WorldWideScience

Sample records for gene mutation analysis

  1. Mutational analysis of the HGO gene in Finnish alkaptonuria patients

    Science.gov (United States)

    de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

    1999-01-01

    Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

  2. [FANCA gene mutation analysis in Fanconi anemia patients].

    Science.gov (United States)

    Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

    2005-10-01

    To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

  3. Mutation analysis of the preproghrelin gene

    DEFF Research Database (Denmark)

    Larsen, Lesli H; Gjesing, Anette P; Sørensen, Thorkild I A

    2005-01-01

    To investigate the preproghrelin gene for variants and their association with obesity and type 2 diabetes.......To investigate the preproghrelin gene for variants and their association with obesity and type 2 diabetes....

  4. Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

    Science.gov (United States)

    Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

    2015-01-01

    To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

  5. GPR143 gene mutation analysis in pediatric patients with albinism.

    Science.gov (United States)

    Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

    2012-09-01

    X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

  6. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    Science.gov (United States)

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

    Science.gov (United States)

    Kim, Myeong Hee; Kang, So Young; Lee, Woo In

    2017-05-01

    The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

  8. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    Science.gov (United States)

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  9. Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

    Science.gov (United States)

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-10-01

    Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

  10. Sequence analysis of tyrosinase gene in ocular and oculocutaneous albinism patients: introducing three novel mutations.

    Science.gov (United States)

    Khordadpoor-Deilamani, Faravareh; Akbari, Mohammad Taghi; Karimipoor, Morteza; Javadi, Gholamreza

    2015-01-01

    Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented eyes (in patients with ocular albinism) or hair, skin, and eyes (in individuals with oculocutaneous albinism). It is associated with decreased visual acuity, nystagmus, strabismus, and photophobia. The tyrosinase gene is known to be involved in both oculocutaneous albinism and autosomal recessive ocular albinism. In this study, we aimed to screen the mutations in the TYR gene in the nonsyndromic OCA and autosomal recessive ocular albinism patients from Iran. The tyrosinase gene was examined in 23 unrelated patients with autosomal recessive ocular albinism or nonsyndromic OCA using DNA sequencing and bioinformatics analysis. TYR gene mutations were identified in 14 (app. 60%) albinism patients. We found 10 mutations, 3 of which were novel. No mutation was found in our ocular albinism patients, but one of them was heterozygous for the p.R402Q polymorphism.

  11. NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Maija Wolf

    2005-01-01

    Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

  12. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  13. Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

    1994-03-01

    Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

  14. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  15. Analysis of gene mutations in children with cholestasis of undefined etiology.

    Science.gov (United States)

    Matte, Ursula; Mourya, Reena; Miethke, Alexander; Liu, Cong; Kauffmann, Gregory; Moyer, Katie; Zhang, Kejian; Bezerra, Jorge A

    2010-10-01

    The discovery of genetic mutations in children with inherited syndromes of intrahepatic cholestasis allows for diagnostic specificity despite similar clinical phenotypes. Here, we aimed to determine whether mutation screening of target genes could assign a molecular diagnosis in children with idiopathic cholestasis. DNA samples were obtained from 51 subjects with cholestasis of undefined etiology and surveyed for mutations in the genes SERPINA1, JAG1, ATP8B1, ABCB11, and ABCB4 by a high-throughput gene chip. Then, the sequence readouts for all 5 genes were analyzed for mutations and correlated with clinical phenotypes. Healthy subjects served as controls. Sequence analysis of the genes identified 14 (or 27%) subjects with missense, nonsense, deletion, and splice site variants associated with disease phenotypes based on the type of mutation and/or biallelic involvement in the JAG1, ATP8B1, ABCB11, or ABCB4 genes. These patients had no syndromic features and could not be differentiated by biochemical markers or histopathology. Among the remaining subjects, 10 (or ∼20%) had sequence variants in ATP8B1 or ABCB11 that involved only 1 allele, 8 had variants not likely to be associated with disease phenotypes, and 19 had no variants that changed amino acid composition. Gene sequence analysis assigned a molecular diagnosis in 27% of subjects with idiopathic cholestasis based on the presence of variants likely to cause disease phenotypes.

  16. Application of DNA chips in the analysis of gene mutation in HBV

    International Nuclear Information System (INIS)

    Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

    2005-01-01

    Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

  17. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  18. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    Science.gov (United States)

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  19. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  20. Mutation analysis of the STRA6 gene in isolated and non-isolated anophthalmia/microphthalmia.

    Science.gov (United States)

    Chassaing, N; Ragge, N; Kariminejad, A; Buffet, A; Ghaderi-Sohi, S; Martinovic, J; Calvas, P

    2013-03-01

    PDAC syndrome [Pulmonary hypoplasia/agenesis, Diaphragmatic hernia/eventration, Anophthalmia/microphthalmia (A/M) and Cardiac Defect] is a condition associated with recessive mutations in the STRA6 gene in some of these patients. Recently, cases with isolated anophthalmia have been associated with STRA6 mutations. To determine the minimal findings associated with STRA6 mutations, we performed mutation analysis of the STRA6 gene in 28 cases with anophthalmia. In 7 of the cases the anophthalmia was isolated, in 14 cases it was associated with one of the major features included in PDAC and 7 had other abnormalities. Mutations were identified in two individuals: one with bilateral anophthalmia and some features included in PDAC, who was a compound heterozygote for a missense mutation and a large intragenic deletion, and the second case with all the major features of PDAC and who had a homozygous splicing mutation. This study suggests that STRA6 mutations are more likely to be identified in individuals with A/M and other abnormalities included in the PDAC spectrum, rather than in isolated A/M cases. © 2012 John Wiley & Sons A/S.

  1. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  2. The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

    OpenAIRE

    Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

    2014-01-01

    As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

  3. Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Chia-Sui Hung

    2007-01-01

    Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

  4. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  5. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  6. Mutation analysis of the MCHR1 gene in human obesity

    DEFF Research Database (Denmark)

    Wermter, Anne-Kathrin; Reichwald, Kathrin; Büch, Thomas

    2005-01-01

    The importance of the melanin-concentrating hormone (MCH) system for regulation of energy homeostasis and body weight has been demonstrated in rodents. We analysed the human MCH receptor 1 gene (MCHR1) with respect to human obesity....

  7. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  8. Mutation Analysis of Consanguineous Moroccan Patients with Parkinson’s Disease Combining Microarray and Gene Panel

    Directory of Open Access Journals (Sweden)

    Ahmed Bouhouche

    2017-10-01

    Full Text Available During the last two decades, 15 different genes have been reported to be responsible for the monogenic form of Parkinson’s disease (PD, representing a worldwide frequency of 5–10%. Among them, 10 genes have been associated with autosomal recessive PD, with PRKN and PINK1 being the most frequent. In a cohort of 145 unrelated Moroccan PD patients enrolled since 2013, 19 patients were born from a consanguineous marriage, of which 15 were isolated cases and 4 familial. One patient was homozygous for the common LRRK2 G2019S mutation and the 18 others who did not carry this mutation were screened for exon rearrangements in the PRKN gene using Affymetrix Cytoscan HD microarray. Two patients were determined homozygous for PRKN exon-deletions, while another patient presented with compound heterozygous inheritance (3/18, 17%. Two other patients showed a region of homozygosity covering the 1p36.12 locus and were sequenced for the candidate PINK1 gene, which revealed two homozygous point mutations: the known Q456X mutation in exon 7 and a novel L539F variation in exon 8. The 13 remaining patients were subjected to next-generation sequencing (NGS that targeted a panel of 22 PD-causing genes and overlapping phenotypes. NGS data showed that two unrelated consanguineous patients with juvenile-onset PD (12 and 13 years carried the same homozygous stop mutation W258X in the ATP13A2 gene, possibly resulting from a founder effect; and one patient with late onset (76 years carried a novel heterozygous frameshift mutation in SYNJ1. Clinical analysis showed that patients with the ATP13A2 mutation developed juvenile-onset PD with a severe phenotype, whereas patients having either PRKN or PINK1 mutations displayed early-onset PD with a relatively mild phenotype. By identifying pathogenic mutations in 45% (8/18 of our consanguineous Moroccan PD series, we demonstrate that the combination of chromosomal microarray analysis and NGS is a powerful approach to

  9. ABCG2 in peptic ulcer: gene expression and mutation analysis.

    Science.gov (United States)

    Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa

    2016-08-01

    The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.

  10. Mutation analysis of the NSD1 gene in patients with autism spectrum disorders and macrocephaly

    Directory of Open Access Journals (Sweden)

    Delorme Richard

    2007-11-01

    Full Text Available Abstract Background Sotos syndrome is an overgrowth syndrome characterized by macrocephaly, advanced bone age, characteristic facial features, and learning disabilities, caused by mutations or deletions of the NSD1 gene, located at 5q35. Sotos syndrome has been described in a number of patients with autism spectrum disorders, suggesting that NSD1 could be involved in other cases of autism and macrocephaly. Methods We screened the NSD1 gene for mutations and deletions in 88 patients with autism spectrum disorders and macrocephaly (head circumference 2 standard deviations or more above the mean. Mutation analysis was performed by direct sequencing of all exons and flanking regions. Dosage analysis of NSD1 was carried out using multiplex ligation-dependent probe amplification. Results We identified three missense variants (R604L, S822C and E1499G in one patient each, but none is within a functional domain. In addition, segregation analysis showed that all variants were inherited from healthy parents and in two cases were also present in unaffected siblings, indicating that they are probably nonpathogenic. No partial or whole gene deletions/duplications were observed. Conclusion Our findings suggest that Sotos syndrome is a rare cause of autism spectrum disorders and that screening for NSD1 mutations and deletions in patients with autism and macrocephaly is not warranted in the absence of other features of Sotos syndrome.

  11. Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

    Science.gov (United States)

    Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

    1998-01-01

    Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

  12. Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

    Directory of Open Access Journals (Sweden)

    Rodolfo Delfini Cançado

    Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

  13. [Analysis of gene mutation of early onset epileptic spasm with unknown reason].

    Science.gov (United States)

    Yang, X; Pan, G; Li, W H; Zhang, L M; Wu, B B; Wang, H J; Zhang, P; Zhou, S Z

    2017-11-02

    Objective: To summarize the gene mutation of early onset epileptic spasm with unknown reason. Method: In this prospective study, data of patients with early onset epileptic spasm with unknown reason were collected from neurological department of Children's Hospital of Fudan University between March 2016 and December 2016. Patients with known disorders such as infection, metabolic, structural, immunological problems and known genetic mutations were excluded. Patients with genetic disease that can be diagnosed by clinical manifestations and phenotypic characteristics were also excluded. Genetic research methods included nervous system panel containing 1 427 epilepsy genes, whole exome sequencing (WES), analysis of copy number variation (CNV) and karyotype analysis of chromosome. The basic information, phenotypes, genetic results and the antiepileptic treatment of patients were analyzed. Result: Nine of the 17 cases with early onset epileptic spasm were boys and eight were girls. Patients' age at first seizure onset ranged from 1 day after birth to 8 months (median age of 3 months). The first hospital visit age ranged from 1 month to 2 years (median age of 4.5 months). The time of following-up ranged from 8 months to 3 years and 10 months. All the 17 patients had early onset epileptic spasm. Video electroencephalogram was used to monitor the spasm seizure. Five patients had Ohtahara syndrome, 10 had West syndrome, two had unclear classification. In 17 cases, 10 of them had detected pathogenic genes. Nine cases had point mutations, involving SCN2A, ARX, UNC80, KCNQ2, and GABRB3. Except one case of mutations in GABRB3 gene have been reported, all the other cases had new mutations. One patient had deletion mutation in CDKL5 gene. One CNV case had 6q 22.31 5.5MB repeats. Ten cases out of 17 were using 2-3 antiepileptic drugs (AEDs) and the drugs had no effect. Seven cases used adrenocorticotropic hormone (ACTH) and prednisone besides AEDs (a total course for 8 weeks

  14. [Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

    Science.gov (United States)

    Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

    2013-02-01

    An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

  15. Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome.

    Science.gov (United States)

    Essawi, Mona L; Ismail, Manal F; Afifi, Hanan H; Kobesiy, Maha M; El Kotoury, Ahmed; Barakat, Maged M

    2013-11-01

    Noonan syndrome (NS) is inherited as an autosomal dominant disorder with dysmorphic facies, short stature, and cardiac defects, which can be caused by missense mutations in the protein tyrosine phosphatase nonreceptor type 11 (PTPN11) gene, which encodes src homology region 2 domain containing tyrosine phosphatase-2 (SHP-2), a protein tyrosine phosphatase that acts in signal transduction downstream to growth factors and cytokines. The current study aimed to study the molecular characterization of the PTPN11 gene among Egyptian patients with Noonan syndrome. Eleven exons of the PTPN11 gene were amplified and screened by single stranded conformational polymorphism (SSCP). DNA samples showing band shift in SSCP were subjected to sequencing. Mutational analysis of the PTPN11 gene revealed T→C transition at position 854 in exon 8, predicting Phe285Ser substitution within PTP domain of SHP-2 protein, in one NS patient and -21C→T polymorphism in intron 7 in four other cases. Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS. Copyright © 2012. Published by Elsevier B.V.

  16. Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Kylie L. Gorringe

    2008-11-01

    Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.

  17. New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

    Science.gov (United States)

    Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2013-01-30

    The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  19. Analysis of mutations in the human HPRT gene induced by accelerated heavy-ion irradiation

    International Nuclear Information System (INIS)

    Kagawa, Yasuhiro; Yatagai, Fumio; Hanaoka, Fumio; Suzuki, Masao; Kase, Youko; Kobayashi, Akiko; Hirano, Masahiko; Kato, Takesi; Watanabe, Masami.

    1995-01-01

    Multiplex PCR analysis of HPRT(-) mutations in human embryo (HE) cells induced by 230 keV/μm carbon-ion irradiation showed no large deletion around the exon regions of the locus gene in contrast to the irradiations at different LETs. To identify these mutations, the sequence alterations in a cDNA of hprt gene were determined for 18 mutant clones in this study. Missing of exon 6 was the most frequent mutational event (10 clones), and missing of both exons 6 and 8 was next most frequent event (6 clones), then base substitutions (2 clones). These characteristics were not seen in a similar analysis of spontaneous mutations, which showed base substitution (5 clones), frameshift (2 clones), missing of both exons 2 and 3 (2 clones), and a single unidentified clone. Direct sequencing and restriction enzyme digestion of the genomic DNA of the mutants which showed missing of exons 6 and 8 in the cDNA, supports the possibility that they were induced by aberrant mRNA splicing. (author)

  20. Mutation screening and association analysis of six candidate genes for autism on chromosome 7q

    DEFF Research Database (Denmark)

    Bonora, E.; Lamb, J.A.; Barnby, G.

    2005-01-01

    in the genes CUTL1, LAMB1 and PTPRZ1. Analysis of genetic variants provided evidence for association with autism for one of the new missense changes identified in LAMB1; this effect was stronger in a subgroup of affected male sibling pair families, implying a possible specific sex-related effect......Genetic studies have provided evidence for an autism susceptibility locus (AUTS1) on chromosome 7q. Screening for mutations in six genes mapping to 7q, CUTL1, SRPK2, SYPL, LAMB1, NRCAM and PTPRZ1 in 48 unrelated individuals with autism led to the identification of several new coding variants...

  1. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  2. Identification of Missense Mutation (I12T in the BSND Gene and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Hina Iqbal

    2011-01-01

    Full Text Available Nonsyndromic hearing loss is a paradigm of genetic heterogeneity with 85 loci and 39 nuclear disease genes reported so far. Mutations of BSND have been shown to cause Bartter syndrome type IV, characterized by significant renal abnormalities and deafness and nonsyndromic nearing loss. We studied a Pakistani consanguineous family. Clinical examinations of affected individuals did not reveal the presence of any associated signs, which are hallmarks of the Bartter syndrome type IV. Linkage analysis identified an area of 18.36 Mb shared by all affected individuals between markers D1S2706 and D1S1596. A maximum two-point LOD score of 2.55 with markers D1S2700 and multipoint LOD score of 3.42 with marker D1S1661 were obtained. BSND mutation, that is, p.I12T, cosegregated in all extant members of our pedigree. BSND mutations can cause nonsyndromic hearing loss, and it is a second report for this mutation. The respected protein, that is, BSND, was first modeled, and then, the identified mutation was further analyzed by using different bioinformatics tools; finally, this protein and its mutant was docked with CLCNKB and REN, interactions of BSND, respectively.

  3. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    Science.gov (United States)

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  4. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  5. Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

    Directory of Open Access Journals (Sweden)

    Dinić Jelena

    2007-01-01

    Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

  6. Screening of point mutations by multiple SSCP analysis in the dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Lasa, A.; Baiget, M.; Gallano, P. [Hospital Sant Pau, Barcelona (Spain)

    1994-09-01

    Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.

  7. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    Science.gov (United States)

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  8. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    Science.gov (United States)

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  9. Mutational analysis of the BRCA1 gene in 30 Czech ovarian cancer ...

    Indian Academy of Sciences (India)

    Ovarian cancer is one of the most severe of oncological diseases. Inherited mutations in cancer susceptibility genes play a causal role in 5–10% of newly diagnosed tumours. BRCA1 and BRCA2 gene alterations are found in the majority of these cases. The aim of this study was to analyse the BRCA1 gene in the ovarian ...

  10. Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.

    Science.gov (United States)

    Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare

    2017-08-15

    Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.

  11. Mutation analysis of the NRXN1 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Onay H

    2016-12-01

    Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

  12. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

    Science.gov (United States)

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

    2017-10-02

    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  13. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  14. Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome

    Directory of Open Access Journals (Sweden)

    Mona L. Essawi

    2013-11-01

    Conclusion: Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS.

  15. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  16. Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.

    Science.gov (United States)

    Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S

    2016-12-01

    This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.

  17. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    Science.gov (United States)

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  18. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  19. Mutation analysis of the ERCC4/FANCQ gene in hereditary breast cancer.

    Directory of Open Access Journals (Sweden)

    Sandra Kohlhase

    Full Text Available The ERCC4 protein forms a structure-specific endonuclease involved in the DNA damage response. Different cancer syndromes such as a subtype of Xeroderma pigmentosum, XPF, and recently a subtype of Fanconi Anemia, FA-Q, have been attributed to biallelic ERCC4 gene mutations. To investigate whether monoallelic ERCC4 gene defects play some role in the inherited component of breast cancer susceptibility, we sequenced the whole ERCC4 coding region and flanking untranslated portions in a series of 101 Byelorussian and German breast cancer patients selected for familial disease (set 1, n = 63 or for the presence of the rs1800067 risk haplotype (set 2, n = 38. This study confirmed six known and one novel exonic variants, including four missense substitutions but no truncating mutation. Missense substitution p.R415Q (rs1800067, a previously postulated breast cancer susceptibility allele, was subsequently screened for in a total of 3,698 breast cancer cases and 2,868 controls from Germany, Belarus or Russia. The Gln415 allele appeared protective against breast cancer in the German series, with the strongest effect for ductal histology (OR 0.67; 95%CI 0.49; 0.92; p = 0.003, but this association was not confirmed in the other two series, with the combined analysis yielding an overall Mantel-Haenszel OR of 0.94 (95% CI 0.81; 1.08. There was no significant effect of p.R415Q on breast cancer survival in the German patient series. The other three detected ERCC4 missense mutations included two known rare variants as well as a novel substitution, p.E17V, that we identified on a p.R415Q haplotype background. The p.E17V mutation is predicted to be probably damaging but was present in just one heterozygous patient. We conclude that the contribution of ERCC4/FANCQ coding mutations to hereditary breast cancer in Central and Eastern Europe is likely to be small.

