compared with controls and association with single nucleotide polymorphisms (SNPs) within the progranulin gene (GRN). In the present study, we investigated the effect of GRN and sortilin (SORT1) gene variation on serum progranulin levels in bipolar individuals and controls. In a Danish cohort of individuals with bipolar disorder and controls, we analysed the serum progranulin level (nbipolar=80, ncontrols=76) and five SNPs located within GRN and two SNPs near the SORT1 gene encoding sortilin, a progranulin scavenger receptor known to affect circulating progranulin levels (nbipolar=166, ncontrols=186). We observed no significant difference in the serum progranulin level between cases and controls and none of the analysed SNPs located within GRN or close to SORT1 were associated with bipolar disorder. Crude and adjusted (adjusted for case-control status, sex and age) linear regression analyses showed no effect of any SNPs on the serum progranulin level. However, we observed that the mean serum progranulin level in cases and controls is affected differently depending on the genotypes of two SNPs within GRN (rs2879096 and rs4792938). The sample size is relatively small and detailed information on medication and polarity of the disorder is not available. No correction for multiple testing was performed. Our study suggests that the potential of progranulin as a biomarker for bipolar disorder is genotype dependent.

  13. Evaluation of promoter methylation status of MLH1 gene in Iranian patients with colorectal tumors and adenoma polyps.

    Science.gov (United States)

    Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid

    2017-01-01

    The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of  MLH1  promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.

  14. Factors Affecting Quality and Health Promoting Compounds during Growth and Postharvest Life of Sweet Cherry (Prunus avium L.

    Directory of Open Access Journals (Sweden)

    Sofia Correia

    2017-12-01

    Full Text Available Sweet cherries are attractive fruits due to their taste, color, nutritional value, and beneficial health effects. Sweet cherry is a highly perishable fruit and all quality attributes and the level of health promoting compounds are affected by growth conditions, picking, packing, transport, and storage. During production, the correct combination of scion × rootstock will produce fruits with higher firmness, weight, sugars, vitamins, and phenolic compounds that boost the fruit antioxidant activity. Orchard management, such as applying drip irrigation and summer pruning, will increase fruit sugar levels and total phenolic content, while application of growth regulators can result in improved storability, increased red coloring, increased fruit size, and reduced cracking. Salicylic acid, oxalic acid, acetylsalicylic acid, and methyl salicylate are promising growth regulators as they also increase total phenolics, anthocyanins, and induce higher activity of antioxidant enzymes. These growth regulators are now also applied as fruit coatings that improve shelf-life with higher antioxidant enzyme activities and total phenolics. Optimizing storage and transport conditions, such as hydro cooling with added CaCl2, chain temperature and relative humidity control, are crucial for slowing down decay of quality attributes and increasing the antioxidant capacity. Application of controlled atmosphere during storage is successful in delaying quality attributes, but lowers ascorbic acid levels. The combination of low temperature storage in combination with modified atmosphere packaging (MAP is successful in reducing the incidence of fruit decay, while preserving taste attributes and stem color with a higher antioxidant capacity. A new trend in MAP is the use of biodegradable films such as micro-perforated polylactic acid film that combine significant retention of quality attributes, high consumer acceptability, and a reduced environmental footprint. Another trend

  15. Expression of Nanog gene promotes NIH3T3 cell proliferation

    International Nuclear Information System (INIS)

    Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu

    2005-01-01

    Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion

  16. Horizontal gene transfer promoted evolution of the ability to propagate under anaerobic conditions in yeasts

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Knecht, Wolfgang; Warneboldt, J.

    2004-01-01

    The ability to propagate under anaerobic conditions is an essential and unique trait of brewer's or baker's yeast (Saccharomyces cervisiae). To understand the evolution of facultative anaerobiosis we studied the dependence of de novo pyrimidine biosynthesis, more precisely the fourth enzymic...... activity catalysed by dihydroorotate dehydrogenase (DHODase), on the enzymes of the respiratory chain in several yeast species. While the majority of yeasts possess a mitochondrial DHODase, Saccharomyces cerevisiae has a cytoplasmatic enzyme, whose activity is independent of the presence of oxygen. From....... We show that these two S. kluyveri enzymes, and their coding genes, differ in their dependence on the presence of oxygen. Only the cytoplasmic DHODase promotes growth in the absence of oxygen. Apparently a Saccharomyces yeast progenitor which had a eukaryotic-like mitochondrial DHODase acquired...

  17. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Directory of Open Access Journals (Sweden)

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  18. Biased perception about gene technology: How perceived naturalness and affect distort benefit perception.

    Science.gov (United States)

    Siegrist, Michael; Hartmann, Christina; Sütterlin, Bernadette

    2016-01-01

    In two experiments, the participants showed biased responses when asked to evaluate the benefits of gene technology. They evaluated the importance of additional yields in corn fields due to a newly introduced variety, which would increase a farmer's revenues. In one condition, the newly introduced variety was described as a product of traditional breeding; in the other, it was identified as genetically modified (GM). The two experiments' findings showed that the same benefits were perceived as less important for a farmer when these were the result of GM crops compared with traditionally bred crops. Mediation analyses suggest that perceived naturalness and the affect associated with the technology per se influence the interpretation of the new information. The lack of perceived naturalness of gene technology seems to be the reason for the participants' perceived lower benefits of a new corn variety in the gene technology condition compared with the perceptions of the participants assigned to the traditional breeding condition. The strategy to increase the acceptance of gene technology by introducing plant varieties that better address consumer and producer needs may not work because people discount its associated benefits. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Association between the dopamine D3 receptor gene locus (DRD3) and unipolar affective disorder.

    Science.gov (United States)

    Dikeos, D G; Papadimitriou, G N; Avramopoulos, D; Karadima, G; Daskalopoulou, E G; Souery, D; Mendlewicz, J; Vassilopoulos, D; Stefanis, C N

    1999-12-01

    Dopamine neurotransmission has been implicated in the pathophysiology of schizophrenia and, more recently, affective disorders. Among the dopamine receptors, D3 can be considered as particularly related to affective disorders due to its neuroanatomical localization in the limbic region of the brain and its relation to the serotoninergic activity of the CNS. The possible involvement of dopamine receptor D3 in unipolar (UP) major depression was investigated by a genetic association study of the D3 receptor gene locus (DRD3) on 36 UP patients and 38 ethnically matched controls. An allelic association of DRD3 (Bal I polymorphism) and UP illness was observed, with the Gly-9 allele (allele '2', 206/98 base-pairs long) being more frequent in patients than in controls (49% vs 29%, P < 0.02). The genotypes containing this allele (1-2 and 2-2) were found in 75% of patients vs 50% of controls (P < 0.03, odds ratio = 3.00, 95% CI = 1.12-8.05). The effect of the genotype remained significant (P < 0.02) after sex and family history were controlled by a multiple linear regression analysis. These results further support the hypothesis that dopaminergic mechanisms may be implicated in the pathogenesis of affective disorder. More specifically, the '2' allele of the dopamine receptor D3 gene seems to be associated with unipolar depression and can be considered as a 'phenotypic modifier' for major psychiatric disorders.

