Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis Prevalência das mutações C282Y e H63D no gene HFE em indivíduos brasileiros com suspeita clínica de hemocromatose hereditária

Directory of Open Access Journals (Sweden)

Alessandro C. S. Ferreira

2008-10-01

Full Text Available Classical hereditary hemochromatosis is a recessive autosomal disease related to a systemic iron overload that is frequently related to C282Y and H63D mutations in the HFE gene. In Brazil, reports on HFE gene mutation frequencies are rare, mainly in regards to a representative sample population. This study intended to determine the prevalence of C282Y and H63D mutations among individuals with clinical suspicion of hereditary hemochromatosis. A total of 1955 patients were studied with C282Y and H63D mutations being detected by the polymerase chain reaction technique followed by enzymatic restriction. The sample consisted of 76.6% men and 23.4% women. The highest percentage of analyzed individuals (56.9% was concentrated in the 41 to 60-year-old age group. Although there were no genic or genotypic differences between genders, a higher number of over 60-year-old women was observed. The C282Y mutation was found as homozygous in 2.9% of the cases and as heterozygous in 10.1%, while the H63D was homozygous in 4.3% and heterozygous in 30.6%. The C282Y and H63D mutant allele frequencies were 0.079 and 0.196, respectively. The highest frequency was observed for H63D which was in genetic equilibrium. This work is important to determine the genetic profile of the population with hereditary hemochromatosis in Brazi.A hemocromatose hereditária clássica (HH é uma doença autossômica recessiva caracterizada por uma sobrecarga sistêmica de ferro, a qual está freqüentemente relacionada às mutações C282Y e H63D no gene HFE. No Brasil, registros das freqüências das mutações no gene HFE são raros, principalmente envolvendo uma amostra representativa da população. Este estudo teve como objetivo a determinação da prevalência das mutações C282Y e H63D em indivíduos com suspeita clínica de HH. Para isto, foram estudados 1955 pacientes para os quais as mutações C282Y e H63D foram pesquisadas pela técnica de Reação em Cadeia da Polimerase

Iron overload in HFE C282Y heterozygotes at first genetic testing: a strategy for identifying rare HFE variants.

Science.gov (United States)

Aguilar-Martinez, Patricia; Grandchamp, Bernard; Cunat, Séverine; Cadet, Estelle; Blanc, François; Nourrit, Marlène; Lassoued, Kaiss; Schved, Jean-François; Rochette, Jacques

2011-04-01

Heterozygotes for the p.Cys282Tyr (C282Y) mutation of the HFE gene do not usually express a hemochromatosis phenotype. Apart from the compound heterozygous state for C282Y and the widespread p.His63Asp (H63D) variant allele, other rare HFE mutations can be found in trans on chromosome 6. We performed molecular investigation of the genes implicated in hereditary hemochromatosis in six patients who presented with iron overload but were simple heterozygotes for the HFE C282Y mutation at first genetic testing. Functional impairment of new variants was deduced from computational methods including molecular modeling studies. We identified four rare HFE mutant alleles, three of which have not been previously described. One mutation is a 13-nucleotide deletion in exon 6 (c.1022_1034del13, p.His341_Ala345 > LeufsX119), which is predicted to lead to an elongated and unstable protein. The second one is a substitution of the last nucleotide of exon 2 (c.340G > A, p.Glu114Lys) which modifies the relative solvent accessibility in a loop interface. The third mutation, p.Arg67Cys, also lies in exon 2 and introduces a destabilization of the secondary structure within a loop of the α1 domain. We also found the previously reported c.548T > C (p.Leu183Pro) missense mutation in exon 3. No other known iron genes were mutated. We present an algorithm at the clinical and genetic levels for identifying patients deserving further investigation. Conclusions Our results suggest that additional mutations in HFE may have a clinical impact in C282Y carriers. In conjunction with results from previously described cases we conclude that an elevated transferrin saturation level and elevated hepatic iron index should indicate the utility of searching for further HFE mutations in C282Y heterozygotes prior to other iron gene studies.

C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.

Science.gov (United States)

Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y

2014-01-01

Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.

[ALLELES C282Y AND H63D HFE GENE, INSULIN RESISTANCE AND SUSCEPTIBILITY TO DISTURBANCE OF PORPHYRIN METABOLISM IN NON-ALCOHOLIC FATTY LIVER DISEASE].

Science.gov (United States)

Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V

2015-01-01

The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.

Molecular epidemiology of HFE gene polymorphic variants (C282Y, H63D and S65C) in the population of Espírito Santo, Brazil.

Science.gov (United States)

Alves, L N R; Santos, E V W; Stur, E; Silva Conforti, A M A; Louro, I D

2016-04-27

Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to progressive iron accumulation and may cause cirrhosis, hepatocellular carcinoma, diabetes, and heart failure. Most cases of HH have been linked to mutations in genes associated with iron homeostasis. There have been three major variants in the high Fe (HFE) gene associated with the disease: C282Y, H63D and S65C. In this context, we aimed to evaluate the prevalence of the polymorphic variants (C282Y, H63D and S65C) of the HFE gene in the population of the Espírito Santo State (ES), Brazil by analyzing three different groups: general population (N = 120), Pomeranian descendants (N = 59), and patients with HH (N = 20). Using genomic DNA extracted from peripheral blood, polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism. Statistically significant differences were observed for genotype distribution of C282Y (P HFE gene allele frequencies for the general population, Pomeranian subpopulation, and patients with HH of ES, Brazil.

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

OpenAIRE

Selma Ünal; Günay Balta; Fatma Gümrük

2014-01-01

Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic.

Science.gov (United States)

Heath, Kathleen M; Axton, Jacob H; McCullough, John M; Harris, Nathan

2016-05-01

The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronutrient for effective thermoregulation. We argue that the C282Y allele was an adaptation to this novel environment. To address our hypothesis, we compiled C282Y allele frequencies, known Neolithic sites in Europe and climatic data on temperature and rainfall for statistical analysis. Our findings indicate that the geographic cline for C282Y frequency in Europe increases as average temperatures decrease below 16°C, a critical threshold for thermoregulation, with rainy days intensifying the trend. The results indicate that the deleterious C282Y allele, responsible for most cases of hemochromatosis, may have evolved as a selective advantage to culture and climate during the European Neolithic. © 2016 The Authors American Journal of Physical Anthropology Published by Wiley Periodicals, Inc.

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

Science.gov (United States)

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-12-01

Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on

HFE gene C282Y variant is associated with colorectal cancer in Caucasians: a meta-analysis.

Science.gov (United States)

Chen, Weidong; Zhao, Hua; Li, Tiegang; Yao, Hongliang

2013-08-01

The HFE gene has been suggested to play an important role in the pathogenesis of colorectal cancer. However, the results have been conflicting. In this study, we performed a meta-analysis to clarify the association of HFE gene C282Y variant with colorectal cancer. PubMed and Embase were retrieved to identify the potential literature. Pooled odds ratio (OR) with 95 % confidence interval (CI) was calculated using fixed- or random-effects model. A total of eight papers including nine studies (7,588 colorectal cancer cases and 81,571 controls) for HFE gene C282Y variant were included in the meta-analysis. The result indicated that HFE gene C282Y variant was significantly associated with colorectal cancer under recessive model (OR = 2.00, 95 % CI = 1.32-3.04), with no evidence of between-study heterogeneity (I (2) = 0.2 %, p = 0.432). Further subgroup analysis by number of cases suggested the effect was significant in studies with more than 500 cases (OR = 2.51, 95 % CI = 1.58-3.98, I (2) = 0.0 %, p = 0.921), but not in studies with less than 500 cases (OR = 0.75, 95 % CI = 0.28-1.97, I (2) = 0.0 %, p = 0.622). The current meta-analysis supported the positive association of HFE gene C282Y variant with colorectal cancer. Further large-scale studies with the consideration for gene-gene/gene-environment interactions should be conducted to investigate the association.

C282Y polymorphism in the HFE gene is associated with risk of breast cancer.

Science.gov (United States)

Liu, Xiaoyan; Lv, Chunlei; Luan, Xiaorong; Lv, Ming

2013-10-01

The C282Y and H63D polymorphisms in the HFE gene have been implicated in susceptibility of breast cancer, but a number of studies have reported inconclusive results. The aim of this study is to investigate the association between the C282Y and H63D polymorphisms in the HFE gene and breast cancer risk by meta-analysis. We searched PubMed and Embase databases, covering all related studies until March 2, 2013. Statistical analysis was performed using STATA 10.0. A total of 7 studies including 1,720 cases and 18,296 controls for HFE C282Y polymorphism and 5 studies including 942 cases and 1,571 controls for HFE H63D polymorphism were included in the meta-analysis. The results showed that HFE C282Y polymorphism was significantly associated with increased risk of breast cancer under homozygotes vs. wild-type model (OR = 2.06, 95%CI = 1.19-3.58) and recessive model (OR = 1.98, 95%CI = 1.14-3.44) but not under heterozygotes vs. wild-type model (OR = 0.97, 95%CI = 0.70-1.35), dominant model (OR = 1.00, 95%CI = 0.72-1.40) and multiplicative model (OR = 1.04, 95%CI = 0.76-1.42). However, we did not find any association between HFE H63D polymorphism and breast cancer risk under all genetic models. This current meta-analysis suggested that C282Y polymorphism rather than H63D might be associated with increased risk of breast cancer.

Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

Directory of Open Access Journals (Sweden)

Yunus Kasım Terzi

2016-12-01

Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

HFE p.C282Y gene variant is associated with varicose veins in Russian population.

Science.gov (United States)

Sokolova, Ekaterina A; Shadrina, Alexandra S; Sevost'ianova, Kseniya S; Shevela, Andrey I; Soldatsky, Evgenii Yu; Seliverstov, Evgenii I; Demekhova, Marina Yu; Shonov, Oleg A; Ilyukhin, Evgenii A; Smetanina, Mariya A; Voronina, Elena N; Zolotukhin, Igor A; Filipenko, Maxim L

2016-08-01

Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown. We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins. We genotyped HFE p.C282Y (rs1800562) and p.H63D (rs1799945) variants in patients with primary varicose veins (n = 463) and in the control group (n = 754). In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02). A borderline significant reverse association of p.63D variant (rs1799945 G allele) with venous leg ulcer development was revealed in Russians (OR 0.25, 95 % CI = 0.06-1.00, P = 0.05), but not in the meta-analysis (P = 0.56). We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.

Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo Delfini Cançado

Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

HFE p.C282Y homozygosity predisposes to rapid serum ferritin rise after menopause: A genotype-stratified cohort study of hemochromatosis in Australian women.

Science.gov (United States)

Warne, Charles D; Zaloumis, Sophie G; Bertalli, Nadine A; Delatycki, Martin B; Nicoll, Amanda J; McLaren, Christine E; Hopper, John L; Giles, Graham G; Anderson, Greg J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J; Gurrin, Lyle C

2017-04-01

Women who are homozygous for the p.C282Y mutation in the HFE gene are at much lower risk of iron overload-related disease than p.C282Y homozygous men, presumably because of the iron-depleting effects of menstruation and pregnancy. We used data from a population cohort study to model the impact of menstruation cessation at menopause on serum ferritin (SF) levels in female p.C282Y homozygotes, with p.C282Y/p.H63D simple or compound heterozygotes and those with neither p.C282Y nor p.H63D mutations (HFE wild types) as comparison groups. A sample of the Melbourne Collaborative Cohort Study was selected for the "HealthIron" study (n = 1438) including all HFE p.C282Y homozygotes plus a random sample stratified by HFE-genotype (p.C282Y and p.H63D). The relationship between the natural logarithm of SF and time since menopause was examined using linear mixed models incorporating spline smoothing. For p.C282Y homozygotes, SF increased by a factor of 3.6 (95% CI (1.8, 7.0), P HFE genotype groups increase more gradually and did not show a distinction between premenopausal and postmenopausal SF levels. Only p.C282Y homozygotes had predicted SF exceeding 200 μg/L postmenopause, but the projected SF did not increase the risk of iron overload-related disease. These data provide the first documented evidence that physiological blood loss is a major factor in determining the marked gender difference in expression of p.C282Y homozygosity. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

Science.gov (United States)

Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

2009-01-01

Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo Lisboa Bittencourt

2009-01-01

Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic

OpenAIRE

Heath, Kathleen M.; Axton, Jacob H.; McCullough, John M.; Harris, Nathan

2016-01-01

ABSTRACT Objectives The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronut...

Frequency of the HFE C282Y and H63D mutations in Danish patients with clinical haemochromatosis initially diagnosed by phenotypic methods

DEFF Research Database (Denmark)

Milman, Nils; Koefoed, Pernille; Pedersen, Palle

2003-01-01

AIM: To assess the frequency of the C282Y and H63D mutations on the HFE gene in Danish patients with clinical hereditary haemochromatosis initially diagnosed by phenotypic methods. METHODS: In the period 1950-1985, an epidemiological survey in Denmark identified 179 patients with clinical...... diagnosis of clinical idiopathic haemochromatosis was made before blood samples were taken for HFE genotyping. The total series consisted of 58 patients (40 men and 18 women) with a median age of 60 yrs (range 18-74). HFE genotyping was performed by the polymerase chain reaction (PCR) technique. RESULTS...

Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

Directory of Open Access Journals (Sweden)

F.V. Perícole

2005-09-01

Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

Science.gov (United States)

Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

2017-07-01

Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

Science.gov (United States)

Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

2016-10-31

To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

The natural history of serum iron indices for HFE C282Y homozygosity associated with hereditary hemochromatosis.

Science.gov (United States)

Gurrin, Lyle C; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Laurie W; Allen, Katrina J

2008-12-01

There are few longitudinal studies of serum ferritin (SF) and transferrin saturation (TS) levels in individuals homozygous for the C282Y mutation. We characterized the development of elevated iron measures in C282Y homozygotes followed for 12 years. From 31,192 people aged 40-69 years at baseline, we identified 203 C282Y homozygotes (95 males), of whom 116 had SF and fasting TS levels measured at baseline (mean age, 55 years) and 86 were untreated and had iron measures at follow-up (mean, 12 years later). The probabilities of SF at follow-up exceeding clinical thresholds were predicted from baseline SF and TS under a multivariate normal model. For C282Y homozygotes, at baseline, 84% of males and 65% of females had elevated SF and 37% of males and 3% of females had SF >1000 microg/L. For males with SF 300-1000 microg/L at baseline, the predicted probability of progressing to SF >1000 microg/L at follow-up was between 13% and 35% and, for females, between 16% and 22%. For C282Y homozygotes with normal baseline SF, 1000 microg/L if left untreated. The majority of C282Y homozygotes who are likely to develop SF levels sufficient to place them at risk of iron overload-related disease will have done so by mean age 55 years. TS >95% at mean age 55 years in males increases the likelihood that SF levels will be elevated at mean age 65 years, but this effect is absent in females, most likely because of physiologic blood loss associated with menstruation.

HFE gene mutations and iron status of Brazilian blood donors.

Science.gov (United States)

Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M

2010-01-01

Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

HFE gene mutations and iron status of Brazilian blood donors

Directory of Open Access Journals (Sweden)

P.C.J.L. Santos

2010-01-01

Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

Study of the effect of HFE gene mutations on iron overload in ...

African Journals Online (AJOL)

Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

The association between the C282Y and H63D polymorphisms of HFE gene and the risk of Parkinson's disease: A meta-analysis.

Science.gov (United States)

Xia, Jianjian; Xu, Huamin; Jiang, Hong; Xie, Junxia

2015-05-19

Impaired brain iron homeostasis has been considered as an important mechanism in Parkinson's diseases (PD). There are indications that C282Y and H63D polymorphisms of HFE genes involved in iron metabolism might contribute to the pathogenesis of PD in some cases. However, the investigation of the relationship between PD and the two polymorphisms had produced contradictory results. We performed a meta-analysis to assess the C282Y and H63D polymorphisms of HFE in PD susceptibility. PubMed, EMBASE and Web of Science were systematically searched to identify relevant researches. The strict selection criteria and exclusion standard were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed-effect or random-effect model was selected, depending on the results of the heterogeneity test. Fifteen studies were included in the meta-analysis (eight studies with 1631 cases and 4548 controls for C282Y; seven studies with 1192 cases and 4065 controls for H63D). For the C282Y polymorphism, significant associations were observed in the Recessive model (YY vs CY+CC: OR=0.22, 95% CI=0.09-0.57, P=0.002). This indicated that the C282Y polymorphism in HFE might be a potential protective factor for PD. However, no significant associations were found for any genetic model for the H63D polymorphism, suggesting that the H63D polymorphism might not be associated with PD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

Science.gov (United States)

Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

2015-05-01

Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

Clinical penetrance in hereditary hemochromatosis: estimates of the cumulative incidence of severe liver disease among HFE C282Y homozygotes.

Science.gov (United States)

Grosse, Scott D; Gurrin, Lyle C; Bertalli, Nadine A; Allen, Katrina J

2018-04-01

Iron overload (hemochromatosis) can cause serious, symptomatic disease that is preventable if detected early and managed appropriately. The leading cause of hemochromatosis in populations of predominantly European ancestry is homozygosity of the C282Y variant in the HFE gene. Screening of adults for iron overload or associated genotypes is controversial, largely because of a belief that severe phenotypes are uncommon, although cascade testing of first-degree relatives of patients is widely endorsed. We contend that severe liver disease (cirrhosis or hepatocellular cancer) is not at all uncommon among older males with hereditary hemochromatosis. Our review of the published data from a variety of empirical sources indicates that roughly 1 in 10 male HFE C282Y homozygotes is likely to develop severe liver disease during his lifetime unless iron overload is detected early and treated. New evidence from a randomized controlled trial of treatment allows for evidence-based management of presymptomatic patients. Although population screening for HFE C282Y homozygosity faces multiple barriers, a potentially effective strategy for increasing the early detection and prevention of clinical iron overload and severe disease is to include HFE C282Y homozygosity in lists of medically actionable gene variants when reporting the results of genome or exome sequencing.

Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

Science.gov (United States)

Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

2012-01-01

The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

Hemochromatosis (HFE) gene mutations and response to chloroquine in porphyria cutanea tarda.

Science.gov (United States)

Stölzel, Ulrich; Köstler, Erich; Schuppan, Detlef; Richter, Matthias; Wollina, Uwe; Doss, Manfred O; Wittekind, Christian; Tannapfel, Andrea

2003-03-01

To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine. We retrospectively analyzed a database (Excel version 2001 [Microsoft Excel, Redmond, Wash]; date range of search, 1985-1999) of chloroquine-treated patients with PCT on whether HFE mutations (C282Y and H63D) might have influenced the clinical response, urinary porphyrin excretion, liver enzyme activities, and serum iron markers. Serum samples and corresponding complete sets of data before and after therapy were available in 62 of 207 patients with PCT who were treated exclusively with chloroquine. Academic teaching hospital. For treatment, low-dose chloroquine diphosphate, 125 to 250 mg twice weekly, was used during a median time of 16 months (range, 12-26 months). Of the 62 German patients with PCT, 37 (60%) carries HFE mutations. Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P<.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%). Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type. All patients homozygous for the C282Y mutation (3 [5%] of 62) had high serum iron, ferritin, and transferrin saturation and failed to respond to chloroquine treatment. The therapeutic response to chloroquine was not compromised by C282Y heterozygosity and compound heterozygosity of HFE mutations. Because HFE C282Y homozygotes (+/+) did not respond to chloroquine and a decrease in serum iron concentration was limited to patients with PCT and HFE wild type, phlebotomy should be first-line therapy in patients with PCT and HFE mutations.

HFE Cys282Tyr homozygotes with serum ferritin concentrations below 1000 microg/L are at low risk of hemochromatosis.

Science.gov (United States)

Allen, Katrina J; Bertalli, Nadine A; Osborne, Nicholas J; Constantine, Clare C; Delatycki, Martin B; Nisselle, Amy E; Nicoll, Amanda J; Gertig, Dorota M; McLaren, Christine E; Giles, Graham G; Hopper, John L; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Gurrin, Lyle C

2010-09-01

Hemochromatosis gene (HFE)-associated hereditary hemochromatosis (HH) is a genetic predisposition to iron overload and subsequent signs and symptoms of disease that potentially affects approximately 80,000 persons in Australia and almost 1 million persons in the United States. Most clinical cases are homozygous for the Cys282Tyr (C282Y) mutation in the HFE gene, with serum ferritin (SF) concentration >1000 microg/L as the strongest predictor of cirrhosis. The optimal treatment regimen for those with SF concentrations above the normal range but aged 40-69 years. An HFE-stratified random sample of 1438 participants including all C282Y homozygotes with iron studies 12 years apart were examined by physicians blinded to participants' HFE genotype. All previously undiagnosed C282Y homozygotes (35 male, 67 female) and all HFE wild-types (131 male, 160 female) with baseline and follow-up SF concentrations age when disease would be expected to have developed. These observations have implications for the management of C282Y homozygotes.

HFE gene mutation and iron overload in Egyptian pediatric acute lymphoblastic leukemia survivors: a single-center study.

Science.gov (United States)

El-Rashedi, Farida H; El-Hawy, Mahmoud A; El-Hefnawy, Sally M; Mohammed, Mona M

2017-08-01

Hereditary hemochromatosis gene (HFE) mutations have a role in iron overload in pediatric acute lymphoblastic leukemia (ALL) survivors. We aimed to evaluate the genotype frequency and allelic distribution of the two HFE gene mutations (C282Y and H63D) in a sample of Egyptian pediatric ALL survivors and to detect the impact of these two mutations on their iron profile. This study was performed on 35 ALL survivors during their follow-up visits to the Hematology and Oncology Unit, Pediatric Department, Menoufia University Hospitals. Thirty-five healthy children of matched age and sex were chosen as controls. After completing treatment course, ALL survivors were screened for the prevalence of these two mutations by polymerase chain reaction-restriction fragment length polymorphism. Serum ferritin levels were measured by an enzyme-linked immunosorbent assay technique (ELISA). C282Y mutation cannot be detected in any of the 35 survivors or the 35 controls. The H63D heterozygous state (CG) was detected in 28.6% of the survivors group and in 20% of controls, while the H63D homozygous (GG) state was detected in 17.1% of survivors. No compound heterozygosity (C282Y/H63D) was detected at both groups with high G allele frequency (31.4%) in survivors more than controls (10%). There were significant higher levels of iron parameters in homozygote survivors than heterozygotes and the controls. H63D mutation aggravates the iron overload status in pediatric ALL survivors.

Rare HFE variants are the most frequent cause of hemochromatosis in non-c282y homozygous patients with hemochromatosis.

Science.gov (United States)

Hamdi-Rozé, Houda; Beaumont-Epinette, Marie-Pascale; Ben Ali, Zeineb; Le Lan, Caroline; Loustaud-Ratti, Véronique; Causse, Xavier; Loreal, Olivier; Deugnier, Yves; Brissot, Pierre; Jouanolle, Anne-Marie; Bardou-Jacquet, Edouard

2016-12-01

p.Cys282Tyr (C282Y) homozygosity explains most cases of HFE-related hemochromatosis, but a significant number of patients presenting with typical type I hemochromatosis phenotype remain unexplained. We sought to describe the clinical relevance of rare HFE variants in non-C282Y homozygotes. Patients referred for hemochromatosis to the National Reference Centre for Rare Iron Overload Diseases from 2004 to 2010 were studied. Sequencing was performed for coding region and intronic flanking sequences of HFE, HAMP, HFE2, TFR2, and SLC40A1. Nine private HFE variants were identified in 13 of 206 unrelated patients. Among those, five have not been previously described: p.Leu270Argfs*4, p.Ala271Valfs*25, p.Tyr52*, p.Lys166Asn, and p.Asp141Tyr. Our results show that rare HFE variants are identified more frequently than variants in the other genes associated with iron overload. Rare HFE variants are therefore the most frequent cause of hemochromatosis in non-C282Y homozygote HFE patients. Am. J. Hematol. 91:1202-1205, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin.

Science.gov (United States)

Coelho-Borges, Silvia; Cheinquer, Hugo; Wolff, Fernando Herz; Cheinquer, Nelson; Krug, Luciano; Ashton-Prolla, Patricia

2012-01-01

Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2) and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week) and ribavirin (1.000 mg, daily) for 24 weeks. Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis) and BclI (H63D mutation analysis) in 16 (37%) patients, all heterozygous (11 H63D, 2 C282Y and 3 both). Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41%) of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test). Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

Effect of C282Y genotype on self-reported musculoskeletal complications in hereditary hemochromatosis.