  20. NUTRIGENOMIC ANALYSIS OF C677T MUTATION OF MTHFR GENE IN SLOVAK POPULATION

    Directory of Open Access Journals (Sweden)

    Jozef Bulla

    2011-04-01

    Full Text Available Total of 124 individuals originated from Slovak Republic has been nutrignomically analysed. Analysis was focused to mutation C677T of MTHFR gene detection and analysis of mutant genotypes frequency. Observed frequency of allele 677C was 0.6998 and allelic frequency of mutant variant 677T was 0.3992. Genotype frequency of mutant heterozygotes with 71% activity of MTHFR enzyme was 0,391 and mutant homozygotes with 33% MTHFR enzyme activity was 0.153. Result shows 64% of Slovak has decreased activity of enzyme MTHFR, and 14.3% of Slovak has predisposition to cancer, cardio vascular diseases, loss of fertility and many others complications according to improper nutrition, low folic acid and B12 vitamin intake.  doi:10.5219/136

  1. Mutation analysis of the PAH gene in phenylketonuria patients from Rio de Janeiro, Southeast Brazil.

    Science.gov (United States)

    Vieira Neto, Eduardo; Laranjeira, Francisco; Quelhas, Dulce; Ribeiro, Isaura; Seabra, Alexandre; Mineiro, Nicole; D M Carvalho, Lilian; Lacerda, Lúcia; G Ribeiro, Márcia

    2018-05-10

    Phenylketonuria (PKU) is an autosomal recessive disease resulting from mutations in the PAH gene. Most of the patients are compound heterozygotes, and genotype is a major factor in determining the phenotypic variability of PKU. More than 1,000 variants have been described in the PAH gene. Rio de Janeiro's population has a predominance of Iberian, followed by African and Amerindian ancestries. It is expected that most PKU variants in this Brazilian state have originated in the Iberian Peninsula. However, rare European, African or pathogenic variants that are characteristic of the admixed population of the state might also be found. A total of 102 patients were included in this study. Genomic DNA was isolated from dried blood spots. Sanger sequencing was used for PAH gene variant identification. Deletions and duplications were also screened using MLPA analysis. Haplotypes were also determined. Nine (8.8%) homozygous and 93 (91.2%) compound heterozygous patients were found. The spectrum included 37 causative mutations. Missense, nonsense, and splicing pathogenic variants corresponded to 63.7%, 2.9%, and 22.6% of the mutant alleles, respectively. Large (1.5%), and small deletions, inframe (5.4%) and with frameshift (3.9%), comprised the remainder. The most frequent pathogenic variants were: p.V388M (12.7%), p.R261Q (11.8%), IVS10-11G>A (10.3%), IVS2+5G>C (6.4%), p.S349P (6.4%), p.R252W (5.4%), p.I65T (4.4%), p.T323del (4.4%), and p.P281L (3.4%). One novel variant was detected: c.934G>T (p.G312C) [rs763115697]. The three most frequent pathogenic variants in our study (34.8% of the alleles) were also the most common in other Brazilian states, Portugal, and Spain (p.V388M, p.R261Q, IVS10-11G>A), corroborating that the Iberian Peninsula is the major source of PAH mutations in Rio de Janeiro. Pathogenic variants that have other geographical origins, such IVS2+5G>C, p.G352Vfs*48, and IVS12+1G>A were also detected. Genetic drift and founder effect may have also played a role

  2. Rapid detection of most frequent Slovenian germ-line mutations in BRCA1 gene using real-time PCR and melting curve analysis

    International Nuclear Information System (INIS)

    Novakovic, S.; Stegel, V.

    2005-01-01

    Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)

  3. [Mutation analysis of FAH gene in patients with tyrosinemia type 1].

    Science.gov (United States)

    Dou, Li-Min; Fang, Ling-Juan; Wang, Xiao-Hong; Lu, Wei; Chen, Rui; Li, Li-Ting; Zhao, Jing; Wang, Jian-She

    2013-04-01

    . Alpha-fetoprotein 412.8 µg/L, levels of tyrosine in blood and succinylacetone in urine were 835.8 µmol/L and 27.48 µmol/L. Rickets did not improve after administration of calcium and vitamine D3. She is homozygous for the mutation c.1027G > A/c.1027G > A, which predicts G343R. The parents were mutation carriers. Analysis by Clustal X on the alignment of amino acids residual reservation among different species showed that the locative amino acid was highly conserved. Polyphen software predicted G343R was probably damaging (PISC score 3.235). Children with tyrosinemia type 1 can have manifestations of persistent diarrhea or late-onset rickets. Physical examination can reveal hepatosplenomegaly, laboratory tests indicate markedly elevated serum concentration of alpha-fetoprotein and alkaline phosphatase in plasma and succinylacetone in urine, other members in family may have tyrosinemias or parents are consanguineous. Mutations c.455G > A and c.1027G > A can be detected in FAH gene of Chinese children.

  4. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  5. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese

    Indian Academy of Sciences (India)

    Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutationsin COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical ...

  6. Molecular analysis of the eighteen most frequent mutations in the BRCA1 gene in 63 Chilean breast cancer families

    Directory of Open Access Journals (Sweden)

    LILIAN JARA

    2004-01-01

    Full Text Available BRCA1 gene mutations account for nearly all families with multiple cases of both early onset breast and/or ovarian cancer and about 30% of hereditary breast cancer. Although to date more than 1,237 distinct mutations, polymorphisms, and variants have been described, several mutations have been found to be recurrent in this gene. We have analyzed 63 Chilean breast/ovarian cancer families for eighteen frequent BRCA1 mutations. The analysis of the five exons and two introns in which these mutations are located was made using mismatch PCR assay, ASO hybridization assay, restriction fragment analysis, allele specific PCR assay and direct sequentiation techniques. Two BRCA1 mutations (185delAG and C61G and one variant of unknown significance (E1250K were found in four of these families. Also, a new mutation (4185delCAAG and one previously described polymorphism (E1038G were found in two other families. The 185delAG was found in a 3.17 % of the families and the others were present only in one of the families of this cohort. Therefore these mutations are not prominent in the Chilean population. The variant of unknown significance and the polymorphism detected could represent a founder effect of Spanish origin

  7. MutaNET: a tool for automated analysis of genomic mutations in gene regulatory networks.

    Science.gov (United States)

    Hollander, Markus; Hamed, Mohamed; Helms, Volkhard; Neininger, Kerstin

    2018-03-01

    Mutations in genomic key elements can influence gene expression and function in various ways, and hence greatly contribute to the phenotype. We developed MutaNET to score the impact of individual mutations on gene regulation and function of a given genome. MutaNET performs statistical analyses of mutations in different genomic regions. The tool also incorporates the mutations in a provided gene regulatory network to estimate their global impact. The integration of a next-generation sequencing pipeline enables calling mutations prior to the analyses. As application example, we used MutaNET to analyze the impact of mutations in antibiotic resistance (AR) genes and their potential effect on AR of bacterial strains. MutaNET is freely available at https://sourceforge.net/projects/mutanet/. It is implemented in Python and supported on Mac OS X, Linux and MS Windows. Step-by-step instructions are available at http://service.bioinformatik.uni-saarland.de/mutanet/. volkhard.helms@bioinformatik.uni-saarland.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  8. Genetic interaction analysis of point mutations enables interrogation of gene function at a residue-level resolution

    Science.gov (United States)

    Braberg, Hannes; Moehle, Erica A.; Shales, Michael; Guthrie, Christine; Krogan, Nevan J.

    2014-01-01

    We have achieved a residue-level resolution of genetic interaction mapping – a technique that measures how the function of one gene is affected by the alteration of a second gene – by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine. PMID:24842270

  9. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo Lisboa Bittencourt

    2009-01-01

    Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  10. Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta.

    Science.gov (United States)

    Ho Duy, Binh; Zhytnik, Lidiia; Maasalu, Katre; Kändla, Ivo; Prans, Ele; Reimann, Ene; Märtson, Aare; Kõks, Sulev

    2016-08-12

    The genetics of osteogenesis imperfecta (OI) have not been studied in a Vietnamese population before. We performed mutational analysis of the COL1A1 and COL1A2 genes in 91 unrelated OI patients of Vietnamese origin. We then systematically characterized the mutation profiles of these two genes which are most commonly related to OI. Genomic DNA was extracted from EDTA-preserved blood according to standard high-salt extraction methods. Sequence analysis and pathogenic variant identification was performed with Mutation Surveyor DNA variant analysis software. Prediction of the pathogenicity of mutations was conducted using Alamut Visual software. The presence of variants was checked against Dalgleish's osteogenesis imperfecta mutation database. The sample consisted of 91 unrelated osteogenesis imperfecta patients. We identified 54 patients with COL1A1/2 pathogenic variants; 33 with COL1A1 and 21 with COL1A2. Two patients had multiple pathogenic variants. Seventeen novel COL1A1 and 10 novel COL1A2 variants were identified. The majority of identified COL1A1/2 pathogenic variants occurred in a glycine substitution (36/56, 64.3 %), usually serine (23/36, 63.9 %). We found two pathogenic variants of the COL1A1 gene c.2461G > A (p.Gly821Ser) in four unrelated patients and one, c.2005G > A (p.Ala669Thr), in two unrelated patients. Our data showed a lower number of collagen OI pathogenic variants in Vietnamese patients compared to reported rates for Asian populations. The OI mutational profile of the Vietnamese population is unique and related to the presence of a high number of recessive mutations in non-collagenous OI genes. Further analysis of OI patients negative for collagen mutations, is required.

  11. The combination of heteroduplex analysis and protein truncation test for exact detection of the APC gene mutations

    International Nuclear Information System (INIS)

    Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.

    1998-01-01

    Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)

  12. Mutation analysis of breast cancer gene BRCA among breast cancer Jordanian females

    International Nuclear Information System (INIS)

    Atoum, Manar F.; Al-Kayed, Sameer A.

    2004-01-01

    To screen mutations of the tumor suppressor breast cancer susceptibility gene 1 (BRCA1) within 3 exons among Jordanian breast cancer females. A total of 135 Jordanian breast cancer females were genetically analyzed by denaturing gradient electrophoresis (DGGE) for mutation detection in 3 BRCA1 exons (2, 11 and 20) between 2000-2002 in Al-Basheer Hospital, Amman, Jordan. Of the studied patients 50 had a family history of breast cancer, 28 had a family history of cancer other than breast cancer, and 57 had no family history of any cancer. Five germline mutations were detected among breast cancer females with a family history of breast cancers (one in exon 2 and 4 mutations in exon 11). Another germline mutation (within exon 11) was detected among breast cancer females with family history of cancer other than breast cancer, and no mutation was detected among breast cancer females with no family history of any cancer or among normal control females. Screening mutations within exon 2, exon 11 and exon 20 showed that most screened mutations were within BRCA1 exon 11 among breast cancer Jordanian families with a family history of breast cancer. (author)

  13. Mutation analysis of the MYO7A and CDH23 genes in Japanese patients with Usher syndrome type 1.

    Science.gov (United States)

    Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Takizawa, Yoshinori; Hosono, Katsuhiro; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

    2010-12-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 1 (USH1), the second common type of USH, is frequently caused by MYO7A and CDH23 mutations, accounting for 70-80% of the cases among various ethnicities, including Caucasians, Africans and Asians. However, there have been no reports of mutation analysis for any responsible genes for USH1 in Japanese patients. This study describes the first mutation analysis of MYO7A and CDH23 in Japanese USH1 patients. Five mutations (three in MYO7A and two in CDH23) were identified in four of five unrelated patients. Of these mutations, two were novel. One of them, p.Tyr1942SerfsX23 in CDH23, was a large deletion causing the loss of 3 exons. This is the first large deletion to be found in CDH23. The incidence of the MYO7A and CDH23 mutations in the study population was 80%, which is consistent with previous findings. Therefore, mutation screening for these genes is expected to be a highly sensitive method for diagnosing USH1 among the Japanese.

  14. Targeted resequencing for analysis of clonal composition of recurrent gene mutations in chronic lymphocytic leukaemia

    NARCIS (Netherlands)

    Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana; Blume, Carolin; Sellner, Leopold; Jauch, Anna; Sill, Martin; Kater, Arnon P.; te Raa, G. Doreen; Geisler, Christian; van Oers, Marinus; Dietrich, Sascha; Dreger, Peter; Ho, Anthony D.; Paruzynski, Anna; Schmidt, Manfred; von Kalle, Christof; Glimm, Hanno; Zenz, Thorsten

    2013-01-01

    Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were

  15. Targeted resequencing for analysis of clonal composition of recurrent gene mutations in chronic lymphocytic leukaemia

    DEFF Research Database (Denmark)

    Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana

    2013-01-01

    Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were...

  16. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese ...

    Indian Academy of Sciences (India)

    2016-10-24

    ,. People's Republic of China ... mutations in COL4A3 and COL4A4 genes which encode type IV collagen α3 and α4 chainsrespectively can .... hematuria and evidence for activation of the unfolded protein response. Focal and ...

  17. Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.

    Science.gov (United States)

    Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco

    2016-12-27

    In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.

  18. Mutation analysis of the candidate genes -, , and in patients with arrhythmogenic right ventricular cardiomyopathy

    DEFF Research Database (Denmark)

    Refsgaard, Lena; Olesen, Morten Salling; Møller, Daniel Vega

    2012-01-01

    INTRODUCTION: Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a genetically determined heart disease characterized by fibrofatty infiltrations in the myocardium, right and/or left ventricular involvement, and ventricular tachyarrhythmias. Although ten genes have been associated with ARVC......, only about 40% of the patients have an identifiable disease-causing mutation. In the present study we aimed at investigating the involvement of the genes SCN1B-SCN4B, FHL1, and LMNA in the pathogenesis of ARVC. METHODS: Sixty-five unrelated patients (55 fulfilling ARVC criteria and 10 borderline cases...... of the variants was non-synonymous. No disease-causing mutations were identified. CONCLUSIONS: In our limited sized cohort the six studied candidate genes were not associated with ARVC....

  19. Mutation analysis of the CHK2 gene in breast carcinoma and other cancers

    International Nuclear Information System (INIS)

    Ingvarsson, Sigurdur; Sigbjornsdottir, Bjarnveig I; Huiping, Chen; Hafsteinsdottir, Sigridur H; Ragnarsson, Gisli; Barkardottir, Rosa B; Arason, Adalgeir; Egilsson, Valgardur; Bergthorsson, Jon TH

    2002-01-01

    Mutations in the CHK2 gene at chromosome 22q12.1 have been reported in families with Li-Fraumeni syndrome. Chk2 is an effector kinase that is activated in response to DNA damage and is involved in cell-cycle pathways and p53 pathways. We screened 139 breast tumors for loss of heterozygosity at chromosome 22q, using seven microsatellite markers, and screened 119 breast tumors with single-strand conformation polymorphism and DNA sequencing for mutations in the CHK2 gene. Seventy-four of 139 sporadic breast tumors (53%) show loss of heterozygosity with at least one marker. These samples and 45 tumors from individuals carrying the BRCA2 999del5 mutation were screened for mutations in the CHK2 gene. In addition to putative polymorphic regions in short mononucleotide repeats in a non-coding exon and intron 2, a germ line variant (T59K) in the first coding exon was detected. On screening 1172 cancer patients for the T59K sequence variant, it was detected in a total of four breast-cancer patients, two colon-cancer patients, one stomach-cancer patient and one ovary-cancer patient, but not in 452 healthy individuals. A tumor-specific 5' splice site mutation at site +3 in intron 8 (TTgt [a → c]atg) was also detected. We conclude that somatic CHK2 mutations are rare in breast cancer, but our results suggest a tumor suppressor function for CHK2 in a small proportion of breast tumors. Furthermore, our results suggest that the T59K CHK2 sequence variant is a low-penetrance allele with respect to tumor growth

  20. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  1. Microarray Analysis of Iris Gene Expression in Mice with Mutations Influencing Pigmentation

    Science.gov (United States)

    Trantow, Colleen M.; Cuffy, Tryphena L.; Fingert, John H.; Kuehn, Markus H.

    2011-01-01

    Purpose. Several ocular diseases involve the iris, notably including oculocutaneous albinism, pigment dispersion syndrome, and exfoliation syndrome. To screen for candidate genes that may contribute to the pathogenesis of these diseases, genome-wide iris gene expression patterns were comparatively analyzed from mouse models of these conditions. Methods. Iris samples from albino mice with a Tyr mutation, pigment dispersion–prone mice with Tyrp1 and Gpnmb mutations, and mice resembling exfoliation syndrome with a Lyst mutation were compared with samples from wild-type mice. All mice were strain (C57BL/6J), age (60 days old), and sex (female) matched. Microarrays were used to compare transcriptional profiles, and differentially expressed transcripts were described by functional annotation clustering using DAVID Bioinformatics Resources. Quantitative real-time PCR was performed to validate a subset of identified changes. Results. Compared with wild-type C57BL/6J mice, each disease context exhibited a large number of statistically significant changes in gene expression, including 685 transcripts differentially expressed in albino irides, 403 in pigment dispersion–prone irides, and 460 in exfoliative-like irides. Conclusions. Functional annotation clusterings were particularly striking among the overrepresented genes, with albino and pigment dispersion–prone irides both exhibiting overall evidence of crystallin-mediated stress responses. Exfoliative-like irides from mice with a Lyst mutation showed overall evidence of involvement of genes that influence immune system processes, lytic vacuoles, and lysosomes. These findings have several biologically relevant implications, particularly with respect to secondary forms of glaucoma, and represent a useful resource as a hypothesis-generating dataset. PMID:20739468

  2. Comprehensive analysis of gene mutation and phenotype of tuberous sclerosis complex in China

    Directory of Open Access Journals (Sweden)

    Guo-qiang HUANG

    2015-04-01

    Full Text Available Objective To summarize the clinical features of tuberous sclerosis complex (TSC, the distribution and description of TSC gene, and to probe into the correlation of genotype with phenotype.  Methods According to the 1998 International Tuberous Sclerosis Complex Diagnostic Criteria, a total of 163 TSC patients with pathogenic mutation in TSC gene (3 cases were detected in our hospital, and the other 160 cases were collected from other institutions in China were enrolled, and their gene detection results and clinical data were analyzed.  Results Among 163 cases, TSC1 mutation (31 cases accounted for 19.02% [32.26% (10/31 in exon 15, 16.13% (5/31 in exon 21, 12.90% (4/31 in exon 18], and TSC2 mutation (132 cases accounted for 80.98% [9.85% (13/132 in exon 37, 7.58% (10/132 in exon 40, 6.82%(9/132 in exon 33]. The proportion of base replacement in TSC1 was 41.94% (13/31, and 52.27% (69/132 in TSC2. Male patients exhibited significantly more subependymal nodules or calcifications than thefemale patients (χ2 = 8.016, P = 0.005. Sporadic patients exhibited significantly more cortical tubers than familial patients (χ2 = 6.273, P = 0.012. Patients with TSC2 mutations had significantly higher frequencies of hypomelanotic macules than patients with TSC1 mutations (χ2 = 6.756, P = 0.009. Patients with missense mutations were more likely to have facial angiofibromas compared with patients with other mutations (χ2 = 4.438, P = 0.035.  Conclusions Exon 15, 21 and 18 of TSC1 and exon 37, 40 and 33 of TSC2 accounted for higher percentage of mutations. Correlating genotypes with phenotypes should facilitate the individualized treatment and prognostic assessment of tuberous sclerosis complex. DOI: 10.3969/j.issn.1672-6731.2015.04.013

  3. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  4. Functional Analysis of Thyroid Peroxidase Gene Mutations Detected in Patients with Thyroid Dyshormonogenesis

    Directory of Open Access Journals (Sweden)

    Srikanta Guria

    2014-01-01

    Full Text Available Thyroid peroxidase (TPO is the key enzyme in the biosynthesis of thyroid hormones. We aimed to identify the spectrum of mutations in the TPO gene leading to hypothyroidism in the population of West Bengal to establish the genetic etiology of the disease. 200 hypothyroid patients (case and their corresponding sex and age matched 200 normal individuals (control were screened depending on their clinical manifestations. Genomic DNA was isolated from peripheral blood samples and TPO gene (Exon 7 to Exon 14 was amplified by PCR. The PCR products were subjected to sequencing to identify mutations. Single nucleotide changes such as Glu 641 Lys, Asp 668 Asn, Thr 725 Pro, Asp 620 Asn, Ser 398 Thr, and Ala 373 Ser were found. Changes in the TPO were assayed in vitro to compare mutant and wild-type activities. Five mutants were enzymatically inactive in the guaiacol and iodide assays. This is a strong indication that the mutations are present at crucial positions of the TPO gene, resulting in inactivated TPO. The results of this study may help to develop a genetic screening protocol for goiter and hypothyroidism in the population of West Bengal.