  20. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  1. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β) Signaling in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Khin, Sann Sanda [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Pathology Research Unit, Department of Medical Research (Central Myanmar), Naypyitaw, Union of (Myanmar); Kitazawa, Riko [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Haraguchi, Ryuma [Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Mori, Kiyoshi [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Kitazawa, Sohei, E-mail: kitazawa@m.ehime-u.ac.jp [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan)

    2011-03-03

    Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.

  2. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β) Signaling in Cancer

    International Nuclear Information System (INIS)

    Khin, Sann Sanda; Kitazawa, Riko; Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo; Haraguchi, Ryuma; Mori, Kiyoshi; Kitazawa, Sohei

    2011-01-01

    Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression

  3. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β Signaling in Cancer

    Directory of Open Access Journals (Sweden)

    Kiyoshi Mori

    2011-03-01

    Full Text Available Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β, induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.

  4. Dragon (repulsive guidance molecule b, RGMb) is a novel gene that promotes colorectal cancer growth.

    Science.gov (United States)

    Shi, Ying; Chen, Guo-Bin; Huang, Xiao-Xiao; Xiao, Chuan-Xing; Wang, Huan-Huan; Li, Ye-Sen; Zhang, Jin-Fang; Li, Shao; Xia, Yin; Ren, Jian-Lin; Guleng, Bayasi

    2015-08-21

    Colorectal cancer (CRC) is one of the most commonly diagnosed cancers and a major cause of cancer death. However, the molecular mechanisms underlying CRC initiation, growth and metastasis are poorly understood. Dragon (RGMb), a member of the repulsive guidance molecule (RGM) family, has been recently identified as a co-receptor for bone morphogenetic protein (BMP) signaling, but the role of Dragon in CRC development is undefined. Here, we show that Dragon expression was increased in colon cancer tissues compared to control tissues in CAC mouse model and in human patients. Dragon promoted proliferation of CT26.WT and CMT93 colon cancer cells and accelerated tumor growth in the xenograft mouse model. Dragon's action on colon cancer development was mediated via the BMP4-Smad1/5/8 and Erk1/2 pathways. Therefore, our results have revealed that Dragon is a novel gene that promotes CRC growth through the BMP pathway. Dragon may be exploited as a potential therapeutic target for CRC treatment.

  5. PROMOTER POLYMORPHISM OF IL-1β GENE IN PATIENTS WITH A HISTORY OF ACUTE MYOCARDIAL INFARCTION

    Directory of Open Access Journals (Sweden)

    A. V. Shevchenko

    2010-01-01

    Full Text Available We have performed analysis of associations between IL-1β gene promoter polymorphism (-511C/T and -31 T/C variants, and conventional cardiovascular risk factors in the patients living in the West Siberia who had previously a history of myocardial infarction (MI. We are shown a strong linkage disequilibrium between IL-1β -31C/T (rs1143627, and IL-1β-511T/C (rs16944. Significant differences in frequency distributions of some compound genotypes were observed between healthy and patients with a history of MI. E.g., frequency of IL-1β-31CC/-511CT genotype was detected in 5.5 % of healthy population, while being absent among MI patients. A frequency of IL-1β (-31/-511 CC/CT genotype showed significant differences between MI patients under 55 years, as compared to healthy persons. Hence, the analyzed IL-1β promoter polymorphisms may be considered as an additional constitutional factor predisposing for vascular alterations.

  6. Cloning and functional analysis of promoters of three GnRH genes in a cichlid

    International Nuclear Information System (INIS)

    Kitahashi, Takashi; Sato, Hideki; Sakuma, Yasuo; Parhar, Ishwar S.

    2005-01-01

    Mechanisms regulating gonadotropin-releasing hormone (GnRH) types, a key molecule for reproductive physiology, remain unclear. In the present study, we cloned the promoters of GnRH1, GnRH2, and GnRH3 genes in the tilapia, Oreochromis niloticus; and found putative binding sites for glucocorticoid receptors, Sp1, C/EBP, GATA, and Oct-1, but not for androgen receptors in all three GnRH promoters using computer analysis. The presence of binding sites for progesterone receptors in GnRH1, estrogen receptors in GnRH1 and GnRH2, and thyroid hormone receptors in GnRH1 and GnRH3 suggests direct action of steroid hormones on GnRH types. Our observation of SOX and LINE-like sequences exclusively in GnRH1, COUP in GnRH2, and retinoid X receptors in GnRH3 suggests their role in sexual differentiation, midbrain segmentation, and visual cue integration, respectively. Thus, the characteristic binding sites for nuclear receptors and transcription factors support the notion that each GnRH type is regulated differently and has distinct physiological roles

  7. Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia

    Energy Technology Data Exchange (ETDEWEB)

    Law, Alice Y.S. [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong); Wong, Chris K.C., E-mail: ckcwong@hkbu.edu.hk [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong)

    2010-02-01

    Stanniocalcin-2 (STC2), the paralog of STC1, has been suggested as a novel target of oxidative stress response to protect cells from apoptosis. The expression of STC2 has been reported to be highly correlated with human cancer development. In this study, we reported that STC2 is a HIF-1 target gene and is involved in the regulation of cell proliferation. STC2 was shown to be up-regulated in different breast and ovarian cancer cells, following exposure to hypoxia. Using ovarian cancer cells (SKOV3), the underlying mechanism of HIF-1 mediated STC2 gene transactivation was characterized. Hypoxia-induced STC2 expression was found to be HIF-1{alpha} dependent and required the recruitment of p300 and HDAC7. Using STC2 promoter deletion constructs and site-directed mutagenesis, two authentic consensus HIF-1 binding sites were identified. Under hypoxic condition, the silencing of STC2 reduced while the overexpression of STC2 increased the levels of phosphorylated retinoblastoma and cyclin D in both SKOV3 and MCF7 cells. The change in cell cycle proteins correlated with the data of the serial cell counts. The results indicated that cell proliferation was reduced in STC2-silenced cells but was increased in STC2-overexpressing hypoxic cells. Solid tumor progression is usually associated with hypoxia. The identification and functional analysis of STC2 up-regulation by hypoxia, a feature of the tumor microenvironment, sheds light on a possible role for STC2 in tumors.