Science.gov (United States)

Camacho, António; Funck-Brentano, Thomas; Simão, Márcio; Cancela, Leonor; Ottaviani, Sébastien; Cohen-Solal, Martine; Richette, Pascal

2015-01-01

Arthropathy that mimics osteoarthritis (OA) and osteoporosis (OP) is considered a complication of hereditary hemochromatosis (HH). We have limited data comparing OA and OP prevalence among HH patients with different hemochromatosis type 1 (HFE) genotypes. We investigated the prevalence of OA and OP in patients with HH by C282Y homozygosity and compound heterozygosity (C282Y/H63D) genotype. A total of 306 patients with HH completed a questionnaire. Clinical and demographic characteristics and presence of OA, OP and related complications were compared by genotype, adjusting for age, sex, body mass index (BMI), current smoking and menopausal status. In total, 266 of the 306 patients (87%) were homozygous for C282Y, and 40 (13%) were compound heterozygous. The 2 groups did not differ by median age [60 (interquartile range [IQR] 53 to 68) vs. 61 (55 to 67) years, P=0.8], sex (female: 48.8% vs. 37.5%, P=0.18) or current smoking habits (12.4% vs. 10%, P=0.3). As compared with compound heterozygous patients, C282Y homozygous patients had higher median serum ferritin concentration at diagnosis [1090 (IQR 610 to 2210) vs. 603 (362 to 950) µg/L, P<0.001], higher median transferrin saturation [80% (IQR 66 to 91%) vs. 63% (55 to 72%), P<0.001]) and lower median BMI [24.8 (22.1 to 26.9) vs. 26.2 (23.5 to 30.3) kg/m2, P<0.003]. The overall prevalence of self-reported OA was significantly higher with C282Y homozygosity than compound heterozygosity (53.4% vs. 32.5%; adjusted odds ratio [aOR] 2.4 [95% confidence interval 1.2-5.0]), as was self-reported OP (25.6% vs. 7.5%; aOR 3.5 [1.1-12.1]). Patients with C282Y homozygosity may be at increased risk of musculoskeletal complications of HH.

Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin

Directory of Open Access Journals (Sweden)

Silvia Coelho-Borges

2012-03-01

Full Text Available CONTEXT: Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. OBJECTIVE: To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. METHODS: A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2 and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week and ribavirin (1.000 mg, daily for 24 weeks. RESULTS: Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis and BclI (H63D mutation analysis in 16 (37% patients, all heterozygous (11 H63D, 2 C282Y and 3 both. Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41% of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test. CONCLUSION: Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

Association Studies of HFE C282Y and H63D Variants with Oral Cancer Risk and Iron Homeostasis Among Whites and Blacks

Directory of Open Access Journals (Sweden)

Nathan R. Jones

2015-12-01

Full Text Available Background: Polymorphisms in the hemochromatosis (HFE gene are associated with excessive iron absorption from the diet, and pro-oxidant effects of iron accumulation are thought to be a risk factor for several types of cancer. Methods: The C282Y (rs1800562 and H63D (rs1799945 polymorphisms were genotyped in 301 oral cancer cases and 437 controls and analyzed in relation to oral cancer risk, and serum iron biomarker levels from a subset of 130 subjects. Results: Individuals with the C282Y allele had lower total iron binding capacity (TIBC (321.2 ± 37.2 µg/dL vs. 397.7 ± 89.0 µg/dL, p = 0.007 and higher percent transferrin saturation (22.0 ± 8.7 vs. 35.6 ± 22.9, p = 0.023 than wild type individuals. Iron and ferritin levels approached significantly higher levels for the C282Y allele (p = 0.0632 and p = 0.0588, respectively. Conclusions: Iron biomarker levels were elevated by the C282Y allele, but neither (rs1800562 nor (rs1799945 was associated with oral cancer risk in blacks and whites.

HFE C282Y and H63D in adults with malignancies in a community medical oncology practice

International Nuclear Information System (INIS)

Barton, James C; Bertoli, Luigi F; Acton, Ronald T

2004-01-01

We sought to compare frequencies of HFE C282Y and H63D alleles and associated odds ratios (OR) in 100 consecutive unrelated white adults with malignancy to those in 318 controls. Data from patients with more than one malignancy were analyzed according to each primary malignancy. For the present study, OR ≥2.0 or ≤0.5 was defined to be increased or decreased, respectively. There were 110 primary malignancies (52 hematologic neoplasms, 58 carcinomas) in the 100 adult patients. Allele frequencies were similar in patients and controls (C282Y: 0.0850 vs. 0.0896, respectively (OR = 0.9); H63D: 0.1400 vs. 0.1447, respectively (OR = 0.9)). Two patients had hemochromatosis and C282Y homozygosity. With C282Y, increased OR occurred in non-Hodgkin lymphoma, myeloproliferative disorders, and adenocarcinoma of prostate (2.0, 2.8, and 3.4, respectively); OR was decreased in myelodysplasia (0.4). With H63D, increased OR occurred in myeloproliferative disorders and adenocarcinomas of breast and prostate (2.4, 2.0, and 2.0, respectively); OR was decreased in non-Hodgkin lymphoma and B-chronic lymphocytic leukemia (0.5 and 0.4, respectively). In 100 consecutive adults with malignancy evaluated in a community medical oncology practice, frequencies of HFE C282Y or H63D were similar to those in the general population. This suggests that C282Y or H63D is not associated with an overall increase in cancer risk. However, odds ratios computed in the present study suggest that increased (or decreased) risk for developing specific types of malignancy may be associated with the inheritance of HFE C282Y or H63D. Study of more patients with these specific types of malignancies is needed to determine if trends described herein would remain and yield significant differences

HFE C282Y/H63D compound heterozygotes are at low risk of hemochromatosis-related morbidity.

Science.gov (United States)

Gurrin, Lyle C; Bertalli, Nadine A; Dalton, Gregory W; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Nicoll, Amanda J; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J

2009-07-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, completed questionnaires and gave blood. Clinical examinations were blinded to HFE genotype. A total of 180 (84 males) clinically examined C282Y/H63D participants were compared with 330 (149 males) controls with neither HFE mutation; 132 (65 males) and 270 (122 males), respectively, had serum iron measures at both timepoints. Mean serum ferritin (SF) and transferrin saturation (TS) were significantly greater for male and female compound heterozygotes than for wild-types at baseline and follow-up (all P females who were premenopausal at baseline, where SF was similar in both genotype groups. For subjects with serum measures from both baseline and follow-up, mean SF and TS levels did not change significantly for men or for postmenopausal women, but for premenopausal women SF levels increased from 43 to 109 microg/L for compound heterozygotes and from 35 to 64 microg/L for wild-types (both P female compound heterozygotes had a similar prevalence of hemochromatosis-related morbidity to wild-types. One of 82 males and zero of 95 females had documented iron overload-related disease. For male compound heterozygotes, mean iron indices do not change during middle age but for female compound heterozygotes menopause results in increased mean SF. Although compound heterozygotes might maintain elevated iron indices during middle age, documented iron overload-related disease is rare.

Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

Science.gov (United States)

Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

2011-06-01

Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for

Hemocromatosis gene (HFE) mutations in patients with type 2 diabetes and their control group in an Iranian population

International Nuclear Information System (INIS)

Sharifi, F.; Esmaeilzadeh, A.; Zali, M.

2008-01-01

Objective was to assess the frequency of 2 different forms of hemochromatosis HFE gene mutations c282y and H63D mutations in a normal population in comparison with type 2 diabetic patients. This case control study was undertaken in Zanjan Diabetic Care Center, Zanjan, western Tehran, in 2005. Two hundred and two individuals were included in this study: 101 type 2 diabetes mellitus T2DM patients and 101 age and gender-matched controls. The patients were examined for mutations in the HFE gene. Nucleotide 845 C282Y and 187 H63D alleles were amplified by polymerase chain reaction PCR with lymphocyte deoxyribonucleic acid. The PCR products were analyzed by restriction enzyme digestion. Chi-square students test and Fisher's exact tests were used for comparison and odds ratio was calculated. Two hundred and two individuals were studied. The frequency of wild /C28Y alleles was 68.3/31.7% in diabetics p=0.08 and 73.4/26.3% in control subjects p=0.08. The distribution of genotypes was not statistically different. Based on our data, HFE mutations were not found in excess in patients with T2DM and there was no evidence that a population-based search for an excess of these alleles in type 2 diabetes was indicated. (author)

Association of mutations in the hemochromatosis gene with shorter life expectancy

DEFF Research Database (Denmark)

Bathum, L; Christiansen, L; Nybo, H

2001-01-01

BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

Precipitating factors of porphyria cutanea tarda in Brazil with emphasis on hemochromatosis gene (HFE) mutations. Study of 60 patients.

Science.gov (United States)

Vieira, Fatima Mendonça Jorge; Nakhle, Maria Cristina; Abrantes-Lemos, Clarice Pires; Cançado, Eduardo Luiz Rachid; Reis, Vitor Manoel Silva dos

2013-01-01

Porphyria cutanea tarda is the most common form of porphyria, characterized by the decreased activity of the uroporphyrinogen decarboxylase enzyme. Several reports associated HFE gene mutations of hereditary hemochromatosis with porphyria cutanea tarda worldwide, although up to date only one study has been conducted in Brazil. Investigation of porphyria cutanea tarda association with C282Y and H63D mutations in the HFE gene. Identification of precipitating factors (hepatitis C, HIV, alcoholism and estrogen) and their link with HFE mutations. An ambispective study of 60 patients with PCT was conducted during the period from 2003 to 2012. Serological tests for hepatitis C and HIV were performed and histories of alcohol abuse and estrogen intake were investigated. HFE mutations were identified with real-time PCR. Porphyria cutanea tarda predominated in males and alcohol abuse was the main precipitating factor. Estrogen intake was the sole precipitating factor present in 25% of female patients. Hepatitis C was present in 41.7%. All HIV-positive patients (15.3%) had a history of alcohol abuse. Allele frequency for HFE mutations, i.e., C282Y (p = 0.0001) and H63D (p = 0.0004), were significantly higher in porphyria cutanea tarda patients, compared to control group. HFE mutations had no association with the other precipitating factors. Alcohol abuse, hepatitis C and estrogen intake are prevalent precipitating factors in our porphyria cutanea tarda population; however, hemochromatosis in itself can also contribute to the outbreak of porphyria cutanea tarda, which makes the research for HFE mutations necessary in these patients.

Mutaciones del gen de la Hemocromatosis en donantes de sangre voluntarios y en pacientes con Porfiria cutánea tarda en Chile Mutations of hemochromatosis gene in volunteer blood donors and Chilean porphyria cutanea tarda patients

Directory of Open Access Journals (Sweden)

Carlos Wolff F

2006-10-01

Full Text Available La acumulación de hierro hepático asociada a mutaciones en el gen HFE de la hemocromatosis hereditaria (HH en los pacientes con porfiria cutánea tarda (PCT podría tener un papel en la etiología y en la expresión clínica de esta enfermedad. Se estudió la frecuencia de las mutaciones H63D y C282Y en un grupo de pacientes con PCT y se la comparó con la observada en un grupo de donantes voluntarios de sangre. Los pacientes con PCT fueron catalogados como portadores de la forma hereditaria o adquirida de la enfermedad, según presentaran o no mutaciones en el gen uroporfirinógeno decarboxilasa (UROD. El 50% de los pacientes con PCT eran portadores de la forma genética de la enfermedad, porcentaje significativamente mayor que lo informado en otras series. El 23% de los donantes voluntarios de sangre eran portadores de la mutación H63D y 2.4% lo era de la mutación C282Y. Frecuencias similares a lo encontrado por otros autores en población chilena de etnia blanca, en población argentina y española, pero significativamente más alta que lo encontrado en estudios en población aborigen araucana. Esto tiene, probablemente, relación con el predominio de ascendencia española en la población blanca chilena. La frecuencia de mutación en el gen HFE en pacientes con PCT no fue significativamente diferente que la observada en donantes voluntarios de sangre. Tampoco hubo diferencias significativas en la frecuencia de estas mutaciones entre los casos con PCT adquirida respecto de aquellos en que ésta era de origen genético. Los resultados obtenidos no permiten afirmar que exista asociación entre la PCT y la condición de portador de mutaciones del gen HFE de la hemocromatosis hereditaria.In patients with porphyria cutanea tarda (PCT, hepatic iron accumulation associated to hereditary hemochromatosis (HH could play a role in the etiology and in the clinical expression of the disease. The H63D and C282Y mutations of the HFE gene frequency were

HFE C282Y/H63D Compound Heterozygotes Are at Low Risk of Hemochromatosis-Related Morbidity

OpenAIRE

Gurrin, Lyle C.; Bertalli, Nadine A.; Dalton, Gregory W.; Osborne, Nicholas J.; Constantine, Clare C.; McLaren, Christine E.; English, Dallas R.; Gertig, Dorota M.; Delatycki, Martin B.; Nicoll, Amanda J.; Southey, Melissa C.; Hopper, John L.; Giles, Graham G.; Anderson, Gregory J.; Olynyk, John K.

2009-01-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, complete...

Decreased iron burden in overweight C282Y homozygous women: Putative role of increased hepcidin production.

Science.gov (United States)

Desgrippes, Romain; Lainé, Fabrice; Morcet, Jeff; Perrin, Michèle; Manet, Ghislain; Jezequel, Caroline; Bardou-Jacquet, Edouard; Ropert, Martine; Deugnier, Yves

2013-05-01

An excess of visceral adipose tissue could be involved as a modulator of the penetrance of HFE hemochromatosis since fat mass is associated with overexpression of hepcidin and low transferrin saturation was found to be associated with being overweight in women. This study was aimed at assessing the relationship between body mass index (BMI), a surrogate marker of insulin resistance, and iron burden in HFE hemochromatosis. In all, 877 patients from a cohort of C282Y homozygotes were included in the study when BMI at diagnosis and amount of iron removed (AIR) by phlebotomy were available. No relationship between AIR and BMI was found in men, whereas 15.1% (52/345) of women with AIR lean (7.9 mmoL/L ± 4.3) women (P = 0.0005). In C282Y homozygous women, BMI ≥28 kg/m(2) is independently associated with a lower amount of iron removed by phlebotomy. BMI is likely a modulator factor of the phenotypic expression of C282Y homozygosity, likely through an increase of circulating levels of hepcidin. Copyright © 2013 American Association for the Study of Liver Diseases.

White blood cells and subtypes in HFE p.C282Y and wild-type homozygotes in the Hemochromatosis and Iron Overload Screening Study.

Science.gov (United States)

Barton, James C; Barton, J Clayborn; Acton, Ronald T

2017-03-01

The major histocompatibility complex is linked to white blood cell (WBC) and lymphocyte counts in subjects unselected for HFE genotypes. We compared age, sex, body mass index, total WBC and subtypes (neutrophils, lymphocytes, monocytes, eosinophils, basophils) (Beckman Coulter® Gen-S), transferrin saturation, and serum ferritin of HFE p.C282Y and wild-type (p.C282Y, p.H63D negative) homozygotes without acquired conditions that influence WBC counts. We performed regressions on WBC and subtypes. There were 161 p.C282Y homozygotes (45.3% men) and 221 wild-type homozygotes (40.3% men). Mean WBC of men and women and between HFE genotypes were similar. Mean lymphocytes were higher in male p.C282Y homozygotes: 1.6×10 9 /L [95% confidence interval: 1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002. Mean lymphocytes and basophils were higher in female p.C282Y homozygotes: 1.6 [1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002; and 0.065 [0.059,0.071] vs. 0.052 [0.051,0.054], p=0.0001, respectively. Transferrin saturation was associated with neutrophils (negative; p=0.0163). Age was associated with lymphocytes (negative; p=0.0003) and monocytes (positive; p<0.0001). Regressions on lymphocytes and basophils revealed positive associations with p.C282Y homozygosity (p=0.0043 and 0.0003, respectively). There were significant positive associations of neutrophils, lymphocytes, monocytes, and eosinophils. We conclude that HFE p.C282Y homozygosity is significantly associated with lymphocyte and basophil counts. Copyright © 2016 Elsevier Inc. All rights reserved.

HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?

Science.gov (United States)

Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M

2010-12-15

Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

Science.gov (United States)

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

LYU Tingxia

2016-08-01

Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

Predicting C282Y Homozygote Genotype for Hemochromatosis Using Serum Ferritin and Transferrin Saturation Values from 44,809 Participants of the HEIRS Study

Directory of Open Access Journals (Sweden)

Andrew Lim

2014-01-01

Full Text Available INTRODUCTION: The simultaneous interpretation of serum ferritin level and transferrin saturation has been used as a clinical guide to diagnose genetic hemochromatosis. The Hemochromatosis and Iron Overload Screening (HEIRS Study screened 101,168 North American participants for serum ferritin level and transferrin saturation, and C282Y genotyping for the HFE gene.

A novel mutation (C1425Y) in the FBN2 gene in a father and son with congenital contractural arachnodactyly.

Science.gov (United States)

Chen, Ying; Lei, Yun-Ping; Zheng, Hong-Xiang; Wang, Wei; Cheng, Hong-Bo; Zhang, Jing; Wang, Hong-Yan; Jin, Li; Li, Hong

2009-06-01

Congenital contractural arachnodactyly (Beals syndrome) is a rare autosomal dominantly inherited connective tissue disorder characterized by flexion contractures, arachnodactyly, crumpled ears, and mild muscular hypoplasia. Here, a father and son with congenital contractural arachnodactyly features were identified. After sequencing 15 exons (22 to 36) of the FBN2 gene, a novel mutation (C1425Y) was found in exon 33. This de novo mutation presented first in the father and was transmitted to his son, but not in the other 14 unaffected family members and 365 normal people. The C1425Y mutation occurs at the 19th cbEGF domain. Cysteines in this cbEGF domain are rather conserved in species, from human down to ascidian. The cbEGF12-13 in human FBN1 was employed as the template to perform homology modeling of cbEGF18-19 of human FBN2 protein. The mutation has also been evaluated by further prediction tools, for example, SIFT, Blosum62, biochemical Yu's matrice, and UMD-Predictor tool. In all analysis, the mutation is predicted to be pathogenic. Thus, the structure destabilization by C1425Y might be the cause of the disorder.

Prevalence of the N-Acetyltransferase (NAT2 gene polymorphism 282C>T in Peruvian population and health implications

Directory of Open Access Journals (Sweden)

Salazar-Granara Alberto

2016-03-01

Full Text Available Objective: To determine the frequency of the C282T polymorphism of the NAT2 gene (N acetyltransferase in Peruvian populations. Field work, focused on exploring genetic risk factor in Peruvian populations, which has influence in the response to drugs and malignancies aetiology. Material and Methods: Cross-sectional study. 166 voluntaries from Lima, Lambayeque, Apurimac, Puno, San Martin, Amazonas and Loreto were enrolled. The sampling was done by convenience and it was use the RFLP-PCR conventional technique was used. Results: The allele frequency were 54% (n=126 for C282 and 46% (n=106 for T282. For the T allele, by its orign , stand out 2 those which origins were Lima 42% (n=25, Amazonas 47% (n=16, San Martin 74% (n=28 and Apurimac 50% (n=13 (X , p>0.05. A global genotype frequency were 26.7% (n=31 for C282/C282, 56.0% (n=65 for C282/T282 and 17.2% (n=20 for T282/T282 (Hardy Weinberg Test p>0.05. By origin, Puno presented allelic imbalance (Hardy Weinberg test p0.05. Conclusion: The overall frequency of NAT2 allele T282 was 46%; San Martin had the highest prevalence (74%. The T282 allele is linked to neoplastic diseases and adverse reactions to anti-TB drugs, these results will be used for the application of pharmacogenetics in Peru

[Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

Science.gov (United States)

He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

2015-11-01

To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

Porfiria cutánea tarda: asociación con mutaciones HFE, hepatitis virales, alcohol y otros factores de riesgo en Guipúzcoa, País Vasco Porphyria cutanea tarda: An analysis of HFE gene mutations, hepatitis viruses, alcohol intake, and other risk factors in 54 patients from Guipúzcoa, Basque Country, Spain

Directory of Open Access Journals (Sweden)

A. Castiella

2008-12-01

Full Text Available Objetivo: estudiar la frecuencia de las mutaciones en el gen HFE (C282Y, H63D, S65C en un grupo de 54 pacientes con porfiria cutánea tarda (PCT y en un grupo de controles sanos (donantes de sangre en Guipúzcoa. También analizar su relación con los virus de la hepatitis B y C (VHB, VHC, alcohol y otros factores de riesgo reconocidos. Métodos: el análisis de las mutaciones se hizo mediante PCR. Se compararon las frecuencias alélicas y genotípicas. Se determinaron la probabilidad y el test de Chi cuadrado. Resultados: no encontramos asociación entre C282Y y PCT (5,76 vs. 5% controles. Se observó una alta frecuencia alélica en la mutación H63D en PCT (34,25%, pero sin ser estadísticamente significativa (controles 29,31%, debido a la alta prevalencia de esta mutación en la población vasca. La mutación S65C fue menor en PCT que en controles. Encontramos una idéntica presencia de H63D en heterocigosis en ambos grupos (38,8 vs. 38,8%. La asociación con el VHC se objetivó en el 35,18% de los pacientes y la infección por VHB en el 7,4%. Un 55,55% de los pacientes tenía un hábito alcohólico de más de 60 g etanol día. Todos eran negativos para el virus de la inmunodeficiencia humana (VIH y 1 de las 5 mujeres con PCT tomaba estrógenos. Conclusión: las mutaciones C282Y y H63D no tienen un papel relevante en los pacientes con PCT en Guipúzcoa. Los factores externos (consumo importante de alcohol y VHC parecen jugar un papel fundamental en el desarrollo de la PCT en nuestra población.Aim: to study the frequency of HFE gene mutations (C282Y, H63D, S65C in a group of 54 sporadic PCT patients and in a group of healthy controls (blood donors from Guipúzcoa, Spain. We studied the association of PCT with HCV, HBV, alcohol abuse, and other established risk factors. Methods: the analysis of mutations was made by PCR. Allelic and genotypic frequencies were compared. Probability was determined and a Chi-squared test was performed. Results

Correlation between HFE gene polymorphisms and increased risk of coronary artery disease among patients with type 2 diabetes in Iran.

Science.gov (United States)

Saremi, Leila; Saremi, Marzieh; Lotfipanah, Shirin; İmani, Saber; Fu, Junjiang; Zhang, Tianyu

2016-04-19

Diabetes mellitus is a risk factor for cardiovascular diseases (CVDs), which are among the major causes of deaths in type 2 diabetes (T2D). The purpose of the present study was to determine the association of C282Y and H63D mutations in the HFE gene with increased risk of coronary artery disease (CAD) in T2D patients. Two hundred and ninety individuals were divided into two groups: a case group and a control group. Genomic DNA of peripheral venous blood cells was extracted and the HFE gene mutations were analyzed using the PCR-RFLP technique. Data analysis revealed a significant difference between the allele frequencies of H63D and C282Y mutations between the case group and the controls (P 0.05). Using a logistic regression model, BMI, FBS, HDL, and total cholesterol levels were significantly different with independent predictors of CVD (P < 0.05). Our results revealed a significant correlation between C282Y and H63D mutations and the development of CAD in T2D patients.

H63D mutation in HFE gene is common in Indians and is associated ...

Indian Academy of Sciences (India)

HH affects predominantly people of northern European origin and is often ... mutation with the C282Y mutation is a known risk factor for iron overload ... or has low allele frequencies in non-Caucasian populations,. i.e. African ... who were ascertained through self-reported questionnaire. ... confidence limits of the D statistic.

АЛЛЕЛИ 282Y И H63D ГЕНА HFE И ПРЕДРАСПОЛОЖЕННОСТЬ К СИНДРОМУ ХРОНИЧЕСКОЙ ПЕРЕГРУЗКИ ЖЕЛЕЗОМ И НАРУШЕНИЮ ПОРФИРИНОВОГО ОБМЕНА ПРИ НЕАЛКОГОЛЬНОЙ ЖИРОВОЙ БОЛЕЗНИ ПЕЧЕНИ

Directory of Open Access Journals (Sweden)

А. Б. Кривошеев

2012-01-01

Full Text Available Testing for carriers of mutations C282Y and H63D HFE gene in 57 patients with nonalcoholic fatty liver disease was completed. Abnormalities in the metabolism of porphyrins were detected in 39 (68.4% patients, mutations C282Y and H63D were detected in 16 (28.1% patients, of whom 12 patients with metabolic disorders of porphyrins and symptoms of the syndrome of chronic iron overload. In 41 (71.9% patients without the mutations found disorders metabolism of porphyrins were in 27 (65.8% patients. They had no symptoms of the syndrome of chronic iron overload. Detection of C282Y and H63D mutations in the gene HFE in conjunction with disorders of porphyrin metabolism in association with the syndrome of chronic iron overload, but the probability will consider these patients as candidates for inclusion in the higher risk of formation of liver fibrosis.

Mutation Spectrum and Phenotypic Features in Noonan Syndrome with PTPN11 Mutations: Definition of Two Novel Mutations.

Science.gov (United States)

Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda

2016-06-01

To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.

Sample-to-SNP kit: a reliable, easy and fast tool for the detection of HFE p.H63D and p.C282Y variations associated to hereditary hemochromatosis.