  5. [Children with idiopathic hypogonadotropic hypogonadism: clinical data analysis and mutations analysis of KAL1 and FGFR1 gene].

    Science.gov (United States)

    Qin, Miao; Gong, Chunxiu; Qi, Zhan; Wu, Di; Liu, Min; Gu, Yi; Cao, Bingyan; Li, Wenjing; Liang, Xuejun

    2014-12-01

    delayed puberty, involving only one parent in 6 families, involving both in 2 families and the other one was an uncle having micropenis with a child. Among these 21 cases, only one boy's father had hyposmia and his first emission age was 14-15 years. Eleven patients accompanied abnormal sense of smelling and the olfactory organ abnormalities on MRI, 4 had olfactory organ abnormalities on MRI while they had good smelling function self-reportedly. We got 15 samples (12 KS and 3 nIHH cases) to screen the mutation of KAL1 (14 exons) and FGFR1 (18 exons). A splicing mutation c.1062+1G>A in KAL1 is identified in case 17 with IHH. One novel heterozygous FGFR1 mutation, a single base deletion mutation on the exon 1 c.27delC is identified in case 14. This mutation causes the premature termination codons. This pilot research showed that IHH/KS diagnosis in children depends on clinical manifestation rather than gene analysis. Small penis or cryptorchidism, smelling abnormality and positive familial history may contribute to the KS/HH diagnosis. MRI of olfactory bulb acts as important proof for diagnosis of KS. Mutations in KAL1 and FGFR1 gene are not main causes of Kallmann syndrome.

  6. WS1 gene mutation analysis of Wolfram syndrome in a Chinese patient and a systematic review of literatures.

    Science.gov (United States)

    Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin

    2010-10-01

    Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.

  7. Molecular genetic analysis of the F11 gene in 14 Turkish patients with factor XI deficiency: identification of novel and recurrent mutations and their inheritance within families.

    Science.gov (United States)

    Colakoglu, Seyma; Bayhan, Turan; Tavil, Betül; Keskin, Ebru Yılmaz; Cakir, Volkan; Gümrük, Fatma; Çetin, Mualla; Aytaç, Selin; Berber, Ergul

    2018-01-01

    Factor XI (FXI) deficiency is an autosomal bleeding disease associated with genetic defects in the F11 gene which cause decreased FXI levels or impaired FXI function. An increasing number of mutations has been reported in the FXI mutation database, most of which affect the serine protease domain of the protein. FXI is a heterogeneous disorder associated with a variable bleeding tendency and a variety of causative F11 gene mutations. The molecular basis of FXI deficiency in 14 patients from ten unrelated families in Turkey was analysed to establish genotype-phenotype correlations and inheritance of the mutations in the patients' families. Fourteen index cases with a diagnosis of FXI deficiency and family members of these patients were enrolled into the study. The patients' F11 genes were amplified by polymerase chain reaction and subjected to direct DNA sequencing analysis. The findings were analysed statistically using bivariate correlations, Pearson's correlation coefficient and the nonparametric Mann-Whitney test. Direct DNA sequencing analysis of the F11 genes revealed that all of the 14 patients had a F11 gene mutation. Eight different mutations were identified in the apple 1, apple 2 or serine protease domains, except one which was a splice site mutation. Six of the mutations were recurrent. Two of the mutations were novel missense mutations, p.Val522Gly and p.Cys581Arg, within the catalytic domain. The p.Trp519Stop mutation was observed in two families whereas all the other mutations were specific to a single family. Identification of mutations confirmed the genetic heterogeneity of FXI deficiency. Most of the patients with mutations did not have any bleeding complications, whereas some had severe bleeding symptoms. Genetic screening for F11 gene mutations is important to decrease the mortality and morbidity rate associated with FXI deficiency, which can be life-threatening if bleeding occurs in tissues with high fibrinolytic activity.

  8. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Directory of Open Access Journals (Sweden)

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  9. Gene mutations in children with chronic pancreatitis.

    Science.gov (United States)

    Witt, H

    2001-01-01

    In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

  10. VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

    Science.gov (United States)

    Jia, Peilin; Zhao, Zhongming

    2014-02-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

  11. Mutation analysis of the WFS1 gene in seven Danish Wolfram syndrome families; four new mutations identified

    DEFF Research Database (Denmark)

    Hansen, Lars; Eiberg, Hans Rudolf Lytchoff; Barrett, Timothy

    2005-01-01

    loss (LFSNHL). WFS1 variants were identified in eight subjects from seven families with WS, leading to the identification of four novel mutations, Q194X (nonsense), H313Y (missense), L313fsX360 (duplication frame shift) and F883fsX951 (deletion frame shift), and four previously reported mutations, A133...

  12. Mutated genes as research tool

    International Nuclear Information System (INIS)

    1981-01-01

    Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

  13. F4-related mutation and expression analysis of the aminopeptidase N gene in pigs.

    Science.gov (United States)

    Goetstouwers, T; Van Poucke, M; Nguyen, V U; Melkebeek, V; Coddens, A; Deforce, D; Cox, E; Peelman, L J

    2014-05-01

    Intestinal infections with F4 enterotoxigenic Escherichia coli (ETEC) are worldwide an important cause of diarrhea in neonatal and recently weaned pigs. Adherence of F4 ETEC to the small intestine by binding to specific receptors is mediated by F4 fimbriae. Porcine aminopeptidase N (ANPEP) was recently identified as a new F4 receptor. In this study, 7 coding mutations and 1 mutation in the 3' untranslated region (3' UTR)were identified in ANPEP by reverse transcriptase (RT-) PCR and sequencing using 3 F4 receptor-positive (F4R+) and 2 F4 receptor-negative (F4R-) pigs, which were F4 phenotyped based on the MUC4 TaqMan, oral immunization, and the in vitro villous adhesion assay. Three potential differential mutations (g.2615C > T, g.8214A > G, and g.16875C > G) identified by comparative analysis between the 3 F4R+ and 2 F4R- pigs were genotyped in 41 additional F4 phenotyped pigs. However, none of these 3 mutations could be associated with F4 ETEC susceptibility. In addition, the RT-PCR experiments did not reveal any differential expression or alternative splicing in the small intestine of F4R+ and F4R- pigs. In conclusion, we hypothesize that the difference in F4 binding to ANPEP is due to modifications in its carbohydrate moieties.

  14. DNA sequence analysis of the mutational specificity of u.v. light in the SUP4-o gene of yeast

    International Nuclear Information System (INIS)

    Kunz, B.A.; Mis, J.R.A.; Pierce, M.K.; Giroux, C.N.

    1987-01-01

    Mutations induced in the SUP4-o gene of Saccharomyces cerevisiae by u.v. irradiation have been characterized. DNA sequence analysis of 120 mutants revealed that u.v. induced all types of base substitutions, although transitions, in particular G:C → A:T events predominated. In addition, a small number of single base pair deletions and double mutations, occurring in tandem or separated by a few base pairs, were recovered. The base pair substitutions were not distributed randomly in the SUP4-o gene and, with one exception, were all located at sites of adjacent pyrimidines, suggesting they were targeted by u.v. photolesions. A substantial fraction of the mutations were detected at hotspots for u.v. mutagenesis. The majority of changes occurred at the 3' base of dipyrimidine sequences where both cyclobutane dimers and [6-4]-photoproducts could form. Approximately one-third of the induced base substitutions were found at potential pyrimidine dimer sites where [6-4]-photoproducts would be expected to occur rarely. Possible origins of the induced mutations and the role of cyclobutane dimers as premutational u.v. lesions in yeast are considered. (author)

  15. Mutation analysis of the adenomatous polyposis coli (APC) gene in Danish patients with familial adenomatous polyposis (FAP)

    DEFF Research Database (Denmark)

    Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen

    2004-01-01

    Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...

  16. Analysis of the GCK gene in 79 MODY type 2 patients: A multicenter Turkish study, mutation profile and description of twenty novel mutations.

    Science.gov (United States)

    Aykut, Ayça; Karaca, Emin; Onay, Hüseyin; Gökşen, Damla; Çetinkalp, Şevki; Eren, Erdal; Ersoy, Betül; Çakır, Esra Papatya; Büyükinan, Muammer; Kara, Cengiz; Anık, Ahmet; Kırel, Birgül; Özen, Samim; Atik, Tahir; Darcan, Şükran; Özkınay, Ferda

    2018-01-30

    Maturity onset diabetes is a genetic form of diabetes mellitus characterized by an early age at onset and several etiologic genes for this form of diabetes have been identified in many patients. Maturity onset diabetes type 2 [MODY2 (#125851)] caused by mutations in the glucokinase gene (GCK). Although its prevalence is not clear, it is estimated that 1%-2% of patients with diabetes have the monogenic form. The aim of this study was to evaluate the molecular spectrum of GCK gene mutations in 177 Turkish MODY type 2 patients. Mutations in the GCK gene were identified in 79 out of 177. All mutant alleles were identified, including 45 different GCK mutations, 20 of which were novel. Copyright © 2017. Published by Elsevier B.V.

  17. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  18. High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhihong CHEN

    2011-10-01

    Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

  19. Identification and Genetic Analysis of a Factor IX Gene Intron 3 Mutation in a Hemophilia B Pedigree in China

    Directory of Open Access Journals (Sweden)

    Dong Hua Cao

    2014-09-01

    Full Text Available OBJECTIVE: Hemophilia B is caused by coagulation defects in the factor IX gene located in Xq27.1 on the X chromosome. A wide range of mutations, showing extensive molecular heterogeneity, have been described in hemophilia B patients. Our study was aimed at genetic analysis and prenatal diagnosis of hemophilia B in order to further elucidate the pathogenesis of the hemophilia B pedigree in China. METHODS: Polymerase chain reaction amplification and direct sequencing of all the coding regions was conducted in hemophilia B patients and carriers. Prenatal diagnosis of the proband was conducted at 20 weeks. RESULTS: We identified the novel point mutation 10.389 A>G, located upstream of the intron 3 acceptor site in hemophilia B patients. The fetus of the proband’s cousin was identified as a carrier. CONCLUSION: Our identification of a novel mutation in the F9 gene associated with hemophilia B provides novel insight into the pathogenesis of this genetically inherited disorder and also represents the basis of prenatal diagnosis.

  20. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  1. Ocular Phenotype Analysis of a Family With Biallelic Mutations in the BEST1 Gene

    DEFF Research Database (Denmark)

    Sharon, Dror; Al-Hamdani, Sermed; Engelsberg, Karl

    2014-01-01

    in the inner nuclear layer, no light rise in the electro-oculography, and a reduced central but preserved peripheral retinal function by multifocal electroretinography. Full-field electroretinography demonstrated a reduced rod response and inner retina dysfunction. Retinal structure was normal in all 3 family......PURPOSE: To investigate the genetic cause and perform a comprehensive clinical analysis of a Danish family with autosomal recessive bestrophinopathy; to investigate whether Bestrophin may be expressed in normal human retina. DESIGN: Retrospective clinical and molecular genetic analysis...... and immunohistochemical observational study. METHODS: setting: National referral center. participants: A family with 5 individuals and biallelic BEST1 mutations, and enucleated eyes from 2 individuals with nonaffected retinas. observation procedures: Molecular genetic analysis included sequencing of BEST1 and co...

  2. Mutations in the Norrie disease gene.

    Science.gov (United States)

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    Science.gov (United States)

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  4. High resolution melting analysis for the detection of EMS induced mutations in wheat SbeIIa genes

    Directory of Open Access Journals (Sweden)

    Botticella Ermelinda

    2011-11-01

    Full Text Available Abstract Background Manipulation of the amylose-amylopectin ratio in cereal starch has been identified as a major target for the production of starches with novel functional properties. In wheat, silencing of starch branching enzyme genes by a transgenic approach reportedly caused an increase of amylose content up to 70% of total starch, exhibiting novel and interesting nutritional characteristics. In this work, the functionality of starch branching enzyme IIa (SBEIIa has been targeted in bread wheat by TILLING. An EMS-mutagenised wheat population has been screened using High Resolution Melting of PCR products to identify functional SNPs in the three homoeologous genes encoding the target enzyme in the hexaploid genome. Results This analysis resulted in the identification of 56, 14 and 53 new allelic variants respectively for SBEIIa-A, SBEIIa-B and SBEIIa-D. The effects of the mutations on protein structure and functionality were evaluated by a bioinformatic approach. Two putative null alleles containing non-sense or splice site mutations were identified for each of the three homoeologous SBEIIa genes; qRT-PCR analysis showed a significant decrease of their gene expression and resulted in increased amylose content. Pyramiding of different single null homoeologous allowed to isolate double null mutants showing an increase of amylose content up to 21% compared to the control. Conclusion TILLING has successfully been used to generate novel alleles for SBEIIa genes known to control amylose content in wheat. Single and double null SBEIIa genotypes have been found to show a significant increase in amylose content.

  5. Mutation analysis of the phenylalanine hydroxylase gene in Azerbaijani population, a report from West Azerbaijan province of Iran

    Directory of Open Access Journals (Sweden)

    Morteza Bagheri

    2015-07-01

    Full Text Available Objective(s:Phenylketonuria (PKU is a genetic inborn error of phenylalanine (Phe metabolism resulting from insufficiency in the hepatic enzyme, phenylalanine hydroxylase (PAH, which leads to elevated levels of Phe in the blood. The present study was carried out for mutation analysis of the PAH gene in West Azerbaijan province of Iran. Materials and Methods:A total of 218 alleles from 40 PKU families were studied using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR method. Results:The frequencies of IVS10-11, S67P, R261Q, R252W, IVS11nt-1 g>c, R408Q, and Q232Q mutations were 28(35, 17(21.25, 15(18.75, 3(3.75, 3(3.75, 2(2.5, and 1(1.25, in cases group, and 51(23.4, 31(14.2, 27(12.4, 6(2.75, 6(2.75, 4(1.83, and 2(0.92 in total group, respectively. The mutations of R243Q, 364delG, L333F, 261X, I65T, and R408W were not detected in our samples. Conclusion: It can be concluded that the IVS10-11 mutation has the highest frequency in the tested population. To our knowledge, this report is the first in its own kind and provides better understanding of the genetic heterogeneity, the origin and distributions of PAH mutations in West Azerbaijan province of Iran.

  6. Mutation analysis of the human CYP3A4 gene 5' regulatory region: population screening using non-radioactive SSCP.

    Science.gov (United States)

    Hamzeiy, Hossein; Vahdati-Mashhadian, Nasser; Edwards, Helen J; Goldfarb, Peter S

    2002-03-20

    Human CYP3A4 is the major cytochrome P450 isoenzyme in adult human liver and is known to metabolise many xenobiotic and endogenous compounds. There is substantial inter-individual variation in the hepatic levels of CYP3A4. Although, polymorphic mutations have been reported in the 5' regulatory region of the CYP3A4 gene, those that have been investigated so far do not appear to have any effect on gene expression. To determine whether other mutations exist in this region of the gene, we have performed a new population screen on a panel of 101 human DNA samples. A 1140 bp section of the 5' proximal regulatory region of the CYP3A4 gene, containing numerous regulatory motifs, was amplified from genomic DNA as three overlapping segments. The 300 bp distal enhancer region at -7.9kb containing additional regulatory motifs was also amplified. Mutation analysis of the resulting PCR products was carried out using non-radioactive single strand conformation polymorphism (SSCP) and confirmatory sequencing of both DNA strands in those samples showing extra SSCP bands. In addition to detection of the previously reported CYP3A4*1B allele in nine subjects, three novel alleles were found: CYP3A4*1E (having a T-->A transversion at -369 in one subject), CYP3A4*1F (having a C-->G tranversion at -747 in 17 subjects) and CYP3A4*15B containing a nine-nucleotide insertion between -845 and -844 linked to an A-->G transition at -392 and a G-->A transition in exon 6 (position 485 in the cDNA) in one subject. All the novel alleles were heterozygous. No mutations were found in the upstream distal enhancer region. Our results clearly indicate that this rapid and simple SSCP approach can reveal mutant alleles in drug metabolising enzyme genes. Detection and determination of the frequency of novel alleles in CYP3A4 will assist investigation of the relationship between genotype, xenobiotic metabolism and toxicity in the CYP3A family of isoenzymes.

  7. Hereditary cancer genes are highly susceptible to splicing mutations

    Science.gov (United States)

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  8. Hereditary cancer genes are highly susceptible to splicing mutations.