  8. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

    Science.gov (United States)

    Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

    2001-08-01

    Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

  9. The XylS/Pm regulator/promoter system and its use in fundamental studies of bacterial gene expression, recombinant protein production and metabolic engineering.

    Science.gov (United States)

    Gawin, Agnieszka; Valla, Svein; Brautaset, Trygve

    2017-07-01

    The XylS/Pm regulator/promoter system originating from the Pseudomonas putida TOL plasmid pWW0 is widely used for regulated low- and high-level recombinant expression of genes and gene clusters in Escherichia coli and other bacteria. Induction of this system can be graded by using different cheap benzoic acid derivatives, which enter cells by passive diffusion, operate in a dose-dependent manner and are typically not metabolized by the host cells. Combinatorial mutagenesis and selection using the bla gene encoding β-lactamase as a reporter have demonstrated that the Pm promoter, the DNA sequence corresponding to the 5' untranslated end of its cognate mRNA and the xylS coding region can be modified and improved relative to various types of applications. By combining such mutant genetic elements, altered and extended expression profiles were achieved. Due to their unique properties, obtained systems serve as a genetic toolbox valuable for heterologous protein production and metabolic engineering, as well as for basic studies aiming at understanding fundamental parameters affecting bacterial gene expression. The approaches used to modify XylS/Pm should be adaptable for similar improvements also of other microbial expression systems. In this review, we summarize constructions, characteristics, refinements and applications of expression tools using the XylS/Pm system. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  10. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    International Nuclear Information System (INIS)

    Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

    2011-01-01

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  11. Affect

    NARCIS (Netherlands)

    Cetinic, M.; Diamanti, J.; Szeman, I.; Blacker, S.; Sully, J.

    2017-01-01

    This chapter historicizes four divergent but historically contemporaneous genres of affect theory – romantic, realist, speculative, and materialist. While critics credited with the turn to affect in the 1990s wrote largely in the wake of poststructuralism from the perspective of gender and queer

  12. A functional variant in the stearoyl-CoA desaturase gene promoter enhances fatty acid desaturation in pork.

    Directory of Open Access Journals (Sweden)

    Joan Estany

    Full Text Available There is growing public concern about reducing saturated fat intake. Stearoyl-CoA desaturase (SCD is the lipogenic enzyme responsible for the biosynthesis of oleic acid (18 ∶ 1 by desaturating stearic acid (18 ∶ 0. Here we describe a total of 18 mutations in the promoter and 3' non-coding region of the pig SCD gene and provide evidence that allele T at AY487830:g.2228T>C in the promoter region enhances fat desaturation (the ratio 18 ∶ 1/18 ∶ 0 in muscle increases from 3.78 to 4.43 in opposite homozygotes without affecting fat content (18 ∶ 0+18 ∶ 1, intramuscular fat content, and backfat thickness. No mutations that could affect the functionality of the protein were found in the coding region. First, we proved in a purebred Duroc line that the C-T-A haplotype of the 3 single nucleotide polymorphisms (SNPs (g.2108C>T; g.2228T>C; g.2281A>G of the promoter region was additively associated to enhanced 18 ∶ 1/18 ∶ 0 both in muscle and subcutaneous fat, but not in liver. We show that this association was consistent over a 10-year period of overlapping generations and, in line with these results, that the C-T-A haplotype displayed greater SCD mRNA expression in muscle. The effect of this haplotype was validated both internally, by comparing opposite homozygote siblings, and externally, by using experimental Duroc-based crossbreds. Second, the g.2281A>G and the g.2108C>T SNPs were excluded as causative mutations using new and previously published data, restricting the causality to g.2228T>C SNP, the last source of genetic variation within the haplotype. This mutation is positioned in the core sequence of several putative transcription factor binding sites, so that there are several plausible mechanisms by which allele T enhances 18 ∶ 1/18 ∶ 0 and, consequently, the proportion of monounsaturated to saturated fat.

  13. Denitrification nitrogen gas formation and gene expression in alpine grassland soil as affected by climate change conditions

    Science.gov (United States)

    Chen, Zhe; Wang, Changhui; Gschwendtner, Silvia; Schloter, Michael; Butterbach-Bahl, Klaus; Dannenmann, Michael

    2013-04-01

    Due to methodological problems, reliable data on soil dinitrogen (N2) emission by denitrification are extremely scarce, and the impacts of climate change on nitrogen (N) gas formation by denitrification and N gas product ratios as well as the underlying microbial drivers remain unclear. We combined the helium-gas-flow-soil-core technique for simultaneously quantification of nitrous oxide (N2O) and N2 emission with the reverse transcript qPCR technology. Our goals were to characterize denitrification dynamics and N gas product ratios in alpine grassland soil as affected by climate change conditions and to evaluate relationships between denitrification gene expression and N gas emission. We used soils from the pre-alpine grassland Terrestrial Environmental Observatory (TERENO), exposed to ambient temperature and precipitation (control treatment), or three years of simulated climate change conditions (increased temperature, reduction of summer precipitation and reduced snow cover). Soils were amended with glucose and nitrate and incubated subsequently at 1) 5°C and 20% oxygen; 2) 5°C and 0% oxygen; 3) 20°C and 0% oxygen until stabilization of N gas emissions in each incubation step. After switching incubation conditions to 0% oxygen and 20°C, N2O emission peaked immediately and declined again, followed by a delayed peak in N2 emission. The dynamics of cnorB gene expression, encoding the reduction of nitric oxide (NO) to N2O, followed the N2O emission pattern, while nosZ gene expression, encoding N2O reduction to N2 followed the course of N2 emission. The mean N2O:N2 ratios were 1.31 + 0.10 and 1.56 + 0.16 for control and climate change treatment respectively, but the denitrification potential was overall lower in climate change treatment. Hence, simulated climate change promoted N2O but lessened N2 emission. This stimulation of N2O was in accordance with increased cnorB gene expression in soil of the climate change treatment. N mass balance calculations revealed