Science.gov (United States)

Nielsen, Peter B; Petersen, Maja S; Ystaas, Viviana; Andersen, Rolf V; Hansen, Karin M; Blaabjerg, Vibeke; Refstrup, Mette

2012-10-01

Classical hereditary hemochromatosis involves the HFE-gene and diagnostic analysis of the DNA variants HFE p.C282Y (c.845G>A; rs1800562) and HFE p.H63D (c.187C>G; rs1799945). The affected protein alters the iron homeostasis resulting in iron overload in various tissues. The aim of this study was to validate the TaqMan-based Sample-to-SNP protocol for the analysis of the HFE-p.C282Y and p.H63D variants with regard to accuracy, usefulness and reproducibility compared to an existing SNP protocol. The Sample-to-SNP protocol uses an approach where the DNA template is made accessible from a cell lysate followed by TaqMan analysis. Besides the HFE-SNPs other eight SNPs were used as well. These SNPs were: Coagulation factor II-gene F2 c.20210G>A, Coagulation factor V-gene F5 p.R506Q (c.1517G>A; rs121917732), Mitochondria SNP: mt7028 G>A, Mitochondria SNP: mt12308 A>G, Proprotein convertase subtilisin/kexin type 9-gene PCSK9 p.R46L (c.137G>T), Plutathione S-transferase pi 1-gene GSTP1 p.I105V (c313A>G; rs1695), LXR g.-171 A>G, ZNF202 g.-118 G>T. In conclusion the Sample-to-SNP kit proved to be an accurate, reliable, robust, easy to use and rapid TaqMan-based SNP detection protocol, which could be quickly implemented in a routine diagnostic or research facility. Copyright © 2012. Published by Elsevier B.V.

HFE mutations and hemochromatosis in Danish patients admitted for HFE genotyping

DEFF Research Database (Denmark)

Koefoed, P; Dalhoff, K; Dissing, J

2002-01-01

Analysis of the common C282Y and H63D mutations in the HFE gene is widely used to diagnose hereditary hemochromatosis (HH). The aim of this study was to evaluate the efficiency with which different hospitals and general practitioners select patients for HH genotype and to determine the distribution...... of HFE mutations in such patients. Nine hundred unrelated patients from Danish hospitals and general practitioners (group A) and 69 consecutive patients from a specialized liver unit (group B) were examined for HFE substitutions using multiplex real-time polymerase chain reaction. In group A we found 13...... in the H63D homozygotes or S65C heterozygotes. Moreover, 7 wild-type patients, 2 C282Y heterozygote patients and one H63D heterozygote patient fulfilled the criteria for HH. The significant enrichment of HH among associated genotype samples submitted for HFE testing indicates that the clinical selection...

Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls

Science.gov (United States)

Yin, Wei-Li; Wang, Feng-Mei; Han, Tao

2016-01-01

Background Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D) of human HFE (hereditary hemochromatosis) gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD), liver cirrhosis and hepatocellular carcinoma (HCC). Methods An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis. Results In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, PassociationHFE C282Y and H63D (all Passociation>0.05). In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, PassociationHFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion. PMID:27657935

An extensive analysis of the hereditary hemochromatosis gene HFE and neighboring histone genes: associations with childhood leukemia.

Science.gov (United States)

Davis, Charronne F; Dorak, M Tevfik

2010-04-01

The most common mutation of the HFE gene C282Y has shown a risk association with childhood acute lymphoblastic leukemia (ALL) in Welsh and Scottish case-control studies. This finding has not been replicated outside Britain. Here, we present a thorough analysis of the HFE gene in a panel of HLA homozygous reference cell lines and in the original population sample from South Wales (117 childhood ALL cases and 414 newborn controls). The 21 of 24 variants analyzed were from the HFE gene region extending 52 kb from the histone gene HIST1H1C to HIST1H1T. We identified the single-nucleotide polymorphism (SNP) rs807212 as a tagging SNP for the most common HFE region haplotype, which contains wild-type alleles of all HFE variants examined. This intergenic SNP rs807212 yielded a strong male-specific protective association (per allele OR = 0.38, 95% CI = 0.22-0.64, P (trend) = 0.0002; P = 0.48 in females), which accounted for the original C282Y risk association. In the HapMap project data, rs807212 was in strong linkage disequilibrium with 25 other SNPs spanning 151 kb around HFE. Minor alleles of these 26 SNPs characterized the most common haplotype for the HFE region, which lacked all disease-associated HFE variants. The HapMap data suggested positive selection in this region even in populations where the HFE C282Y mutation is absent. These results have implications for the sex-specific associations observed in this region and suggest the inclusion of rs807212 in future studies of the HFE gene and the extended HLA class I region.

Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

Science.gov (United States)

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2012-10-15

Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

Haemochromatosis gene mutation H63D is a risk factor for iron ...

African Journals Online (AJOL)

Introduction: Iron overload is the main cause of morbidity and mortality in patients with β-thalassemia. The Aim: The aim of this study was to evaluate the prevalence of genetic markers (HFE mutations C282Y and H63D) among Egyptian β-thalassemic. Children and its effect on their iron status. Patients and Methods: 59 ...

Novel mutations in the USH1C gene in Usher syndrome patients.

Science.gov (United States)

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

2010-12-31

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls.

Directory of Open Access Journals (Sweden)

Qing Ye

Full Text Available Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D of human HFE (hereditary hemochromatosis gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD, liver cirrhosis and hepatocellular carcinoma (HCC.An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis.In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, Passociation0.05. In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, Passociation<0.05. Moreover, a positive association between compound heterozygosity for C282Y/H63D and the risk of NAFLD and HCC, but not liver cirrhosis, was observed.Our meta-analysis provides evidence that the HFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion.

HFE gene mutations in coronary atherothrombotic disease

Directory of Open Access Journals (Sweden)

Calado R.T.

2000-01-01

Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

Directory of Open Access Journals (Sweden)

Dinić Jelena

2007-01-01

Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

Derivation of induced pluripotent stem cells from a familial Alzheimer's disease patient carrying the L282F mutation in presenilin 1

DEFF Research Database (Denmark)

Poon, Anna Fong-Yee; Li, Tong; Pires, Carlota

2016-01-01

Mutations in presenilin 1 (PSEN1) lead to the most aggressive form of familial Alzheimer's disease (AD). Human induced pluripotent stem cells (hiPSCs) derived from AD patients can be differentiated and used for disease modeling. Here, we derived hiPSC from skin fibroblasts obtained from an AD...... patient carrying a L282F mutation in PSEN1. We transfected skin fibroblasts with episomal iPSC reprogramming vectors targeting human OCT4, SOX2, L-MYC, KLF4, NANOG, LIN28, and short hairpin RNA against TP53. Our hiPSC line, L282F-hiPSC, displayed typical stem cell characteristics with consistent...... expression of pluripotency genes and the ability to differentiation into the three germ layers....

Lack of evidence for the pathogenic role of iron and HFE gene mutations in Brazilian patients with nonalcoholic steatohepatitis

Directory of Open Access Journals (Sweden)

M.M. Deguti

2003-06-01

Full Text Available The hypothesis of the role of iron overload associated with HFE gene mutations in the pathogenesis of nonalcoholic steatohepatitis (NASH has been raised in recent years. In the present study, biochemical and histopathological evidence of iron overload and HFE mutations was investigated in NASH patients. Thirty-two NASH patients, 19 females (59%, average 49.2 years, 72% Caucasians, 12% Mulattoes and 12% Asians, were submitted to serum aminotransferase and iron profile determinations. Liver biopsies were analyzed for necroinflammatory activity, architectural damage and iron deposition. In 31 of the patients, C282Y and H63D mutations were tested by PCR-RFLP. Alanine aminotransferase levels were increased in 30 patients, 2.42 ± 1.12 times the upper normal limit on average. Serum iron concentration, transferrin saturation and ferritin averages were 99.4 ± 31.3 g/dl, 33.1 ± 12.7% and 219.8 ± 163.8 µg/dl, respectively, corresponding to normal values in 93.5, 68.7 and 78.1% of the patients. Hepatic siderosis was observed in three patients and was not associated with architectural damage (P = 0.53 or with necroinflammatory activity (P = 0.27. The allelic frequencies (N = 31 found were 1.6 and 14.1% for C282Y and H63D, respectively, which were compatible with those described for the local population. In conclusion, no evidence of an association of hepatic iron overload and HFE mutations with NASH was found. Brazilian NASH patients comprise a heterogeneous group with many associated conditions such as hyperinsulinism, environmental hepatotoxin exposure and drugs, but not hepatic iron overload, and their disease susceptibility could be related to genetic and environmental features other than HFE mutations.

Iron-related gene variants and brain iron in multiple sclerosis and healthy individuals

Directory of Open Access Journals (Sweden)

Jesper Hagemeier

2018-01-01

Full Text Available Brain iron homeostasis is known to be disturbed in multiple sclerosis (MS, yet little is known about the association of common gene variants linked to iron regulation and pathological tissue changes in the brain. In this study, we investigated the association of genetic determinants linked to iron regulation with deep gray matter (GM magnetic susceptibility in both healthy controls (HC and MS patients. Four hundred (400 patients with MS and 150 age- and sex-matched HCs were enrolled and obtained 3 T MRI examination. Three (3 single nucleotide polymorphisms (SNPs associated with iron regulation were genotyped: two SNPs in the human hereditary hemochromatosis protein gene HFE: rs1800562 (C282Y mutation and rs1799945 (H63D mutation, as well as the rs1049296 SNP in the transferrin gene (C2 mutation. The effects of disease and genetic status were studied using quantitative susceptibility mapping (QSM voxel-based analysis (VBA and region-of-interest (ROI analysis of the deep GM. The general linear model framework was used to compare groups. Analyses were corrected for age and sex, and adjusted for false discovery rate. We found moderate increases in susceptibility in the right putamen of participants with the C282Y (+6.1 ppb and H63D (+6.9 ppb gene variants vs. non-carriers, as well as a decrease in thalamic susceptibility of progressive MS patients with the C282Y mutation (left: −5.3 ppb, right: −6.7 ppb, p < 0.05. Female MS patients had lower susceptibility in the caudate (−6.0 ppb and putamen (left: −3.9 ppb, right: −4.6 ppb than men, but only when they had a wild-type allele (p < 0.05. Iron-gene linked increases in putamen susceptibility (in HC and relapsing remitting MS and decreases in thalamus susceptibility (in progressive MS, coupled with apparent sex interactions, indicate that brain iron in healthy and disease states may be influenced by genetic factors.

Risk of iron overload in carriers of genetic mutations associated with hereditary haemochromatosis: UK Food Standards Agency workshop.

Science.gov (United States)

Singh, Mamta; Ashwell, Margaret; Sanderson, Peter; Cade, Janet; Moreton, Jennifer; Fairweather-Tait, Susan; Roe, Mark; Marx, Joannes J M; Worwood, Mark; Cook, James D

2006-10-01

The UK Food Standards Agency convened a group of expert scientists to review current research investigating diet and carriers of genetic mutations associated with hereditary haemochromatosis. The workshop concluded that individuals who are heterozygous for the C282Y mutation of the HFE gene do not appear to respond abnormally to dietary Fe and therefore do not need to change their diet to prevent accumulation of body Fe.

Introduction of Molecular Diagnosis of Hemochromatosis Type 1 in Cuba

Directory of Open Access Journals (Sweden)

Ismael Aramís Cervera García

2013-06-01

Full Text Available Background: hemochromatosis type 1 is an autosomal recessive genetic disorder, which should be diagnosed during its preclinical phase in order to prevent severe organ damage. Objective: to establish the diagnosis of hemochromatosis type 1 in Cuba, and calculate its frequencies in patients with hepatopathies. Methods: an analytic cross-sectional study was conducted including 65 patients with liver disease, who were referred to the laboratory of Molecular Biology of the National Medical Genetics Center by clinical geneticists. A PCR-RFLP analysis was used for detecting the C282Y and H63D mutations in the HFE gene. Results: PCR-RFLP analysis was standardized for the detection of C282Y and H63D mutations. Frequencies of C282Y and H63D mutations in the HFE gene in patients with hepatopathies were 6.3% and 18.2% respectively. Conclusions: molecular diagnosis of C282Y and H63D mutations in the HFE gene causing hemochromatosis type 1 contributed to the identification of 28 carriers in the 65 patients who were studied, as well as a homozygous individual for the H63D mutation, which shows the high prevalence of these mutations in Cuban patients with liver disease.

Novel gene PUS3 c.A212G mutation in Ukrainian family with intellectual disability

Directory of Open Access Journals (Sweden)

Gulkovskyi R. V.

2015-04-01

Full Text Available Aim. To evaluate a possible role of a novel c.A212G substitution in the PUS3 gene at intellectual disability (ID. Methods. The observed group consisted of the ID Ukrainian family members (parents and two affected children and the control group – of 300 healthy individuals from general population of Ukraine. Sanger sequencing of the PUS3 gene exon 1 was performed for the family members. Polymorphic variants of c.A212G were analyzed using ARMS PCR. The homology models of wild type and p.Y71C mutant catalytic domains of human Pus3 were generated using the crystal structure of the human Pus1 catalytic domain (PDB ID: 4NZ6 as a template. Results. It was shown that the father of the affected siblings was the c.A212G substitution heterozygous carrier whereas the mother was a wild type allele homozygote, and the exom sequencing result was confirmed – the affected children are 212G homozygotes. We supposed de novo mutation in the maternal germ line. A low frequency of 212G allele (0.0017 was shown in the population of Ukraine. Homology modelling of the wild type and p.Y71C mutant catalytic domain of human Pus3 revealed that substitution p.Y71C is located in close proximity to its active site. Conclusions. The absence of hypoproteinemia in our patients, homozygous for the 212C allele allows us to assume that the mutation c.A212G PUS3 is rather neutral and cannot be the major cause of ID. However, considering a low frequency of the 212G allele in the population and close localization of p.Y71C substitution to the active site of hPus3 we cannot exclude that the c.A212G mutation in PUS3 may be a modifier for some pathologies including syndromic ID.

Dietary Iron Intake and Serum Ferritin Concentration in 213 Patients Homozygous for the HFEC282Y Hemochromatosis Mutation

Directory of Open Access Journals (Sweden)

Victor R Gordeuk

2012-01-01

Full Text Available BACKGROUND: HFEC282Y homozygotes have an increased risk for developing increased iron stores and related disorders. It is controversial whether dietary iron restrictions should be recommended to such individuals.

Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies

Directory of Open Access Journals (Sweden)

M. Li

2014-03-01

Full Text Available Iron homeostasis dysregulation has been regarded as an important mechanism in neurodegenerative diseases. The H63D and C282Y polymorphisms in the HFE gene may be involved in the development of sporadic amyotrophic lateral sclerosis (ALS through the disruption of iron homeostasis. However, studies investigating the relationship between ALS and these two polymorphisms have yielded contradictory outcomes. We performed a meta-analysis to assess the roles of the H63D and C282Y polymorphisms of HFE in ALS susceptibility. PubMed, MEDLINE, EMBASE, and Cochrane Library databases were systematically searched to identify relevant studies. Strict selection criteria and exclusion criteria were applied. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of associations. A fixed- or random-effect model was selected, depending on the results of the heterogeneity test. Fourteen studies were included in the meta-analysis (six studies with 1692 cases and 8359 controls for C282Y; 14 studies with 5849 cases and 13,710 controls for H63D. For the C282Y polymorphism, significant associations were observed in the allele model (Y vs C: OR=0.76, 95%CI=0.62-0.92, P=0.005 and the dominant model (YY+CY vs CC: OR=0.75, 95%CI=0.61-0.92, P=0.006. No associations were found for any genetic model for the H63D polymorphism. The C282Y polymorphism in HFE could be a potential protective factor for ALS in Caucasians. However, the H63D polymorphism does not appear to be associated with ALS.

Mutational landscape of the human Y chromosome-linked genes ...

Indian Academy of Sciences (India)

Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism. Deepali Pathak, Sandeep Kumar Yadav, Leena Rawal and Sher Ali. J. Genet. 94, 677–687. Table 1. Details showing age, sex, karyotype, clinical features and diagnosis results of the patients with H. Hormone profile.

Mutation of the S and 3c genes in genomes of feline coronaviruses.

Science.gov (United States)

Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

2018-05-17

Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

HFE H63D mutation frequency shows an increase in Turkish women with breast cancer

Directory of Open Access Journals (Sweden)

Guler Emine

2006-02-01

Full Text Available Abstract Background The hereditary hemochromatosis gene HFE plays a pivotal role in iron homeostasis. The association between cancer and HFE hetero- or homozygosity has previously been shown including hepatocellular and nonhepatocellular malignancies. This study was performed to compare frequencies of HFE C282Y and H63D variants in Turkish women with breast cancer and healthy controls. Methods Archived DNA samples of Hacettepe University Oncology Institute were used in this study. The HFE gene was investigated by PCR-RFLP. Results All subjects studied were free from C282Y mutation. Thirty-nine patients had H63D mutation and were all heterozygous. H63D allele frequency was 22.2% (39/176 in the breast cancer patients, and 14% (28/200 in the healthy volunteers. Statistical analysis of cases with HFE H63D phenotype showed significant difference between breast cancer and healthy volunteers (P = 0.02. Conclusion Our results suggest that HFE H63D mutation frequencies were increased in the breast cancer patients in comparison to those in the general population. Also, odds ratios (odds ratio = 2.05 computed in this study suggest that H63D has a positive association with breast cancer.

LOS GENES BRCA1 y BRCA2. ESTUDIO MOLECULAR

Directory of Open Access Journals (Sweden)

N. Alonso

2006-11-01

Full Text Available RESUMENEn los últimos años, se realizaron numerosos estudios para establecer la predisposición hereditaria al cáncer y las alteraciones mutacionales a nivel de genes susceptibles de originar cáncer de mama y ovario. En 1994 se identificaron los genes BRCA1 (Breast Cancer Gene 1 y BRCA2 (Breast Cancer Gene 2 como susceptibles de cáncer de mama y ovario. En la actualidad se sabe que las mutaciones en BRCA1 y BRCA2 están lejos de explicar la totalidad de los casos de cáncer de mama y/o ovario, y a pesar de que se postulan alteraciones mutacionales en otros genes como CHEK2, TP53 y PTEN, el BRCA1 y BRCA2, siguen teniendo su importancia y utilidad en la valoración del riesgo de predisposición hereditaria. Aunque las cifras son variables según los distintos estudios y autores, se trata en cualquier caso de porcentajes importantes. Entre el 15 y el 85% de las mujeres portadoras de mutación BRCA 1 o BRCA 2 tienen riesgo de desarrollar un cáncer de mama y entre un 10 y 60% de desarrollar un cáncer de ovario. ABSTRACT:In the last years, numerous studies were made to establish the hereditary predisposition to the cancer and the mutationals alterations at level of genes susceptible to originate breast and ovarian cancers. In 1994 genes BRCA1 (Breast Cancer Gene 1 and BRCA2 were identified (Breast Cancer Gene 2 as susceptible of both of breast and ovarian cancers. At the present time, it is knows that the mutations in BRCA 1 and BRCA 2 are far from explaining the totality of the cases of breast cancer and/or ovary, and although mutationals alterations in other genes like CHEK2, TP53 and PTEN, the BRCA1 and BRCA2 are postulated, they continue having his importance and utility in the valuation of the risk of hereditary predisposition. Correlations between both BRCA1 and BRCA2 levels with tumour grade metastasis and prognostic accuracy. Between 15 and 85% of the carrying women of mutation BRCA 1 or BRCA 2 have risk of developing a cancer of breast

Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

Directory of Open Access Journals (Sweden)

Srivastava Satish

2003-07-01

Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

Normosmic idiopathic hypogonadotropic hypogonadism due to a novel homozygous nonsense c.C969A (p.Y323X) mutation in the KISS1R gene in three unrelated families.

Science.gov (United States)

Demirbilek, Huseyin; Ozbek, M Nuri; Demir, Korcan; Kotan, L Damla; Cesur, Yasar; Dogan, Murat; Temiz, Fatih; Mengen, Eda; Gurbuz, Fatih; Yuksel, Bilgin; Topaloglu, A Kemal

2015-03-01

The spectrum of genetic alterations in cases of hypogonadotropic hypogonadism continue to expand. However, KISS1R mutations remain rare. The aim of this study was to understand the molecular basis of normosmic idiopathic hypogonadotropic hypogonadism. Clinical characteristics, hormonal studies and genetic analyses of seven cases with idiopathic normosmic hypogonadotropic hypogonadism (nIHH) from three unrelated consanguineous families are presented. One male presented with absence of pubertal onset and required surgery for severe penoscrotal hypospadias and cryptorchidism, while other two males had absence of pubertal onset. Two of four female cases required replacement therapy for pubertal onset and maintenance, whereas the other two had spontaneous pubertal onset but incomplete maturation. In sequence analysis, we identified a novel homozygous nonsense (p.Y323X) mutation (c.C969A) in the last exon of the KISS1R gene in all clinically affected cases. We identified a homozygous nonsense mutation in the KISS1R gene in three unrelated families with nIHH, which enabled us to observe the phenotypic consequences of this rare condition. Escape from nonsense-mediated decay, and thus production of abnormal proteins, may account for the variable severity of the phenotype. Although KISS1R mutations are extremely rare and can cause a heterogeneous phenotype, analysis of the KISS1R gene should be a part of genetic analysis of patients with nIHH, to allow better understanding of phenotype-genotype relationship of KISS1R mutations and the underlying genetic basis of patients with nIHH. © 2014 John Wiley & Sons Ltd.

HFE gene variants affect iron in the brain.

Science.gov (United States)

Nandar, Wint; Connor, James R

2011-04-01

Iron accumulation in the brain and increased oxidative stress are consistent observations in many neurodegenerative diseases. Thus, we have begun examination into gene mutations or allelic variants that could be associated with loss of iron homeostasis. One of the mechanisms leading to iron overload is a mutation in the HFE gene, which is involved in iron metabolism. The 2 most common HFE gene variants are C282Y (1.9%) and H63D (8.9%). The C282Y HFE variant is more commonly associated with hereditary hemochromatosis, which is an autosomal recessive disorder, characterized by iron overload in a number of systemic organs. The H63D HFE variant appears less frequently associated with hemochromatosis, but its role in the neurodegenerative diseases has received more attention. At the cellular level, the HFE mutant protein resulting from the H63D HFE gene variant is associated with iron dyshomeostasis, increased oxidative stress, glutamate release, tau phosphorylation, and alteration in inflammatory response, each of which is under investigation as a contributing factor to neurodegenerative diseases. Therefore, the HFE gene variants are proposed to be genetic modifiers or a risk factor for neurodegenerative diseases by establishing an enabling milieu for pathogenic agents. This review will discuss the current knowledge of the association of the HFE gene variants with neurodegenerative diseases: amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and ischemic stroke. Importantly, the data herein also begin to dispel the long-held view that the brain is protected from iron accumulation associated with the HFE mutations.

HNPCC: Six new pathogenic mutations

Directory of Open Access Journals (Sweden)

Epplen Joerg T

2004-06-01

Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... ease (36.6%), delayed puberty (56.6%), primary (35.71%) and secondary amenorrhea (21.42%), short stature. (27.3%) .... guineous marriage (61.5%) and a high rate of positive family his- .... Safer food, better business.

p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

International Nuclear Information System (INIS)

Ikehata, Hironobu

1998-01-01

Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

Science.gov (United States)

Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

2005-01-01

Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

Dicty_cDB: SLH282 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH282 (Link to dictyBase) - - - Contig-U10985-1 | Contig-U15908-1 SLH2...82P (Link to Original site) SLH282F 506 SLH282Z 455 SLH282P 961 - - Show SLH282 Library SL (Link to library) Clone ID SLH2...85-1 | Contig-U15908-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH2...82Q.Seq.d/ Representative seq. ID SLH282P (Link to Original site) Representative DNA sequence >SLH282 (SLH2...82Q) /CSM/SL/SLH2-D/SLH282Q.Seq.d/ GGTTTTTAAAACTATTGATACTGAAGAGAATGGAATTATATCAATAACACAATTAAGACA

Genome-wide association study identifies TF as a significant modifier gene of iron metabolism in HFE hemochromatosis.

Science.gov (United States)

de Tayrac, Marie; Roth, Marie-Paule; Jouanolle, Anne-Marie; Coppin, Hélène; le Gac, Gérald; Piperno, Alberto; Férec, Claude; Pelucchi, Sara; Scotet, Virginie; Bardou-Jacquet, Edouard; Ropert, Martine; Bouvet, Régis; Génin, Emmanuelle; Mosser, Jean; Deugnier, Yves

2015-03-01

Hereditary hemochromatosis (HH) is the most common form of genetic iron loading disease. It is mainly related to the homozygous C282Y/C282Y mutation in the HFE gene that is, however, a necessary but not a sufficient condition to develop clinical and even biochemical HH. This suggests that modifier genes are likely involved in the expressivity of the disease. Our aim was to identify such modifier genes. We performed a genome-wide association study (GWAS) using DNA collected from 474 unrelated C282Y homozygotes. Associations were examined for both quantitative iron burden indices and clinical outcomes with 534,213 single nucleotide polymorphisms (SNP) genotypes, with replication analyses in an independent sample of 748 C282Y homozygotes from four different European centres. One SNP met genome-wide statistical significance for association with transferrin concentration (rs3811647, GWAS p value of 7×10(-9) and replication p value of 5×10(-13)). This SNP, located within intron 11 of the TF gene, had a pleiotropic effect on serum iron (GWAS p value of 4.9×10(-6) and replication p value of 3.2×10(-6)). Both serum transferrin and iron levels were associated with serum ferritin levels, amount of iron removed and global clinical stage (pHFE-associated HH (HFE-HH) patients, identified the rs3811647 polymorphism in the TF gene as the only SNP significantly associated with iron metabolism through serum transferrin and iron levels. Because these two outcomes were clearly associated with the biochemical and clinical expression of the disease, an indirect link between the rs3811647 polymorphism and the phenotypic presentation of HFE-HH is likely. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Different Phenotypes of the Two Chinese Probands with the Same c.889G>A (p.C162Y Mutation in COCH Gene Verify Different Mechanisms Underlying Autosomal Dominant Nonsyndromic Deafness 9.