    Directory of Open Access Journals (Sweden)

    Christy L Rhine

    2018-03-01

    Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

  9. Non-invasive detection of urothelial cancer through the analysis of driver gene mutations and aneuploidy

    Science.gov (United States)

    Li, Lu; Douville, Christopher; Wang, Yuxuan; Cohen, Joshua David; Taheri, Diana; Silliman, Natalie; Schaefer, Joy; Ptak, Janine; Dobbyn, Lisa; Papoli, Maria; Kinde, Isaac; Afsari, Bahman; Tregnago, Aline C; Bezerra, Stephania M; VandenBussche, Christopher; Fujita, Kazutoshi; Ertoy, Dilek; Cunha, Isabela W; Yu, Lijia; Bivalacqua, Trinity J; Grollman, Arthur P; Diaz, Luis A; Karchin, Rachel; Danilova, Ludmila; Huang, Chao-Yuan; Shun, Chia-Tung; Turesky, Robert J; Yun, Byeong Hwa; Rosenquist, Thomas A; Pu, Yeong-Shiau; Hruban, Ralph H; Tomasetti, Cristian; Papadopoulos, Nickolas; Kinzler, Ken W

    2018-01-01

    Current non-invasive approaches for detection of urothelial cancers are suboptimal. We developed a test to detect urothelial neoplasms using DNA recovered from cells shed into urine. UroSEEK incorporates massive parallel sequencing assays for mutations in 11 genes and copy number changes on 39 chromosome arms. In 570 patients at risk for bladder cancer (BC), UroSEEK was positive in 83% of those who developed BC. Combined with cytology, UroSEEK detected 95% of patients who developed BC. Of 56 patients with upper tract urothelial cancer, 75% tested positive by UroSEEK, including 79% of those with non-invasive tumors. UroSEEK detected genetic abnormalities in 68% of urines obtained from BC patients under surveillance who demonstrated clinical evidence of recurrence. The advantages of UroSEEK over cytology were evident in low-grade BCs; UroSEEK detected 67% of cases whereas cytology detected none. These results establish the foundation for a new non-invasive approach for detection of urothelial cancer. PMID:29557778

  10. Mutation analysis of the MDM4 gene in German breast cancer patients

    International Nuclear Information System (INIS)

    Reincke, Scarlett; Govbakh, Lina; Wilhelm, Bettina; Jin, Haiyan; Bogdanova, Natalia; Bremer, Michael; Karstens, Johann H; Dörk, Thilo

    2008-01-01

    MDM4 is a negative regulator of p53 and cooperates with MDM2 in the cellular response to DNA damage. It is unknown, however, whether MDM4 gene alterations play some role in the inherited component of breast cancer susceptibility. We sequenced the whole MDM4 coding region and flanking untranslated regions in genomic DNA samples obtained from 40 German patients with familial breast cancer. Selected variants were subsequently screened by RFLP-based assays in an extended set of breast cancer cases and controls. Our resequencing study uncovered two MDM4 coding variants in 4/40 patients. Three patients carried a silent substitution at codon 74 that was linked with another rare variant in the 5'UTR. No association of this allele with breast cancer was found in a subsequent screening of 133 patients with bilateral breast cancer and 136 controls. The fourth patient was heterozygous for the missense substitution D153G which is located in a less conserved region of the MDM4 protein but may affect a predicted phosphorylation site. The D153G substitution only partially segregated with breast cancer in the family and was not identified on additional 680 chromosomes screened. This study did not reveal clearly pathogenic mutations although it uncovered two new unclassified variants at a low frequency. We conclude that there is no evidence for a major role of MDM4 coding variants in the inherited susceptibility towards breast cancer in German patients

  11. MDE heteroduplex analysis of PCR products spanning each exon of the fibrillin (FBN1) gene greatly increases the efficiency of mutation detection in the Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)

    1994-09-01

    Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.

  12. Mutation scanning of peach floral genes

    Directory of Open Access Journals (Sweden)

    Wilde H Dayton

    2011-05-01

    Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

  13. Molecular analysis of the most prevalent mutations of the FANCA and FANCC genes in Brazilian patients with Fanconi anaemia

    OpenAIRE

    Rodriguez, David Enrique Aguilar; Lima, Carmen Silvia Passos; Lourenço, Gustavo Jacob; Figueiredo, Maria Estela; Carneiro, Jorge David Aivazoglu; Tone, Luiz Gonzaga; Llerena Jr., Juan Clinton; Toscano, Raquel Alves; Brandalise, Silvia; Pinto Júnior, Walter; Costa, Fernando Ferreira; Bertuzzo, Carmen Sílvia

    2005-01-01

    Fanconi anaemia (FA) is a recessive autosomal disease determined by mutations in genes of at least eleven complementation groups, with distinct distributions in different populations. As far as we know, there are no reports regarding the molecular characterisation of the disease in unselected FA patients in Brazil. OBECTIVE: This study aimed to investigate the most prevalent mutations of FANCA and FANCC genes in Brazilian patients with FA. METHODS: Genomic DNA obtained from 22 racially and et...

  14. ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari

    2016-11-01

    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  15. Molecular analysis of the most prevalent mutations of the FANCA and FANCC genes in Brazilian patients with Fanconi anaemia

    Directory of Open Access Journals (Sweden)

    David Enrique Aguilar Rodriguez

    2005-01-01

    Full Text Available Fanconi anaemia (FA is a recessive autosomal disease determined by mutations in genes of at least eleven complementation groups, with distinct distributions in different populations. As far as we know, there are no reports regarding the molecular characterisation of the disease in unselected FA patients in Brazil. OBECTIVE: This study aimed to investigate the most prevalent mutations of FANCA and FANCC genes in Brazilian patients with FA. METHODS: Genomic DNA obtained from 22 racially and ethnically diverse unrelated FA patients (mean age ± SD: 14.0 ± 7.8 years; 10 male, 12 female; 14 white, 8 black was analysed by polymerase chain reaction and restriction site assays for identification of FANCA (delta3788-3790 and FANCC (delta322G, IVS4+4A -> T, W22X, L496R, R548X, Q13X, R185X, and L554P gene mutations. RESULTS: Mutations in FANCA and FANCC genes were identified in 6 (27.3% and 14 (63.6% out of 22 patients, respectively. The disease could not be attributed to the tested mutations in the two remaining patients enrolled in the study (9.1%. The registry of the two most prevalent gene abnormalities (delta3788-3790 and IVS4 + 4 -> T revealed that they were present in 18.2% and 15.9% of the FA alleles, respectively. Additional FANCC gene mutations were found in the study, with the following prevalence: delta322G (11.4%, W22X (9.1%, Q13X (2.3%, L554P (2.3%, and R548X (2.3% of total FA alleles. CONCLUSION: These results suggest that mutations of FANCA and FANCC genes are the most prevalent mutations among FA patients in Brazil.

  16. Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations.

    Science.gov (United States)

    Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela

    2011-03-01

    Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.

  17. Novel mutations and phenotypic associations identified through APC, MUTYH, NTHL1, POLD1, POLE gene analysis in Indian Familial Adenomatous Polyposis cohort.

    Science.gov (United States)

    Khan, Nikhat; Lipsa, Anuja; Arunachal, Gautham; Ramadwar, Mukta; Sarin, Rajiv

    2017-05-22

    Colo-Rectal Cancer is a common cancer worldwide with 5-10% cases being hereditary. Familial Adenomatous Polyposis (FAP) syndrome is due to germline mutations in the APC or rarely MUTYH gene. NTHL1, POLD1, POLE have been recently reported in previously unexplained FAP cases. Unlike the Caucasian population, FAP phenotype and its genotypic associations have not been widely studied in several geoethnic groups. We report the first FAP cohort from South Asia and the only non-Caucasian cohort with comprehensive analysis of APC, MUTYH, NTHL1, POLD1, POLE genes. In this cohort of 112 individuals from 53 FAP families, we detected germline APC mutations in 60 individuals (45 families) and biallelic MUTYH mutations in 4 individuals (2 families). No NTHL1, POLD1, POLE mutations were identified. Fifteen novel APC mutations and a new Indian APC mutational hotspot at codon 935 were identified. Eight very rare FAP phenotype or phenotypes rarely associated with mutations outside specific APC regions were observed. APC genotype-phenotype association studies in different geo-ethnic groups can enrich the existing knowledge about phenotypic consequences of distinct APC mutations and guide counseling and risk management in different populations. A stepwise cost-effective mutation screening approach is proposed for genetic testing of south Asian FAP patients.

  18. Evaluating the performance of clinical criteria for predicting mismatch repair gene mutations in Lynch syndrome: a comprehensive analysis of 3,671 families.

    Science.gov (United States)

    Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph

    2014-07-01

    Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p small-bowel cancer (p small-bowel cancer were clinically relevant predictors for Lynch syndrome. © 2013 UICC.

  19. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  20. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  1. Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2013-08-01

    Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

  2. Analysis of common deafness gene mutations in deaf people from unique ethnic groups in Gansu Province, China.

    Science.gov (United States)

    Xu, Bai-Cheng; Bian, Pan-Pan; Liu, Xiao-Wen; Zhu, Yi-Ming; Yang, Xiao-Long; Ma, Jian-Li; Chen, Xing-Jian; Wang, Yan-Li; Guo, Yu-Fen

    2014-09-01

    The GJB2 gene mutation characteristic of Dongxiang was the interaction result of ethnic background and geographical environment, and Yugur exhibited the typical founder effect. The SLC26A4 gene mutation characteristic of Dongxiang was related to caucasian backgrounds and selection of purpose exons, i.e. ethnic background and the penetrance of ethnic specificity caused the low mtDNA1555A>G mutation frequency in Dongxiang. To determine the prevalence of GJB2 and SLC26A4 genes and mtDNA1555A>G mutations and analyze the ethnic specificity in the non-syndromic sensorineural hearing loss (NSHL) of unique ethnic groups in Gansu Province. Peripheral blood samples were obtained from Dongxiang, Yugur, Bonan, and ethnic Han groups with moderately severe to profound NSHL in Gansu Province. Bidirectional sequencing (or enzyme digestion) was applied to identify the sequence variations. The pathogenic allele frequency of the three gene mutations was different. The frequency of the GJB2 gene among the Dongxiang, Yugur, Bonan, and ethnic Han groups was 9.03%, 12.5%, 5.88%, and 12.17%, respectively. No difference was found between the ethnic groups. The frequencies of the SLC26A4 genes were 3.23%, 8.33%, 0%, and 9.81%, respectively. The mutation frequency of mtDNA1555A>G was 0%, 0%, 0%, and 6.03%, respectively. No difference was found between the ethnic groups, except for the Dongxiang and ethnic Han groups, both in SLC26A4 gene and mtDNA1555A>G.

  3. Evaluation and identification of factors related to KRAS and BRAF gene mutations in colorectal cancer: A meta-analysis

    Directory of Open Access Journals (Sweden)

    Li Lin

    2016-01-01

    Conclusion: The meta-analysis reveals that KRAS has a slightly higher mutation rate in MSI-L/MSS tumors. Moreover, BRAF mutations have higher detection rates in right-sided colorectal cancer, which suggests that BRAF mutations are likely in CIMP-H tumors. Therefore, based on these findings, the molecular diagnostic tests to be conducted in colorectal cancer patients can be determined according to the location/clinical features of the tumor.

  4. Analysis of P gene mutations in patients with type II (tyrosinase-positive) oculocutaneous albinism (OCA2)

    Energy Technology Data Exchange (ETDEWEB)

    Lee, S.T.; Nicholls, R.D.; Schnur, R. [Univ. of Wisconsin, Madison, WI (United States)]|[Case Western Reserve Univ., Cleveland, OH (United States)]|[Children`s Hospital of Philadelphia, PA (United States)] [and others

    1994-09-01

    OCA2 is an autosomal recessive disorder in which the biosynthesis of melanin pigment is greatly reduced in the skin, hair, and eyes. Recently, we showed that OCA2 results from mutations of the P gene, in chromosome segment 15q11-q13. In addition to OCA2, mutations of P account for OCA associated with the Prader-Willi syndrome and some cases of {open_quotes}autosomal recessive ocular albinism{close_quotes} (AROA). We have now studied 38 unrelated patients with various forms of OCA2 or AROA from a variety of different ethnic groups. None of these patients had detectable abnormalities of the tyrosinase (TYR) gene. Among 8 African-American patients with OCA2 we observed apparent locus homogeneity. We detected abnormalities of the P gene in all 8 patients, including 12 different mutations and deletions, most of which are unique to this group and none of which is predominant. In contrast, OCA2 in other populations appears to be genetically heterogeneous. Among 21 Caucasian patients we detected abnormalities of the P gene in only 8, comprising 9 different point mutations and deletions, some of which also occurred among the African-American patients. Among 3 Middle-Eastern, 3 Indo-Pakistani, and 3 Asian patients we detected mutations of the P gene in only one from each group. In a large Indo-Pakistani kindred with OCA2 we have excluded both the TYR and P genes on the basis of genetic linkage. The prevalence of mutations of the P gene thus appears to be much higher among African-Americans with OCA2 than among patients from other ethnic groups. The incidence of OCA2 in some parts of equatorial Africa is extremely high, as frequent as 1 per 1100, and the disease has been linked to P in South African Bantu. The eventual characterization of P gene mutations in Africans will be informative with regard to the origins of P gene mutations in African-American patients.

  5. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia

    2017-10-11

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  6. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia; Requena, David; Gushiken, Eduardo; Gilman, Robert H.; Antiparra, Ricardo; Lucero, Bryan; Lizá rraga, Pilar; Cieza, Basilio; Roncal, Elisa; Grandjean, Louis; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; Moore, David; Zimic, Mirko

    2017-01-01

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  7. The molecular analysis of mutations in exons 4, 11 and 21 of the cystic fibrosis transmembrane conductance regulator (CFTR gene in cystic fibrosis patients in Kermanshah, Iran

    Directory of Open Access Journals (Sweden)

    Nasibe Karimi

    2017-03-01

    Full Text Available Introduction: Cystic fibrosis (CF is a common genetic disorder in white populations with an autosomal recessive pattern, caused by mutations in the CFTR gene. The frequency of more than 1950 various mutations reported in the CFTR gene significantly varies in different populations. ∆F508 is a common mutation in exon 10, which is first addressed in the molecular analysis of the disease. Other exons are required to be investigated owing to failing to identify mutations in the patients. The present study was conducted to investigate mutations in exons 4, 11 and 21 of the CFTR gene using the sequencing method in CF patients in Kermanshah province, Iran. Methods: The present descriptive study was conducted on all patients with CF presenting to the medical genetics center in Kermanshah in 2010-2011. After taking blood samples and extracting DNA using saturated NaCl solution, sequences of exons were amplified using PCR and sequenced for identifying mutations. Results: The frequency of mutations was found to be respectively 0, 0 and 5.5% in exon 11, 21 and 4. The D110H mutation was found to be homozygous in one subject and heterozygous in another. Moreover, the 4029A>G polymorphism (12.9% was found to be homozygous in two subjects and heterozygous in three others. Conclusion: The D110H mutation is recommended to be included in the screening programs of the study population. The results obtained support the effects of ethnic and geographical factors on the distribution of CF mutations.

  8. Identification and functional analysis of a novel mutation in the SOX10 gene associated with Waardenburg syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Chen, Hong-Sheng; Li, Hai-Bo; Zhang, Hua; Mei, Ling-Yun; He, Chu-Feng; Wang, Xing-Wei; Men, Mei-Chao; Jiang, Lu; Liao, Xin-Bin; Wu, Hong; Feng, Yong

    2014-03-15

    Waardenburg syndrome type IV (WS4) is a rare genetic disorder, characterized by auditory-pigmentary abnormalities and Hirschsprung disease. Mutations of the EDNRB gene, EDN3 gene, or SOX10 gene are responsible for WS4. In the present study, we reported a case of a Chinese patient with clinical features of WS4. In addition, the three genes mentioned above were sequenced in order to identify whether mutations are responsible for the case. We revealed a novel nonsense mutation, c.1063C>T (p.Q355*), in the last coding exon of SOX10. The same mutation was not found in three unaffected family members or 100 unrelated controls. Then, the function and mechanism of the mutation were investigated in vitro. We found both wild-type (WT) and mutant SOX10 p.Q355* were detected at the expected size and their expression levels are equivalent. The mutant protein also localized in the nucleus and retained the DNA-binding activity as WT counterpart; however, it lost its transactivation capability on the MITF promoter and acted as a dominant-negative repressor impairing function of the WT SOX10. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Analysis of two mutations in the MTHFR gene associated with mild ...

    African Journals Online (AJOL)

    Conclusions. Since hyperhomocysteinaemia is a risk factor for premature CVD, the heterogeneous distribution of the 677C→T and 1298A→C mutations across ethnic groups may partly explain ethnic differences in heart disease risk through decreased enzyme activity and hence increased homocysteine levels.

  10. Qualitative analysis of mouse specific-locus mutations: information on genetic organization, gene expression, and the chromosomal nature of induced lesions

    International Nuclear Information System (INIS)

    Russell, L.B.

    1982-01-01

    Analysis of mouse specific-locus (SL) mutations at three loci has identified over 33 distinct complementation groups - most of which are probably overlapping deficiencies - and 13 to 14 new functional units. The complementation maps that have been generated for the d-se and c regions include numerous vital functions; however, some of the genes in these regions are non-vital. At such loci, hypomorphic mutants must represent intragenic alterations, and some viable nulls could conceivably be intragenic lesions also. Analysis of SL mutations has provided information on genetic expression. Homozygous deficiencies can be completely viable or can kill at any one of a range of developmental stages. Heterozygonus deficiencies of up to 6 cM or more in genetic length have been recovered and propagated. The time of death of homozygous and the degree of inviability of heterozygous deficiencies are related more to specific content of the missing segment than to its length. Combinations of deficiencies with x-autosome translocations that inactivate the homologous region in a mosaic fashion have shown that organismic lethals are not necessarily cell lethal. The spectrum of mutations induced depends on the nature of the mutagen and the type of germ cell exposed. Radiation of spermatogonia produces intragenic as well as null mutations. Spontaneous mutations have an admixture of types not present in populations of mutations induced in germ cells, and this raises doubts concerning the accuracy of doubling-dose calculations in genetic risk estimation. The analysis of SL mutations has yielded genetic tools for the construction of detailed gene-dosage series, cis-trans comparisons, the mapping of known genes and identification of new genes, genetic rescue of various types, and the identification and isolation of DNA sequences

  11. SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

    Directory of Open Access Journals (Sweden)

    Yuan-Zong Song

    Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

  12. Protein truncation test: analysis of two novel point mutations at the carboxy-terminus of the human dystrophin gene associated with mental retardation.

    Science.gov (United States)

    Tuffery, S; Lenk, U; Roberts, R G; Coubes, C; Demaille, J; Claustres, M

    1995-01-01

    Approximately one-third of the mutations responsible for Duchenne muscular dytrophy (DMD) do not involve gross rearrangements of the dystrophin gene. Methods for intensive mutation screening have recently been applied to this immense gene, which resulted in the identification of a number of point mutations in DMD patients, mostly translation-terminating mutations. A number of data raised the possibility that the C-terminal region of dystrophin might be involved in some cases of mental retardation associated with DMD. Using single-strand conformation analysis of products amplified by polymerase chain reaction (PCR-SSCA) to screen the terminal domains of the dystrophin gene (exons 60-79) of 20 unrelated patients with DMD or BMD, we detected two novel point mutations in two mentally retarded DMD patients: a 1-bp deletion in exon 70 (10334delC) and a 5' splice donor site alteration in intron 69 (10294 + 1G-->T). Both mutations should result in a premature translation termination of dystrophin. The possible effects on the reading frame were analyzed by the study of reverse transcripts amplified from peripheral blood lymphocytes mRNA and by the protein truncation test.

  13. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  14. Molecular analysis of HEXA gene in Argentinean patients affected with Tay-Sachs disease: possible common origin of the prevalent c.459+5A>G mutation.

    Science.gov (United States)

    Zampieri, Stefania; Montalvo, Annalisa; Blanco, Mariana; Zanin, Irene; Amartino, Hernan; Vlahovicek, Kristian; Szlago, Marina; Schenone, Andrea; Pittis, Gabriela; Bembi, Bruno; Dardis, Andrea

    2012-05-15

    Tay-Sachs disease (TSD) is a recessively inherited disorder caused by the deficient activity of hexosaminidase A due to mutations in the HEXA gene. Up to date there is no information regarding the molecular genetics of TSD in Argentinean patients. In the present study we have studied 17 Argentinean families affected by TSD, including 20 patients with the acute infantile form and 3 with the sub-acute form. Overall, we identified 14 different mutations accounting for 100% of the studied alleles. Eight mutations were novel: 5 were single base changes leading to drastic residue changes or truncated proteins, 2 were small deletions and one was an intronic mutation that may cause a splicing defect. Although the spectrum of mutations was highly heterogeneous, a high frequency of the c.459+5G>A mutation, previously described in different populations was found among the studied cohort. Haplotype analysis suggested that in these families the c.459+5G>A mutation might have arisen by a single mutational event. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. A molecular genetic analysis of carotenoid biosynthesis and the effects of carotenoid mutations on other photosynthetic genes in Rhodobacter capsulatus

    International Nuclear Information System (INIS)

    Armstrong, G.A.