  14. Induction of interferon-stimulated genes by IRF3 promotes replication of Toxoplasma gondii.

    Science.gov (United States)

    Majumdar, Tanmay; Chattopadhyay, Saurabh; Ozhegov, Evgeny; Dhar, Jayeeta; Goswami, Ramansu; Sen, Ganes C; Barik, Sailen

    2015-03-01

    Innate immunity is the first line of defense against microbial insult. The transcription factor, IRF3, is needed by mammalian cells to mount innate immune responses against many microbes, especially viruses. IRF3 remains inactive in the cytoplasm of uninfected cells; upon virus infection, it gets phosphorylated and then translocates to the nucleus, where it binds to the promoters of antiviral genes and induces their expression. Such genes include type I interferons (IFNs) as well as Interferon Stimulated Genes (ISGs). IRF3-/- cells support enhanced replication of many viruses and therefore, the corresponding mice are highly susceptible to viral pathogenesis. Here, we provide evidence for an unexpected pro-microbial role of IRF3: the replication of the protozoan parasite, Toxoplasma gondii, was significantly impaired in IRF3-/- cells. In exploring whether the transcriptional activity of IRF3 was important for its pro-parasitic function, we found that ISGs induced by parasite-activated IRF3 were indeed essential, whereas type I interferons were not important. To delineate the signaling pathway that activates IRF3 in response to parasite infection, we used genetically modified human and mouse cells. The pro-parasitic signaling pathway, which we termed PISA (Parasite-IRF3 Signaling Activation), activated IRF3 without any involvement of the Toll-like receptor or RIG-I-like receptor pathways, thereby ruling out a role of parasite-derived RNA species in activating PISA. Instead, PISA needed the presence of cGAS, STING, TBK1 and IRF3, indicating the necessity of DNA-triggered signaling. To evaluate the physiological significance of our in vitro findings, IRF3-/- mice were challenged with parasite infection and their morbidity and mortality were measured. Unlike WT mice, the IRF3-/- mice did not support replication of the parasite and were resistant to pathogenesis caused by it. Our results revealed a new paradigm in which the antiviral host factor, IRF3, plays a cell

  15. Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

    Science.gov (United States)

    Lintas, Carla; Sacco, Roberto; Persico, Antonio M

    2016-01-01

    Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

  16. The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: 
a Meta-analysis

    Directory of Open Access Journals (Sweden)

    Yichang SUN

    2014-03-01

    Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.

  17. Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2006-01-01

    In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

  18. THE ABERRANT PROMOTER HYPERMETHYLATION PATTERN OF THE ANTI - ANGIOGENIC TSP1 GENE IN EPITHELIAL OVARIAN CARCINOMA: AN INDIAN STUDY

    Directory of Open Access Journals (Sweden)

    Ramesh

    2015-06-01

    Full Text Available PURPOSE: The promoter hypermethylation patterns of Thrombospodin - 1 gene in 50 EOC patients were studied and the methylation pattern was correlated with various clinic pathological parameters. METHODS: The promoter hypermethylation pattern of the TSP - 1 gene was assessed using nested PCR and Methylation specific PCR. STATISTICAL ANALYSIS: All the available data was statistically analyzed using the Chi square test or Fisher Exact Test on the SPSS software version 22.0 and a value <0.0 5 was considered statistically significant. RESULTS: Forty of the fifty ovarian carcinoma samples reported positive for methylation corresponding to a methylation frequency of 80%. A methylation frequency of 89.2%, 83.3% and 42.8% was observed in malignant , Low malignant potential (borderline and benign sample cohorts. CONCLUSION: From the results drawn from this study, it clearly shows that the anti angiogenic protein TSP - 1 is extensively hypermethylated in ovarian carcinoma and that it accumulates over t he progression of the disease from benign to malignant. As previous reports suggest that there is no evidence of mutation of this gene, promoter hypermethylation may be a crucial factor for the down regulation of the gene. Further by clubbing together the promoter hypermethylation pattern of TSP - 1 gene with hypermethylation patterns of other TSG may provide a better insight into the application of using methylation profiles of TSG as a biomarker in the detection of ovarian carcinoma.

  19. Functional polymorphisms in the IL6 gene promoter and the risk of urinary bladder cancer in India.

    Science.gov (United States)

    Gautam, Kirti Amresh; Muktanand, Tripathi; Sankhwar, Satya Narayan; Goel, Apul; Sankhwar, Pushp Lata; Rajender, Singh

    2016-01-01

    Interleukin-6 is a multifunctional cytokine, which plays a key role in tumor proliferation and differentiation. Variations in its gene (IL6) sequence may affect the risk of developing various cancers, including urinary bladder cancer. The present study was done to find the association of functional polymorphisms in the IL6 promoter with urinary bladder cancer. Single nucleotide polymorphisms were genotyped in histologically confirmed 232 cases of urinary bladder cancer and 250 healthy controls. The controls subjects were matched to the cases by age, sex, and ethnicity. Genotyping of the polymorphisms (-174G>C; -572G>C, -596A>G) was undertaken by direct DNA sequencing. The level of association between the genotypes and urinary bladder cancer risk was estimated by odds ratios and 95% confidence intervals generated by applying the chi-square test. Linkage disequilibrium (LD) between SNPs and haplotype analysis were performed using Haploview software. Significantly higher number of smokers (p=0.047), tobacco chewers (p=C locus differed significantly between cases and controls and the variant genotypes GC+CC were significantly rarer in the cases (p=0.00073; OR=0.52 95% CI 0.35-0.75). Variant genotypes (GC+CC) were more common in grade I than grade III tumors (p=0.032), further suggesting a protective effect. No LD was found between the SNPs; however, the frequency of haplotype AGC was significantly lesser in the cases than controls (p=0.0103), suggesting a protective effect. Genotype distribution at the other two loci (-572G>C and -596A>G) did not show association with bladder cancer. IL6 (-174G>C) substitution confers significant protection against the risk of urinary bladder cancer in the study population, while other substitutions in this gene (-572G>C and -596A>G) do not affect the risk. In general, there is a lack of studies on the cytokine gene polymorphisms in urinary bladder cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.

    Directory of Open Access Journals (Sweden)

    Francesca Grespi

    2011-03-01

    Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.