Directory of Open Access Journals (Sweden)

Qi Wang

Full Text Available By analyzing the different phenotypes of two Chinese DFNA9 families with the same mutation located in the intervening region between the LCCL and vWFA domains of cochlin and testing the functional changes in the mutant cochlin, we investigated the different pathogeneses for mutations in LCCL and vWFA domains.Targeted next-generation sequencing for deafness-related genes was used to identify the mutation in the proband in family #208. The probands of family #208 and family #32 with the same p.C162Y mutation were followed for more than 3 years to evaluate the progression of hearing loss and vestibular dysfunction using pure-tone audiometry, caloric testing, electrocochleogram, vestibular-evoked myogenic potential, and video head-impulse test. The disruption of normal cleavage to produce secreted LCCL domain fragments and the tendency to form aggregations of mutant cochlins were tested by in vitro cell experiments.The two families showed different clinical symptoms. Family #32 was identified as having early-onset, progressive sensorineural hearing loss, similar to the symptoms in DFNA9 patients with cochlin mutations in the vWFA domain. The proband of family #208 endured late-onset recurrent paroxysmal vertigo attacks and progressively deteriorating hearing, similar to symptoms in those with cochlin mutations in the LCCL domain. We therefore suggest that the disrupted cleavage of the LCCL domain fragment is likely to cause vestibular dysfunction, and aggregation of mutant cochlin caused by mutations in the vWFA domain is responsible for early-onset hearing loss. The p.C162Y mutation causes either disruption of LCCL domain fragment cleavage or aggregation of mutant cochlin, resulting in the different phenotypes in the two families.This study demonstrates that DFNA9 families with the same genotype may have significantly different phenotypes. The mutation site in cochlin is related to the pathological mechanism underlying the different phenotypes.

The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Mohammad Soleiman Soltanpour

2018-01-01

Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

Iron storage disease in Asia-Pacific populations: the importance of non-HFE mutations.

Science.gov (United States)

McDonald, Cameron J; Wallace, Daniel F; Crawford, Darrell H G; Subramaniam, V Nathan

2013-07-01

Hereditary hemochromatosis (HH) is a widely recognized and well-studied condition in European populations. This is largely due to the high prevalence of the C282Y mutation of HFE. Although less common than in Europe, HH cases have been reported in the Asia-Pacific region because of mutations in both HFE and non-HFE genes. Mutations in all of the currently known genes implicated in non-HFE HH (hemojuvelin, hepcidin, transferrin receptor 2, and ferroportin) have been reported in patients from the Asia-Pacific region. This review discusses the molecular basis of HH and the genes and mutations known to cause non-HFE HH with particular reference to the Asia-Pacific region. Challenges in the genetic diagnosis of non-HFE HH are also discussed and how new technologies such as next generation sequencing may be informative in the future. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

FAMILY ANAMNESIS OF CHILDREN WITH MUTATION OF THE INHERITED HEMOCHROMATOSIS

Directory of Open Access Journals (Sweden)

S.I. Polyakova

2010-01-01

Full Text Available The inherited burdened is studied on diseases, associated with an overload iron in 41 children with frequent mutations of the inherited hemochromatosis (IG of a 1 type (C282y, H63d, S65c. Control group was made by 27 children with undiscovered frequent mutations of NG. Frequencies of iron-associated diseases are compared for 560 members of families which have children with mutations of IG and 390 members of families which have children without IG mutations. Some features of medical-genealogical anamnesis, which can be conditioned of siderosis, are exposed, and indirectly specify in the presence of mutations in the gene of HFE. So, the high frequency of oncologic diseases, diabetes mellitus, hepatocirrhosis and deaths of relatives under the age of 50 years are the foundation for research of exchange of iron and holding of molecular-genetic research of the inherited hemochromatosis. Key words: inherited hemochromatosis, heredity, children. (Pediatric Pharmacology. – 2010; 7(3:52-56

Relationship of Baseline Hemoglobin Level with Serum Ferritin, Postphlebotomy Hemoglobin Changes, and Phlebotomy Requirements among HFE C282Y Homozygotes

Directory of Open Access Journals (Sweden)

Seyed Ali Mousavi

2015-01-01

Full Text Available Objectives. We aimed to examine whether baseline hemoglobin levels in C282Y-homozygous patients are related to the degree of serum ferritin (SF elevation and whether patients with different baseline hemoglobin have different phlebotomy requirements. Methods. A total of 196 patients (124 males and 72 females who had undergone therapeutic phlebotomy and had SF and both pre- and posttreatment hemoglobin values were included in the study. Results. Bivariate correlation analysis suggested that baseline SF explains approximately 6 to 7% of the variation in baseline hemoglobin. The results also showed that males who had higher (≥150 g/L baseline hemoglobin levels had a significantly greater reduction in their posttreatment hemoglobin despite requiring fewer phlebotomies to achieve iron depletion than those who had lower (<150 g/L baseline hemoglobin, regardless of whether baseline SF was below or above 1000 µg/L. There were no significant differences between hemoglobin subgroups regarding baseline and treatment characteristics, except for transferrin saturation between male subgroups with SF above 1000 µg/L. Similar differences were observed when females with higher (≥138 g/L baseline hemoglobin were compared with those with lower (<138 g/L baseline hemoglobin. Conclusion. Dividing C282Y-homozygous patients into just two subgroups according to the degree of baseline SF elevation may obscure important subgroup variations.

Relationship of Baseline Hemoglobin Level with Serum Ferritin, Postphlebotomy Hemoglobin Changes, and Phlebotomy Requirements among HFE C282Y Homozygotes

Science.gov (United States)

Mousavi, Seyed Ali; Mahmood, Faiza; Aandahl, Astrid; Knutsen, Teresa Risopatron; Llohn, Abid Hussain

2015-01-01

Objectives. We aimed to examine whether baseline hemoglobin levels in C282Y-homozygous patients are related to the degree of serum ferritin (SF) elevation and whether patients with different baseline hemoglobin have different phlebotomy requirements. Methods. A total of 196 patients (124 males and 72 females) who had undergone therapeutic phlebotomy and had SF and both pre- and posttreatment hemoglobin values were included in the study. Results. Bivariate correlation analysis suggested that baseline SF explains approximately 6 to 7% of the variation in baseline hemoglobin. The results also showed that males who had higher (≥150 g/L) baseline hemoglobin levels had a significantly greater reduction in their posttreatment hemoglobin despite requiring fewer phlebotomies to achieve iron depletion than those who had lower (baseline hemoglobin, regardless of whether baseline SF was below or above 1000 µg/L. There were no significant differences between hemoglobin subgroups regarding baseline and treatment characteristics, except for transferrin saturation between male subgroups with SF above 1000 µg/L. Similar differences were observed when females with higher (≥138 g/L) baseline hemoglobin were compared with those with lower (baseline hemoglobin. Conclusion. Dividing C282Y-homozygous patients into just two subgroups according to the degree of baseline SF elevation may obscure important subgroup variations. PMID:26380265

New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

Science.gov (United States)

Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2013-01-30

The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

International Nuclear Information System (INIS)

Romeo, G.; Hassan, H.J.; Staempfli, S.

1987-01-01

The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees

A molecular dynamics investigation on the crizotinib resistance mechanism of C1156Y mutation in ALK

International Nuclear Information System (INIS)

Sun, Hui-Yong; Ji, Feng-Qin

2012-01-01

Highlights: ► The study revealed the detailed resistance mechanism of the non-active mutation C1156Y in ALK. ► C1156Y leads to crizotinib displacement and conformational changes in the binding cavity. ► The conformations cause a decline in the vdW and electrostatic energy between crizotinib and ALK. -- Abstract: Crizotinib is an anaplastic lymphoma kinase (ALK) inhibitor that has recently been approved in the US for the treatment of non-small cell lung carcinoma (NSCLC). Despite its outstanding safety and efficacy, several resistant mutations against crizotinib have been detected in the treatment of NSCLC. However, in contrast to the widely accepted mechanism of steric hindrance by mutations at the active site, the mechanism by which the C1156Y non-active site mutation confers resistance against crizotinib remains unclear. In the present study, the resistance mechanism of C1156Y in ALK was investigated using molecular dynamics simulations. The results suggest that despite the non-active site mutation, C1156Y causes the dislocation of crizotinib as well as the indirect conformational changes in the binding cavity, which results in a marked decrease in the van der Waals and electrostatic interactions between crizotinib and ALK. The obtained results provide a detailed explanation of the resistance caused by C1156Y and may give a vital clue for the design of drugs to combat crizotinib resistance.

THE EFFECT OF HAEMOCHROMATOSIS MUTATION ON IRON OVERLOAD IN THALASSAEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Tapas Ranjan Behera

2016-11-01

Full Text Available BACKGROUND Haemochromatosis is a genetic form of iron overload due to a defective HFE gene. Secondary iron overload is the main complication in transfusion-dependent thalassaemia major patients. This study aims at evaluating the degree of iron overload in β-thalassaemia major patients with and without HFE mutations (C282Y, H63D and S65C. MATERIALS AND METHODS A descriptive observational study was conducted including fifty diagnosed -thalassaemia major cases. Detailed clinical history and iron profile was estimated. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS After DNA analysis of all the thalassaemia major cases, two groups were identified, one with HFE gene mutation and other without HFE gene mutation. Iron profile of both the groups (with and without HFE gene mutation was estimated and compared. Only H63D mutation (out of three HFE gene mutations was detected in 16% cases (8 out of 50 cases, which comprised the group with mutation. Comparison of iron parameters between two groups (with and without HFE gene mutation showed significant difference in percent transferrin saturation (p=0.02, while other iron parameters (serum iron and serum ferritin did not show significant difference. CONCLUSION No significant difference between serum ferritin values (a marker of iron overload of groups with and without mutation (mean ferritin level 4641±2166 ng/mL and 4170±2461 ng/mL, respectively was found (p=0.61, in a patient population in whom transfusion protocol and proper chelation regimen was followed.

Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age.

Science.gov (United States)

Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J

2009-07-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

Allele frequencies of hemojuvelin gene (HJV I222N and G320V missense mutations in white and African American subjects from the general Alabama population

Directory of Open Access Journals (Sweden)

Bohannon Sean B

2004-12-01

Full Text Available Abstract Background Homozygosity or compound heterozygosity for coding region mutations of the hemojuvelin gene (HJV in whites is a cause of early age-of-onset iron overload (juvenile hemochromatosis, and of hemochromatosis phenotypes in some young or middle-aged adults. HJV coding region mutations have also been identified recently in African American primary iron overload and control subjects. Primary iron overload unexplained by typical hemochromatosis-associated HFE genotypes is common in white and black adults in Alabama, and HJV I222N and G320V were detected in a white Alabama juvenile hemochromatosis index patient. Thus, we estimated the frequency of the HJV missense mutations I222N and G320V in adult whites and African Americans from Alabama general population convenience samples. Methods We evaluated the genomic DNA of 241 Alabama white and 124 African American adults who reported no history of hemochromatosis or iron overload to detect HJV missense mutations I222N and G320V using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP technique. Analysis for HJV I222N was performed in 240 whites and 124 African Americans. Analysis for HJV G320V was performed in 241 whites and 118 African Americans. Results One of 240 white control subjects was heterozygous for HJV I222N; she was also heterozygous for HFE C282Y, but had normal serum iron measures and bone marrow iron stores. HJV I222N was not detected in 124 African American subjects. HJV G320V was not detected in 241 white or 118 African American subjects. Conclusions HJV I222N and G320V are probably uncommon causes or modifiers of primary iron overload in adult whites and African Americans in Alabama. Double heterozygosity for HJV I222N and HFE C282Y may not promote increased iron absorption.

Founder effect of the RET C611Y mutation in multiple endocrine neoplasia 2A in Denmark

DEFF Research Database (Denmark)

Mathiesen, Jes Sloth; Kroustrup, Jens Peter; Vestergaard, Peter

2017-01-01

BACKGROUND: Multiple endocrine neoplasia (MEN) 2A and 2B are caused by REarranged during Transfection (RET) germline mutations. In a recent nationwide study we reported of an unusually high prevalence (33%) of families with the C611Y mutation and hypothesized that this might be due to a founder...... effect. We conducted the first nationwide study of haplotypes in MEN2A families aiming to investigate the relatedness and occurrence of de novo mutations among Danish families carrying similar mutations. METHODS: The study included 21 apparently unrelated MEN2A families identified from a nationwide...... Danish RET cohort from 1994 to 2014. Twelve, two, two, three and two families carried the C611Y, C618F, C618Y, C620R and C634R mutation, respectively. Single nucleotide polymorphism chip data and identity by descent analysis were used to assess relatedness. RESULTS: A common founder mutation was found...

A molecular dynamics investigation on the crizotinib resistance mechanism of C1156Y mutation in ALK

Energy Technology Data Exchange (ETDEWEB)

Sun, Hui-Yong [Shandong University of Technology, Zibo 255049 (China); Ji, Feng-Qin, E-mail: fengqinji@mail.hzau.edu.cn [National Key Laboratory of Crop Genetic Improvement, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Center for Bioinformatics, Huazhong Agricultural University, Wuhan 430070 (China)

2012-06-29

Highlights: Black-Right-Pointing-Pointer The study revealed the detailed resistance mechanism of the non-active mutation C1156Y in ALK. Black-Right-Pointing-Pointer C1156Y leads to crizotinib displacement and conformational changes in the binding cavity. Black-Right-Pointing-Pointer The conformations cause a decline in the vdW and electrostatic energy between crizotinib and ALK. -- Abstract: Crizotinib is an anaplastic lymphoma kinase (ALK) inhibitor that has recently been approved in the US for the treatment of non-small cell lung carcinoma (NSCLC). Despite its outstanding safety and efficacy, several resistant mutations against crizotinib have been detected in the treatment of NSCLC. However, in contrast to the widely accepted mechanism of steric hindrance by mutations at the active site, the mechanism by which the C1156Y non-active site mutation confers resistance against crizotinib remains unclear. In the present study, the resistance mechanism of C1156Y in ALK was investigated using molecular dynamics simulations. The results suggest that despite the non-active site mutation, C1156Y causes the dislocation of crizotinib as well as the indirect conformational changes in the binding cavity, which results in a marked decrease in the van der Waals and electrostatic interactions between crizotinib and ALK. The obtained results provide a detailed explanation of the resistance caused by C1156Y and may give a vital clue for the design of drugs to combat crizotinib resistance.

Two Mutations in Surfactant Protein C Gene Associated with Neonatal Respiratory Distress

Directory of Open Access Journals (Sweden)

Anna Tarocco

2015-01-01

Full Text Available Multiple mutations of surfactant genes causing surfactant dysfunction have been described. Surfactant protein C (SP-C deficiency is associated with variable clinical manifestations ranging from neonatal respiratory distress syndrome to lethal lung disease. We present an extremely low birth weight male infant with an unusual course of respiratory distress syndrome associated with two mutations in the SFTPC gene: C43-7G>A and 12T>A. He required mechanical ventilation for 26 days and was treated with 5 subsequent doses of surfactant with temporary and short-term efficacy. He was discharged at 37 weeks of postconceptional age without any respiratory support. During the first 16 months of life he developed five respiratory infections that did not require hospitalization. Conclusion. This mild course in our patient with two mutations is peculiar because the outcome in patients with a single SFTPC mutation is usually poor.

[Molecular genetic diagnostics and screening of hereditary hemochromatosis].

Science.gov (United States)

Zlocha, J; Kovács, L; Pozgayová, S; Kupcová, V; Durínová, S

2006-06-01

Hereditary hemochromatosis is considered one of the most common hereditary diseases in population of Caucasian origin. In recent years, a candidate gene for HLA-linked hemochromatosis, HFE, has been cloned, and a single G-to-A mutation resulting in a cysteine-to-tyrosine substitution (C282Y) has been identified in up to 80% of study patients with type 1 hereditary hemochromatosis. The purpose of the paper was to confirm the importance of genetic testing for HFE mutations in making the diagnosis of hemochromatosis and find out a suitable diagnostic algorithm for the indication of this form of diagnostics in patients suspected of hereditary hemochromatosis. The examination of C282Y mutation was conducted in 500 subjects. The most frequent indications for DNA analysis were hepatopathy of unknown ethiology, liver cirrhosis, diabetes mellitus, bronze skin pigmentation in connection with high serum iron concentration, elevated transferrin saturation and elevated serum ferritin levels. In our group of patients, 29 homozygotes and 75 heterozygotes for C282Y mutation were identified, 10 patients carried both C282Y and H63D mutations of HFE gene (compound heterozygotes), whereas in 386 subjects the mutation was not found. The genotype-phenotype correlation showed that 22 homozygotes had liver affection proved by imaging and/or histologic methods. Except the liver disorders, the most common symptoms of these patients were type 2 diabetes mellitus or glucose tolerance disorder (10 patients), arthritis or joint pain (9 patients) and cardiovascular disorders, such as cardiomyopathy (2 patients). Bronze skin pigmentation was present in 9 homozygotes. Transferin saturation values were significantly higher in homozygotes for C282Y mutation as compared to C282Y heterozygotes (p diagnostics of this severe, but in early recognition curable disease. Early detection and phlebotomy treatment prior to the onset of cirrhosis can reduce morbidity and normalize life expectancy. It is readily

Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

Science.gov (United States)

Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

2014-10-10

The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP. Copyright © 2014 Elsevier B.V. All rights reserved.

NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

Science.gov (United States)

Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

2017-09-01

To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

Isolation of temperature-sensitive mutations in murC of Staphylococcus aureus.

Science.gov (United States)

Ishibashi, Mihoko; Kurokawa, Kenji; Nishida, Satoshi; Ueno, Kohji; Matsuo, Miki; Sekimizu, Kazuhisa

2007-09-01

Enzymes in the bacterial peptidoglycan biosynthesis pathway are important targets for novel antibiotics. Of 750 temperature-sensitive (TS) mutants of Gram-positive Staphylococcus aureus, six were complemented by the murC gene, which encodes the UDP-N-acetylmuramic acid:l-alanine ligase. Each mutation resulted in a single amino acid substitution and, in all cases, the TS phenotype was suppressed by high osmotic stress. In mutant strains with the G222E substitution, a decrease in the viable cell number immediately after shift to the restrictive temperature was observed. These results suggest that S. aureus MurC protein is essential for cell growth. The MurC H343Y mutation is located in the putative alanine recognition pocket. Consistent with this, allele-specific suppression was observed of the H343Y mutation by multiple copies of the aapA gene, which encodes an alanine transporter. The results suggest an in vivo role for the H343 residue of S. aureus MurC protein in high-affinity binding to L-alanine.

Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect

International Nuclear Information System (INIS)

Wang Hu; Wang Jizheng; Zheng Weiyue; Wang Xiaojian; Wang Shuxia; Song Lei; Zou Yubao; Yao Yan; Hui Rutai

2006-01-01

Dilated cardiomyopathy is a form of heart muscle disease characterized by impaired systolic function and ventricular dilation. The mutations in lamin A/C gene have been linked to dilated cardiomyopathy. We screened genetic mutations in a large Chinese family of 50 members including members with dilated cardiomyopathy and found a Glu82Lys substitution mutation in the rod domain of the lamin A/C protein in eight family members, three of them have been diagnosed as dilated cardiomyopathy, one presented with heart dilation. The pathogenic mechanism of lamin A/C gene defect is poorly understood. Glu82Lys mutated lamin A/C and wild type protein was transfected into HEK293 cells. The mutated protein was not properly localized at the inner nuclear membrane and the emerin protein, which interacts with lamin A/C, was also aberrantly distributed. The nuclear membrane structure was disrupted and heterochromatin was aggregated aberrantly in the nucleus of the HEK293 cells stably transfected with mutated lamin A/C gene as determined by transmission electron microscopy

Effects of highly conserved major histocompatibility complex (MHC extended haplotypes on iron and low CD8+ T lymphocyte phenotypes in HFE C282Y homozygous hemochromatosis patients from three geographically distant areas.

Directory of Open Access Journals (Sweden)

Mónica Costa

Full Text Available Hereditary Hemochromatosis (HH is a recessively inherited disorder of iron overload occurring commonly in subjects homozygous for the C282Y mutation in HFE gene localized on chromosome 6p21.3 in linkage disequilibrium with the human leukocyte antigen (HLA-A locus. Although its genetic homogeneity, the phenotypic expression is variable suggesting the presence of modifying factors. One such genetic factor, a SNP microhaplotype named A-A-T, was recently found to be associated with a more severe phenotype and also with low CD8(+T-lymphocyte numbers. The present study aimed to test whether the predictive value of the A-A-T microhaplotype remained in other population settings. In this study of 304 HH patients from 3 geographically distant populations (Porto, Portugal 65; Alabama, USA 57; Nord-Trøndelag, Norway 182, the extended haplotypes involving A-A-T were studied in 608 chromosomes and the CD8(+ T-lymphocyte numbers were determined in all subjects. Patients from Porto had a more severe phenotype than those from other settings. Patients with A-A-T seemed on average to have greater iron stores (p = 0.021, but significant differences were not confirmed in the 3 separate populations. Low CD8(+ T-lymphocytes were associated with HLA-A*03-A-A-T in Porto and Alabama patients but not in the greater series from Nord-Trøndelag. Although A-A-T may signal a more severe iron phenotype, this study was unable to prove such an association in all population settings, precluding its use as a universal predictive marker of iron overload in HH. Interestingly, the association between A-A-T and CD8(+ T-lymphocytes, which was confirmed in Porto and Alabama patients, was not observed in Nord-Trøndelag patients, showing that common HLA haplotypes like A*01-B*08 or A*03-B*07 segregating with HFE/C282Y in the three populations may carry different messages. These findings further strengthen the relevance of HH as a good disease model to search for novel candidate loci

Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

Science.gov (United States)

Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

2018-02-14

Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion（E15）mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

A new mutation in WFS1 gene (C.1522-1523delTA, Y508fsX421) may be responsible for early appearance of clinical features of Wolfram syndrome and suicidal behaviour.

Science.gov (United States)

Aluclu, Mehmet Ufuk; Bahceci, Mithat; Tuzcu, Alpaslan; Arikan, Senay; Gokalp, Deniz

2006-12-01

Wolfram syndrome (WS) is an autosomal recessive disorder characterized by the association of juvenile-onset diabetes mellitus and optic atrophy. It is also known by the acronym DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). We diagnosed Wolfram syndrome in 2 male siblings and determined a new mutation (c. 1522-1523delTA, Y508fsX421). Both affected siblings were homozygous, other family members were heterozygous. Dilated renal outflow tracts in the third decade, and neuropsychiatric disorders including bipolar disorder and neurosensorial deafness appear in the fourth decade in ordinary WS, whereas these features appeared in second decade in our patients. This mutation may be responsible for early appearance of dilated renal outflow tracts and multiple neurological abnormalities. Psychiatric disturbances such as suicide were reported at increased frequency in Wolfram patients and in heterozygous carriers. Suicidal behaviour occurred in our patients when they were yet 11 and 13 years old. Therefore, our findings may indicate that there may be a relationship between this WFS1 mutation and mood disorder such as suicidal behaviour. We determined a new mutation (c. 1522-1523delTA, Y508fsX421) in WS1 gene in 2 siblings with Wolfram syndrome. This mutation may be responsible for early appearance of clinical features of Wolfram syndrome, and there may be a relationship between this mutation and suicidal behaviour.

An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

Science.gov (United States)

Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

2018-06-01

: Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

Multifocal white matter lesions associated with the D313Y mutation of the α-galactosidase A gene.