    1989-04-01

    The nine known R. capsulatus carotenoid genes are contained within the 46 kilobase (kb) photosynthesis gene cluster. An 11 kb subcluster containing eight of these genes has been cloned and its nucleotide sequence determined. A new gene, crtK, has been located in the middle of the subcluster. The carotenoid gene cluster contains sequences homologous to Escherichia coli ω 70 promoters, rho-independent transcription terminators, and prokaryotic transcriptional factor binding sites. The phenotypes and genotypes of ten transposon Tn5.7 insertion mutations within the carotenoid gene cluster have been analyzed, by characterization of the carotenoids accumulated and high resolution mapping of the Tn5.7 insertions. The enzymatic blockages in previously uncharacterized early carotenoid mutants have been determined using a new in vitro synthesis system, suggesting specific roles for the CrtB and CrtE gene products. The expression of six of the eight carotenoid genes in the cluster is induced upon the shift from dark chemoheterotrophic to anaerobic photosynthetic growth. The magnitude of the induction is equivalent to that of genes encoding structural photosynthesis polypeptides, although the carotenoid genes are induced earlier after the growth shift. Different means of regulating photosynthesis genes in R. capsulatus are discussed, and a rationale for the temporal pattern of expression of the carotenoid genes during photosynthetic adaptation is presented. Comparison of the deduced amino acid sequences of the two dehydrogenases of the R. capsulatus carotenoid biosynthesis pathway reveals two regions of strong similarity. The effect of carotenoid mutations on the photosynthetic phenotype has been studied by examining growth rates, pigments, pigment-protein complexes and gene expression for a complete set of carotenoid mutants. 161 refs

  16. A molecular genetic analysis of carotenoid biosynthesis and the effects of carotenoid mutations on other photosynthetic genes in Rhodobacter capsulatus

    Energy Technology Data Exchange (ETDEWEB)

    Armstrong, G.A.

    1989-04-01

    The nine known R. capsulatus carotenoid genes are contained within the 46 kilobase (kb) photosynthesis gene cluster. An 11 kb subcluster containing eight of these genes has been cloned and its nucleotide sequence determined. A new gene, crtK, has been located in the middle of the subcluster. The carotenoid gene cluster contains sequences homologous to Escherichia coli ..omega../sup 70/ promoters, rho-independent transcription terminators, and prokaryotic transcriptional factor binding sites. The phenotypes and genotypes of ten transposon Tn5.7 insertion mutations within the carotenoid gene cluster have been analyzed, by characterization of the carotenoids accumulated and high resolution mapping of the Tn5.7 insertions. The enzymatic blockages in previously uncharacterized early carotenoid mutants have been determined using a new in vitro synthesis system, suggesting specific roles for the CrtB and CrtE gene products. The expression of six of the eight carotenoid genes in the cluster is induced upon the shift from dark chemoheterotrophic to anaerobic photosynthetic growth. The magnitude of the induction is equivalent to that of genes encoding structural photosynthesis polypeptides, although the carotenoid genes are induced earlier after the growth shift. Different means of regulating photosynthesis genes in R. capsulatus are discussed, and a rationale for the temporal pattern of expression of the carotenoid genes during photosynthetic adaptation is presented. Comparison of the deduced amino acid sequences of the two dehydrogenases of the R. capsulatus carotenoid biosynthesis pathway reveals two regions of strong similarity. The effect of carotenoid mutations on the photosynthetic phenotype has been studied by examining growth rates, pigments, pigment-protein complexes and gene expression for a complete set of carotenoid mutants. 161 refs.

  17. Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Medori, R.; Tritschler, H.J. (Universita di Bologna (Italy))

    1993-10-01

    Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of French ancestry. Three family members who are under 40 years of age and who inherited the mutation showed only reduced perfusion in the basal ganglia on single photon emission computerized tomography. Some FFI features differ from the clinical and neuropathologic findings associated with 178[sup Asn] reported elsewhere. However, additional intragenic mutations accounting for the phenotypic differences were not observed in two affected individuals. In other sporadic and familial forms of Creutzfeldt-Jakob disease and Gerstmann-Straeussler syndrome, Met or Val homozygosity at polymorphic codon 129 is associated with a more severe phenotype, younger age at onset, and faster progression. In FFI, young and old individuals at disease onset had 129[sup Met/Val]. Moreover, of five 178[sup Asn] individuals who are above age-at-onset range and who are well, two have 129[sup Met] and three have 129[sup Met/Val], suggesting that polymorphic site 129 does not modulate FFI phenotypic expression. Genetic heterogeneity and environment may play an important role in inter- and intrafamilial variability of the 178[sup Asn] mutation. 32 refs., 5 figs., 1 tab.

  18. Generation and analysis of knock-in mice carrying pseudohypoaldosteronism type II-causing mutations in the cullin 3 gene.

    Science.gov (United States)

    Araki, Yuya; Rai, Tatemitsu; Sohara, Eisei; Mori, Takayasu; Inoue, Yuichi; Isobe, Kiyoshi; Kikuchi, Eriko; Ohta, Akihito; Sasaki, Sei; Uchida, Shinichi

    2015-10-21

    Pseudohypoaldosteronism type II (PHAII) is a hereditary hypertensive disease caused by mutations in four different genes: with-no-lysine kinases (WNK) 1 and 4, Kelch-like family member 3 (KLHL3), and cullin 3 (Cul3). Cul3 and KLHL3 form an E3 ligase complex that ubiquitinates and reduces the expression level of WNK4. PHAII-causing mutations in WNK4 and KLHL3 impair WNK4 ubiquitination. However, the molecular pathogenesis of PHAII caused by Cul3 mutations is unclear. In cultured cells and human leukocytes, PHAII-causing Cul3 mutations result in the skipping of exon 9, producing mutant Cul3 protein lacking 57 amino acids. However, whether this phenomenon occurs in the kidneys and is responsible for the pathogenesis of PHAII in vivo is unknown. We generated knock-in mice carrying a mutation in the C-terminus of intron 8 of Cul3, c.1207-1G>A, which corresponds to a PHAII-causing mutation in the human Cul3 gene. Heterozygous Cul3(G(-1)A/+) knock-in mice did not exhibit PHAII phenotypes, and the skipping of exon 9 was not evident in their kidneys. However, the level of Cul3 mRNA expression in the kidneys of heterozygous knock-in mice was approximately half that of wild-type mice. Furthermore, homozygous knock-in mice were nonviable. It suggested that the mutant allele behaved like a knockout allele and did not produce Cul3 mRNA lacking exon 9. A reduction in Cul3 expression alone was not sufficient to develop PHAII in the knock-in mice. Our findings highlighted the pathogenic role of mutant Cul3 protein and provided insight to explain why PHAII-causing mutations in Cul3 cause kidney-predominant PHAII phenotypes. © 2015. Published by The Company of Biologists Ltd.

  19. Functional analysis of a SOX10 gene mutation associated with Waardenburg syndrome II.

    Science.gov (United States)

    Wang, Xue-Ping; Hao, Zi-Qi; Liu, Ya-Lan; Mei, Ling-Yun; He, Chu-Feng; Niu, Zhi-Jie; Sun, Jie; Zhao, Yu-Lin; Feng, Yong

    2017-11-04

    Waardenburg syndrome (WS) is an autosomal dominant inherited non-syndromic type of hereditary hearing loss characterized by varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. WS is classified into four subtypes (WS1-WS4) based on additional symptoms. WS2 is characterized by the absence of additional symptoms. Recently, we identified a SOX10 missense mutation c.422T > C (p.L141P) associated with WS2. We performed functional assays and found the mutant loses DNA-binding capacity, shows aberrant cytoplasmic and nuclear localization, and fails to interact with PAX3. Therefore, the mutant cannot transactivate the MITF promoter effectively, inhibiting melanin synthesis and leading to WS2. Our study confirmed haploinsufficiency as the underlying pathogenesis for WS2. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Mutational Analysis of TAC3 and TACR3 Genes in Patients with Idiopathic Central Pubertal Disorders

    Science.gov (United States)

    Tusset, Cintia; Noel, Sekoni D.; Trarbach, Ericka B.; Silveira, Letícia F. G.; Jorge, Alexander A. L.; Brito, Vinicius N.; Cukier, Priscila; Seminara, Stephanie B.; de Mendonça, Berenice B.; Kaiser, Ursula B.; Latronico, Ana Claudia

    2013-01-01

    Aim To investigate the presence of variants in the TAC3 and TACR3 genes, which encode NKB and its receptor (NK3R), respectively, in a large cohort of patients with idiopathic central pubertal disorders. Patients and Methods Two hundred and thirty seven patients were studied: 114 with central precocious puberty (CPP), 73 with normosmic isolated hypogonadotropic hypogonadism (IHH) and 50 with constitutional delay of growth and puberty (CDGP). The control group consisted of 150 Brazilian individuals with normal pubertal development. Genomic DNA was extracted from peripheral blood and the entire coding region of both TAC3 and TACR3 genes were amplified and automatically sequenced. Results We identified one variant (p.A63P) in NKB and four variants, p.G18D, p.L58L (c.172C>T), p.W275* and p.A449S in NK3R, which were absent in the control group. The p.A63P variant was identified in a girl with CPP, and p.A449S in a girl with CDGP. The known p.G18D, p.L58L and p.W275* variants were identified in three unrelated males with normosmic IHH. Conclusion Rare variants in the TAC3 and TACR3 genes were identified in patients with central pubertal disorders. Loss-of-function variants of TACR3 were associated with the normosmic IHH phenotype. PMID:23329188

  1. Identification of eight novel mutations in a collaborative analysis of a part of the second transmembrane domain of the CFTR gene

    Energy Technology Data Exchange (ETDEWEB)

    Mercier, B.; Audrezet, M.P.; Guillermit, H.; Quere, I.; Verlingue, C.; Ferec, C. (CDTS, Brest (France)); Lissens, W.; Bonduelle, M.; Liebaers, I. (University Hospital VUB, Brussels (Belgium)); Novelli, G.; Sangiuolo, F.; Dallapiccola, B. (IRCCS, Rotondo (Italy)); Kalaydjieva, L. (Inst. of Obstetrics, Sofia (Bulgaria)); Arce, M. De; Cashman, S. (Trinity College, Dublin (Ireland)); Kapranov, N. (NRC of medical Genetics, Moscow (Russian Federation)); Canki Klain, N. (Tozd Univerzitetna Ginekoloska Klinika, Ljubljana (Yugoslavia)); Lenoir, G. (Hopital des Enfants Malades Necker, Paris (France)); Chauveau, P. (Centre Hospitalier General, Le Havre (France)); Lanaerts, C. (Centre Hospitalier Regional et Universitaire, Amiens (France)); Rault, G. (Centre Helio-Marin, Roscoff (France))

    1993-04-01

    Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene, particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.

  2. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  3. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  4. Analysis of SOX10 mutations identified in Waardenburg-Hirschsprung patients: Differential effects on target gene regulation.

    Science.gov (United States)

    Chan, Kwok Keung; Wong, Corinne Kung Yen; Lui, Vincent Chi Hang; Tam, Paul Kwong Hang; Sham, Mai Har

    2003-10-15

    SOX10 is a member of the SOX gene family related by homology to the high-mobility group (HMG) box region of the testis-determining gene SRY. Mutations of the transcription factor gene SOX10 lead to Waardenburg-Hirschsprung syndrome (Waardenburg-Shah syndrome, WS4) in humans. A number of SOX10 mutations have been identified in WS4 patients who suffer from different extents of intestinal aganglionosis, pigmentation, and hearing abnormalities. Some patients also exhibit signs of myelination deficiency in the central and peripheral nervous systems. Although the molecular bases for the wide range of symptoms displayed by the patients are still not clearly understood, a few target genes for SOX10 have been identified. We have analyzed the impact of six different SOX10 mutations on the activation of SOX10 target genes by yeast one-hybrid and mammalian cell transfection assays. To investigate the transactivation activities of the mutant proteins, three different SOX target binding sites were introduced into luciferase reporter gene constructs and examined in our series of transfection assays: consensus HMG domain protein binding sites; SOX10 binding sites identified in the RET promoter; and Sox10 binding sites identified in the P0 promoter. We found that the same mutation could have different transactivation activities when tested with different target binding sites and in different cell lines. The differential transactivation activities of the SOX10 mutants appeared to correlate with the intestinal and/or neurological symptoms presented in the patients. Among the six mutant SOX10 proteins tested, much reduced transactivation activities were observed when tested on the SOX10 binding sites from the RET promoter. Of the two similar mutations X467K and 1400del12, only the 1400del12 mutant protein exhibited an increase of transactivation through the P0 promoter. While the lack of normal SOX10 mediated activation of RET transcription may lead to intestinal aganglionosis

  5. Mutation update for the PORCN gene

    NARCIS (Netherlands)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,

  6. Molecular Genetic Analysis of the PLP1 Gene in 38 Families with PLP1-related disorders: Identification and Functional Characterization of 11 Novel PLP1 Mutations

    Directory of Open Access Journals (Sweden)

    Marchiani Valentina

    2011-06-01

    Full Text Available Abstract Background The breadth of the clinical spectrum underlying Pelizaeus-Merzbacher disease and spastic paraplegia type 2 is due to the extensive allelic heterogeneity in the X-linked PLP1 gene encoding myelin proteolipid protein (PLP. PLP1 mutations range from gene duplications of variable size found in 60-70% of patients to intragenic lesions present in 15-20% of patients. Methods Forty-eight male patients from 38 unrelated families with a PLP1-related disorder were studied. All DNA samples were screened for PLP1 gene duplications using real-time PCR. PLP1 gene sequencing analysis was performed on patients negative for the duplication. The mutational status of all 14 potential carrier mothers of the familial PLP1 gene mutation was determined as well as 15/24 potential carrier mothers of the PLP1 duplication. Results and Conclusions PLP1 gene duplications were identified in 24 of the unrelated patients whereas a variety of intragenic PLP1 mutations were found in the remaining 14 patients. Of the 14 different intragenic lesions, 11 were novel; these included one nonsense and 7 missense mutations, a 657-bp deletion, a microdeletion and a microduplication. The functional significance of the novel PLP1 missense mutations, all occurring at evolutionarily conserved residues, was analysed by the MutPred tool whereas their potential effect on splicing was ascertained using the Skippy algorithm and a neural network. Although MutPred predicted that all 7 novel missense mutations would be likely to be deleterious, in silico analysis indicated that four of them (p.Leu146Val, p.Leu159Pro, p.Thr230Ile, p.Ala247Asp might cause exon skipping by altering exonic splicing elements. These predictions were then investigated in vitro for both p.Leu146Val and p.Thr230Ile by means of RNA or minigene studies and were subsequently confirmed in the case of p.Leu146Val. Peripheral neuropathy was noted in four patients harbouring intragenic mutations that altered RNA

  7. molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

    International Nuclear Information System (INIS)

    Kamel, S.A.L.M.

    2004-01-01

    β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

  8. Analysis of the EGFR gene mutation in patients with non- small cell ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1637-1641 ... Keywords: Non-small cell lung cancer, Epidermal growth factor receptor (EGFR), Targeted therapy, ... inhibitors can be identified by molecular analysis of lung ...

  9. Mutational analysis of the HLA-DQ3.2 insulin-dependent diabetes mellitus susceptibility gene

    International Nuclear Information System (INIS)

    Kwok, W.W.; Lotshaw, C.; Milner, E.C.B.; Knitter-Jack, N.; Nepom, G.T.

    1989-01-01

    The human major histocompatibility complex includes approximately 14 class II HLA genes within the HLA-D region, most of which exist in multiple allelic forms. One of these genes, the DQ3.2β gene, accounts for the well-documented association of HLA-DR4 with insulin-dependent diabetes mellitus and is the single allele most highly correlated with this disease. The authors analyzed the amino acid substitutions that lead to the structural differences distinguishing DQ3.2β from its nondiabetogenic, but closely related allele, DQ3.1β. Site-directed mutagenesis of the DQ3.2β gene was used to convert key nucleotides into DQ3.2β codons. Subsequent expression studies of these mutated DQ3.2β clones using retroviral vectors defined amino acid 45 as critical for generating serologic epitopes characterizing the DQw3.1β and DQw3.2β molecules

  10. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    Directory of Open Access Journals (Sweden)

    Chang Jan-Gowth

    2011-10-01

    Full Text Available Abstract Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser and the hotspot mutation (p.Ala84Thr from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD simulations and normal mode analysis (NMA, we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

  11. Mutation update for the PORCN gene

    DEFF Research Database (Denmark)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

  12. Glucokinase gene mutations (MODY 2) in Asian Indians.

    Science.gov (United States)

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  13. Diverse growth hormone receptor gene mutations in Laron syndrome.

    Science.gov (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  14. Functional analysis of a nonstop mutation in MITF gene identified in a patient with Waardenburg syndrome type 2.

    Science.gov (United States)

    Sun, Jie; Hao, Ziqi; Luo, Hunjin; He, Chufeng; Mei, Lingyun; Liu, Yalan; Wang, Xueping; Niu, Zhijie; Chen, Hongsheng; Li, Jia-Da; Feng, Yong

    2017-07-01

    Waardenburg syndrome (WS) is an autosomal dominant inherited neurogenic disorder with the combination of various degrees of sensorineural deafness and pigmentary abnormalities affecting the skin, hair and eye. The four subtypes of WS were defined on the basis of the presence or absence of additional symptoms. Mutation of human microphthalmia-associated transcription factor (MITF) gene gives rise to WS2. Here, we identified a novel WS-associated mutation at the stop codon of MITF (p.X420Y) in a Chinese WS2 patient. This mutation resulted in an extension of extra 33 amino-acid residues in MITF. The mutant MITF appeared in both the nucleus and the cytoplasm, whereas the wild-type MITF was localized in the nucleus exclusively. The mutation led to a reduction in the transcriptional activities, whereas the DNA-binding activity was not altered. We show that the foremost mechanism was haploinsufficiency for the mild phenotypes of WS2 induced in X420Y MITF.

  15. Eight novel F13A1 gene missense mutations in patients with mild FXIII deficiency: in silico analysis suggests changes in FXIII-A subunit structure/function.

    Science.gov (United States)

    Biswas, Arijit; Ivaskevicius, Vytautas; Thomas, Anne; Varvenne, Michael; Brand, Brigitte; Rott, Hannelore; Haussels, Iris; Ruehl, Heiko; Scholz, Ute; Klamroth, Robert; Oldenburg, Johannes

    2014-10-01

    Mild FXIII deficiency is an under-diagnosed disorder because the carriers of this deficiency are often asymptomatic and reveal a phenotype only under special circumstances like surgery or induced trauma. Mutational reports from this type of deficiency have been rare. In this study, we present the phenotypic and genotypic data of nine patients showing mild FXIII-A deficiency caused by eight novel heterozygous missense mutations (Pro166Leu, Arg171Gln, His342Tyr, Gln415Arg, Leu529Pro, Gln601Lys, Arg703Gln and Arg715Gly) in the F13A1 gene. None of these variants were seen in 200 healthy controls. In silico structural analysis of the local wild-type protein structures (activated and non-activated) from X-ray crystallographic models downloaded from the protein databank identified potential structural/functional effects for the identified mutations. The missense mutations in the core domain are suggested to be directly influencing the catalytic triad. Mutations on other domains might influence other critical factors such as activation peptide cleavage or the barrel domain integrity. In vitro expression and subsequent biochemical studies in the future will be able to confirm the pathophysiological mechanisms proposed for the mutations in this article.