  1. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  2. Factors affecting health-promoting lifestyle profile in Iranian male seafarers working on tankers

    DEFF Research Database (Denmark)

    Baygi, Fereshteh; Jensen, Olaf Chresten; Mohammadi-Nasrabadi, Fatemeh

    2017-01-01

    -sectional study was performed on 200 Iranian male seafarers in 2015. A self-administered socio-demographic and Health Promotion Lifestyle Profile II (HPLP-II) questionnaire was completed. One-way analysis of variance was used to identify significant differences among the various departments. The t......-test was utilised to compare the HPLP-II scores according to the demographic variables. Multiple linear regression analysis was performed to assess the association between demographic variables and the overall HPLP-II score, in addition to the six health-promoting lifestyle subscale scores. RESULTS: The mean age...... (19.95 ± 4.23). The lowest score for nutrition was found among the seafarers working in the engine department (engine: 20.41 ± 4.50, deck: 23.52 ± 4.97, and galley: 24.83 ± 4.64) (p Working in the engine department was found to have a significant negative effect on the nutrition score (B = -3...

  3. Vanillin Differentially Affects Azoxymethane-Injected Rat Colon Carcinogenesis and Gene Expression

    Science.gov (United States)

    Ho, Ket Li; Chong, Pei Pei; Yazan, Latifah Saiful

    2012-01-01

    Abstract Vanillin is the substance responsible for the flavor and smell of vanilla, a widely used flavoring agent. Previous studies reported that vanillin is a good antimutagen and anticarcinogen. However, there are also some contradicting findings showing that vanillin was a comutagen and cocarcinogen. This study investigated whether vanillin is an anticarcinogen or a cocarcinogen in rats induced with azoxymethane (AOM). Rats induced with AOM will develop aberrant crypt foci (ACF). AOM-challenged rats were treated with vanillin orally and intraperitoneally at low and high concentrations and ACF density, multiplicity, and distribution were observed. The gene expression of 14 colorectal cancer-related genes was also studied. Results showed that vanillin consumed orally had no effect on ACF. However, high concentrations (300 mg/kg body weight) of vanillin administered through intraperitoneal injection could increase ACF density and ACF multiplicity. ACF were mainly found in the distal colon rather than in the mid-section and proximal colon. The expression of colorectal cancer biomarkers, protooncogenes, recombinational repair, mismatch repair, and cell cycle arrest, and tumor suppressor gene expression were also affected by vanillin. Vanillin was not cocarcinogenic when consumed orally. However, it was cocarcinogenic when being administered intraperitoneally at high concentration. Hence, the use of vanillin in food should be safe but might have cocarcinogenic potential when it is used in high concentration for therapeutic purposes. PMID:23216109

  4. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Trevisan, Marta; Desole, Giovanna; Costanzi, Giulia; Lavezzo, Enrico; Palù, Giorgio; Barzon, Luisa

    2017-01-20

    Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

  5. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Marta Trevisan

    2017-01-01

    Full Text Available Induced pluripotent stem cells (iPSCs are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

  6. Mosaicism for the FMR1 gene influences adaptive skills development in fragile X-affected males

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, I.L.; Sudhalter, V.; Nolin, S.L. [New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY (United States)

    1996-08-09

    Fragile X syndrome is one of the most common forms of inherited mental retardation, and the first of a new class of genetic disorders associated with expanded trinucleotide repeats. Previously, we found that about 41% of affected males are mosaic for this mutation in that some of their blood cells have an active fragile X gene and others do not. It has been hypothesized that these mosaic cases should show higher levels of functioning than those who have only the inactive full mutation gene, but previous studies have provided negative or equivocal results. In the present study, the cross-sectional development of communication, self-care, socialization, and motor skills was studied in 46 males with fragile X syndrome under age 20 years as a function of two variables: age and the presence or absence of mosaicism. The rate of adaptive skills development was 2-4 times as great in mosaic cases as in full mutation cases. There was also a trend for cases with autism to be more prevalent in the full-mutation group. These results have implications for prognosis, for the utility of gene or protein replacement therapies for this disorder, and for understanding the association between mental retardation, developmental disorders, and fragile X syndrome. 21 refs., 3 figs.

  7. Gain-of-function screen for genes that affect Drosophila muscle pattern formation.

    Directory of Open Access Journals (Sweden)

    Nicole Staudt

    2005-10-01

    Full Text Available This article reports the production of an EP-element insertion library with more than 3,700 unique target sites within the Drosophila melanogaster genome and its use to systematically identify genes that affect embryonic muscle pattern formation. We designed a UAS/GAL4 system to drive GAL4-responsive expression of the EP-targeted genes in developing apodeme cells to which migrating myotubes finally attach and in an intrasegmental pattern of cells that serve myotubes as a migration substrate on their way towards the apodemes. The results suggest that misexpression of more than 1.5% of the Drosophila genes can interfere with proper myotube guidance and/or muscle attachment. In addition to factors already known to participate in these processes, we identified a number of enzymes that participate in the synthesis or modification of protein carbohydrate side chains and in Ubiquitin modifications and/or the Ubiquitin-dependent degradation of proteins, suggesting that these processes are relevant for muscle pattern formation.

  8. Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome.

    Science.gov (United States)

    Abdi, Samia; Bahloul, Amel; Behlouli, Asma; Hardelin, Jean-Pierre; Makrelouf, Mohamed; Boudjelida, Kamel; Louha, Malek; Cheknene, Ahmed; Belouni, Rachid; Rous, Yahia; Merad, Zahida; Selmane, Djamel; Hasbelaoui, Mokhtar; Bonnet, Crystel; Zenati, Akila; Petit, Christine

    2016-01-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by a dual sensory impairment affecting hearing and vision. USH is clinically and genetically heterogeneous. Ten different causal genes have been reported. We studied the molecular bases of the disease in 18 unrelated Algerian patients by targeted-exome sequencing, and identified the causal biallelic mutations in all of them: 16 patients carried the mutations at the homozygous state and 2 at the compound heterozygous state. Nine of the 17 different mutations detected in MYO7A (1 of 5 mutations), CDH23 (4 of 7 mutations), PCDH15 (1 mutation), USH1C (1 mutation), USH1G (1 mutation), and USH2A (1 of 2 mutations), had not been previously reported. The deleterious consequences of a missense mutation of CDH23 (p.Asp1501Asn) and the in-frame single codon deletion in USH1G (p.Ala397del) on the corresponding proteins were predicted from the solved 3D-structures of extracellular cadherin (EC) domains of cadherin-23 and the sterile alpha motif (SAM) domain of USH1G/sans, respectively. In addition, we were able to show that the USH1G mutation is likely to affect the binding interface between the SAM domain and USH1C/harmonin. This should spur the use of 3D-structures, not only of isolated protein domains, but also of protein-protein interaction interfaces, to predict the functional impact of mutations detected in the USH genes.