Science.gov (United States)

Lenders, Malte; Duning, Thomas; Schelleckes, Michael; Schmitz, Boris; Stander, Sonja; Rolfs, Arndt; Brand, Stefan-Martin; Brand, Eva

2013-01-01

White matter lesions (WML) are clinically relevant since they are associated with strokes, cognitive decline, depression, or epilepsy, but the underlying etiology in young adults without classical risk factors still remains elusive. Our aim was to elucidate the possible clinical diagnosis and mechanisms leading to WML in patients carrying the D313Y mutation in the α-galactosidase A (GLA) gene, a mutation that was formerly described as nonpathogenic. Pathogenic GLA mutations cause Fabry disease, a vascular endothelial glycosphingolipid storage disease typically presenting with a symptom complex of renal, cardiac, and cerebrovascular manifestations. We performed in-depths clinical, biochemical and genetic examinations as well as advanced magnetic resonance imaging analyses in a pedigree with the genetically determined GLA mutation D313Y. We detected exclusive neurologic manifestations of the central nervous system of the "pseudo"-deficient D313Y mutation leading to manifest WML in 7 affected adult family members. Furthermore, two family members that do not carry the mutation showed no WML. The D313Y mutation resulted in a normal GLA enzyme activity in leukocytes and severely decreased activities in plasma. In conclusion, our results provide evidence that GLA D313Y is potentially involved in neural damage with significant WML, demonstrating the necessity of evaluating patients carrying D313Y more thoroughly. D313Y might broaden the spectrum of hereditary small artery diseases of the brain, which preferably occur in young adults without classical risk factors. In view of the existing causal therapy regime, D313Y should be more specifically taken into account in these patients.

Mek1Y130C mice recapitulate aspects of human cardio-facio-cutaneous syndrome

Science.gov (United States)

Aoidi, Rifdat; Houde, Nicolas; Landry-Truchon, Kim; Holter, Michael; Jacquet, Kevin; Charron, Louis; Yu, Benjamin D.; Rauen, Katherine A.; Bisson, Nicolas; Newbern, Jason

2018-01-01

ABSTRACT The RAS/MAPK signaling pathway is one of the most investigated pathways, owing to its established role in numerous cellular processes and implication in cancer. Germline mutations in genes encoding members of the RAS/MAPK pathway also cause severe developmental syndromes collectively known as RASopathies. These syndromes share overlapping characteristics, including craniofacial dysmorphology, cardiac malformations, cutaneous abnormalities and developmental delay. Cardio-facio-cutaneous syndrome (CFC) is a rare RASopathy associated with mutations in BRAF, KRAS, MEK1 (MAP2K1) and MEK2 (MAP2K2). MEK1 and MEK2 mutations are found in ∼25% of the CFC patients and the MEK1Y130C substitution is the most common one. However, little is known about the origins and mechanisms responsible for the development of CFC. To our knowledge, no mouse model carrying RASopathy-linked Mek1 or Mek2 gene mutations has been reported. To investigate the molecular and developmental consequences of the Mek1Y130C mutation, we generated a mouse line carrying this mutation. Analysis of mice from a Mek1 allelic series revealed that the Mek1Y130C allele expresses both wild-type and Y130C mutant forms of MEK1. However, despite reduced levels of MEK1 protein and the lower abundance of MEK1 Y130C protein than wild type, Mek1Y130C mutants showed increased ERK (MAPK) protein activation in response to growth factors, supporting a role for MEK1 Y130C in hyperactivation of the RAS/MAPK pathway, leading to CFC. Mek1Y130C mutant mice exhibited pulmonary artery stenosis, cranial dysmorphia and neurological anomalies, including increased numbers of GFAP+ astrocytes and Olig2+ oligodendrocytes in regions of the cerebral cortex. These data indicate that the Mek1Y130C mutation recapitulates major aspects of CFC, providing a new animal model to investigate the physiopathology of this RASopathy. This article has an associated First Person interview with the first author of the paper. PMID:29590634

Multifocal white matter lesions associated with the D313Y mutation of the α-galactosidase A gene.

Directory of Open Access Journals (Sweden)

Malte Lenders

Full Text Available White matter lesions (WML are clinically relevant since they are associated with strokes, cognitive decline, depression, or epilepsy, but the underlying etiology in young adults without classical risk factors still remains elusive. Our aim was to elucidate the possible clinical diagnosis and mechanisms leading to WML in patients carrying the D313Y mutation in the α-galactosidase A (GLA gene, a mutation that was formerly described as nonpathogenic. Pathogenic GLA mutations cause Fabry disease, a vascular endothelial glycosphingolipid storage disease typically presenting with a symptom complex of renal, cardiac, and cerebrovascular manifestations. We performed in-depths clinical, biochemical and genetic examinations as well as advanced magnetic resonance imaging analyses in a pedigree with the genetically determined GLA mutation D313Y. We detected exclusive neurologic manifestations of the central nervous system of the "pseudo"-deficient D313Y mutation leading to manifest WML in 7 affected adult family members. Furthermore, two family members that do not carry the mutation showed no WML. The D313Y mutation resulted in a normal GLA enzyme activity in leukocytes and severely decreased activities in plasma. In conclusion, our results provide evidence that GLA D313Y is potentially involved in neural damage with significant WML, demonstrating the necessity of evaluating patients carrying D313Y more thoroughly. D313Y might broaden the spectrum of hereditary small artery diseases of the brain, which preferably occur in young adults without classical risk factors. In view of the existing causal therapy regime, D313Y should be more specifically taken into account in these patients.

Hemochromatosis mutations in the general population

DEFF Research Database (Denmark)

Andersen, Rolf Vaern; Tybjaerg-Hansen, Anne; Appleyard, Merete

2004-01-01

The progression rate of iron overload in hereditary hemochromatosis in individuals in the general population is unknown. We therefore examined in the general population iron overload progression rate in C282Y homozygotes. Using a cohort study of the Danish general population, The Copenhagen City...... saturation and ferritin levels increased slightly in male and female C282Y homozygotes. None of the C282Y homozygotes developed clinically overt hemochromatosis. In conclusion, individuals in the general population with C282Y homozygosity at most demonstrate modest increases in transferrin saturation...

An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

Science.gov (United States)

Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

2017-07-01

We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

A survey of new temperature-sensitive, embryonic-lethal mutations in C. elegans: 24 alleles of thirteen genes.

Directory of Open Access Journals (Sweden)

Sean M O'Rourke

2011-03-01

Full Text Available To study essential maternal gene requirements in the early C. elegans embryo, we have screened for temperature-sensitive, embryonic lethal mutations in an effort to bypass essential zygotic requirements for such genes during larval and adult germline development. With conditional alleles, multiple essential requirements can be examined by shifting at different times from the permissive temperature of 15°C to the restrictive temperature of 26°C. Here we describe 24 conditional mutations that affect 13 different loci and report the identity of the gene mutations responsible for the conditional lethality in 22 of the mutants. All but four are mis-sense mutations, with two mutations affecting splice sites, another creating an in-frame deletion, and one creating a premature stop codon. Almost all of the mis-sense mutations affect residues conserved in orthologs, and thus may be useful for engineering conditional mutations in other organisms. We find that 62% of the mutants display additional phenotypes when shifted to the restrictive temperature as L1 larvae, in addition to causing embryonic lethality after L4 upshifts. Remarkably, we also found that 13 out of the 24 mutations appear to be fast-acting, making them particularly useful for careful dissection of multiple essential requirements. Our findings highlight the value of C. elegans for identifying useful temperature-sensitive mutations in essential genes, and provide new insights into the requirements for some of the affected loci.

Coinheritance of hereditary spherocytosis and reversibility of cirrhosis in a young female patient with hereditary hemochromatosis.

Science.gov (United States)

Höblinger, A; Erdmann, C; Strassburg, C P; Sauerbruch, T; Lammert, F

2009-04-16

Here we report a 33-years-old woman with hereditary spherocytosis and hemochromatosis due to homozygosity for the C282Y mutation of the HFE gene. The coinheritance of both conditions led to severe iron overload and liver cirrhosis at young age. The patient was treated by repeated phlebotomy, and reversibility of cirrhosis was documented by transient elastography. This report discusses the pathophysiology of iron accumulation in patients with hemolytic anemia combined with HFE C282Y homozygosity. The case indicates that patients with hematological disorders characterized by increased erythropoetic activity should be screened for HFE mutations.

Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases.

Science.gov (United States)

He, Xin; Chen, Zhigang; Jiang, Yangyan; Qiu, Xi; Zhao, Xiaoying

2013-01-25

The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

Frequency of the Hemochromatosis Gene (HFE Variants in a Jordanian Arab Population and in Diabetics from the Same Region

Directory of Open Access Journals (Sweden)

Asem Alkhateeb

2009-01-01

Full Text Available Hereditary HFE-linked hemochromatosis is a frequent recessive disorder among individuals of northern European ancestry. The clinical characteristic of this disease is the gradual accumulation of iron in internal organs, which ultimately may lead to organ damage and death. Three allelic variants of HFE gene have been correlated with hereditary hemochromatosis: C282Y is significantly associated with hereditary hemochromatosis in populations of Celtic origin, H63D and S65C are associated with milder form of iron overload. In this study we performed mutation analysis to identify allele frequency of the three variants of HFE gene in Jordanian Arab population, to assess deviations of these frequencies from those detected elsewhere, and to determine if there is an increased frequency of these variants in a diabetic population (Type 2 diabetes from the same area. DNA was extracted from blood samples of 440 individuals attending King Abdullah University Hospital for ambulatory services. We used polymerase chain reaction (PCR to amplify exons 2 and 4 of the HFE gene then restriction fragment length polymorphism (RFLP method to detect the variants. There were neither homozygous nor heterozygous for C282Y variant. For the H63D variant, 0.68% were homozygous and 21.1% were heterozygous. For the S65C variant, there were no homozygous and 0.23% were heterozygous. Allelic frequencies were, 0%, 11.25%, and 0.11% for C282Y, H63D, and S65C, respectively. Our samples were subdivided into two categories of type 2 diabetic (89 cases and controls (blood donors, 204 cases and compared with regard to the H63D variant. Both groups did not have homozygous H63D variant. H63D heterozygous in diabetics were 23.60% and in blood donor controls 22.55%. Allelic frequency of the mutant H63D allele was 11.80% in diabetics and 11.27% for the blood donor controls. This is the first study to show the frequency of the three hemochromatosis gene variants in Jordan with the interesting

Identification of a breast cancer family double heterozygote for RAD51C and BRCA2 gene mutations

DEFF Research Database (Denmark)

Ahlborn, Lise B; Steffensen, Ane Y; Jønson, Lars

2015-01-01

for mutations in the RAD51C and BRCA2 genes. The RAD51C missense mutation p.Arg258His has previously been identified in a homozygous state in a patient with Fanconi anemia. This mutation is known to affect the DNA repair function of the RAD51C protein. The BRCA2 p.Leu3216Leu synonymous mutation has not been...

A novel nonsense mutation in cathepsin C gene in an Egyptian ...

African Journals Online (AJOL)

Hala Soliman

2015-04-22

Apr 22, 2015 ... as defects of phagocytic function and deregulation of localized ... Aim: The aim of this study is to detect the mutation in CTSC gene expected to be the ..... [20] Toomes C, James J, Wood AJ, McCormick D, Lench N, Hewitt.

Posterior microphthalmia and nanophthalmia in Tunisia caused by a founder c.1059_1066insC mutation of the PRSS56 gene.

Science.gov (United States)

Said, Mariem Ben; Chouchène, Ebtissem; Salem, Salma Ben; Daoud, Kods; Largueche, Leila; Bouassida, Walid; Benzina, Zeineb; Ayadi, Hammadi; Söderkvist, Peter; Matri, Leila; Hmani-Aifa, Mounira

2013-10-10

Congenital microphthalmia (CMIC) is a common developmental ocular disorder characterized by a small, and sometimes malformed, eye. Posterior microphthalmia (PM) and nanophthalmia are two rare subtypes of isolated CMIC characterized by extreme hyperopia due to short axial length and elevated lens/eye volume ratio. While nanophthalmia is associated with a reduced size in both anterior and posterior segments, PM involves a normal-size anterior chamber but a small posterior segment. Several genes encoding transcription and non-transcription regulators have been identified in different forms of CMIC. MFRP gene mutations have, for instance, been associated with nanophthalmia, and mutations in the recently identified PRSS56 gene have been linked to PM. So far, these two forms of CMIC have been associated with 9 mutations in PRSS56. Of particular interest, a c.1059_1066insC mutation has recently been reported in four Tunisian families with isolated PM and one Tunisian family with nanophthalmia. Here, we performed a genome-wide scan using a high density single nucleotide polymorphism (SNP) array 50 K in a large consanguineous Tunisian family (PM7) affected with PM and identified the same causative disease mutation. A total of 24 polymorphic markers spanning the PRSS56 gene in 6 families originating from different regions of Tunisia were analyzed to investigate the origin of the c.1059_1066insC mutation and to determine whether it arose in a common ancestor. A highly significant disease-associated haplotype, spanning across the 146 kb of the 2q37.1 chromosome, was conserved in those families, suggesting that c.1059_1066insC arose from a common founder. The age of the mutation in this haplotype was estimated to be around 1,850 years. The identification of such 'founder effects' may greatly simplify diagnostic genetic screening and lead to better prognostic counseling. © 2013 Elsevier B.V. All rights reserved.

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

Science.gov (United States)

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

Science.gov (United States)

Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

2014-11-18

Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

Preliminary investigation of bottlenose dolphins (Tursiops truncatus) for hfe gene-related hemochromatosis.

Science.gov (United States)

Phillips, Brianne E; Venn-Watson, Stephanie; Archer, Linda L; Nollens, Hendrik H; Wellehan, James F X

2014-10-01

Hemochromatosis (iron storage disease) has been reported in diverse mammals including bottlenose dolphins (Tursiops truncatus). The primary cause of excessive iron storage in humans is hereditary hemochromatosis. Most human hereditary hemochromatosis cases (up to 90%) are caused by a point mutation in the hfe gene, resulting in a C282Y substitution leading to iron accumulation. To evaluate the possibility of a hereditary hemochromatosis-like genetic predisposition in dolphins, we sequenced the bottlenose dolphin hfe gene, using reverse transcriptase-PCR and hfe primers designed from the dolphin genome, from liver of affected and healthy control dolphins. Sample size included two case animals and five control animals. Although isotype diversity was evident, no coding differences were identified in the hfe gene between any of the animals examined. Because our sample size was small, we cannot exclude the possibility that hemochromatosis in dolphins is due to a coding mutation in the hfe gene. Other potential causes of hemochromatosis, including mutations in different genes, diet, primary liver disease, and insulin resistance, should be evaluated.

Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

International Nuclear Information System (INIS)

Liang, Min; Guan, Minqiang; Zhao, Fuxing; Zhou, Xiangtian; Yuan, Meixia; Tong, Yi; Yang, Li; Wei, Qi-Ping; Sun, Yan-Hong; Lu, Fan; Qu, Jia

2009-01-01

We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.

The prevalence of primary hereditary hemochromatosis in central Anatolia.

Science.gov (United States)

Karaca, Halit; Güven, Kadri; Önal, Müge; Gürsoy, Şebnem; Başkol, Mevlüt; Özkul, Yusuf

2013-01-01

Hereditary hemochromatosis is an autosomal recessive disorder associated with the HFE genes. Early identification and diagnosis is important as end stage organ damage may occur if treatment is delayed.. This study aimed to identify the prevalence of hereditary hemochromatosis in Kayseri and surroundings known as Central Anatolia. 2304 participants (1220 males, 1084 females) who were older then the age of 17 were included in the study conducted between December 2005 and December 2006 in Kayseri, Turkey. Transferin saturation was measured from overnight fasting blood samples. Serum iron, total iron binding capacity, and transferin saturation were measured. Serum ferritin levels and hereditary hemochromatosis genetic analysis were also performed after an overnight fasting blood samples from participants whose transferin saturation results were more than 50% in man and more than 45% in women. The homozygote C282Y mutation and heterozygote C282Y mutation prevalences were found as 0.08% (1/1220) and 0.08% (1/1220) in male participants, respectively. The heterozygote H63D mutation prevalence was found in 0.09% (1/1084) of female participants. Calculated prevalences in general population are as follows; The homozygote C282Y mutation prevalence is 0.043% (1/2304), the heterozygote C282Y mutation prevalence is 0.043% (1/2304) and the heterozygote H63D mutation prevalence is 0.043% (1/2304). The prevalence of hereditary hemochromatosis in Central Anatolia is 0.043% (1/2304). Because of the relatively low frequency, population screening studies are not cost-effective.

A novel mutation in the albumin gene (c.1A>C) resulting in analbuminemia.

Science.gov (United States)

Caridi, Gianluca; Dagnino, Monica; Lugani, Francesca; Shalev, Stavit A; Campagnoli, Monica; Galliano, Monica; Spiegel, Ronen; Minchiotti, Lorenzo

2013-01-01

Analbuminemia (OMIM # 103600) is a rare autosomal recessive disorder manifested by the absence or severe reduction of circulating serum albumin in homozygous or compound heterozygous subjects. The trait is caused by a variety of mutations within the albumin gene. We report here the clinical and molecular characterisation of two new cases of congenital analbuminemia diagnosed in two members of the Druze population living in a Galilean village (Northern Israel) on the basis of their low level of circulating albumin. The albumin gene was screened by single-strand conformation polymorphism and heteroduplex analysis, and the mutated region was submitted to DNA sequencing. Both the analbuminemic subjects resulted homozygous for a previously unreported c.1 A>C transversion, for which we suggest the name Afula from the hospital where the two cases were investigated. This mutation causes the loss of the primary start codon ATG for Met1, which is replaced by a - then untranslated - triplet CTG for Leu. (p.Met1Leu). The use of an alternative downstream ATG codon would probably give rise to a completely aberrant polypeptide chain, leading to a misrouted intracellular transport and a premature degradation. The discovery of this new ALB mutation, probably inherited from a common ancestor, sheds light on the molecular mechanism underlying the analbuminemic trait and may serve in the development of a rapid genetic test for the identification of a-symptomatic heterozygous carriers in the Druze population in the Galilee. © 2012 The Authors. European Journal of Clinical Investigation © 2012 Stichting European Society for Clinical Investigation Journal Foundation.

Kinetics of gene and chromosome mutations induced by UV-C in yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Koltovaya, N.; Kokoreva, A.; Senchenko, D.; Shvaneva, N.; Zhuchkina, N.

2017-01-01

The systematic study of the kinetics of UV-induced gene and structural mutations in eukaryotic cells was carried out on the basis of model yeast S. cerevisiae. A variety of genetic assays (all types of base pair substitutions, frameshifts, forward mutations canl, chromosomal and plasmid rearrangements) in haploid strains were used. Yeast cells were treated by UV-C light of fluence of energy up to 200 J/m"2. The kinetics of the induced gene and structural mutations is represented by a linear-quadratic and exponential functions. The slope of curves in log-log plots was not constant, had the value 2-4 and depended on the interval of doses. It was suggested that it is the superposition and dynamics of different pathways form the mutagenic responses of eukaryotic cells to UV-C light that cause the high-order curves. [ru

Clinical follow up of Mexican women with early onset of breast cancer and mutations in the BRCA1 and BRCA2 genes Estudio de seguimiento clínico de mujeres mexicanas con cáncer de mama de inicio temprano y mutaciones en los genes BRCA1 y BRCA2

Directory of Open Access Journals (Sweden)

Ana Laura Calderón-Garcidueñas

2005-04-01

Full Text Available OBJECTIVE: This study describes the presence of mutations in BRCA1 and BRCA2 genes in a group of Mexican women and the clinical evolution of early onset breast cancer (EOBC. MATERIAL AND METHODS: A prospective hospital-based study was performed in a sample of 22 women with EOBC (7 in clinical stage IIA, 8 in IIB, and 7 in IIIA. The patients attended a tertiary care hospital in northeastern Mexico in 1997 and were followed up over a 5-year period. Molecular analysis included: 1 a mutation screening by heteroduplex analysis (HA of BRCA1 and BRCA2 genes and 2 a sequence analysis. RESULTS: Of 22 patients, 14 (63.6% showed a variant band detected by heteroduplex analysis of the BRCA1 and BRCA2 genes: 8 polymorphisms, 4 mutations of uncertain significance, and 2 novel truncated protein mutations, one in BRCA1 (exon 11, 3587delT and the other in the BRCA2 gene (exon 11, 2664InsA. CONCLUSIONS: These findings support future studies to determine the significance and impact of the genetic factor in this Mexican women population.OBJETIVO: Describir la presencia de mutaciones en los genes BRCA1 y BRCA2 y la evolución clínica de un grupo de mujeres con carcinoma mamario de inicio temprano (CMIT. MATERIAL Y MÉTODOS: Se realizó un estudio hospitalario, prospectivo, en una muestra de 22 pacientes con CMIT (siete en etapa clínica IIA, ocho en la IIB y siete en etapa IIIA. Las pacientes fueron atendidas en un hospital del noreste de México en 1997 y se realizó un seguimiento clínico durante cinco años. El análisis molecular incluyó: 1 análisis heterodúplex (AH para detectar bandas variantes en la secuencia de ADN de los genes BRCA1 y BRCA2, y 2 análisis de secuenciación. RESULTADOS: De 22 pacientes, 14 (63.6% mostraron banda variante por AH en los genes BRCA1 y BRCA2: ocho polimorfismos, cuatro mutaciones de significado incierto y dos mutaciones noveles con proteína truncada, una en BRCA1 (exón 11, 3587delT y otra en BRCA2 (exón 11, 2664Ins

Mutations in c10orf11, a melanocyte-differentiation gene, cause autosomal-recessive albinism.

Science.gov (United States)

Grønskov, Karen; Dooley, Christopher M; Østergaard, Elsebet; Kelsh, Robert N; Hansen, Lars; Levesque, Mitchell P; Vilhelmsen, Kaj; Møllgård, Kjeld; Stemple, Derek L; Rosenberg, Thomas

2013-03-07

Autosomal-recessive albinism is a hypopigmentation disorder with a broad phenotypic range. A substantial fraction of individuals with albinism remain genetically unresolved, and it has been hypothesized that more genes are to be identified. By using homozygosity mapping of an inbred Faroese family, we identified a 3.5 Mb homozygous region (10q22.2-q22.3) on chromosome 10. The region contains five protein-coding genes, and sequencing of one of these, C10orf11, revealed a nonsense mutation that segregated with the disease and showed a recessive inheritance pattern. Investigation of additional albinism-affected individuals from the Faroe Islands revealed that five out of eight unrelated affected persons had the nonsense mutation in C10orf11. Screening of a cohort of autosomal-recessive-albinism-affected individuals residing in Denmark showed a homozygous 1 bp duplication in C10orf11 in an individual originating from Lithuania. Immunohistochemistry showed localization of C10orf11 in melanoblasts and melanocytes in human fetal tissue, but no localization was seen in retinal pigment epithelial cells. Knockdown of the zebrafish (Danio rerio) homolog with the use of morpholinos resulted in substantially decreased pigmentation and a reduction of the apparent number of pigmented melanocytes. The morphant phenotype was rescued by wild-type C10orf11, but not by mutant C10orf11. In conclusion, we have identified a melanocyte-differentiation gene, C10orf11, which when mutated causes autosomal-recessive albinism in humans. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia.

Science.gov (United States)

Dzhemileva, Lilya U; Barashkov, Nikolay A; Posukh, Olga L; Khusainova, Rita I; Akhmetova, Vita L; Kutuev, Ildus A; Gilyazova, Irina R; Tadinova, Vera N; Fedorova, Sardana A; Khidiyatova, Irina M; Lobov, Simeon L; Khusnutdinova, Elza K

2010-11-01

Hearing impairment is one of the most common disorders of sensorineural function and the incidence of profound prelingual deafness is about 1 per 1000 at birth. GJB2 gene mutations make the largest contribution to hereditary hearing impairment. The spectrum and prevalence of some GJB2 mutations are known to be dependent on the ethnic origin of the population. This study presents data on the carrier frequencies of major GJB2 mutations, c.35delG, c.167delT and c.235delC, among 2308 healthy persons from 18 various populations of Eurasia: Russians, Bashkirs, Tatars, Chuvashes, Udmurts, Komi-Permyaks and Mordvins (Volga-Ural region of Russia); Belarusians and Ukrainians (East Europe); Abkhazians, Avars, Cherkessians and Ingushes (Caucasus); Kazakhs, Uighurs and Uzbeks (Central Asia); and Yakuts and Altaians (Siberia). The data on c.35delG and c.235delC mutation prevalence in the studied ethnic groups can be used to investigate the prospective founder effect in the origin and prevalence of these mutations in Eurasia and consequently in populations around the world.

Risk factors for development of dementia in a unique six-year cohort study. I. An exploratory, pilot study of involvement of the E4 allele of apolipoprotein E, mutations of the hemochromatosis-HFE gene, type 2 diabetes, and stroke.