  16. Identification and functional analysis of a novel mutation in the PAX3 gene associated with Waardenburg syndrome type I.

    Science.gov (United States)

    Niu, Zhijie; Li, Jiada; Tang, Fen; Sun, Jie; Wang, Xueping; Jiang, Lu; Mei, Lingyun; Chen, Hongsheng; Liu, Yalan; Cai, Xinzhang; Feng, Yong; He, Chufeng

    2018-02-05

    Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant genetic disorder of neural crest cells (NCC) characterized by congenital sensorineural hearing loss, dystopia canthorum, and abnormal iris pigmentation. WS1 is due to loss-of-function mutations in paired box gene 3 (PAX3). Here, we identified a novel PAX3 mutation (c.808C>G, p.R270G) in a three-generation Chinese family with WS1, and then analyzed its in vitro activities. The R270G PAX3 retained nuclear distribution and normal DNA-binding ability; however, it failed to activate MITF promoter, suggesting that haploinsufficiency may be the underlying mechanism for the mild WS1 phenotype of the study family. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Detection of sdhB Gene Mutations in SDHI-Resistant Isolates of Botrytis cinerea Using High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Samaras, Anastasios; Madesis, Panagiotis; Karaoglanidis, George S

    2016-01-01

    Botrytis cinerea , is a high risk pathogen for fungicide resistance development. Pathogen' resistance to SDHIs is associated with several mutations in sdh gene. The diversity of mutations and their differential effect on cross-resistance patterns among SDHIs and the fitness of resistant strains necessitate the availability of a tool for their rapid identification. This study was initiated to develop and validate a high-resolution melting (HRM) analysis for the identification of P225H/F/L//T, N230I, and H272L/R/Y mutations. Based on the sequence of sdh B subunit of resistant and sensitive isolates, a universal primer pair was designed. The specificity of the HRM analysis primers was verified to ensure against the cross-reaction with other fungal species and its sensitivity was evaluated using concentrations of known amounts of mutant's DNA. The melting curve analysis generated nine distinct curve profiles, enabling the discrimination of all the four mutations located at codon 225, the N230I mutation, the three mutations located in codon 272, and the non-mutated isolates (isolates of wild-type sensitivity). Similar results were obtained when DNA was extracted directly from artificially inoculated strawberry fruit. The method was validated by monitoring the presence of sdh B mutations in samples of naturally infected strawberry fruits and stone fruit rootstock seedling plants showing damping-off symptoms. HRM analysis data were compared with a standard PIRA-PCR technique and an absolute agreement was observed suggesting that in both populations the H272R mutation was the predominant one, while H272Y, N230I, and P225H were detected in lower frequencies. The results of the study suggest that HRM analysis can be a useful tool for sensate, accurate, and rapid identification of several sdh B mutations in B. cinerea and it is expected to contribute in routine fungicide resistance monitoring or assessments of the effectiveness of anti-resistance strategies implemented in

  18. Detection of sdhB gene mutations in SDHI-resistant isolates of Botrytis cinerea using high resolution melting (HRM analysis

    Directory of Open Access Journals (Sweden)

    Anastasios Samaras

    2016-11-01

    Full Text Available Botrytis cinerea, is a high-risk pathogen for fungicide resistance development. Pathogen` resistance to SDHIs is associated with several mutations in sdh gene. The diversity of mutations and their differential effect on cross-resistance patterns among SDHIs and the fitness of resistant strains necessitate the availability of a tool for their rapid identification. This study was initiated to develop and validate a high-resolution melting (HRM analysis for the identification of P225H/F/L//T, N230I and H272L/R/Y mutations. Based on the sequence of sdhB subunit of resistant and sensitive isolates, a universal primer pair was designed. The specificity of the HRM analysis primers was verified to ensure against the cross-reaction with other fungal species and its sensitivity was evaluated using concentrations of known amounts of mutant`s DNA. The melting curve analysis generated nine distinct curve profiles, enabling the discrimination of all the 4 mutations located at codon 225, the N230I mutation, the 3 mutations located in codon 272 and the non mutated isolates (isolates of wild type sensitivity. Similar results were obtained when DNA was extracted directly from artificially inoculated strawberry fruit. The method was validated by monitoring the presence of sdhB mutations in samples of naturally infected strawberry fruits and stone fruit rootstock seedling plants showing damping off symptoms. HRM analysis data were compared with a standard PIRA-PCR technique and an absolute agreement was observed suggesting that in both populations the H272R mutation was the predominant one, while H272Y, N230I and P225H were detected in lower frequencies. The results of the study suggest that HRM analysis can be a useful tool for sensate, accurate and rapid identification of several sdhB mutations in B. cinerea and it is expected to contribute in routine fungicide resistance monitoring or assessments of the effectiveness of antiresistance strategies implemented in

  19. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri

    2017-08-01

    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  20. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    Science.gov (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  1. Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

    Science.gov (United States)

    Nakazawa, M; Wada, Y; Tamai, M

    1998-04-01

    To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

  2. Microarray-based mutation analysis of the ABCA4 (ABCR) gene in autosomal recessive cone-rod dystrophy and retinitis pigmentosa.

    Science.gov (United States)

    Klevering, B Jeroen; Yzer, Suzanne; Rohrschneider, Klaus; Zonneveld, Marijke; Allikmets, Rando; van den Born, L Ingeborgh; Maugeri, Alessandra; Hoyng, Carel B; Cremers, Frans P M

    2004-12-01

    Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or autosomal recessive CRD (54 cases) or RP (90 cases). We performed detailed ophthalmologic examinations and identified at least one ABCA4 mutation in 18 patients (33%) with CRD and in five patients (5.6%) with RP. Single-strand conformation polymorphism (SSCP) analysis and subsequent DNA sequencing revealed four novel missense mutations (R24C, E161K, P597S, G618E) and a novel 1-bp deletion (5888delG). Ophthalmoscopic abnormalities in CRD patients ranged from minor granular pigmentary changes in the posterior pole to widespread atrophy. In 12 patients with recordable electroretinogram (ERG) tracings, a cone-rod pattern was detected. Three patients demonstrated progression from a retinal dystrophy resembling STGD1 to a more widespread degeneration, and were subsequently diagnosed as CRD. In addition to a variable degree of atrophy, all RP patients displayed ophthalmologic characteristics of classic RP. When detectable, ERG recordings in these patients demonstrated rod-cone patterns of photoreceptor degeneration. In conclusion, in this study, we show that the ABCA4 mutation chip is an efficient first screening tool for arCRD.

  3. Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

    International Nuclear Information System (INIS)

    Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha

    2012-01-01

    KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

  4. Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

    Science.gov (United States)

    Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

    2017-02-01

    Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

  5. [Clinical features and ACADVL gene mutation spectrum analysis of 11 Chinese patients with very long chain acyl-CoA dehydrogenase deficiency].

    Science.gov (United States)

    Jinjun, Cao; Wenjuan, Qiu; Ruinan, Zhang; Jun, Ye; Lianshu, Han; Huiwen, Zhang; Qigang, Zhang; Xuefan, Gu

    2015-04-01

    To investigate the clinical and laboratory features of very long chain acyl-CoA dehydrogenase deficiency ( VLCADD ) and the correlations between its genotype and phenotype. Eleven patients diagnosed as VLCADD of Shanghai Jiaotong University School of Medicine seen from September 2006 to May 2014 were included. There were 9 boys and 2 girls, whose age was 2 d-17 years. Analysis was performed on clinical features, routine laboratory examination, and tandem mass spectrometry (MS-MS) , gas chromatography mass spectrometry (GC-MS) and genetic analysis were conducted. All cases had elevated levels of blood tetradecanoylcarnitine (C14:1) recognized as the characteristic biomarker for VLCADD. The eleven patients were classified into three groups: six cases in neonatal onset group, three in infancy onset group form patients and two in late onset group. Neonatal onset patients were characterized by hypoactivity, hypoglycemia shortly after birth. Infancy onset patients presented hepatomegaly and hypoglycemia in infancy. The two adolescent patients showed initial manifestations of exercise intolerance or rhabdomyolysis. Six of the eleven patients died at the age of 2-8 months, including four neonatal onset and two infant onset patients, with one or two null mutations. The other two neonatal onset patients were diagnosed since early birth through neonatal screening and their clinical manifestation are almost normal after treatments. Among 11 patients, seventeen different mutations in the ACADVL gene were identified, with a total mutation detection rate of 95.45% (21/22 alleles), including eleven reported mutations ( p. S22X, p. G43D, p. R511Q, p. W427X, p. A213T, p. C215R, p. G222R, p. R450H, p. R456H, c. 296-297delCA, c. 1605 + 1G > T) and six novel mutations (p. S72F, p. Q100X, p. M437T, p. D466Y, c. 1315delG insAC, IVS7 + 4 A > G). The p. R450H was the most frequent mutation identified in three alleles (13.63%, 3/22 alleles), followed by p. S22X and p. D466Y mutations which

  6. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  7. Analysis of mutations in 7 genes associated with neuronal excitability and synaptic transmission in a cohort of children with non-syndromic infantile epileptic encephalopathy.

    Directory of Open Access Journals (Sweden)

    Anna Ka-Yee Kwong

    Full Text Available Epileptic Encephalopathy (EE is a heterogeneous condition in which cognitive, sensory and/or motor functions deteriorate as a consequence of epileptic activity, which consists of frequent seizures and/or major interictal paroxysmal activity. There are various causes of EE and they may occur at any age in early childhood. Genetic mutations have been identified to contribute to an increasing number of children with early onset EE which had been previously considered as cryptogenic. We identified 26 patients with Infantile Epileptic Encephalopathy (IEE of unknown etiology despite extensive workup and without any specific epilepsy syndromic phenotypes. We performed genetic analysis on a panel of 7 genes (ARX, CDKL5, KCNQ2, PCDH19, SCN1A, SCN2A, STXBP1 and identified 10 point mutations [ARX (1, CDKL5 (3, KCNQ2 (2, PCDH19 (1, SCN1A (1, STXBP1 (2] as well as one microdeletion involving both SCN1A and SCN2A. The high rate (42% of mutations suggested that genetic testing of this IEE panel of genes is recommended for cryptogenic IEE with no etiology identified. These 7 genes are associated with channelopathies or synaptic transmission and we recommend early genetic testing if possible to guide the treatment strategy.

  8. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  9. Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease

    NARCIS (Netherlands)

    Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value

    1999-01-01

    The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in

  10. Mutational analysis of the myxovirescin biosynthetic gene cluster reveals novel insights into the functional elaboration of polyketide backbones.

    Science.gov (United States)

    Simunovic, Vesna; Müller, Rolf

    2007-07-23

    It has been proposed that two acyl carrier proteins (ACPs)-TaB and TaE--and two 3-hydroxy-3-methylglutaryl synthases (HMGSs)--TaC and TaF--could constitute two functional ACP-HMGS pairs (TaB/TaC and TaE/TaF) responsible for the incorporation of acetate and propionate units into the myxovirescin A scaffold, leading to the formation of beta-methyl and beta-ethyl groups, respectively. It has been suggested that three more proteins--TaX and TaY, which are members of the superfamily of enoyl-CoA hydratases (ECHs), and a variant ketosynthase (KS) TaK--are shared between two ACP-HMGS pairs, to give the complete set of enzymes required to perform the beta-alkylations. The beta-methyl branch is presumably further hydroxylated (by TaH) and methylated to produce the methoxymethyl group observed in myxovirescin A. To substantiate this hypothesis, a series of gene-deletion mutants were created, and the effects of these mutations on myxovirescin production were examined. As predicted, DeltataB and DeltataE ACP mutants revealed similar phenotypes to their associated HMGS mutants DeltataC and DeltataF, respectively, thus providing direct evidence for the role of TaE/TaF in the formation of the beta-ethyl branch and implying a role for TaB/TaC in the formation of the beta-methyl group. Production of myxovirescin A was dramatically reduced in a DeltataK mutant and abolished in both the DeltataX and the DeltataY mutant backgrounds. Analysis of a DeltataH mutant confirmed the role of the cytochrome P450 TaH in hydroxylation of the beta-methyl group. Taken together, these experiments support a model in which the discrete ACPs TaB and TaE are compatible only with their associated HMGSs TaC and TaF, respectively, and function in a substrate-specific manner. Both TaB and TaC are essential for myxovirescin production, and the TaB/TaC pair can rescue antibiotic production in the absence of either TaE or TaF. Finally, the reduced level of myxovirescin production in the DeltataE mutant

  11. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    Science.gov (United States)

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  12. Molecular genetic analysis of the calcium sensing receptor gene in patients clinically suspected to have familial hypocalciuric hypercalcemia: phenotypic variation and mutation spectrum in a Danish population

    DEFF Research Database (Denmark)

    Nissen, Peter H; Christensen, Signe E; Heickendorff, Lene

    2007-01-01

    CONTEXT: The autosomal dominantly inherited condition familial hypocalciuric hypercalcemia (FHH) is characterized by elevated plasma calcium levels, relative or absolute hypocalciuria, and normal to moderately elevated plasma PTH. The condition is difficult to distinguish clinically from primary...... hyperparathyroidism and is caused by inactivating mutations in the calcium sensing receptor (CASR) gene. OBJECTIVE: We sought to define the mutation spectrum of the CASR gene in a Danish FHH population and to establish genotype-phenotype relationships regarding the different mutations. DESIGN AND PARTICIPANTS...

  13. Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

    Directory of Open Access Journals (Sweden)

    F.V. Perícole

    2005-09-01

    Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

  14. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    Science.gov (United States)

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

  15. Correlation of the UV-induced mutational spectra and the DNA damage distribution of the human HPRT gene: Automating the analysis

    International Nuclear Information System (INIS)

    Kotturi, G.; Erfle, H.; Koop, B.F.; Boer, J.G. de; Glickman, B.W.

    1994-01-01

    Automated DNA sequencers can be readily adapted for various types of sequence-based nucleic acid analysis: more recently it was determined the distribution of UV photoproducts in the E. coli laci gene using techniques developed for automated fluorescence-based analysis. We have been working to improve the automated approach of damage distribution. Our current method is more rigorous. We have new software that integrates the area under the individual peaks, rather than measuring the height of the curve. In addition, we now employ an internal standard. The analysis can also be partially automated. Detection limits for both major types of UV-photoproducts (cyclobutane dimers and pyrimidine (6-4) pyrimidone photoproducts) are reported. The UV-induced damage distribution in the hprt gene is compared to the mutational spectra in human and rodents cells

  16. Mapping of the human cone transducin {alpha} subunit (GNAT2) gene to 1p13 and mutation analysis in patients with Stargardt`s disease

    Energy Technology Data Exchange (ETDEWEB)

    Magovcevic, I.; Weremowicz, S.; Morton, C.C. [Harvard Medical School, Boston, MA (United States)] [and others

    1994-09-01

    Transducin {alpha} subunits are members of a large family of G-proteins and play an important role in phototransduction in rod and cone photoreceptors. We report the localization of the human cone {alpha} transducin (GNAT2) gene using fluorescence in situ hybridization (FISH) on chromosome 1 in band p13. The recent assignment of a gene for Stargardt`s disease to the same chromosomal region by linkage analysis prompted us to investigate the possible role of GNAT2 in the pathogenesis of this disease. Stargardt`s disease is characterized by degeneration in late childhood or early adulthood of the macula of the retina, a region rich in cones. We screened patients with Stargardt`s disease, with or without peripheral cone involvement as monitored by the full-field ERG, for mutations in this gene. We investigated 66 unrelated patients including 22 with peripheral cone dysfunction for mutations in the coding region of the GNAT2 gene using polymerase chain reaction-single strand conformation polymorphism analysis (SSCP) and direct sequencing. One patient (034-16) was heterozygous for a silent change in exon VI, Asp238Asp (GAT to GAC). Two patients, one (035-005) with peripheral cone involvement and one (071-001) without peripheral cone involvement, were heterozygous for the missense change Val124Met (GTG to ATG) in exon IV. A subsequent screen of 96 unrelated, unaffected controls revealed one individual (N10) who was also heterozygous for the Val124Met alteration. We concluded that Asp238Asp and Val124Met are rare variants not causing Stargardt`s disease. Hence, no disease-specific mutations were found indicating that GNAT2 is probably not involved in the pathogenesis of most cases of Stargardt`s disease.

  17. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

    Science.gov (United States)

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

    2015-05-01

    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  18. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  19. Transcriptome analysis of an apple (Malus × domestica) yellow fruit somatic mutation identifies a gene network module highly associated with anthocyanin and epigenetic regulation.

    Science.gov (United States)

    El-Sharkawy, Islam; Liang, Dong; Xu, Kenong

    2015-12-01

    Using RNA-seq, this study analysed an apple (Malus×domestica) anthocyanin-deficient yellow-skin somatic mutant 'Blondee' (BLO) and its red-skin parent 'Kidd's D-8' (KID), the original name of 'Gala', to understand the molecular mechanisms underlying the mutation. A total of 3299 differentially expressed genes (DEGs) were identified between BLO and KID at four developmental stages and/or between two adjacent stages within BLO and/or KID. A weighted gene co-expression network analysis (WGCNA) of the DEGs uncovered a network module of 34 genes highly correlated (r=0.95, P=9.0×10(-13)) with anthocyanin contents. Although 12 of the 34 genes in the WGCNA module were characterized and known of roles in anthocyanin, the remainder 22 appear to be novel. Examining the expression of ten representative genes in the module in 14 diverse apples revealed that at least eight were significantly correlated with anthocyanin variation. MdMYB10 (MDP0000259614) and MdGST (MDP0000252292) were among the most suppressed module member genes in BLO despite being undistinguishable in their corresponding sequences between BLO and KID. Methylation assay of MdMYB10 and MdGST in fruit skin revealed that two regions (MR3 and MR7) in the MdMYB10 promoter exhibited remarkable differences between BLO and KID. In particular, methylation was high and progressively increased alongside fruit development in BLO while was correspondingly low and constant in KID. The methylation levels in both MR3 and MR7 were negatively correlated with anthocyanin content as well as the expression of MdMYB10 and MdGST. Clearly, the collective repression of the 34 genes explains the loss-of-colour in BLO while the methylation in MdMYB10 promoter is likely causal for the mutation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Mutated Genes in Schizophrenia Map to Brain Networks

    Science.gov (United States)

    ... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...