  9. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    International Nuclear Information System (INIS)

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  10. Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters

    OpenAIRE

    Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.

    2011-01-01

    The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...

  11. Agaricus brasiliensis (sun mushroom) affects the expression of genes related to cholesterol homeostasis.

    Science.gov (United States)

    de Miranda, Aline Mayrink; Rossoni Júnior, Joamyr Victor; Souza E Silva, Lorena; Dos Santos, Rinaldo Cardoso; Silva, Marcelo Eustáquio; Pedrosa, Maria Lúcia

    2017-06-01

    The sun mushroom (Agaricus brasiliensis) is considered a major source of bioactive compounds with potential health benefits. Mushrooms typically act as lipid-lowering agents; however, little is known about the mechanisms of action of A. brasiliensis in biological systems. This study aimed to determine the underlying mechanism involved in the cholesterol-lowering effect of A. brasiliensis through the assessment of fecal and serum lipid profiles in addition to gene expression analysis of specific transcription factors, enzymes, and transporters involved in cholesterol homeostasis. Twenty-four albino Fischer rats approximately 90 days old, with an average weight of 205 g, were divided into four groups of 6 each and fed a standard AIN-93 M diet (C), hypercholesterolemic diet (H), hypercholesterolemic diet +1 % A. brasiliensis (HAb), or hypercholesterolemic diet +0.008 % simvastatin (HS) for 6 weeks. Simvastatin was used as a positive control, as it is a typical drug prescribed for lipid disorders. Subsequently, blood, liver, and feces samples were collected for lipid profile and quantitative real-time polymerase chain reaction gene expression analyses. Diet supplementation with A. brasiliensis significantly improved serum lipid profiles, comparable to the effect observed for simvastatin. In addition, A. brasiliensis dietary supplementation markedly promoted fecal cholesterol excretion. Increased expression of 7α-hydroxylase (CYP7A1), ATP-binding cassette subfamily G-transporters (ABCG5/G8), and low-density lipoprotein receptor (LDLR) was observed following A. brasiliensis administration. Our results suggest that consumption of A. brasiliensis improves the serum lipid profile in hypercholesterolemic rats by modulating the expression of key genes involved in hepatic cholesterol metabolism.

  12. Amelogenin Affects Brushite Crystal Morphology and Promotes Its Phase Transformation to Monetite

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Dongni; Ruan, Qichao; Tao, Jinhui; Lo, Jonathan; Nutt, Steven; Moradian-Oldak, Janet

    2016-09-07

    Amelogenin protein is involved in organized apatite crystallization during enamel formation. Brushite (CaHPO4·2H2O), which is one of the precursors for hydroxyapatite in in vitro mineralization, has been used for fabrication of biomaterials for hard tissue repair. In order to explore its potential application in biomimetic material synthesis, we studied the influence of amelogenin on brushite morphology and phase transformation to monetite. Our results show that amelogenin can adsorb onto surface of brushite, leading to the formation of layered structures on the (010) face. Amelogenin promoted the phase transformation of brushite into monetite (CaHPO4) in the dry state, presumably by interacting with crystalline water layers in brushite unit cell. Changes to the crystal morphology by amelogenin continued even after the phase transformation to monetite forming an organized nanotextured structure of nano-sticks resembling the bundle structure in enamel.

  13. Bioaerosols from a food waste composting plant affect human airway epithelial cell remodeling genes.

    Science.gov (United States)

    Chang, Min-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-12-24

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 10(2) conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5-10 μm) having higher endotoxin levels than did fine particles (0.5-2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21 WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers.

  14. Bioaerosols from a Food Waste Composting Plant Affect Human Airway Epithelial Cell Remodeling Genes

    Science.gov (United States)

    Chang, Ming-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-01-01

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 102 conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5–10 μm) having higher endotoxin levels than did fine particles (0.5–2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers. PMID:24368426

  15. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    International Nuclear Information System (INIS)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-01-01

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  16. Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter

    Science.gov (United States)

    Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.

    2011-01-01

    Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are

  17. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  18. Contribution of the Pmra Promoter to Expression of Genes in the Escherichia coli mra Cluster of Cell Envelope Biosynthesis and Cell Division Genes

    Science.gov (United States)

    Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi

    1998-01-01

    Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276

  19. An exploration of decision aid effectiveness: the impact of promoting affective vs. deliberative processing on a health-related decision.

    Science.gov (United States)

    Davis, Esther L; McCaffery, Kirsten; Mullan, Barbara; Juraskova, Ilona

    2015-12-01

    Decision aids (DAs) are non-directive communication tools that help patients make value-consistent health-care decisions. However, most DAs have been developed without an explicit theoretical framework, resulting in a lack of understanding of how DAs achieve outcomes. To investigate the effect of promoting affective vs. deliberative processing on DA effectiveness based on dual-process theory. One hundred and forty-eight female university students participated in a randomized controlled experiment with three conditions: emotion-focused, information-focused and control. Preference-value consistency, knowledge, decisional conflict and satisfaction were compared across the conditions using planned contrast analyses. The intervention comprised two different DAs and instructional manipulations. The emotion-focused condition received a modified DA with affective content and instructions to induce an affective reaction. The information-focused and control conditions received the same DA without the affective content. The information-focused condition received additional instructions to induce deliberative processing. Controlling for the experiment-wise error rate at P processing may hinder value-consistent decision making, while deliberative processing may enhance decisional satisfaction. This investigation of the effect of affective and deliberative processes in DA-supported decision making has implications for the design and use of DAs. DA effectiveness may be enhanced by incorporating a simple instruction to focus on the details of the information. © 2014 John Wiley & Sons Ltd.