Science.gov (United States)

Percy, Maire; Somerville, Martin J; Hicks, Mark; Garcia, Angeles; Colelli, Teresa; Wright, Emily; Kitaygorodsky, Julia; Jiang, Amy; Ho, Valerie; Parpia, Alyssa; Wong, Michael K

2014-01-01

Risk factors for dementia development are not well-defined. We evaluated several factors alone and in combination in a unique cohort of Caucasian volunteers over an approximately 6-year observation window using a nested case/control design. Factors included: apolipoprotein E (ApoE) gene variants (the E4 allele is the strongest confirmed genetic predisposing factor for Alzheimer's disease), the hemochromatosis-HFE gene mutations (H63D and C282Y), diabetes, and stroke. At study entry, subjects were ≥65 years of age (M ± SD = 73.0 ± 4.9), had an MMSE score ≥24, and no evidence of cerebrovascular disease or current depression. Genotyping was completed on 163 available DNA samples from three different groups at the study end: those who still had normal cognitive function; those who had developed dementia; and those with Mild Cognitive Impairment (MCI). Analyses were interpreted at the 95% confidence level without Bonferroni corrections. In the subgroup with dementia, all cases of diabetes were type 2 and present at study entry, whereas all strokes occurred during the study. The results highlight apparently synergistic interactions between genetic and medical risk factors for dementia development, gender differences in risk factors, and involvement of HFE mutations. Having E4 (i.e., either of E3/4 or E4/4), C282Y, H63D, diabetes, or stroke alone did not attain significance. Significant predisposing factors with post-hoc power ≥80% were: E4 homozygosity (E4/4)males+females, odds ratio (OR) = 56.0); E4+diabetes (males+females, OR = 13.7; E4+H63D+diabetes (females, OR = 52.0); E4+stroke (males, OR = 46.5). The importance of preventing diabetes and stroke to ward off dementia and the possible role of iron dysmetabolism in dementia are discussed.

Clinical study of DMD gene point mutation causing Becker muscular dystrophy

Directory of Open Access Journals (Sweden)

Ji-qing CAO

2015-07-01

Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

Aarskog-Scott syndrome: clinical update and report of nine novel mutations of the FGD1 gene.

Science.gov (United States)

Orrico, A; Galli, L; Faivre, L; Clayton-Smith, J; Azzarello-Burri, S M; Hertz, J M; Jacquemont, S; Taurisano, R; Arroyo Carrera, I; Tarantino, E; Devriendt, K; Melis, D; Thelle, T; Meinhardt, U; Sorrentino, V

2010-02-01

Mutations in the FGD1 gene have been shown to cause Aarskog-Scott syndrome (AAS), or facio-digito-genital dysplasia (OMIM#305400), an X-linked disorder characterized by distinctive genital and skeletal developmental abnormalities with a broad spectrum of clinical phenotypes. To date, 20 distinct mutations have been reported, but little phenotypic data are available on patients with molecularly confirmed AAS. In the present study, we report on our experience of screening for mutations in the FGD1 gene in a cohort of 60 European patients with a clinically suspected diagnosis of AAS. We identified nine novel mutations in 11 patients (detection rate of 18.33%), including three missense mutations (p.R402Q; p.S558W; p.K748E), four truncating mutations (p.Y530X; p.R656X; c.806delC; c.1620delC), one in-frame deletion (c.2020_2022delGAG) and the first reported splice site mutation (c.1935+3A>C). A recurrent mutation (p.R656X) was detected in three independent families. We did not find any evidence for phenotype-genotype correlations between type and position of mutations and clinical features. In addition to the well-established phenotypic features of AAS, other clinical features are also reported and discussed. Copyright 2010 Wiley-Liss, Inc.

Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

Energy Technology Data Exchange (ETDEWEB)

Liang, Min [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Guan, Minqiang [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhao, Fuxing; Zhou, Xiangtian [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yuan, Meixia [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Tong, Yi [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); The First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005 (China); Yang, Li [Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229 (United States); Wei, Qi-Ping; Sun, Yan-Hong [Department of Ophthalmology, Dongfang Hospital, Beijing University of Chinese Medicine and Pharmacology, Beijing 100078 (China); Lu, Fan [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Qu, Jia, E-mail: jqu@wzmc.net [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); and others

2009-06-05

We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.

Low frequency of c-MPL gene mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders.

Science.gov (United States)

Ghotaslou, A; Nadali, F; Chahardouli, B; Alizad Ghandforosh, N; Rostami, S H; Alimoghaddam, K; Ghavamzadeh, A

2015-01-01

Myeloproliferative disorders are a group of diseases characterized by increased proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with philadelphia-negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study was to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negativemyeloproliferative disorders. Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD) Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-refractory mutation system (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with Ph-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients.

Severe Clinical Course in a Patient with Congenital Amegakaryocytic Thrombocytopenia Due to a Missense Mutation of the c-MPL Gene.

Science.gov (United States)

Ok Bozkaya, İkbal; Yaralı, Neşe; Işık, Pamir; Ünsal Saç, Rukiye; Tavil, Betül; Tunç, Bahattin

2015-06-01

Congenital amegakaryocytic thrombocytopenia (CAMT) generally begins at birth with severe thrombocytopenia and progresses to pancytopenia. It is caused by mutations in the thrombopoietin receptor gene, the myeloproliferative leukemia virus oncogene (c-MPL). The association between CAMT and c-MPL mutation type has been reported in the literature. Patients with CAMT have been categorized according to their clinical symptoms caused by different mutations. Missense mutations of c-MPL have been classified as type II and these patients have delayed onset of bone marrow failure compared to type I patients. Here we present a girl with severe clinical course of CAMT II having a missense mutation in exon 4 of the c-MPL gene who was admitted to our hospital with intracranial hemorrhage during the newborn period.

Comprehensive Genomic Profiling of 282 Pediatric Low- and High-Grade Gliomas Reveals Genomic Drivers, Tumor Mutational Burden, and Hypermutation Signatures.

Science.gov (United States)

Johnson, Adrienne; Severson, Eric; Gay, Laurie; Vergilio, Jo-Anne; Elvin, Julia; Suh, James; Daniel, Sugganth; Covert, Mandy; Frampton, Garrett M; Hsu, Sigmund; Lesser, Glenn J; Stogner-Underwood, Kimberly; Mott, Ryan T; Rush, Sarah Z; Stanke, Jennifer J; Dahiya, Sonika; Sun, James; Reddy, Prasanth; Chalmers, Zachary R; Erlich, Rachel; Chudnovsky, Yakov; Fabrizio, David; Schrock, Alexa B; Ali, Siraj; Miller, Vincent; Stephens, Philip J; Ross, Jeffrey; Crawford, John R; Ramkissoon, Shakti H

2017-12-01

Pediatric brain tumors are the leading cause of death for children with cancer in the U.S. Incorporating next-generation sequencing data for both pediatric low-grade (pLGGs) and high-grade gliomas (pHGGs) can inform diagnostic, prognostic, and therapeutic decision-making. We performed comprehensive genomic profiling on 282 pediatric gliomas (157 pHGGs, 125 pLGGs), sequencing 315 cancer-related genes and calculating the tumor mutational burden (TMB; mutations per megabase [Mb]). In pLGGs, we detected genomic alterations (GA) in 95.2% (119/125) of tumors. BRAF was most frequently altered (48%; 60/125), and FGFR1 missense (17.6%; 22/125), NF1 loss of function (8.8%; 11/125), and TP53 (5.6%; 7/125) mutations were also detected. Rearrangements were identified in 35% of pLGGs, including KIAA1549-BRAF , QKI-RAF1 , FGFR3-TACC3 , CEP85L-ROS1 , and GOPC-ROS1 fusions. Among pHGGs, GA were identified in 96.8% (152/157). The genes most frequently mutated were TP53 (49%; 77/157), H3F3A (37.6%; 59/157), ATRX (24.2%; 38/157), NF1 (22.2%; 35/157), and PDGFRA (21.7%; 34/157). Interestingly, most H3F3A mutations (81.4%; 35/43) were the variant K28M. Midline tumor analysis revealed H3F3A mutations (40%; 40/100) consisted solely of the K28M variant. Pediatric high-grade gliomas harbored oncogenic EML4-ALK , DGKB-ETV1 , ATG7-RAF1 , and EWSR1-PATZ1 fusions. Six percent (9/157) of pHGGs were hypermutated (TMB >20 mutations per Mb; range 43-581 mutations per Mb), harboring mutations deleterious for DNA repair in MSH6, MSH2, MLH1, PMS2, POLE , and POLD1 genes (78% of cases). Comprehensive genomic profiling of pediatric gliomas provides objective data that promote diagnostic accuracy and enhance clinical decision-making. Additionally, TMB could be a biomarker to identify pediatric glioblastoma (GBM) patients who may benefit from immunotherapy. By providing objective data to support diagnostic, prognostic, and therapeutic decision-making, comprehensive genomic profiling is necessary for

Influence of Diet, Menstruation and Genetic Factors on Iron Status: A Cross-Sectional Study in Spanish Women of Childbearing Age

Directory of Open Access Journals (Sweden)

Ruth Blanco-Rojo

2014-03-01

Full Text Available The aim of this study was to investigate the combined influence of diet, menstruation and genetic factors on iron status in Spanish menstruating women (n = 142. Dietary intake was assessed by a 72-h detailed dietary report and menstrual blood loss by a questionnaire, to determine a Menstrual Blood Loss Coefficient (MBLC. Five selected SNPs were genotyped: rs3811647, rs1799852 (Tf gene; rs1375515 (CACNA2D3 gene; and rs1800562 and rs1799945 (HFE gene, mutations C282Y and H63D, respectively. Iron biomarkers were determined and cluster analysis was performed. Differences among clusters in dietary intake, menstrual blood loss parameters and genotype frequencies distribution were studied. A categorical regression was performed to identify factors associated with cluster belonging. Three clusters were identified: women with poor iron status close to developing iron deficiency anemia (Cluster 1, n = 26; women with mild iron deficiency (Cluster 2, n = 59 and women with normal iron status (Cluster 3, n = 57. Three independent factors, red meat consumption, MBLC and mutation C282Y, were included in the model that better explained cluster belonging (R2 = 0.142, p < 0.001. In conclusion, the combination of high red meat consumption, low menstrual blood loss and the HFE C282Y mutation may protect from iron deficiency in women of childbearing age. These findings could be useful to implement adequate strategies to prevent iron deficiency anemia.

Influence of diet, menstruation and genetic factors on iron status: a cross-sectional study in Spanish women of childbearing age.

Science.gov (United States)

Blanco-Rojo, Ruth; Toxqui, Laura; López-Parra, Ana M; Baeza-Richer, Carlos; Pérez-Granados, Ana M; Arroyo-Pardo, Eduardo; Vaquero, M Pilar

2014-03-06

The aim of this study was to investigate the combined influence of diet, menstruation and genetic factors on iron status in Spanish menstruating women (n = 142). Dietary intake was assessed by a 72-h detailed dietary report and menstrual blood loss by a questionnaire, to determine a Menstrual Blood Loss Coefficient (MBLC). Five selected SNPs were genotyped: rs3811647, rs1799852 (Tf gene); rs1375515 (CACNA2D3 gene); and rs1800562 and rs1799945 (HFE gene, mutations C282Y and H63D, respectively). Iron biomarkers were determined and cluster analysis was performed. Differences among clusters in dietary intake, menstrual blood loss parameters and genotype frequencies distribution were studied. A categorical regression was performed to identify factors associated with cluster belonging. Three clusters were identified: women with poor iron status close to developing iron deficiency anemia (Cluster 1, n = 26); women with mild iron deficiency (Cluster 2, n = 59) and women with normal iron status (Cluster 3, n = 57). Three independent factors, red meat consumption, MBLC and mutation C282Y, were included in the model that better explained cluster belonging (R2 = 0.142, p < 0.001). In conclusion, the combination of high red meat consumption, low menstrual blood loss and the HFE C282Y mutation may protect from iron deficiency in women of childbearing age. These findings could be useful to implement adequate strategies to prevent iron deficiency anemia.

Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

Directory of Open Access Journals (Sweden)

Mehul Mistri

Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

Science.gov (United States)

Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh

2012-01-01

Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

MTHFR Gene C677T Mutation and ACE Gene I/D Polymorphism in Turkish Patients with Osteoarthritis

Directory of Open Access Journals (Sweden)

Ahmet Inanir

2013-01-01

Full Text Available Osteoarthritis is a degenerative joint disorder resulting in destruction of articular cartilage, osteophyte formation, and subchondral bone sclerosis. In recent years, numerous genetic factors have been identified and implicated in osteoarthritis. The aim of the current study was to examine the influence of methylenetetrahydrofolate reductase (MTHFR gene C677T mutation and angiotensin converting enzyme (ACE gene insertion/deletion (I/D variations on the risk of osteoarthritis.

R54C Mutation of NOTCH3 Gene in the First Rungus Family with CADASIL.

Directory of Open Access Journals (Sweden)

Kheng-Seang Lim

Full Text Available Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL is a rare hereditary stroke caused by mutations in NOTCH3 gene. We report the first case of CADASIL in an indigenous Rungus (Kadazan-Dusun family in Kudat, Sabah, Malaysia confirmed by a R54C (c.160C>T, p.Arg54Cys mutation in the NOTCH3. This mutation was previously reported in a Caucasian and two Korean cases of CADASIL. We recruited two generations of the affected Rungus family (n = 9 and found a missense mutation (c.160C>T in exon 2 of NOTCH3 in three siblings. Two of the three siblings had severe white matter abnormalities in their brain MRI (Scheltens score 33 and 50 respectively, one of whom had a young stroke at the age of 38. The remaining sibling, however, did not show any clinical features of CADASIL and had only minimal changes in her brain MRI (Scheltens score 17. This further emphasized the phenotype variability among family members with the same mutation in CADASIL. This is the first reported family with CADASIL in Rungus subtribe of Kadazan-Dusun ethnicity with a known mutation at exon 2 of NOTCH3. The penetrance of this mutation was not complete during the course of this study.

Autosomal mutations affecting Y chromosome loops in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Petrucci Romano

2008-04-01

Full Text Available Abstract Background The Y chromosome of Drosophila melanogaster harbors several genes required for male fertility. The genes for these fertility factors are very large in size and contain conspicuous amounts of repetitive DNA and transposons. Three of these loci (ks-1, kl-3 and kl-5 have the ability to develop giant lampbrush-like loops in primary spermatocytes, a cytological manifestation of their active state in these cells. Y-loops bind a number of non-Y encoded proteins, but the mechanisms regulating their development and their specific functions are still to be elucidated. Results Here we report the results of a screen of 726 male sterile lines to identify novel autosomal genes controlling Y-loop function. We analyzed mutant testis preparations both in vivo and by immunofluorescence using antibodies directed against Y-loop-associated proteins. This screen enabled us to isolate 17 mutations at 15 loci whose wild-type function is required for proper Y-loop morphogenesis. Six of these loci are likely to specifically control loop development, while the others display pleiotropic effects on both loops and meiotic processes such as spermiogenesis, sperm development and maturation. We also determined the map position of the mutations affecting exclusively Y-loop morphology. Conclusion Our cytological screening permitted us to identify novel genetic functions required for male spermatogenesis, some of which show pleiotropic effects. Analysis of these mutations also shows that loop development can be uncoupled from meiosis progression. These data represent a useful framework for the characterization of Y-loop development at a molecular level and for the study of the genetic control of heterochromatin.

A new experimental system for study on adaptive mutations

Institute of Scientific and Technical Information of China (English)

Lü; Zhong; (

2001-01-01

［1］Luria, S. E., Delbrück, M., Mutation of bacteria from virus sensitivity to virus resistance, Genetics, 1943, 28: 491.［2］Lederberg, J., Lederberg, E. M., Replica plating and indirect selection of bacteria mutants, J. Bacteriol., 1952, 63: 399.［3］Carins, J., Overbaugh, J., Miller, S., The origin of mutants, Nature, 1988, 355: 142.［4］Foster, P. L., Adaptive mutation: the uses of adversity, Annu. Rev. Microbiol., 1993, 47: 467.［5］Hall, B. G., Adaptive mutagenesis: a process that generates almost exclusively beneficient mutations, Genetica, 1998, 102/103: 109.［6］Kasak, L., Horak, R., Kivisaar, M., Promotor-creating mutations in Psuedmonas putida: A model system for the study of mutation in starving bacteria, PNAS, 1997, 94: 3134.［7］Steele, D. F., Jinks-Robertson, An examination of adaptive reversion in Saccharomyces cerevisiae, Genetics, 1992, 132: 9.［8］Davis, R. W., Botstein, Roth, J. R., Advanced Bacterial Genetics--A Manual for Genetic Engineering, New York: Cold Spring Harbor Laboratory Press, 1980, 13.［9］Miller, J. H., Experiments in Molecular Genetics, New York: Cold Spring Harbor Laboratory Press, 1972, 352.［10］ Lea, D. E., Coulson, C. A., The distribution of the numbers of mutants in bacterial populations, J. Genetics, 1949, 49: 264.［11］ Hughes, K. T., Roth, J. R., Transitory cis complementation: a method for provided transposition function to defective transposons, Genetics, 1988, 119: 9.［12］ Sanderson, K. E., Roth J., Linkage map of Salmonella typhimurium, Microbiol. Rev., 1988, 52: 485.［13］ He, B., Shiau, A., Choi, K. Y., Genes of the E. coli pur region are negatively controlled by a repressor-operator interaction, J. Bacteriol., 1990, 172: 4555.［14］ Liu, B., Huang, Y., Wang, A. Q., Regulation of purine biosynthetic genes expression in Salmonella typhimurium (IV)--Oc mutation site of purG and its function analysis, Science in China, Ser. C, 1997, 40(3): 238.［15］ Tang, H., Qin, J. C., Wang, A. Q

c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness.

Science.gov (United States)

Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak

2016-02-01

Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

Science.gov (United States)

Wimmer, Katharina; Wernstedt, Annekatrin

2014-01-01

The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

Glucokinase gene mutations (MODY 2) in Asian Indians.

Science.gov (United States)

Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

2014-03-01

Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

Nuclear envelope alterations in fibroblasts from LGMD1B patients carrying nonsense Y259X heterozygous or homozygous mutation in lamin A/C gene.

NARCIS (Netherlands)

Muchir, A.; Engelen, B.G.M. van; Lammens, M.M.Y.; Mislow, J.M.; McNally, E.; Schwartz, K.; Bonne, G.

2003-01-01

Mutations in the LMNA gene encoding nuclear lamins A and C are responsible for seven inherited disorders affecting specific tissues. We have analyzed skin fibroblasts from a patient with type 1B limb-girdle muscular dystrophy and from her deceased newborn grandchild carrying, respectively, a

Altered Gene-Regulatory Function of KDM5C by a Novel Mutation Associated With Autism and Intellectual Disability.

Science.gov (United States)

Vallianatos, Christina N; Farrehi, Clara; Friez, Michael J; Burmeister, Margit; Keegan, Catherine E; Iwase, Shigeki

2018-01-01

Intellectual disability (ID) affects up to 2% of the population world-wide and often coincides with other neurological conditions such as autism spectrum disorders. Mutations in KDM5C cause Mental Retardation, X-linked, Syndromic, Claes-Jensen type (MRXSCJ, OMIM #300534) and are one of the most common causes of X-linked ID. KDM5C encodes a histone demethylase for di- and tri-methylated histone H3 lysine 4 (H3K4me2/3), which are enriched in transcriptionally engaged promoter regions. KDM5C regulates gene transcription; however, it remains unknown whether removal of H3K4me is fully responsible for KDM5C-mediated gene regulation. Most mutations functionally tested to date result in reduced enzymatic activity of KDM5C, indicating loss of demethylase function as the primary mechanism underlying MRXSCJ. Here, we report a novel KDM5C mutation, R1115H, identified in an individual displaying MRXSCJ-like symptoms. The carrier mother's cells exhibited a highly skewed X-inactivation pattern. The KDM5C-R1115H substitution does not have an impact on enzymatic activity nor protein stability. However, when overexpressed in post-mitotic neurons, KDM5C-R1115H failed to fully suppress expression of target genes, while the mutant also affected expression of a distinct set of genes compared to KDM5C-wildtype. These results suggest that KDM5C may have non-enzymatic roles in gene regulation, and alteration of these roles contributes to MRXSCJ in this patient.

Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

Science.gov (United States)

Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

2014-12-15

Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

Frekvensen af haemokromatoseassocierede mutationer i haemokromatosegenet i den danske befolkning. ØsterbroundersØgelsen

DEFF Research Database (Denmark)

Larsen, Lisbeth Enggaard; Ellervik, Christina; Appleyard, Merete

2002-01-01

INTRODUCTION: Hereditary haemochromatosis is an autosomal recessive condition characterised by systemic iron overload. In Northern Europe, 85-90% of patients with haemochromatosis are homozygous for the C282Y mutation in the HFE gene. In the present study, we determined the prevalence...

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

Science.gov (United States)

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

Science.gov (United States)

Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

2011-05-01

Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

Mutations of the phenylalanine hydroxylase gene in patients with phenylketonuria in Shanxi, China

Directory of Open Access Journals (Sweden)

Yong-An Zhou

2012-01-01

Full Text Available The variation in mutations in exons 3, 6, 7, 11 and 12 of the phenylalanine hydroxylase (PAH gene was investigated in 59 children with phenylketonuria (PKU and 100 normal children. Three single nucleotide polymorphisms were detected by sequence analysis. The mutational frequencies of cDNA 696, cDNA 735 and cDNA 1155 in patients were 96.2%, 76.1% and 7.6%, respectively, whereas in healthy children the corresponding frequencies were 97.0%, 77.3% and 8.3%. In addition, 81 mutations accounted for 61.0% of the mutant alleles. R111X, H64 > TfsX9 and S70 del accounted for 5.1%, 0.8% and 0.8% mutation of alleles in exon 3, whereas EX6-96A > G accounted for 10.2% mutation of alleles in exon 6. R243Q had the highest incidence in exon 7 (12.7%, followed by Ivs7 +2T>A (5.1% and T278I (2.5%. G247V, R252Q, L255S, R261Q and E280K accounted for 0.8% while Y356X and V399V accounted for 5.9% and 5.1%, respectively, in exon 11. R413P and A434D accounted for 5.9% and 2.5%, respectively, in exon 12. Seventy-two variant alleles accounted for the 16 mutations observed here. The mutation characteristics and distributions demonstrated that EX6-96A > G and R243Q were the hot regions for mutations in the PAH gene in Shanxi patients with PKU.

HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

Directory of Open Access Journals (Sweden)

Luis COSTA-MATOS

2013-03-01

Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05, but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI: 2.09-142.34, P = 0.008. However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003. Conclusions ALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no

Determination of D816V mutation in the c-kIt gene in the Slovenian patients with acute myeloid leukemia and systemic mastocytosis

Directory of Open Access Journals (Sweden)

Martina Fink

2012-12-01

Full Text Available Background: D816V mutation in the C-KIT gene is present in more than 90 % of patients with systemic mastocytosis (SM and 2–7 % of patients with acute myeloid leukemia (AML. D816V mutation is caused by the substitution of adenine with thymine at 2447 nucleotide sequence in the C-KIT gene. This nucleotide substitution causes the replacment of aspartate acid by valine at codon 816 of the KIT protein. KIT protein with D816V mutation acts as constitutively active tyrosine kinase that promotes cell proliferation and inhibits apoptosis. The purpose of our study was to determine the incidence of D816V mutation in the C-KIT gene in Slovenian patients with AML and in patients with suspected systemic mastocytosis. Patients and methods: In the retrospective study, 71 patients with AML and 25 patients with suspected systemic mastocytosis were included. D816V mutation in the C-KIT gene was determined by polymerase chain reaction (PCR and the resulting PCR products were analyzed by agarose gel electrophoresis. Results: D816V mutation in KIT protein was determined in 7 % of patients with AML and in 32 % patients with suspected systemic mastocytosis. Conclusions: Identification of D816V mutation in the C-KIT gene must always be performed in patients with suspected systemic mastocytosis. The determination of this mutation contributes to the diagnosis and treatment selection. The finding of D816V mutation in the C-KIT gene in patients with AML and concomitant genetic modifications RUNX-RUNX1T1 (typical translocation t(8; 21 (q22, q22 or CBFB-MYH11, which is the result of inversion on chromosome 16–(inv (16 (p13, q22, however, indicates a faster, more aggressive course of the disease and predicts a worse outcome. The finding of the mutation in other patients with AML may indicate the presence of concomitant AML and SM, which was not found in our patients.

Possible association of the Plasmodium falciparum T1526C resa2 gene mutation with severe malaria

Directory of Open Access Journals (Sweden)

Durand Rémy

2012-04-01

Full Text Available Abstract Background Plasmodium falciparum exports proteins that remodel the erythrocyte membrane. One such protein, called Pf155/RESA (RESA1 contributes to parasite fitness, optimizing parasite survival during febrile episodes. Resa1 gene is a member of a small family comprising three highly related genes. Preliminary evidence led to a search for clues indicating the involvement of RESA2 protein in the pathophysiology of malaria. In the present study, cDNA sequence of resa2 gene was obtained from two different strains. The proportion of P. falciparum isolates having a non-stop T1526C mutation in resa2 gene was evaluated and the association of this genotype with severity of malaria was investigated. Methods Resa2 cDNAs of two different strains (a patient isolate and K1 culture adapted strain was obtained by RT-PCR and DNA sequencing was performed to confirm its gene structure. The proportion of isolates having a T1526C mutation was evaluated using a PCR-RFLP methodology on groups of severe malaria and uncomplicated patients recruited in 1991–1994 in Senegal and in 2009 in Benin. Results A unique ORF with an internal translation stop was found in the patient isolate (Genbank access number : JN183870, while the K1 strain harboured the T1526C mutation (Genbank access number : JN183869 which affects the internal stop codon and restores a full length coding sequence. About 14% of isolates obtained from Senegal and Benin harboured mutant T1526C parasites. Some isolates had both wild and mutant resa alleles. The analysis excluding those mixed isolates showed that the resa2 T1526C mutation was found more frequently in severe malaria cases than in uncomplicated cases (p = 0.008. The association of the presence of the mutant allele and parasitaemia >4% was shown in multivariate analysis (p = 0.03 in the group of Beninese children. Conclusions All T1526C mutant parasites theoretically have the ability to give rise to a full-length RESA2 protein

A novel nonsense mutation of the GPR143 gene identified in a Chinese pedigree with ocular albinism.