  1. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism

    NARCIS (Netherlands)

    Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Dörfler, Arnd; Kinning, Esther; Megarbane, André; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Dörr, Helmuth-Günther; Reis, André

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss-of-function mutations in the centrosomal pericentrin (PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial dwarfism

  2. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism

    NARCIS (Netherlands)

    Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Doerfler, Arnd; Kinning, Esther; Megarbane, Andre; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Doerr, Helmuth-Guenther; Reis, Andre

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss- of- function mutations in the centrosomal pericentrin ( PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial

  3. Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Shen Xi-Zhong

    2010-03-01

    Full Text Available Abstract Background Hereditary hemochromatosis (HH is an autosomal recessive disorder mainly associated with homozygosity for the C282Y and H63D mutations in the hemochromatosis (HFE gene. The reports about the C282Y and H63D mutations and hepatocellular carninoma (HCC were controversial. To clarify the relationship between C282Y and H63D mutations and HCC, a meta-analysis including nine studies (1102 HCC cases and 3766 controls, mainly came from European populations was performed. Methods The association was measured using random-effect (RE or fixed-effect (FE odds ratios (ORs combined with 95% confidence intervals (CIs according to the studies' heterogeneity. Results Meta-analysis of nine studies showed that Y allele of C282Y was associated with HCC risk: RE OR reached 1.50 (95%CI: 1.05-2.14, p for heterogeneity = 0.02, I2 = 0.57. Subgroup analysis of seven studies also showed Y allele was associated with HCC risk in healthy populations: RE OR reached 1.61 (95%CI: 1.08-2.39, p for heterogeneity = 0.04, I2 = 0.55. We further did subgroup analysis in alcoholic liver cirrhosis (LC patients of four studies (224 cases and 380 controls and found that both the dominant model and Y allele of C282Y were associated with HCC risk (FE OR reached 4.06, 95%CI: 2.08-7.92 and 3.41, 95%CI: 1.81-6.41, respectively. There was no distinct heterogeneity among the studies (I2 = 0. Sensitivity analyses showed the results were robust in the subgroup analysis of alcoholic LC patients. Conclusions C282Y mutation was associated with HCC in European alcoholic LC patients.

  4. Analysis of significantly mutated genes as a clinical tool for the diagnosis in a case of lung cancer.

    Science.gov (United States)

    Miyashita, Yoshihiro; Hirotsu, Yosuke; Tsutsui, Toshiharu; Higashi, Seishi; Sogami, Yusuke; Kakizaki, Yumiko; Goto, Taichiro; Amemiya, Kenji; Oyama, Toshio; Omata, Masao

    2017-01-01

    Bronchoendoscopic examination is not necessarily comfortable procedure and limited by its sensitivity, depending on the location and size of the tumor lesion. Patients with a non-diagnostic bronchoendoscopic examination often undergo further invasive examinations. Non-invasive diagnostic tool of lung cancer is desired. A 72-year-old man had a 3.0 cm × 2.5 cm mass lesion in the segment B1 of right lung. Cytological examination of sputum, bronchial washing and curetted samples were all "negative". We could confirm a diagnosis of lung cancer after right upper lung lobe resection pathologically, and also obtained concordant results by genomic analysis using cytological negative samples from airways collected before operation. Genetic analysis showed mutational profiles of both resected specimens and samples from airways were identical. These data clearly indicated the next generation sequencing (NGS) may yield a diagnostic tool to conduct "precision medicine".

  5. FLNC Gene Splice Mutations Cause Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Rene L. Begay, BS

    2016-08-01

    Full Text Available A genetic etiology has been identified in 30% to 40% of dilated cardiomyopathy (DCM patients, yet only 50% of these cases are associated with a known causative gene variant. Thus, in order to understand the pathophysiology of DCM, it is necessary to identify and characterize additional genes. In this study, whole exome sequencing in combination with segregation analysis was used to identify mutations in a novel gene, filamin C (FLNC, resulting in a cardiac-restricted DCM pathology. Here we provide functional data via zebrafish studies and protein analysis to support a model implicating FLNC haploinsufficiency as a mechanism of DCM.

  6. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  7. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  8. Microarray-based mutation analysis of the ABCA4 (ABCR) gene in autosomal recessive cone-rod dystrophy and retinitis pigmentosa.

    NARCIS (Netherlands)

    Klevering, B.J.; Ijzer, S.; Rohrschneider, K.; Zonneveld-Vrieling, M.N.; Allikmets, R.; Born, L.I. van den; Maugeri, A.; Hoyng, C.B.; Cremers, F.P.M.

    2004-01-01

    Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or

  9. Towards linked open gene mutations data

    Science.gov (United States)

    2012-01-01

    Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

  10. Towards linked open gene mutations data.

    Science.gov (United States)

    Zappa, Achille; Splendiani, Andrea; Romano, Paolo

    2012-03-28

    With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on

  11. Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    LYU Tingxia

    2016-08-01

    Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

  12. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    International Nuclear Information System (INIS)

    Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza

    2006-01-01

    We explored the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA Ser(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA Ser(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  13. Comparative Genome Analysis Between Aspergillus oryzae Strains Reveals Close Relationship Between Sites of Mutation Localization and Regions of Highly Divergent Genes among Aspergillus Species

    Science.gov (United States)

    Umemura, Myco; Koike, Hideaki; Yamane, Noriko; Koyama, Yoshinori; Satou, Yuki; Kikuzato, Ikuya; Teruya, Morimi; Tsukahara, Masatoshi; Imada, Yumi; Wachi, Youji; Miwa, Yukino; Yano, Shuichi; Tamano, Koichi; Kawarabayasi, Yutaka; Fujimori, Kazuhiro E.; Machida, Masayuki; Hirano, Takashi

    2012-01-01

    Aspergillus oryzae has been utilized for over 1000 years in Japan for the production of various traditional foods, and a large number of A. oryzae strains have been isolated and/or selected for the effective fermentation of food ingredients. Characteristics of genetic alterations among the strains used are of particular interest in studies of A. oryzae. Here, we have sequenced the whole genome of an industrial fungal isolate, A. oryzae RIB326, by using a next-generation sequencing system and compared the data with those of A. oryzae RIB40, a wild-type strain sequenced in 2005. The aim of this study was to evaluate the mutation pressure on the non-syntenic blocks (NSBs) of the genome, which were previously identified through comparative genomic analysis of A. oryzae, Aspergillus fumigatus, and Aspergillus nidulans. We found that genes within the NSBs of RIB326 accumulate mutations more frequently than those within the SBs, regardless of their distance from the telomeres or of their expression level. Our findings suggest that the high mutation frequency of NSBs might contribute to maintaining the diversity of the A. oryzae genome. PMID:22912434

  14. Comparative genome analysis between Aspergillus oryzae strains reveals close relationship between sites of mutation localization and regions of highly divergent genes among Aspergillus species.

    Science.gov (United States)

    Umemura, Myco; Koike, Hideaki; Yamane, Noriko; Koyama, Yoshinori; Satou, Yuki; Kikuzato, Ikuya; Teruya, Morimi; Tsukahara, Masatoshi; Imada, Yumi; Wachi, Youji; Miwa, Yukino; Yano, Shuichi; Tamano, Koichi; Kawarabayasi, Yutaka; Fujimori, Kazuhiro E; Machida, Masayuki; Hirano, Takashi

    2012-10-01

    Aspergillus oryzae has been utilized for over 1000 years in Japan for the production of various traditional foods, and a large number of A. oryzae strains have been isolated and/or selected for the effective fermentation of food ingredients. Characteristics of genetic alterations among the strains used are of particular interest in studies of A. oryzae. Here, we have sequenced the whole genome of an industrial fungal isolate, A. oryzae RIB326, by using a next-generation sequencing system and compared the data with those of A. oryzae RIB40, a wild-type strain sequenced in 2005. The aim of this study was to evaluate the mutation pressure on the non-syntenic blocks (NSBs) of the genome, which were previously identified through comparative genomic analysis of A. oryzae, Aspergillus fumigatus, and Aspergillus nidulans. We found that genes within the NSBs of RIB326 accumulate mutations more frequently than those within the SBs, regardless of their distance from the telomeres or of their expression level. Our findings suggest that the high mutation frequency of NSBs might contribute to maintaining the diversity of the A. oryzae genome.

  15. Collodion Baby with TGM1 gene mutation

    Directory of Open Access Journals (Sweden)

    Sharma D

    2015-09-01

    Full Text Available Deepak Sharma,1 Basudev Gupta,2 Sweta Shastri,3 Aakash Pandita,1 Smita Pawar4 1Department of Neonatology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, 2Department of Pediatrics, Civil Hospital, Palwal, Haryana, 3Department of Pathology, NKP Salve Medical College, Nagpur, Maharashtra, 4Department of Obstetrics and Gynaecology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, IndiaAbstract: Collodion baby (CB is normally diagnosed at the time of birth and refers to a newborn infant that is delivered with a lambskin-like membrane encompassing the total body surface. CB is not a specific disease entity, but is a common phenotype in conditions like harlequin ichthyosis, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, and trichothiodystrophy. We report a CB that was brought to our department and later diagnosed to have TGM1 gene c.984+1G>A mutation. However, it could not be ascertained whether the infant had lamellar ichthyosis or congenital ichthyosiform erythroderma (both having the same mutation. The infant was lost to follow-up.Keywords: cellophane membrane, c.984+1G>A mutation, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, parchment membrane, TGM1 gene

  16. HFE gene mutations in coronary atherothrombotic disease

    Directory of Open Access Journals (Sweden)

    Calado R.T.

    2000-01-01

    Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

  17. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  18. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

    Science.gov (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

    2016-05-01

    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  19. Analysis of HLA-A antigens and C282Y and H63D mutations of the HFE gene in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Bittencourt P.L.

    2002-01-01

    Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.

  20. A novel missense mutation of ADAR1 gene in a Chinese family ...

    Indian Academy of Sciences (India)

    This study was mainlyto explore the pathogenic mutation of ADAR1 gene and provide genetics counselling and prenatal diagnostic testing for childbearing individuals.Mutational analysis of ADAR1 gene was performed by polymerase chain reaction (PCR) and electrophoretic separation of PCR products by 1.5% agarose ...

  1. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

    Science.gov (United States)

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

    2011-01-01

    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  2. Mutational analysis of the Wolfram syndrome gene in two families with chromosome 4p-linked bipolar affective disorder.

    Science.gov (United States)

    Evans, K L; Lawson, D; Meitinger, T; Blackwood, D H; Porteous, D J

    2000-04-03

    Bipolar affective disorder (BPAD) is a complex disease with a significant genetic component. Heterozygous carriers of Wolfram syndrome (WFS) are at increased risk of psychiatric illness. A gene for WFS (WFS1) has recently been cloned and mapped to chromosome 4p, in the general region we previously reported as showing linkage to BPAD. Here we present sequence analysis of the WFS1 coding sequence in five affected individuals from two chromosome 4p-linked families. This resulted in the identification of six polymorphisms, two of which are predicted to change the amino acid sequence of the WFS1 protein, however none of the changes segregated with disease status. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:158-160, 2000. Copyright 2000 Wiley-Liss, Inc.

  3. Mutation profile of all 49 exons of the human myosin VIIA gene, and haplotype analysis, in Usher 1B families from diverse origins.

    Science.gov (United States)

    Adato, A; Weil, D; Kalinski, H; Pel-Or, Y; Ayadi, H; Petit, C; Korostishevsky, M; Bonne-Tamir, B

    1997-10-01

    Usher syndrome types I (USH1A-USH1E) are a group of autosomal recessive diseases characterized by profound congenital hearing loss, vestibular areflexia, and progressive visual loss due to retinitis pigmentosa. The human myosin VIIA gene, located on 11q14, has been shown to be responsible for Usher syndrome type 1B (USH1B). Haplotypes were constructed in 28 USH1 families by use of the following polymorphic markers spanning the USH1B locus: D11S787, D11S527, D11S1789, D11S906, D11S4186, and OMP. Affected individuals and members of their families from 12 different ethnic origins were screened for the presence of mutations in all 49 exons of the myosin VIIA gene. In 15 families myosin VIIA mutations were detected, verifying their classification as USH1B. All these mutations are novel, including three missense mutations, one premature stop codon, two splicing mutations, one frameshift, and one deletion of >2 kb comprising exons 47 and 48, a part of exon 49, and the introns between them. Three mutations were shared by more than one family, consistent with haplotype similarities. Altogether, 16 USH1B haplotypes were observed in the 15 families; most haplotypes were population specific. Several exonic and intronic polymorphisms were also detected. None of the 20 known USH1B mutations reported so far in other world populations were identified in our families.

  4. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  5. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    Science.gov (United States)

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  6. New Mutation Identified in the SRY Gene High Mobility Group (HMG

    Directory of Open Access Journals (Sweden)

    Feride İffet Şahin

    2013-06-01

    Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

  7. Congenital Hypopituitarism due to POU1F1 Gene Mutation

    Directory of Open Access Journals (Sweden)

    Ni-Chung Lee

    2011-01-01

    Full Text Available POU1F1 (Pit-1; Gene ID 5449 is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome, elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S mutation. The rarity of the disease can result in delayed diagnosis and treatment.

  8. Congenital hypopituitarism due to POU1F1 gene mutation.

    Science.gov (United States)

    Lee, Ni-Chung; Tsai, Wen-Yu; Peng, Shinn-Forng; Tung, Yi-Ching; Chien, Yin-Hsiu; Hwu, Wuh-Liang

    2011-01-01

    POU1F1 (Pit-1; Gene ID 5449) is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome), elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S) mutation. The rarity of the disease can result in delayed diagnosis and treatment. Copyright © 2011 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All rights reserved.

  9. An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

    International Nuclear Information System (INIS)

    Jin Tao; Zou Liuhe; Yang Ling

    2004-01-01

    Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

  10. Somatic Mutational Landscape of Splicing Factor Genes and Their Functional Consequences across 33 Cancer Types

    Directory of Open Access Journals (Sweden)

    Michael Seiler

    2018-04-01

    Full Text Available Summary: Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA, and we identified 119 splicing factor genes with significant non-silent mutation patterns, including mutation over-representation, recurrent loss of function (tumor suppressor-like, or hotspot mutation profile (oncogene-like. Furthermore, RNA sequencing analysis revealed altered splicing events associated with selected splicing factor mutations. In addition, we were able to identify common gene pathway profiles associated with the presence of these mutations. Our analysis suggests that somatic alteration of genes involved in the RNA-splicing process is common in cancer and may represent an underappreciated hallmark of tumorigenesis. : Seiler et al. report that 119 splicing factor genes carry putative driver mutations over 33 tumor types in TCGA. The most common mutations appear to be mutually exclusive and are associated with lineage-independent altered splicing. Samples with these mutations show deregulation of cell-autonomous pathways and immune infiltration. Keywords: splicing, SF3B1, U2AF1, SRSF2, RBM10, FUBP1, cancer, mutation

  11. [Study of gene mutation in 62 hemophilia A children].

    Science.gov (United States)

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  12. Spectrum of mismatch repair gene mutations and clinical presentation of Hispanic individuals with Lynch syndrome.

    Science.gov (United States)

    Sunga, Annette Y; Ricker, Charité; Espenschied, Carin R; Castillo, Danielle; Melas, Marilena; Herzog, Josef; Bannon, Sarah; Cruz-Correa, Marcia; Lynch, Patrick; Solomon, Ilana; Gruber, Stephen B; Weitzel, Jeffrey N

    2017-04-01

    Lynch syndrome (LS), the most common hereditary colorectal cancer syndrome, is caused by mismatch repair (MMR) gene mutations. However, data about MMR mutations in Hispanics are limited. This study aims to describe the spectrum of MMR mutations in Hispanics with LS and explore ancestral origins. This case series involved an IRB-approved retrospective chart review of self-identified Hispanic patients (n = 397) seen for genetic cancer risk assessment at four collaborating academic institutions in California, Texas, and Puerto Rico who were evaluated by MMR genotyping and/or tumor analysis. A literature review was conducted for all mutations identified. Of those who underwent clinical genetic testing (n = 176), 71 had MMR gene mutations. Nine mutations were observed more than once. One third (3/9) of recurrent mutations and two additional mutations (seen only once) were previously reported in Spain, confirming the influence of Spanish ancestry on MMR mutations in Hispanic populations. The recurrent mutations identified (n = 9) included both previously reported mutations as well as unique mutations not in the literature. This is the largest report of Hispanic MMR mutations in North America; however, a larger sample and haplotype analyses are needed to better understand recurrent MMR mutations in Hispanic populations. Copyright © 2017. Published by Elsevier Inc.

  13. Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies

    Directory of Open Access Journals (Sweden)

    M. Li

    2014-03-01

    Full Text Available Iron homeostasis dysregulation has been regarded as an important mechanism in neurodegenerative diseases. The H63D and C282Y polymorphisms in the HFE gene may be involved in the development of sporadic amyotrophic lateral sclerosis (ALS through the disruption of iron homeostasis. However, studies investigating the relationship between ALS and these two polymorphisms have yielded contradictory outcomes. We performed a meta-analysis to assess the roles of the H63D and C282Y polymorphisms of HFE in ALS susceptibility. PubMed, MEDLINE, EMBASE, and Cochrane Library databases were systematically searched to identify relevant studies. Strict selection criteria and exclusion criteria were applied. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of associations. A fixed- or random-effect model was selected, depending on the results of the heterogeneity test. Fourteen studies were included in the meta-analysis (six studies with 1692 cases and 8359 controls for C282Y; 14 studies with 5849 cases and 13,710 controls for H63D. For the C282Y polymorphism, significant associations were observed in the allele model (Y vs C: OR=0.76, 95%CI=0.62-0.92, P=0.005 and the dominant model (YY+CY vs CC: OR=0.75, 95%CI=0.61-0.92, P=0.006. No associations were found for any genetic model for the H63D polymorphism. The C282Y polymorphism in HFE could be a potential protective factor for ALS in Caucasians. However, the H63D polymorphism does not appear to be associated with ALS.

  14. The role of objective facial analysis using FDNA in making diagnoses following whole exome analysis. Report of two patients with mutations in the BAF complex genes.

    Science.gov (United States)

    Gripp, Karen W; Baker, Laura; Telegrafi, Aida; Monaghan, Kristin G

    2016-07-01

    The genetic basis of numerous intellectual disability (ID) syndromes has recently been identified by applying exome analysis on a research or clinical basis. There is significant clinical overlap of biologically related syndromes, as exemplified by Nicolaides-Baraitser (NCBRS) and Coffin-Siris (CSS) syndrome. Both result from mutations affecting the BAF (mSWI/SNF) complex and belong to the growing category of BAFopathies. In addition to the notable clinical overlap between these BAFopathies, heterogeneity exists for patients clinically diagnosed with one of these conditions. We report two teenagers with ID whose molecular diagnosis of a SMARC2A or ARID1B mutation, respectively, was established through clinical exome analysis. Interestingly, using only the information provided in a single clinically obtained facial photograph from each patient, the facial dysmorphology analysis detected similarities to facial patterns associated with NCBRS as the first suggestion for both individuals, followed by CSS as the second highest ranked in the individual with the ARID1B mutation. Had this information been available to the laboratory performing the exome analysis, it could have been utilized during the variant analysis and reporting process, in conjunction with the written summary provided with each test requisition. While the available massive parallel sequencing technology, variant calling and variant interpretation are constantly evolving, clinical information remains critical for this diagnostic process. When trio analysis is not feasible, additional diagnostic tools may become particularly valuable. Facial dysmorphology analysis data may supplement the clinical phenotype summary and provide data independent of the clinician's personal experience and bias. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

  16. Hemochromatosis C282Y gene mutation as a potential susceptibility ...

    African Journals Online (AJOL)

    G.M. Mokhtar

    2017-08-12

    Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

  17. Identification and functional analysis of a naturally occurring E89K mutation in the ABCA1 gene of the WHAM chicken

    NARCIS (Netherlands)

    Attie, Alan D.; Hamon, Yannick; Brooks-Wilson, Angela R.; Gray-Keller, Mark P.; MacDonald, Marcia L. E.; Rigot, Veronique; Tebon, Angie; Zhang, Lin-Hua; Mulligan, Jacob D.; Singaraja, Roshni R.; Bitgood, J. James; Cook, Mark E.; Kastelein, John J. P.; Chimini, Giovanna; Hayden, Michael R.