  20. Bio-Oss® modified by calcitonin gene-related peptide promotes osteogenesis in vitro.

    Science.gov (United States)

    Li, Yuanjing; Yang, Lan; Zheng, Zhichao; Li, Zhengmao; Deng, Tian; Ren, Wen; Wu, Caijuan; Guo, Lvhua

    2017-11-01

    Bio-Oss ® and α-calcitonin gene-related peptide (CGRP) are involved in osteogenesis. However, it has remained to be assessed how α-CGRP affects the effect of Bio-Oss. In the present study, primary osteoblasts were incubated with α-CGRP, Bio-Oss, α-GGRP-Bio-Oss or mimic-α-CGRP. The proliferation rate, mineralization nodules, alkaline phosphatase (ALP) activity and the expression of osteogenic genes were measured by a Cell Counting Kit-8 assay, Alizarin Red-S staining, ALP activity detection and reverse-transcription quantitative PCR as well as western blot analysis, respectively. The proliferation rate, ALP activity and the number of mineralization nodules were significantly increased in the α-CGRP-modified Bio-Oss group compared to that in the Bio-Oss group. The mRNA and protein levels of osteocalcin, Runt-related transcription factor-2 and ALP were significantly upregulated in the α-CGRP-Bio-Oss group compared with those in the Bio-Oss group. Furthermore, the effect of mimic-α-CGRP on osteogenesis was reduced as it carried a mutation. In conclusion, the present study was the first to demonstrate that Bio-Oss modified with CGRP contributed to osteogenesis and may provide a novel formulation applied in the clinic for restoration of large bone defects.

  1. Vitamin D receptor gene polymorphisms, dietary promotion of insulin resistance, and colon and rectal cancer.

    Science.gov (United States)

    Murtaugh, Maureen A; Sweeney, Carol; Ma, Khe-Ni; Potter, John D; Caan, Bette J; Wolff, Roger K; Slattery, Martha L

    2006-01-01

    Modifiable risk factors in colorectal cancer etiology and their interactions with genetic susceptibility are of particular interest. Functional vitamin D receptor (VDR) gene polymorphisms may influence carcinogenesis through modification of cell growth, protection from oxidative stress, cell-cell matrix effects, or insulin and insulin-like growth factor pathways. We investigated interactions between foods (dairy products, red and processed meat, and whole and refined grains) and dietary patterns (sucrose-to-fiber ratio and glycemic index) associated with insulin resistance with the FokI polymorphism of the VDR gene and colon and rectal cancer risk. Data (diet, anthropometrics, and lifestyle) and DNA came from case-control studies of colon (1,698 cases and 1,861 controls) and rectal cancer (752 cases and 960 controls) in northern California, Utah, and the Twin Cities metropolitan area, Minnesota (colon cancer study only). Unconditional logistic regression models were adjusted for smoking, race, sex, age, body mass index, physical activity, energy intake, dietary fiber, and calcium. The lowest colon cancer risk was observed with the Ff/ff FokI genotypes and a low sucrose-to-fiber ratio. Rectal cancer risk decreased with greater consumption of dairy products and increased with red or processed meat consumption and the FF genotype. Modifiable dietary risk factors may be differentially important among individuals by VDR genotype and may act through the insulin pathway to affect colon cancer risk and through fat, calcium, or other means to influence rectal cancer risk.

  2. Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2005-01-01

    In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

  3. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site

    DEFF Research Database (Denmark)

    Schulze, A; Zerfass, K; Spitkovsky, D

    1995-01-01

    Cyclin A is involved in the control of S phase and mitosis in mammalian cells. Expression of the cyclin A gene in nontransformed cells is characterized by repression of its promoter during the G1 phase of the cell cycle and its induction at S-phase entry. We show that this mode of regulation...

  4. Key tumor suppressor genes inactivated by "greater promoter" methylation and somatic mutations in head and neck cancer

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David

    Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing

  5. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    Science.gov (United States)

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  6. Clinical Utility of promoter methylation of the tumor suppressor genes DKK3, and RASSF1A in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Marwa H. Saied

    2018-04-01

    Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1

  7. A compact dual promoter adeno-associated viral vector for efficient delivery of two genes to dorsal root ganglion neurons

    NARCIS (Netherlands)

    Fagoe, N D; Eggers, R; Verhaagen, J; Mason, M R J

    Adeno-associated viral (AAV) vectors based on serotype 5 are an efficient means to target dorsal root ganglia (DRG) to study gene function in the primary sensory neurons of the peripheral nervous system. In this study, we have developed a compact AAV dual promoter vector composed of the

  8. Exploring the potential of the glycerol-3-phosphate dehydrogenase 2 (GPD2) promoter for recombinant gene expression in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna

    2015-01-01

    A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...

  9. Tissue-specific production of limonene in Camelina sativa with the Arabidopsis promoters of genes BANYULS and FRUITFULL

    NARCIS (Netherlands)

    Borghi, Monica; Xie, De Yu

    2016-01-01

    Main conclusion: Arabidopsis promoters of genesBANYULSandFRUITFULLare transcribed in Camelina. They triggered the transcription oflimonene synthaseand induced higher limonene production in seeds and fruits thanCaMV 35Spromoter.Camelina sativa (Camelina) is an oilseed crop of relevance for the

  10. DNA Methyltransferase 3B Gene Promoter and Interleukin-1 Receptor Antagonist Polymorphisms in Childhood Immune Thrombocytopenia

    Directory of Open Access Journals (Sweden)

    Margarita Pesmatzoglou

    2012-01-01

    Full Text Available Primary immune thrombocytopenia (ITP is one of the most common blood diseases as well as the commonest acquired bleeding disorder in childhood. Although the etiology of ITP is unclear, in the pathogenesis of the disease, both environmental and genetic factors including polymorphisms of TNF-a, IL-10, and IL-4 genes have been suggested to be involved. In this study, we investigated the rs2424913 single-nucleotide polymorphism (SNP (C46359T in DNA methyltransferase 3B (DNMT3B gene promoter and the VNTR polymorphism of IL-1 receptor antagonist (IL-1 Ra intron-2 in 32 children (17 boys with the diagnosis of ITP and 64 healthy individuals. No significant differences were found in the genotype distribution of DNMT3B polymorphism between the children with ITP and the control group, whereas the frequency of allele T appeared significantly increased in children with ITP (P = 0.03, OR = 2, 95% CI: 1.06–3.94. In case of IL-1 Ra polymorphism, children with ITP had a significantly higher frequency of genotype I/II, compared to control group (P = 0.043, OR = 2.60, 95% CI: 1.02–6.50. Moreover, genotype I/I as well as allele I was overrepresented in the control group, suggesting that allele I may have a decreased risk for development of ITP. Our findings suggest that rs2424913 DNMT3B SNP as well as IL-1 Ra VNTR polymorphism may contribute to the susceptibility to ITP.