Directory of Open Access Journals (Sweden)

Naihong Yan

Full Text Available BACKGROUND: The purpose of this study was to elucidate the molecular basis of ocular albinism type I in a Chinese pedigree. METHODOLOGY/PRINCIPAL FINDINGS: Complete ophthalmologic examinations were performed on 4 patients, 7 carriers and 17 unaffected individuals in this five-generation family. All coding exons of four-point-one (4.1, ezrin, radixin, moesin (FERM domain-containing 7 (FRMD7 and G protein-coupled receptor 143 (GPR143 genes were amplified by polymerase chain reaction (PCR, sequenced and compared with a reference database. Ocular albinism and nystagmus were found in all patients of this family. Macular hypoplasia was present in the patients including the proband. A novel nonsense hemizygous mutation c.807T>A in the GPR143 gene was identified in four patients and the heterozygous mutation was found in seven asymptomatic individuals. This mutation is a substitution of tyrosine for adenine which leads to a premature stop codon at position 269 (p.Y269X of GPR143. CONCLUSIONS/SIGNIFICANCE: This is the first report that p.Y269X mutation of GPR143 gene is responsible for the pathogenesis of familial ocular albinism. These results expand the mutation spectrum of GPR143, and demonstrate the clinical characteristics of ocular albinism type I in Chinese population.

Analysis of MYO7A in a Moroccan family with Usher syndrome type 1B: novel loss-of-function mutation and non-pathogenicity of p.Y1719C.

Science.gov (United States)

Boulouiz, Redouane; Li, Yun; Abidi, Omar; Bolz, Hanno; Chafik, Abdelaziz; Kubisch, Christian; Roub, Hassan; Wollnik, Bernd; Barakat, Abdelhamid

2007-10-02

Mutations in the MYO7A gene are responsible for Usher syndrome type 1B (USH1B), the most common USH1 subtype, which accounts for the largest proportion of USH1 cases in most populations. Molecular genetic diagnosis in Usher syndrome is well established and identification of the underlying mutations in Usher patients is important for confirmation of the clinical diagnosis and genetic counseling. We analyzed a large consanguineous USH1 family from Morocco and linked the disease in this family to the MYO7A/USH1B locus. We identified the frequently described missense change p.Y1719C. In addition, we found the homozygous c.1687G>A mutation in the last nucleotide of exon 14, which is predicted to result in aberrant splicing and may lead to loss of MYO7A transcript. We further showed that p.Y1719C is not disease-causing but does represent a frequent polymorphism in the Moroccan population, with an estimated carrier frequency of 0.07. This finding has an important impact for molecular diagnosis and genetic counseling in USH1B families.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Science.gov (United States)

Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

2017-01-01

Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Directory of Open Access Journals (Sweden)

Sang Y Lee

Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

New Mutation Identified in the SRY Gene High Mobility Group (HMG

Directory of Open Access Journals (Sweden)

Feride İffet Şahin

2013-06-01

Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

Directory of Open Access Journals (Sweden)

Fernanda Veronese Oliveira

2014-01-01

Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

Science.gov (United States)

Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

2016-08-01

To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT) Among Romani Patients from the Balkan Region

OpenAIRE

Marija Dimishkovska; Vjosa Mulliqi Kotori; Zoran Gucev; Svetlana Kocheva; Momir Polenakovic; Dijana Plaseska-Karanfilska

2018-01-01

Background: Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%), FANCC (10-15%), FANCG (~10%) or FANCD2 (3-6%) genes. We have already reported the FANCA variant c.190–256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in t...

Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT) Among Romani Patients from the Balkan Region.

Science.gov (United States)

Dimishkovska, Marija; Kotori, Vjosa Mulliqi; Gucev, Zoran; Kocheva, Svetlana; Polenakovic, Momir; Plaseska-Karanfilska, Dijana

2018-01-20

Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%), FANCC (10-15%), FANCG (~10%) or FANCD2 (3-6%) genes. We have already reported the FANCA variant c.190-256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in two patients from Macedonia and Kosovo. The novel FANCA mutation c.3446_3449dupCCCT was identified in two fanconi anemia patients with Romany ethnicity; a 2-year-old girl from Macedonia who is a compound heterozygote for a previously reported FANCA c.190-256_283+1680del2040dupC and the novel mutation and a 10-year-old girl from Kosovo who is a homozygote for the novel FANCA c.3446_3449dupCCCT mutation. The novel mutation is located in exon 35 in the FAAP20-binding domain which plays a crucial role in the FANCA -FAAP20 interaction and is required for integrity of the fanconi anemia pathway. The finding of the FANCA c.3446_3449dupCCCT mutation in two unrelated FA patients with Romani ethnicity from Macedonia and Kosovo suggests it is a founder mutation in the Romani population living in the Balkan region.

Intrafamilial Variability of Early-Onset Diabetes due to an INS Mutation

DEFF Research Database (Denmark)

Fredheim, Siri; Svensson, Jannet; Pørksen, Sven

2011-01-01

Aim. The objective of this study was to describe the clinical characteristics of two siblings and their father carrying a C95Y mutation in the insulin (INS) gene. Methods/Results. A Danish patient, his sister, and his father were identified to carry the C95Y mutation in the preproinsulin molecule...... children. The father, insulin treated for over 40 years, has bilateral preproliferative retinopathy. Conclusions. These three cases further confirm the essential features of diabetes caused by INS mutations with proteotoxic effect. We conclude that patients with similar features must be investigated...... for mutations of INS gene....

Novel compound heterozygous mutations in the GPR98 (USH2C) gene identified by whole exome sequencing in a Moroccan deaf family.

Science.gov (United States)

Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid

2017-10-01

In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.

Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

Science.gov (United States)

Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

2015-01-01

Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

HLA haplotype map of river valley populations with hemochromatosis traced through five centuries in Central Sweden.

Science.gov (United States)

Olsson, K Sigvard; Ritter, Bernd; Hansson, Norbeth; Chowdhury, Ruma R

2008-07-01

The hemochromatosis mutation, C282Y of the HFE gene, seems to have originated from a single event which once occurred in a person living in the north west of Europe carrying human leukocyte antigen (HLA)-A3-B7. In descendants of this ancestor also other haplotypes appear probably caused by local recombinations and founder effects. The background of these associations is unknown. Isolated river valley populations may be fruitful for the mapping of genetic disorders such as hemochromatosis. In this study, we try to test this hypothesis in a study from central Sweden where the haplotyope A1-B8 was common. HLA haplotypes and HFE mutations were studied in hemochromatosis patients with present or past parental origin in a sparsely populated (1/km(2)) rural district (n = 8366 in the year of 2005), in central Sweden. Pedigrees were constructed from the Swedish church book registry. Extended haplotypes were studied to evaluate origin of recombinations. There were 87 original probands, 36 females and 51 males identified during 30 yr, of whom 86% carried C282Y/C282Y and 14% C282Y/H63D. Of 32 different HLA haplotypes A1-B8 was the most common (34%), followed by A3-B7 (16%), both in strong linkage disequilibrium with controls, (P females. River valley populations may contain HLA haplotypes reflecting their demographic history. This study has demonstrated that the resistance against recombinations between HLA-A and HFE make HLA haplotypes excellent markers for population movements. Founder effects and genetic drift from bottleneck populations (surviving the plague?) may explain the commonness of the mutation in central Scandinavia. The intergenerational time difference >30 yr was greater than expected and means that the age of the original mutation may be underestimated.

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

Science.gov (United States)

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

DEFF Research Database (Denmark)

Riess, O; Noerremoelle, A; Weber, B

1992-01-01

The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons...

Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

Science.gov (United States)

Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

2001-10-01

Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT Among Romani Patients from the Balkan Region

Directory of Open Access Journals (Sweden)

Marija Dimishkovska

2018-02-01

Full Text Available Background: Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%, FANCC (10-15%, FANCG (~10% or FANCD2 (3-6% genes. We have already reported the FANCA variant c.190–256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in two patients from Macedonia and Kosovo. Case Report: The novel FANCA mutation c.3446_3449dupCCCT was identified in two fanconi anemia patients with Romany ethnicity; a 2-year-old girl from Macedonia who is a compound heterozygote for a previously reported FANCA c.190-256_283+1680del2040dupC and the novel mutation and a 10-year-old girl from Kosovo who is a homozygote for the novel FANCA c.3446_3449dupCCCT mutation. The novel mutation is located in exon 35 in the FAAP20-binding domain which plays a crucial role in the FANCA-FAAP20 interaction and is required for integrity of the fanconi anemia pathway. Conclusion: The finding of the FANCA c.3446_3449dupCCCT mutation in two unrelated FA patients with Romani ethnicity from Macedonia and Kosovo suggests it is a founder mutation in the Romani population living in the Balkan region

Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

Directory of Open Access Journals (Sweden)

Marianna P.R. Porto

2010-01-01

Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family.

Science.gov (United States)

Zhang, Xin-Yu; Jiang, Wei-Ying; Chen, Lu-Ming; Chen, Su-Qin

2013-01-01

To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND). Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP) gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF) prediction were also undertaken. Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2). The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids. A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation.

A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

Directory of Open Access Journals (Sweden)

NING Huibin

2017-01-01

Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

Association between nucleotide mutation of eNOS gene and serum ...

African Journals Online (AJOL)

Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

Presence of c.3956delC mutation in familial adenomatous polyposis patients from Brazil.

Science.gov (United States)

Moreira-Nunes, Caroline Aquino; Alcântara, Diego di Felipe Ávila; Lima-Júnior, Sérgio Figueiredo; Cavalléro, Sandro Roberto de Araújo; Rey, Juan Antonio; Pinto, Giovanny Rebouças; de Assumpção, Paulo Pimentel; Burbano, Rommel Rodriguez

2015-08-21

To characterize APC gene mutations and correlate them with patient phenotypes in individuals diagnosed with familial adenomatous polyposis (FAP) in northern Brazil. A total of 15 individuals diagnosed with FAP from 5 different families from the north of Brazil were analyzed in this study. In addition to patients with histopathological diagnosis of FAP, family members who had not developed the disease were also tested in order to identify mutations and for possible genetic counseling. All analyzed patients or their guardians signed a consent form approved by the Research Ethics Committee of the João de Barros Barreto University Hospital (Belem, Brazil). DNA extracted from the peripheral blood of a member of each of the affected families was subjected to direct sequencing. The proband of each family was sequenced to identify germline mutations using the Ion Torrent platform. To validate the detected mutations, Sanger sequencing was also performed. The samples from all patients were also tested for the identification of mutations by real-time quantitative polymerase chain reaction using the amplification refractory mutation system. Through interviews with relatives and a search of medical records, it was possible to construct genograms for three of the five families included in the study. All 15 patients from the five families with FAP exhibited mutations in the APC gene, and all mutations were detected in exon 15 of the APC gene. In addition to the patients with a histological diagnosis of FAP, family members without disease symptoms showed the mutation in the APC gene. In the present study, we detected two of the three most frequent germline mutations in the literature: the mutation at codon 1309 and the mutation at codon 1061. The presence of c.3956delC mutation was found in all families from this study, and suggests that this mutation was introduced in the population of the State of Pará through ancestor immigration (i.e., a de novo mutation that arose in one

Substitution rates in the X- and Y-linked genes of the plants, Silene latifolia and S. dioica.

Science.gov (United States)

Filatov, Dmitry A; Charlesworth, Deborah

2002-06-01

Theory predicts that selection should be less effective in the nonrecombining genes of Y-chromosomes, relative to the situation for genes on the other chromosomes, and this should lead to the accumulation of deleterious nonsynonymous substitutions. In addition, synonymous substitution rates may differ between X- and Y-linked genes because of the male-driven evolution effect and also because of actual differences in per-replication mutation rates between the sex chromosomes. Here, we report the first study of synonymous and nonsynonymous substitution rates on plant sex chromosomes. We sequenced two pairs of sex-linked genes, SlX1-SlY1 and SlX4-SlY4, from dioecious Silene latifolia and S. dioica, and their non-sex-linked homologues from nondioecious S. vulgaris and Lychnis flos-jovis, respectively. The rate of nonsynonymous substitutions in the SlY4 gene is significantly higher than that in the SlX4 gene. Silent substitution rates are also significantly higher in both Y-linked genes, compared with their X-linked homologues. The higher nonsynonymous substitution rate in the SlY4 gene is therefore likely to be caused by a mutation rate difference between the sex chromosomes. The difference in silent substitution rates between the SlX4 and SlY4 genes is too great to be explained solely by a higher per-generation mutation rate in males than females. It is thus probably caused by a difference in per-replication mutation rates between the sex chromosomes. This suggests that the local mutation rate can change in a relatively short evolutionary time.

Three novel and two known androgen receptor gene mutations ...

Indian Academy of Sciences (India)

gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

Science.gov (United States)

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family

Directory of Open Access Journals (Sweden)

Xin-Yu Zhang

2013-12-01

Full Text Available AIM:To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND.METHODS:Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF prediction were also undertaken.RESULTS:Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2. The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids.CONCLUSION:A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation.

Ethnic disparity in 21-hydroxylase gene mutations identified in Pakistani congenital adrenal hyperplasia patients

Directory of Open Access Journals (Sweden)

Jabbar Abdul

2011-02-01

Full Text Available Abstract Background Congenital adrenal hyperplasia (CAH is a group of autosomal recessive disorders caused by defects in the steroid 21 hydroxylase gene (CYP21A2. We studied the spectrum of mutations in CYP21A2 gene in a multi-ethnic population in Pakistan to explore the genetics of CAH. Methods A cross sectional study was conducted for the identification of mutations CYP21A2 and their phenotypic associations in CAH using ARMS-PCR assay. Results Overall, 29 patients were analyzed for nine different mutations. The group consisted of two major forms of CAH including 17 salt wasters and 12 simple virilizers. There were 14 phenotypic males and 15 females representing all the major ethnic groups of Pakistan. Parental consanguinity was reported in 65% cases and was equally distributed in the major ethnic groups. Among 58 chromosomes analyzed, mutations were identified in 45 (78.6% chromosomes. The most frequent mutation was I2 splice (27% followed by Ile173Asn (26%, Arg 357 Trp (19%, Gln319stop, 16% and Leu308InsT (12%, whereas Val282Leu was not observed in this study. Homozygosity was seen in 44% and heterozygosity in 34% cases. I2 splice mutation was found to be associated with SW in the homozygous. The Ile173Asn mutation was identified in both SW and SV forms. Moreover, Arg357Trp manifested SW in compound heterozygous state. Conclusion Our study showed that CAH exists in our population with ethnic difference in the prevalence of mutations examined.

Complex phenotype linked to a mutation in exon 11 of the lamin A/C gene: Hypertrophic cardiomyopathy, atrioventricular block, severe dyslipidemia and diabetes.

Science.gov (United States)

Francisco, Ana Rita G; Santos Gonçalves, Inês; Veiga, Fátima; Mendes Pedro, Mónica; Pinto, Fausto J; Brito, Dulce

2017-09-01

The lamin A/C (LMNA) gene encodes lamins A and C, which have an important role in nuclear cohesion and chromatin organization. Mutations in this gene usually lead to the so-called laminopathies, the primary cardiac manifestations of which are dilated cardiomyopathy and intracardiac conduction defects. Some mutations, associated with lipodystrophy but not cardiomyopathy, have been linked to metabolic abnormalities such as diabetes and severe dyslipidemia. Herein we describe a new phenotype associated with a mutation in exon 11 of the LMNA gene: hypertrophic cardiomyopathy, atrioventricular block, severe dyslipidemia and diabetes. A 64-year-old woman with hypertrophic cardiomyopathy and a point mutation in exon 11 of the LMNA gene (c.1718C>T, Ser573Leu) presented with severe symptomatic ventricular hypertrophy and left ventricular outflow tract obstruction. She underwent septal alcohol ablation, followed by Morrow myectomy. The patient was also diagnosed with severe dyslipidemia, diabetes and obesity, and fulfilled diagnostic criteria for metabolic syndrome. No other characteristics of LMNA mutation-related phenotypes were identified. The development of type III atrioventricular block with no apparent cause, and mildly depressed systolic function, prompted referral for cardiac resynchronization therapy. In conclusion, the association between LMNA mutations and different phenotypes is complex and not fully understood, and can present with a broad spectrum of severity. Copyright © 2017 Sociedade Portuguesa de Cardiologia. Publicado por Elsevier España, S.L.U. All rights reserved.

Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.

Directory of Open Access Journals (Sweden)

Jian Wang

Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.

Two novel mutations of CLCN7 gene in Chinese families with autosomal dominant osteopetrosis (type II).

Science.gov (United States)

Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin

2016-07-01

Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense

Geographical distribution of β-globin gene mutations in Syria.

Science.gov (United States)

Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

2018-04-11

Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

HPRT gene mutation frequency and the factor of influence in adult peripheral blood lymphocytes

International Nuclear Information System (INIS)

Zhao Jingyong; Zheng Siying; Cui Fengmei; Wang Liuyi; Lao Qinhua; Wu Hongliang

2002-01-01

Objective: To study the HPRT gene loci mutation frequencies and the factor of influence in peripheral blood lymphocytes of adult with ages ranging from 21-50. Methods: HPRT gene mutation frequency (GMf) were examined by the technique of multinuclear cell assay. Relation between GMf and years were fitted with a computer. Results: Relation could be described by the following equation: y = 0.7555 + 0.0440x, r = 0.9829. Smoking has influence on GMf and sex hasn't. Conclusion: HPRT gene mutation frequency increases with increasing of age. Increasing rate is 0.00440% per year

[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

Science.gov (United States)

Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

2017-08-10

To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead

International Nuclear Information System (INIS)

Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

2015-01-01

The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25–63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead–exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. Conclusion. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers

A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report.

Science.gov (United States)

Shi, Yunfang; Li, Xiaozhou; Ju, Duan; Li, Yan; Zhang, Xiuling; Zhang, Ying

2016-04-01

Waardenburg syndrome (WS) is an autosomal dominant disorder with varying degrees of sensorineural hearing loss, and accumulation of pigmentation in hair, skin and iris. There are four types of WS (WS1-4) with differing characteristics. Mutations in six genes [paired box gene 3 ( PAX3 ), microphthalmia-associated transcription factor ( MITF ), endothelin 3 ( END3 ), endothelin receptor type B ( EDNRB ), SRY (sex determining region Y)-box 10 ( SOX10 ) and snail homolog 2 ( SNAI2 )] have been identified to be associated with the various types. This case report describes the investigation of genetic mutations in three patients with WS2 from a single family. Genomic DNA was extracted, and the six WS-related genes were sequenced using next-generation sequencing technology. In addition to mutations in PAX3, EDNRB and SOX10, a novel heterozygous MITF mutation, p.Δ315Arg (c.944_946delGAA) on exon 8 was identified. This is predicted to be a candidate disease-causing mutation that may affect the structure and function of the enzyme.

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients

OpenAIRE

Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

2016-01-01

Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among t...

The origin of the p.E180 growth hormone receptor gene mutation.

Science.gov (United States)

Ostrer, Harry

2016-06-01

Laron syndrome, an autosomal recessive condition of extreme short stature, is caused by the absence or dysfunction of the growth hormone receptor. A recurrent mutation in the GHR gene, p.E180, did not alter the encoded amino acid, but activated a cryptic splice acceptor resulting in a receptor protein with an 8-amino acid deletion in the extracellular domain. This mutation has been observed among Sephardic Jews and among individuals in Ecuador, Brazil and Chile, most notably in a large genetic isolate in Loja, Ecuador. A common origin has been postulated based on a shared genetic background of markers flanking this mutation, suggesting that the Lojanos (and others) may have Sephardic (Converso) Jewish ancestry. Analysis of the population structure of Lojanos based on genome-wide analysis demonstrated European, Sephardic Jewish and Native American ancestry in this group. X-autosomal comparison and monoallelic Y chromosomal and mitochondrial genetic analysis demonstrated gender-biased admixture between Native American women and European and Sephardic Jewish men. These findings are compatible with the co-occurrence of the Inquisition and the colonization of the Americas, including Converso Jews escaping the Inquisition in the Iberian Peninsula. Although not found among Lojanos, Converso Jews also brought founder mutations to contemporary Hispanic and Latino populations in the BRCA1 (c.68_69delAG) and BLM (c.2207_2212delATCTGAinsTAGATTC) genes. Copyright © 2015 Elsevier Ltd. All rights reserved.

DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

Science.gov (United States)

Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

2006-02-01

Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

Science.gov (United States)

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

NDP gene mutations in 14 French families with Norrie disease.

Science.gov (United States)

Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

2003-12-01

Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

A novel c.240_241insGG mutation in NDP gene in a family with Norrie disease.

Science.gov (United States)

Andarva, Monavvar; Jamshidi, Javad; Ghaedi, Hamid; Daftarian, Narsis; Emamalizadeh, Babak; Alehabib, Elham; Taghavi, Shaghyegh; Pouriran, Ramin; Darvish, Hossein

2018-03-01

Norrie disease (ND) is a rare, X-linked recessive disorder with the main characteristic of early childhood blindness. The aim of the present study was to identify the genetic cause of the disease and the phenotypic characteristics of the patients in an Iranian family with four affected males with ND. Norrie disease pseudoglioma (NDP) gene was sequenced and clinical examination was performed on patients. A GG dinucleotide insertion in exon 3 (c.240_241insGG) of NDP was detected in all patients. The mutation caused a frameshift and an early stop codon (p.Phe81Glyfs*23). A novel mutation was found in the NDP gene in the affected males of the family. As the mutation was absent in the normal male members of the family, it should be the genetic cause of the disease. © 2017 Optometry Australia.

Two novel mutations in the EYS gene are possible major causes of autosomal recessive retinitis pigmentosa in the Japanese population.

Directory of Open Access Journals (Sweden)

Katsuhiro Hosono

Full Text Available Retinitis pigmentosa (RP is a highly heterogeneous genetic disease including autosomal recessive (ar, autosomal dominant (ad, and X-linked inheritance. Recently, arRP has been associated with mutations in EYS (Eyes shut homolog, which is a major causative gene for this disease. This study was conducted to determine the spectrum and frequency of EYS mutations in 100 Japanese arRP patients. To determine the prevalence of EYS mutations, all EYS exons were screened for mutations by polymerase chain reaction amplification, and sequence analysis was performed. We detected 67 sequence alterations in EYS, of which 21 were novel. Of these, 7 were very likely pathogenic mutations, 6 were possible pathogenic mutations, and 54 were predicted non-pathogenic sequence alterations. The minimum observed prevalence of distinct EYS mutations in our study was 18% (18/100, comprising 9 patients with 2 very likely pathogenic mutations and the remaining 9 with only one such mutation. Among these mutations, 2 novel truncating mutations, c.4957_4958insA (p.S1653KfsX2 and c.8868C>A (p.Y2956X, were identified in 16 patients and accounted for 57.1% (20/35 alleles of the mutated alleles. Although these 2 truncating mutations were not detected in Japanese patients with adRP or Leber's congenital amaurosis, we detected them in Korean arRP patients. Similar to Japanese arRP results, the c.4957_4958insA mutation was more frequently detected than the c.8868C>A mutation. The 18% estimated prevalence of very likely pathogenic mutations in our study suggests a major involvement of EYS in the pathogenesis of arRP in the Japanese population. Mutation spectrum of EYS in 100 Japanese patients, including 13 distinct very likely and possible pathogenic mutations, was largely different from the previously reported spectrum in patients from non-Asian populations. Screening for c.4957_4958insA and c.8868C>A mutations in the EYS gene may therefore be very effective for the genetic testing

Screening for mutations in two exons of FANCG gene in Pakistani population.

Science.gov (United States)

Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

2017-06-01

Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

Science.gov (United States)

Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

2017-01-01

Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

Science.gov (United States)

Fukuda, H; Hiramatsu, K

1997-05-01

Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

Science.gov (United States)

Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

2018-05-31

Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

Science.gov (United States)

Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

2014-06-01

Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

OpenAIRE

Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

2014-01-01

As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

Ocular phenotypes associated with two mutations (R121W, C126X) in the Norrie disease gene.

Science.gov (United States)

Kellner, U; Fuchs, S; Bornfeld, N; Foerster, M H; Gal, A

1996-06-01

To describe the ocular phenotypes associated with 2 mutations in the Norrie disease gene including a manifesting carrier. Ophthalmological examinations were performed in 2 affected males and one manifesting carrier. Genomic DNA was analyzed by direct sequencing of the Norrie disease gene. Family I: A 29-year-old male had the right eye enucleated at the age of 3 years. His left eye showed severe temporal dragging of the retina and central scars. Visual acuity was 20/300. DNA analysis revealed a C-to-T transition of the first nucleotide in codon 121 predicting the replacement of arginine-121 by tryptophan (R121W). Both the mother and maternal grandmother carry the same mutation in heterozygous form. Family 2: A 3-month-old boy presented with severe temporal dragging of the retina on both eyes and subsequently developed retinal detachment. Visual acuity was limited to light perception. His mother's left eye was amaurotic and phthitic. Her right eye showed severe retinal dragging, visual acuity was reduced to 20/60. DNA analysis revealed a T-to-A transversion of the third nucleotide in codon 126 creating a stop codon (C126X). The mother and maternal grandmother were carriers. Mutations in the Norrie disease gene can lead to retinal malformations of variable severity both in hemizygous males and manifesting carriers.

Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

Energy Technology Data Exchange (ETDEWEB)

Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)

2008-05-01

The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

Directory of Open Access Journals (Sweden)

Avani Solanki

Full Text Available Fanconi anemia (FA, a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C. Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

Science.gov (United States)

Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

2016-01-01

Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

Science.gov (United States)

Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

2000-08-01

We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Is the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene due to a founder effect in Chinese head and neck paraganglioma patients?

Science.gov (United States)

Zha, Yang; Chen, Xing-ming; Lam, Ching-wan; Lee, Soo-chin; Tong, Sui-fan; Gao, Zhi-qiang

2011-08-01

Three Chinese patients with head and neck paragangliomas have been reported to carry the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene. In addition, in our hospital, two further patients were identified who have the same mutation. It is unclear whether the c.3G>C mutation in Chinese patients is a recurrent mutation or if it is due to a founder effect. We conducted haplotype analysis on these patients to answer this question. Individual case-control study. Germ-line mutations were confirmed in the patients and their families examined in this study using direct sequencing. We also constructed and analyzed haplotypes in four Chinese families. Genotype frequencies were compared to the control group. Three of four families shared the same haplotype, which rarely occurred in the control group. The last family shared a very short area on the physical map with the other three families. There is a founder effect in Chinese head and neck paraganglioma patients carrying the SDHD c.3G>C mutation. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

Frequency of c.35delG Mutation in GJB2 Gene (Connexin 26 in Syrian Patients with Nonsyndromic Hearing Impairment

Directory of Open Access Journals (Sweden)

Hazem Kaheel

2017-01-01

Full Text Available Background. Hearing impairments (HI are the most common birth defect worldwide. Very large numbers of genes have been identified but the most profound is GJB2. The clinical interest regarding this gene is very pronounced due to its high carrier frequency (0.5–5.4% across different ethnic groups. This study aimed to determine the prevalence of common GJB2 mutations in Syrian patients with profound sensorineural HI. Methods. We carried out PCR, restriction enzyme based screening, and sequencing of 132 Syrian patients diagnosed clinically with hereditary deafness for different GJB2 mutations. Results. The result revealed that, in GJB2 gene, c.35delG is the most prevalent among affected studied subjects (13.64%, followed by c.457G>A (2.4%. Conclusion. The benefit of this study on the one hand is its first report of prelingual deafness causative gene mutations identified by sequencing technology in the Syrian families. It is obvious from the results that the deployment in biomedical research is highly effective and has a great impact on the ability to uncover the cause of genetic variation in different genetic diseases.

GPR143 gene mutation analysis in pediatric patients with albinism.

Science.gov (United States)

Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

2012-09-01

X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

Homozygosity For The C282Y Substitution In The HFE Gene: The Incomplete Penetrance And Variable Expressivity

Directory of Open Access Journals (Sweden)

Dilum Ekanayake

2015-01-01

Full Text Available The syndrome of hepatic cirrhosis diabetes and skin pigmentation (‘Bronze diabetes’ has been well documented, including its propensity to lead to hepatocellular cancer. However, this picture of advanced disease is much less common nowadays with increased awareness and early diagnosis. However, in addition to this, it has been increasingly recognised that in contrast to other diseases inherited as autosomal recessive traits, subjects carrying the genetic predisposition infrequently develop overt disease. This is due only in part to physiological and pathological blood loss, and further relevant genetic mutations have been anticipated. Indeed, an international consortium has recently identified that the genetic variant ( GNPAT has been identified as predisposing to iron overload related disease. Further mutations can be anticipated and will assist in early diagnosis and treatment as well as identifying subjects predisposed to significant iron overload.

Using iron studies to predict HFE mutations in New Zealand: implications for laboratory testing.

Science.gov (United States)

O'Toole, Rebecca; Romeril, Kenneth; Bromhead, Collette

2017-04-01

The diagnosis of hereditary haemochromatosis (HH) is not straightforward because symptoms are often absent or non-specific. Biochemical markers of iron-overloading may be affected by other conditions. To measure the correlation between iron studies and HFE genotype to inform evidence-based recommendations for laboratory testing in New Zealand. Results from 2388 patients genotyped for C282Y, H63D and S65C in Wellington, New Zealand from 2007 to 2013 were compared with their biochemical phenotype as quantified by serum ferritin (SF), transferrin saturation (TS), serum iron (SI) and serum transferrin (ST). The predictive power of these markers was evaluated by receiver operator characteristic (ROC) curve analysis, and if a statistically significant association for a variable was seen, sensitivity, specificity and predictive values were calculated. Test ordering patterns showed that 62% of HFE genotyping tests were ordered because of an elevated SF alone and only 11% of these had a C-reactive protein test to rule out an acute phase reaction. The association between SF and significant HFE genotypes SF was low. However, TS values ≥45% predicted HH mutations with the highest sensitivity and specificity. A SF of >1000 µg/L was found in one at-risk patient (C282Y homozygote) who had a TS <45%. Our analysis highlights the need for clear guidelines for investigation of hyperferritinaemia and HH in New Zealand. Using our findings, we developed an evidence-based laboratory testing algorithm based on a TS ≥45%, a SF ≥1000 µg/L and/or a family history of HH which identified all C282Y homozygotes in this study. © 2016 Royal Australasian College of Physicians.

The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead.

Science.gov (United States)

Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

2015-08-06

The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25-63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead-exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Development of antibiotic resistance and up-regulation of the antimutator gene pfpI in mutator Pseudomonas aeruginosa due to inactivation of two DNA oxidative repair genes (mutY, mutM)

DEFF Research Database (Denmark)

Mandsberg, Lotte Frigaard; Macia, Maria D.; Bergmann, Kirsten R.

2011-01-01

showed only a fivefold increase, whereas the single mutant PAOMMgm (mutM) showed a nonsignificant increase in MR compared with PAO1 and the single mutants. Mutations in the regulator nfxB leading to hyperexpression of MexCD-OprJ efflux pump were found as the mechanism of resistance to ciprofloxacin....... In this study, we constructed a double mutant in mutY and mutM (PAOMY-Mgm) and characterized the phenotype and the gene expression profile using microarray and RT-PCR. PAOMY-Mgm presented 28-fold increases in MR compared with wild-type reference strain PAO1. In comparison, the PAOMYgm (mutY) single mutant...... in the double mutant. A better fitness of the mutator compared with PAO1 was found in growth competition experiments in the presence of ciprofloxacin at concentrations just below minimal inhibitory concentration. Up-regulation of the antimutator gene pfpI, that has been shown to provide protection to oxidative...

Intrafamilial Variability of Early-Onset Diabetes due to an INS Mutation

DEFF Research Database (Denmark)

Fredheim, Siri; Svensson, Jannet; Pörksen, Sven

2011-01-01

Aim. The objective of this study was to describe the clinical characteristics of two siblings and their father carrying a C95Y mutation in the insulin (INS) gene. Methods/Results. A Danish patient, his sister, and his father were identified to carry the C95Y mutation in the preproinsulin molecule....... The father, insulin treated for over 40 years, has bilateral preproliferative retinopathy. Conclusions. These three cases further confirm the essential features of diabetes caused by INS mutations with proteotoxic effect. We conclude that patients with similar features must be investigated for mutations...

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

Science.gov (United States)

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

Directory of Open Access Journals (Sweden)

Maryam Taghdiri

2017-08-01

Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

Science.gov (United States)

Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

2017-01-01

Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

International Nuclear Information System (INIS)

Kimura, Hiroshi; Kato, Takesi.

1992-01-01

X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

Genomic profiling of CHEK2*1100delC-mutated breast carcinomas

International Nuclear Information System (INIS)

Massink, Maarten P. G.; Kooi, Irsan E.; Martens, John W. M.; Waisfisz, Quinten; Meijers-Heijboer, Hanne

2015-01-01

CHEK2*1100delC is a moderate-risk breast cancer susceptibility allele with a high prevalence in the Netherlands. We performed copy number and gene expression profiling to investigate whether CHEK2*1100delC breast cancers harbor characteristic genomic aberrations, as seen for BRCA1 mutated breast cancers. We performed high-resolution SNP array and gene expression profiling of 120 familial breast carcinomas selected from a larger cohort of 155 familial breast tumors, including BRCA1, BRCA2, and CHEK2 mutant tumors. Gene expression analyses based on a mRNA immune signature was used to identify samples with relative low amounts of tumor infiltrating lymphocytes (TILs), which were previously found to disturb tumor copy number and LOH (loss of heterozygosity) profiling. We specifically compared the genomic and gene expression profiles of CHEK2*1100delC breast cancers (n = 14) with BRCAX (familial non-BRCA1/BRCA2/CHEK2*1100delC mutated) breast cancers (n = 34) of the luminal intrinsic subtypes for which both SNP-array and gene expression data is available. High amounts of TILs were found in a relatively small number of luminal breast cancers as compared to breast cancers of the basal-like subtype. As expected, these samples mostly have very few copy number aberrations and no detectable regions of LOH. By unsupervised hierarchical clustering of copy number data we observed a great degree of heterogeneity amongst the CHEK2*1100delC breast cancers, comparable to the BRCAX breast cancers. Furthermore, copy number aberrations were mostly seen at low frequencies in both the CHEK2*1100delC and BRCAX group of breast cancers. However, supervised class comparison identified copy number loss of chromosomal arm 1p to be associated with CHEK2*1100delC status. In conclusion, in contrast to basal-like BRCA1 mutated breast cancers, no apparent specific somatic copy number aberration (CNA) profile for CHEK2*1100delC breast cancers was found. With the possible exception of copy number loss

[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

Science.gov (United States)

Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

2018-02-10

OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

Dental phenotype in Jalili syndrome due to a c.1312 dupC homozygous mutation in the CNNM4 gene.

Directory of Open Access Journals (Sweden)

Hans U Luder

Full Text Available Jalili syndrome denotes a recessively inherited combination of an eye disease (cone-rod dystrophy and a dental disorder (amelogenesis imperfecta, which is caused by mutations in the CNNM4 gene. Whereas the ophthalmic consequences of these mutations have been studied comprehensively, the dental phenotype has obtained less attention. A defective transport of magnesium ions by the photoreceptors of the retina is assumed to account for the progressive visual impairment. Since magnesium is also incorporated in the mineral of dental hard tissues, we hypothesized that magnesium concentrations in defective enamel resulting from mutations in CNNM4 would be abnormal, if a similar deficiency of magnesium transport also accounted for the amelogenesis imperfecta. Thus, a detailed analysis of the dental hard tissues was performed in two boys of Kosovan origin affected by Jalili syndrome. Retinal dystrophy of the patients was diagnosed by a comprehensive eye examination and full-field electroretinography. A mutational analysis revealed a c.1312 dupC homozygous mutation in CNNM4, a genetic defect which had already been identified in other Kosovan families and putatively results in loss-of-function of the protein. The evaluation of six primary teeth using light and scanning electron microscopy as well as energy-dispersive X-ray spectroscopy showed that dental enamel was thin and deficient in mineral, suggesting a hypoplastic/hypomineralized type of amelogenesis imperfecta. The reduced mineral density of enamel was accompanied by decreased amounts of calcium, but significantly elevated levels of magnesium. In dentin, however, a similar mineral deficiency was associated with reduced magnesium and normal calcium levels. It is concluded that the c.1312 dupC mutation of CNNM4 results in mineralization defects of both enamel and dentin, which are associated with significantly abnormal magnesium concentrations. Thus, we could not disprove the hypothesis that a

Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

Science.gov (United States)

Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

2018-04-13

While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

Gender and plasma iron biomarkers, but not HFE gene mutations, increase the risk of colorectal cancer and polyps.

Science.gov (United States)

Castiella, Agustin; Múgica, Fernando; Zapata, Eva; Zubiaurre, Leire; Iribarren, Arantxa; de Juan, M Dolores; Alzate, Luis; Gil, Ines; Urdapilleta, Gregorio; Otazua, Pedro; Emparanza, José Ignacio

2015-09-01

A cohort study of patients included in the Basque Country colorectal cancer (CRC) screening programme was carried out to assess the risk of adenomatous polyps and CRC (P-CRC) associated with HFE gene mutations, with gender and with iron biomarkers (serum ferritin (SF), iron (Fe) and transferrin saturation index (TSI)). Among 432 included patients (mean age 59.8 years), 263 were men (60.9 %) and 169 women (39.1 %). P-CRC were identified in 221 patients (51.2 %) and no polyps (NP) in 211 patients (48.8 %). HFE mutations were identified in 43.8 % of the patients. C282Y/wt genotypic frequency was 6.8 % in the P-CRC group and 1.4 % in the NP group (p < 0.05). The allelic frequency was 3.8 versus 1.2 % (p < 0.05). For laboratory, all three iron biomarkers showed a statistically significant difference: mean Fe, 91.29 ± 34 for P-CRC and 80.81 ± 30.59 for NP group. Mean TSI for P-CRC was 24.95 ± 8.90 and 22.74 ± 8.79 for NP group. Mean SF 308.09 ± 536.32 for P-CRC and 177.55 ± 159.95 for NP group. In a multivariate logistic regression analysis, only male gender (odds ratio (OR) = 2.04, 1.29-3.22), SF (OR = 1.001, 1.0004-1.003) and Fe (OR = 1.01, 1.004-1.02) were related with the presence of CRC and adenoma. Men gender and raised serum iron biomarkers increase the risk of P-CRC.

Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

Science.gov (United States)

Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

2014-05-01

Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

Correlation Between C677T and A1298C Mutations on the MTHFR Gene With Plasma Homocysteine Levels and Venous Thrombosis in Pregnant Women at Risk of Thrombosis

Directory of Open Access Journals (Sweden)

Kazem Ghaffari

2015-12-01

Full Text Available Background: Deep venous thrombosis (DVT is a common disease with a high morbidity, mortality and increase in miscarriages. Objectives: The purpose of this study was to assessment the correlation between C677T and A1298C mutations on the methylenetetrahydrofolate reductase (MTHFR gene with total plasma homocysteine levels and deep venous thrombosis in pregnant women at risk of thrombosis. Patients and Methods: In this case-control study, 120 pregnant women with risk of DVT and 100 pregnant women without risk of DVT were included in the study. Assay for identification of MTHFR mutations was carried out by PCR-RFLP. Total plasma homocysteine was measured by ELISA method. Results: Homozygous (MM mutations of MTHFR C677T and A1298C were not associated with DVT in pregnant women with and without DVT, respectively. Plasma homocysteine levels were significantly higher in pregnant women with DVT (18.3 ± 5.9 μmol/L than in the pregnant women without DVT (8.9 ± 6.4 μmol/L in C677T and A1298C mutations on the MTHFR gene, respectively (P = 0.021. Conclusions: Our results showed that MTHFR C677T and MTHFR A1289C polymorphisms are not connected with total plasma homocysteine levels in pregnant women with and without DVT. Also, plasma homocysteine levels were significantly higher in pregnant women with DVT.

Structural and dynamic characterization of the C313Y mutation in Myostatin dimeric protein, responsible for the double muscle phenotype in Piedmontese cattle

Directory of Open Access Journals (Sweden)

Silvia eBongiorno

2016-02-01

Full Text Available The knowledge of the molecular effects of the C313Y mutation, responsible for the double muscle phenotype in Piedmontese cattle, can help understanding the actual mechanism of phenotype determination and paves the route for a better modulation of the positive effects of this economic important phenotype in the beef industry, while minimizing the negative side effects, now inevitably intersected.The structure and dynamic behaviour of the active dimeric form of Myostatin in cattle was analyzed by means of three state-of-the-art Molecular Dynamics simulations, 200-ns long, of wild-type and C313Y mutants. Our results highlight a role for the conserved Arg333 in establishing a network of short and long range interactions between the two monomers in the wild-type protein that is destroyed upon the C313Y mutation even in a single monomer. Furthermore, the native protein shows an asymmetry in residue fluctuation that is absent in the double monomer mutant. Time window analysis on further 200-ns of simulation demonstrates that this is a characteristic behaviour of the protein, likely depended from the long range communications between monomers. The same behaviour, in fact, has already been observed in other mutated dimers. Finally, the mutation does not produce alterations in the secondary structure elements that compose the characteristic TGF-β cystine-knot motif.

Activating HER2 mutations in HER2 gene amplification negative breast cancer.

Science.gov (United States)

Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J

2013-02-01

Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.

A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.

Science.gov (United States)

Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah

2016-05-01

Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.

Application of DNA chips in the analysis of gene mutation in HBV

International Nuclear Information System (INIS)

Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

2005-01-01

Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

Frequency of the allelic variant c.1150T > C in exon 10 of the fibroblast growth factor receptor 3 (FGFR3 gene is not increased in patients with pathogenic mutations and related chondrodysplasia phenotypes

Directory of Open Access Journals (Sweden)

Thatiane Yoshie Kanazawa

2014-12-01

Full Text Available Mutations in the FGFR3 gene cause the phenotypic spectrum of FGFR3 chondrodysplasias ranging from lethal forms to the milder phenotype seen in hypochondroplasia (Hch. The p.N540K mutation in the FGFR3 gene occurs in ~70% of individuals with Hch, and nearly 30% of individuals with the Hch phenotype have no mutations in the FGFR3, which suggests genetic heterogeneity. The identification of a severe case of Hch associated with the typical mutation c.1620C > A and the occurrence of a c.1150T > C change that resulted in a p.F384L in exon 10, together with the suspicion that this second change could be a modulator of the phenotype, prompted us to investigate this hypothesis in a cohort of patients. An analysis of 48 patients with FGFR3 chondrodysplasia phenotypes and 330 healthy (control individuals revealed no significant difference in the frequency of the C allele at the c.1150 position (p = 0.34. One patient carrying the combination `pathogenic mutation plus the allelic variant c.1150T > C' had a typical achondroplasia (Ach phenotype. In addition, three other patients with atypical phenotypes showed no association with the allelic variant. Together, these results do not support the hypothesis of a modulatory role for the c.1150T > C change in the FGFR3 gene.

Lamin A/C mutations with lipodystrophy, cardiac abnormalities, and muscular dystrophy

NARCIS (Netherlands)

van der Kooi, A. J.; Bonne, G.; Eymard, B.; Duboc, D.; Talim, B.; van der Valk, M.; Reiss, P.; Richard, P.; Demay, L.; Merlini, L.; Schwartz, K.; Busch, H. F. M.; de Visser, M.

2002-01-01

Mutations in the lamin A/C gene are found in Emery-Dreifuss muscular dystrophy, limb girdle muscular dystrophy with cardiac conduction disturbances, dilated cardiomyopathy with conduction system disease, and familial partial lipodystrophy. Cases with lamin A/C mutations presenting with lipodystrophy

Clinical characteristics and STK11 gene mutations in Chinese children with Peutz-Jeghers syndrome.

Science.gov (United States)

Huang, Zhiheng; Miao, Shijian; Wang, Lin; Zhang, Ping; Wu, Bingbing; Wu, Jie; Huang, Ying

2015-11-25

Peutz-Jeghers syndrome (PJS) is a rare autosomal dominant inherited disease characterized by gastrointestinal hamartomatous polyps and mucocutaneous melanin spots. Germline mutation of the serine/threonine kinase 11 (STK11) gene are responsible for PJS. In this study, we investigated the clinical characteristics and molecular basis of the disease in Chinese children with PJS. Thirteen children diagnosed with PJS in our hospital were enrolled in this study from 2011 to 2015, and their clinical data on polyp characteristics, intussusceptions events, family histories, etc. were described. Genomic DNA was extracted from whole-blood samples from each subject, and the entire coding sequence of the STK11 gene was amplified by polymerase chain reaction and analyzed by direct sequencing. The median age at the onset of symptoms was 2 years and 4 months. To date, these children have undergone 40 endoscopy screenings, 17 laparotomies and 9 intussusceptions. Polyps were found in the stomach, duodenum, small bowel, colon and rectum, with large polyps found in 7 children. Mutations were found in eleven children, including seven novel mutations (c.481het_dupA, c.943_944het_delCCinsG, c.397het_delG, c.862 + 1G > G/A, c.348_349het_delGT, and c.803_804het_delGGinsC and c.121_139de l19insTT) and four previously reported mutations (c.658C > C/T, c.890G > G/A, c.1062 C > C/G, and c.290 + 1G > G/A). One PJS patient did not have any STK11 mutations. The polyps caused significant clinical consequences in children with PJS, and mutations of the STK11 gene are generally the cause of PJS in Chinese children. This study expands the spectrum of known STK11 gene mutations.

Surfactant protein B deficiency and gene mutations for neonatal respiratory distress syndrome in China Han ethnic population

Science.gov (United States)

Yin, Xiaojuan; Meng, Fanping; wang, Yan; Xie, Lu; Kong, Xiangyong; Feng, Zhichun

2013-01-01

Objective: To determine whether the SP-B deficiency and gene mutations in exon 4 is associated with neonatal RDS in China Han ethnic population. Methods: The study population consisted of 40 neonates with RDS and 40 neonates with other diseases as control in China Han ethnic population. We Compared SP-B expression in lung tissue and bronchoalveolar lavage fluid with immunoblotting, and analyzed mutations in the SP-B gene with polymerase chain reaction (PCR) and gene sequencing. Results: In RDS group, low mature Surfactant protein B was found in both lung tissue and bronchoalveolar lavage fluid in 8 neonates. In control group, only 4 neonates with low mature Surfactant protein B in both lung tissue and bronchoalveolar lavage fluid. In RDS group, 20 neonates were found to have mutations in exon 4, 12 homozygous mutations with C/C genotype and 8 heterozygous mutations with C/T genotype in surfactant protein B gene+1580 polymorphism. There were 8 cases mutations in control group, 1 in C/C and 7 in C/T genotype. The frequency of homozygotes with C/C genotype was 0.3 and frequency of heterozygotes with C/T genotype was 0.02 in RDS group. In control group, frequency of homozygotes with C/C genotype was 0.025 and frequency of heterozygote with C/T genotype was 0.175. Conclusion: Low mature Surfactant protein B is associated with the pathogenesis of neonatal respiratory distress syndrome (RDS) in China Han ethnic population. Mutations in exon 4 of the surfactant protein B gene demonstrate an association between homozygous mutations with C/C genotype in SP-B gene and neonatal RDS. PMID:23330012

Severe hypertriglyceridemia due to two novel loss-of-function lipoprotein lipase gene mutations (C310R/E396V) in a Chinese family associated with recurrent acute pancreatitis.

Science.gov (United States)

Lun, Yu; Sun, Xiaofang; Wang, Ping; Chi, Jingwei; Hou, Xu; Wang, Yangang

2017-07-18

Lipoprotein lipase (LPL) is widely expressed in skeletal muscles, cardiac muscles as well as adipose tissue and involved in the catabolism of triglyceride. Herein we have systematically characterized two novel loss-of-function mutations in LPL from a Chinese family in which afflicted members were manifested by severe hypertriglyceridemia and recurrent pancreatitis. DNA sequencing revealed that the proband was a heterozygote carrying a novel c.T928C (p.C310R) mutation in exon 6 of the LPL gene. Another member of the family was detected to be a compound heterozygote who along with the c.T928C mutation also carried a novel missense mutation c.A1187T (p.E396V) in exon 8 of the LPL gene. Furthermore, COS-1 cells were transfected with lentiviruses containing the mutant LPL genes. While C310R markedly reduced the overall LPL protein level, COS-1 cells carrying E396V or double mutations contained similar overall LPL protein levels to the wild-type. The specific activity of the LPL mutants remained at comparable magnitude to the wild-type. However, few LPL were detected in the culture medium for the mutants, suggesting that both mutations caused aberrant triglyceride catabolism. More specifically, E396V and double mutations dampened the transport of LPL to the cell surface, while for the C310R mutation, reducing LPL protein level might be involved. By characterizing these two novel LPL mutations, this study has expanded our understanding on the pathogenesis of familial hypertriglyceridemia (FHTG).