  11. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  12. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    Science.gov (United States)

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  13. Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination phenotypes

    International Nuclear Information System (INIS)

    Cole, G.M.; Mortimer, R.K.

    1989-01-01

    The Saccharomyces cerevisiae RAD54 gene is transcriptionally regulated by a broad spectrum of DNA-damaging agents. Induction of RAD54 by DNA-damaging agents is under positive control. Sequences responsible for DNA damage induction (the DRS element) lie within a 29-base-pair region from -99 to -70 from the most proximal transcription start site. This inducible promoter element is functionally separable from a poly(dA-dT) region immediately downstream which is required for constitutive expression. Deletions which eliminate induction of RAD54 transcription by DNA damage but do not affect constitutive expression have no effect on growth or survival of noninducible strains relative to wild-type strains in the presence of DNA-damaging agents. The DRS element is also not required for homothallic mating type switching, transcriptional induction of RAD54 during meiosis, meiotic recombination, or spontaneous or X-ray-induced mitotic recombination. We find no phenotype for a lack of induction of RAD54 message via the damage-inducible DRS, which raises significant questions about the physiology of DNA damage induction in S. cerevisiae

  14. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  15. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  16. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  17. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  18. Significant association between polymorphism of the erythropoietin gene promoter and myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    O'Brien Susan

    2010-11-01

    Full Text Available Abstract Background Myelodysplastic syndrome (MDS may be induced by certain mutagenic environmental or chemotherapeutic toxins; however, the role of susceptibility genes remains unclear. The G/G genotype of the single-nucleotide polymorphism (SNP rs1617640 in the erythropoietin (EPO promoter has been shown to be associated with decreased EPO expression. We examined the association of rs1617640 genotype with MDS. Methods We genotyped the EPO rS1617640 SNP in 189 patients with MDS, 257 with acute myeloid leukemia (AML, 106 with acute lymphoblastic leukemia, 97 with chronic lymphocytic leukemia, 353 with chronic myeloid leukemia, and 95 healthy controls. Results The G/G genotype was significantly more common in MDS patients (47/187; 25.1% than in controls (6/95; 6.3% or in patients with other leukemias (101/813; 12.4% (all P P = 0.03. Time to neutrophils recovery after therapy was significantly longer in MDS patients with the G/G genotype (P = 0.02. Conclusions These findings suggest a strong association between the rs1617640 G/G genotype and MDS. Further studies are warranted to investigate the utility of screening for this marker in individuals exposed to environmental toxins or chemotherapy.

  19. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  20. Promoter Methylation and BDNF and DAT1 Gene Expression Profiles in Patients with Drug Addiction.

    Science.gov (United States)

    Kordi-Tamandani, Dor Mohammad; Tajoddini, Shahrad; Salimi, Farzaneh

    2015-01-01

    Drug addiction is a brain disorder that has negative consequences for individuals and society. Addictions are chronic relapsing diseases of the brain that are caused by direct drug-induced effects and persevering neuroadaptations at the epigenetic, neuropeptide and neurotransmitter levels. Because the dopaminergic system has a significant role in drug abuse, the purpose of this study was to analyze the methylation and expression profile of brain-derived neurotrophic factor (BDNF) and dopamine transporter (DAT1) genes in individuals with drug addiction. BDNF and DAT1 promoter methylation were investigated with a methylation-specific polymerase chain reaction (PCR) technique in blood samples from 75 individuals with drug addiction and 65 healthy controls. The expression levels of BDNF and DAT1 were assessed in 12 mRNA samples from the blood of patients and compared to the samples of healthy controls (n = 12) with real-time quantitative reverse transcription PCR. No significant differences were found in the methylation of BDNF and DAT1 between patients and controls, but the relative levels of expression of BDNF and DAT1 mRNA differed significantly in the patients compared to controls (p drug addiction.

  1. Association between a promoter dopamine D2 receptor gene variant and the personality trait detachment.

    Science.gov (United States)

    Jönsson, Erik G; Cichon, Sven; Gustavsson, J Petter; Grünhage, Frank; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Farde, Lars; Propping, Peter; Nöthen, Markus M

    2003-04-01

    Personality traits have shown considerable heritable components. Striatal dopamine D(2) receptor density, as determined by positron-emission tomography, has been associated with detached personality, as assessed by the Karolinska Scales of Personality. A putative functional promoter polymorphism in the dopamine D(2) receptor gene (DRD2), -141C ins/del, has been associated with dopamine D(2) receptor density. In this study healthy subjects (n = 235) who filled in at least one of several personality questionnaires (Karolinska Scales of Personality, Swedish Universities Scales of Personality, Health-relevant Five-factor Personality Inventory, and Temperament and Character Inventory) were analyzed with regard to the DRD2 -141C ins/del variant. There was an association (p =.001) between the DRD2 -141C ins/del variant and Karolinska Scales of Personality Detachment scale, indicating higher scores in subjects with the -141C del variant. There were also associations between the DRD2 -141C ins/del variant and a number of Karolinska Scales of Personality and Swedish Universities Scales of Personality Neuroticism-related scales, but of these only Swedish Universities Scales of Personality Lack of Assertiveness scale (p =.001) survived correction for multiple testing. These results add further support for the involvement of dopamine D(2) receptor in certain personality traits. The results should be treated with caution until replicated.

  2. Upregulated Expression of a Unique Gene by Hepatitis B x Antigen Promotes Hepatocellular Growth and Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Zhaorui Lian

    2003-05-01

    Full Text Available Hepatitis B x antigen (HBxAg is a trans-activating protein that may be involved in hepatocarcinogenesis, although few natural effectors of HBxAg that participate in this process have been identified. To identify additional effectors, whole cell RNA isolated from HBxAg-positive and HBxAg-negative HepG2 cells were compared by polymerase chain reaction select cDNA subtraction, and one clone, upregulated gene, clone 11 (URG11, was chosen for further characterization. Elevated levels of URG11 mRNA and protein were observed in HBxAg-positive compared to HBxAg-negative HepG2 cells. Costaining was observed in infected liver (P<.01. URG11 stimulated cell growth in culture (P<.01, anchorage-independent growth in soft agar (P<.001, and accelerated tumor formation (P<.01, and yielded larger tumors (P<.02 in SCID mice injected subcutaneously with HepG2 cells. These data suggest that URG11 is a natural effector of HBxAg that may promote the development of hepatocellular carcinoma.