    2002-01-01

    The Wisconsin hypoalpha mutant (WHAM) chicken has a >90% reduction in plasma HDL due to hypercatabolism. by the kidney of lipid-poor apoA-I. The WHAM chickens have a recessive white skin phenotype caused by a single-gene mutation that maps to the chicken Z-chromosome. This corresponds to human

  18. Molecular analysis of the androgen-receptor gene in a family with receptor-positive partial androgen insensitivity: an unusual type of intronic mutation

    NARCIS (Netherlands)

    H.T. Brüggenwirth (Hennie); A.L.M. Boehmer (Annemie); S. Ramnarain; M.C. Verleun-Mooijman; D.P.E. Satijn (David); J. Trapman (Jan); J.A. Grootegoed (Anton); A.O. Brinkmann (Albert)

    1997-01-01

    textabstractIn the coding part and the intron-exon boundaries of the androgen-receptor gene of a patient with partial androgen insensitivity, no mutation was found. The androgen receptor of this patient displayed normal ligand-binding parameters and migrated as a

  19. Mutation analysis of genes that control the G1/S cell cycle in melanoma: TP53, CDKN1A, CDKN2A, and CDKN2B

    International Nuclear Information System (INIS)

    Soto, José Luis; Cabrera, Carmen M; Serrano, Salvio; López-Nevot, Miguel Ángel

    2005-01-01

    The role of genes involved in the control of progression from the G1 to the S phase of the cell cycle in melanoma tumors in not fully known. The aim of our study was to analyse mutations in TP53, CDKN1A, CDKN2A, and CDKN2B genes in melanoma tumors and melanoma cell lines We analysed 39 primary and metastatic melanomas and 9 melanoma cell lines by single-stranded conformational polymorphism (SSCP). The single-stranded technique showed heterozygous defects in the TP53 gene in 8 of 39 (20.5%) melanoma tumors: three new single point mutations in intronic sequences (introns 1 and 2) and exon 10, and three new single nucleotide polymorphisms located in introns 1 and 2 (C to T transition at position 11701 in intron 1; C insertion at position 11818 in intron 2; and C insertion at position 11875 in intron 2). One melanoma tumor exhibited two heterozygous alterations in the CDKN2A exon 1 one of which was novel (stop codon, and missense mutation). No defects were found in the remaining genes. These results suggest that these genes are involved in melanoma tumorigenesis, although they may be not the major targets. Other suppressor genes that may be informative of the mechanism of tumorigenesis in skin melanomas should be studied

  20. Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).

    Science.gov (United States)

    Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker

    2006-12-01

    To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.

  1. Molecular screening of pituitary adenomas for gene mutations and rearrangements

    Energy Technology Data Exchange (ETDEWEB)

    Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

    1993-07-01

    Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

  2. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  3. Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

    African Journals Online (AJOL)

    Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...

  4. DNA mutation motifs in the genes associated with inherited diseases.

    Directory of Open Access Journals (Sweden)

    Michal Růžička

    Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  5. Splice Site Mutations in the ATP7A Gene

    DEFF Research Database (Denmark)

    Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk

    2011-01-01

    Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...... to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations...

  6. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  7. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  8. Consecutive analysis of mutation spectrum in the dystrophin gene of 507 Korean boys with Duchenne/Becker muscular dystrophy in a single center.

    Science.gov (United States)

    Cho, Anna; Seong, Moon-Woo; Lim, Byung Chan; Lee, Hwa Jeen; Byeon, Jung Hye; Kim, Seung Soo; Kim, Soo Yeon; Choi, Sun Ah; Wong, Ai-Lynn; Lee, Jeongho; Kim, Jon Soo; Ryu, Hye Won; Lee, Jin Sook; Kim, Hunmin; Hwang, Hee; Choi, Ji Eun; Kim, Ki Joong; Hwang, Young Seung; Hong, Ki Ho; Park, Seungman; Cho, Sung Im; Lee, Seung Jun; Park, Hyunwoong; Seo, Soo Hyun; Park, Sung Sup; Chae, Jong Hee

    2017-05-01

    Duchenne and Becker muscular dystrophies (DMD and BMD) are allelic X-linked recessive muscle diseases caused by mutations in the large and complex dystrophin gene. We analyzed the dystrophin gene in 507 Korean DMD/BMD patients by multiple ligation-dependent probe amplification and direct sequencing. Overall, 117 different deletions, 48 duplications, and 90 pathogenic sequence variations, including 30 novel variations, were identified. Deletions and duplications accounted for 65.4% and 13.3% of Korean dystrophinopathy, respectively, suggesting that the incidence of large rearrangements in dystrophin is similar among different ethnic groups. We also detected sequence variations in >100 probands. The small variations were dispersed across the whole gene, and 12.3% were nonsense mutations. Precise genetic characterization in patients with DMD/BMD is timely and important for implementing nationwide registration systems and future molecular therapeutic trials in Korea and globally. Muscle Nerve 55: 727-734, 2017. © 2016 Wiley Periodicals, Inc.

  9. COL1A2 gene analysis in a Czech osteogenesis imperfecta patient: a candidate novel mutation in a patient affected by osteogenesis imperfecta type 3

    Directory of Open Access Journals (Sweden)

    Hrušková L

    2015-08-01

    Full Text Available Lucie Hrušková,1 Ivo Mařík,2,3 Stella Mazurová,1 Pavel Martásek,1 Ivan Mazura1 1Department of Pediatrics and Adolescent Medicine, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic; 2Ambulant Centre for Defects of Locomotor Apparatus 1.1.c., Prague, Czech Republic; 3Faculty of Medical Studies, West Bohemia University, Pilsen, Czech RepublicAbstract: Osteogenesis imperfecta is a heritable bone fragility disease with a heterogenic genetic origin. Most cases result from mutations of either the COL1A1 gene or the COL1A2 gene. We identified a novel COL1A2 gene mutation in a Czech patient, born to unaffected parents, who was diagnosed according to clinical and anthropometric findings and radiographic features as having type 3 osteogenesis imperfecta, which is a severe form of this disease. The identified Gly814Trp mutation was predicted by a number of complementary bioinformatic programs to result in functional alteration of the protein. This case report provides both evidence of a novel COL1A2 mutation resulting in type 3 osteogenesis imperfecta and a genotype:phenotype correlation in this affected individual. Keywords: osteogenesis imperfecta type 3, collagen, alpha-2 (I chain, substitution, sequencing 

  10. Mutation analysis of suppressor of cytokine signalling 3, a candidate gene in Type 1 diabetes and insulin sensitivity

    DEFF Research Database (Denmark)

    Gylvin, T; Nolsøe, R; Hansen, T

    2004-01-01

    Beta cell loss in Type 1 and Type 2 diabetes mellitus may result from apoptosis and necrosis induced by inflammatory mediators. The suppressor of cytokine signalling (SOCS)-3 is a natural inhibitor of cytokine signalling and also influences insulin signalling. SOCS3 could therefore be a candidate...... gene in the development of Type 1 and Type 2 diabetes mellitus....

  11. Clinical study of DMD gene point mutation causing Becker muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Ji-qing CAO

    2015-07-01

    Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

  12. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  13. Determination of HER2 and p53 Mutations by Sequence Analysis Method and EGFR/Chromosome 7 Gene Status by Fluorescence in Situ Hybridization for the Predilection of Targeted Therapy Modalities in Immunohistochemically Triple Negative Breast Carcinomas in Turkish Population.

    Science.gov (United States)

    Pala, Emel Ebru; Bayol, Umit; Keskin, Elif Usturali; Ozguzer, Alp; Kucuk, Ulku; Ozer, Ozge; Koc, Altug

    2015-09-01

    Triple negative breast cancer (TNBC), an agressive subtype accounts nearly 15 % of all breast carcinomas. Conventional chemotherapy is the only treatment modality thus new, effective targeted therapy methods have been investigated. Epidermal growth factor receptor (EGFR) inhibitors give hope according to the recent studies results. Also therapeutic agents have been tried against aberrant p53 signal activity as TNBC show high p53 mutation rates. Our aim was to detect the incidence of mutations/amplifications identified in TNBC in our population. Here we used sequence analysis to detect HER2 (exon 18-23), p53 (exon 5-8) mutations; fluorescence in situ hybridization (FISH) method to analyse EGFR/chromosome 7 centromere gene status in 82 immunohistochemically TNBC. Basaloid phenotype was identified in 49 (59.8 %) patients. EGFR amplification was noted in 5 cases (6.1 %). All EGFR amplified cases showed EGFR overexpression by immunohistochemistry (IHC). p53 mutations were identified in 33 (40.2 %) cases. Almost 60 % of the basal like breast cancer cases showed p53 mutation. Only one case showed HER2 mutation (exon 20:g.36830_3). Our results showed that gene amplification is not the unique mechanism in EGFR overexpression. IHC might be used in the decision of anti-EGFR therapy in routine practice. p53 mutation rate was lower than the rates reported in the literature probably due to ethnic differences and low sensitivity of sanger sequences in general mutation screening. We also established the rarity of HER2 mutation in TNBC. In conclusion EGFR and p53 are the major targets in TNBC also for our population.

  14. HFE gene mutations and iron status of Brazilian blood donors.

    Science.gov (United States)

    Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M

    2010-01-01

    Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  15. HFE gene mutations and iron status of Brazilian blood donors

    Directory of Open Access Journals (Sweden)

    P.C.J.L. Santos

    2010-01-01

    Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  16. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  17. Analysis of 6174delT Mutation in BRCA2 Gene by Mutagenically Separated PCR Among Libyan Patients with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Lamia Elfandi

    2016-03-01

    Full Text Available Background: Breast cancer is the most common malignancy among women. It is estimated that 1 in 10 women worldwide is affected by breast cancer during their lifetime. In 5 to 10% of breast cancer patients, the disease results from a hereditary predisposition, which can be attributable to mutations in either of two tumor suppressor genes, BRCA1 and BRCA2 to a large extent. BRCA2 6174delT mutation constitutes the common mutant alleles which predispose to hereditary breast cancer in the Ashkenazi population with a reported carrier frequency of 1.52%. In this study, we investigated the presence of the 6174delT mutation of the BRCA2 gene in Libyan woman affected with breast cancer and compared the results with those of other population groups.Methods: Eighty- five Libyan women with breast cancer in additions to 5 relatives of the patients (healthy individuals were recruited to this study. We obtained clinical information, family history, and peripheral blood for DNA extraction and analyzed the data using multiplex mutagenic polymerase chain reaction (MS-PCR for detection of 6174delT mutation in the BRCA2 gene. Results: The 6174delT of the BRCA2 gene was not detected either in the 85 patients with breast cancer (18 with familial breast cancer and 67 with sporadic breast cancer nor in the 5 healthy individuals. Conclusions: The present study showed that the 6174delT of the BRCA2 gene was not detectable using mutagenic PCR in the Libyan patients with breast cancer and can be considered to be exceedingly rare

  18. Mutational analysis of two structural genes of the remperate lactococcal bacteriophage TP901-1 involved in tail length determination and baseplate assembly

    DEFF Research Database (Denmark)

    Pedersen, Margit; Østergaard, Solvej; Bresciani, José

    2000-01-01

    Two putative structural genes, orf tmp (tape measure protein) and orf bpp (baseplate protein), of the temperate lactococcal phage TP901-1 were examined by introduction of specific mutations in the prophage strain Lactococcus lactic ssp. cremoris 901-1. The adsorption efficiencies of the mutated...... or duplication of 29% in orf tmp was shown to shorten or lengthen the phage tail by approximately 30%, respectively. The orf tmp is proposed to function as a tape measure protein, TMP, important for assembly of the TP901-1 phage tail and involved in tail length determination. Specific mutations in orf bpp...... produced phages which were unable to adsorb to the indicator strain and electron microscopy revealed particles lacking the baseplate structure. The orf bpp is proposed to encode a highly immunogenic structural baseplate protein, BPP, important for assembly of the baseplate. Finally, an assembly pathway...

  19. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  20. A patient with Werner syndrome and adiponectin gene mutation.

    Science.gov (United States)

    Hashimoto, Naotake; Hatanaka, Sachiko; Yokote, Koutaro; Kurosawa, Hiroko; Yoshida, Tomohiko; Iwai, Rie; Takahashi, Hidenori; Yoshida, Katsuya; Horie, Atsuya; Sakurai, Kenichi; Yagui, Kazuo; Saito, Yasushi; Yoshida, Shouji

    2007-01-01

    Werner syndrome is a premature aging disease characterized by genomic instability and increased cancer risk. Here, we report a 45-year-old diabetic man as the first Werner syndrome patient found to have an adiponectin gene mutation. Showing graying and loss of hair, skin atrophy, and juvenile cataract, he was diagnosed with Werner syndrome type 4 by molecular analysis. His serum adiponectin concentration was low. In the globular domain of the adiponectin gene, I164T in exon 3 was detected. When we examined effects of pioglitazone (15 mg/day) on serum adiponectin multimer and monomer concentrations using selective assays, the patient's relative percentage increased in adiponectin concentration was almost same as that in the 18 diabetic patients without an adiponectin mutation, but the absolute adiponectin concentration was half of those seen in diabetic patients treated with the same pioglitazone dose who had no adiponectin mutation. The response suggested that pioglitazone treatment might help to prevent future Werner syndrome-related acceleration of atherosclerosis. Present and further clinical relevant to atherosclerosis in this patient should be imformative concerning the pathogenesis and treatment of atherosclerosis in the presence of hypoadiponectinemia and insulin resistance.

  1. Mutational analysis of the multicopy hao gene coding for hydroxylamine oxidoreductase in Nitrosomonas sp. strain ENI-11.

    Science.gov (United States)

    Yamagata, A; Hirota, R; Kato, J; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

    2000-08-01

    The ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11 contains three copies of the hao gene (hao1, hao2, and hao3) coding for hydroxylamine oxidoreductase (HAO). Three single mutants (hao1::kan, hao2::kan, or hao3::kan) had 68 to 75% of the wild-type growth rate and 58 to 89% of the wild-type HAO activity when grown under the same conditions. A double mutant (hao1::kan and hao3::amp) also had 68% of the wild-type growth and 37% of the wild-type HAO activity.

  2. X-Linked Hypohidrotic Ectodermal Dysplasia: New Features and a Novel EDA Gene Mutation.

    Science.gov (United States)

    Savasta, Salvatore; Carlone, Giorgia; Castagnoli, Riccardo; Chiappe, Francesca; Bassanese, Francesco; Piras, Roberta; Salpietro, Vincenzo; Brazzelli, Valeria; Verrotti, Alberto; Marseglia, Gian L

    2017-01-01

    We described a 5-year-old male with hypodontia, hypohidrosis, and facial dysmorphisms characterized by a depressed nasal bridge, maxillary hypoplasia, and protuberant lips. Chromosomal analysis revealed a normal 46,XY male karyotype. Due to the presence of clinical features of hypohidrotic ectodermal dysplasia (HED), the EDA gene, located at Xq12q13.1, of the patient and his family was sequenced. Analysis of the proband's sequence revealed a missense mutation (T to A transversion) in hemizygosity state at nucleotide position 158 in exon 1 of the EDA gene, which changes codon 53 from leucine to histidine, while heterozygosity at this position was detected in the slightly affected mother; moreover, this mutation was not found in the publically available Human Gene Mutation Database. To date, our findings indicate that a novel mutation in EDA is associated with X-linked HED, adding it to the repertoire of EDA mutations. © 2017 S. Karger AG, Basel.

  3. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  4. A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

    Directory of Open Access Journals (Sweden)

    NING Huibin

    2017-01-01

    Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

  5. Functional features of gene expression profiles differentiating gastrointestinal stromal tumours according to KIT mutations and expression

    International Nuclear Information System (INIS)

    Ostrowski, Jerzy; Dobosz, Anna Jerzak Vel; Jarosz, Dorota; Ruka, Wlodzimierz; Wyrwicz, Lucjan S; Polkowski, Marcin; Paziewska, Agnieszka; Skrzypczak, Magdalena; Goryca, Krzysztof; Rubel, Tymon; Kokoszyñska, Katarzyna; Rutkowski, Piotr; Nowecki, Zbigniew I

    2009-01-01

    Gastrointestinal stromal tumours (GISTs) represent a heterogeneous group of tumours of mesenchymal origin characterized by gain-of-function mutations in KIT or PDGFRA of the type III receptor tyrosine kinase family. Although mutations in either receptor are thought to drive an early oncogenic event through similar pathways, two previous studies reported the mutation-specific gene expression profiles. However, their further conclusions were rather discordant. To clarify the molecular characteristics of differentially expressed genes according to GIST receptor mutations, we combined microarray-based analysis with detailed functional annotations. Total RNA was isolated from 29 frozen gastric GISTs and processed for hybridization on GENECHIP ® HG-U133 Plus 2.0 microarrays (Affymetrix). KIT and PDGFRA were analyzed by sequencing, while related mRNA levels were analyzed by quantitative RT-PCR. Fifteen and eleven tumours possessed mutations in KIT and PDGFRA, respectively; no mutation was found in three tumours. Gene expression analysis identified no discriminative profiles associated with clinical or pathological parameters, even though expression of hundreds of genes differentiated tumour receptor mutation and expression status. Functional features of genes differentially expressed between the two groups of GISTs suggested alterations in angiogenesis and G-protein-related and calcium signalling. Our study has identified novel molecular elements likely to be involved in receptor-dependent GIST development and allowed confirmation of previously published results. These elements may be potential therapeutic targets and novel markers of KIT mutation status

  6. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    OpenAIRE

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...

  7. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  8. Mutations of the Norrie gene in Korean ROP infants.

    Science.gov (United States)

    Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

    2002-12-01

    The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

  9. Cytogenetic Profile and Gene Mutations of Childhood Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Nawaf Alkhayat

    2017-07-01

    Full Text Available Background: Childhood acute lymphoblastic leukemia (ALL is characterized by recurrent genetic aberrations. The identification of those abnormalities is clinically important because they are considered significant risk-stratifying markers. Aims: There are insufficient data of cytogenetic profiles in Saudi Arabian patients with childhood ALL leukemia. We have examined a cohort of 110 cases of ALL to determine the cytogenetic profiles and prevalence of FLT3 mutations and analysis of the more frequently observed abnormalities and its correlations to other biologic factors and patient outcomes and to compare our results with previously published results. Materials and methods: Patients —We reviewed all cases from 2007 to 2016 with an established diagnosis of childhood ALL. Of the 110 patients, 98 were B-lineage ALL and 12 T-cell ALL. All the patients were treated by UKALL 2003 protocol and risk stratified according previously published criteria. Cytogenetic analysis —Chromosome banding analysis and fluorescence in situ hybridization were used to detect genetic aberrations. Analysis of FLT3 mutations —Bone marrow or blood samples were screened for FLT3 mutations (internal tandem duplications, and point mutations, D835 using polymerase chain reaction methods. Result: Cytogenetic analysis showed chromosomal anomalies in 68 out of 102 cases with an overall incidence 66.7%. The most frequent chromosomal anomalies in ALL were hyperdiploidy, t(9;22, t(12;21, and MLL gene rearrangements. Our data are in accordance with those published previously and showed that FLT3 mutations are not common in patients with ALL (4.7% and have no prognostic relevance in pediatric patients with ALL. On the contrary, t(9;22, MLL gene rearrangements and hypodiploidy were signs of a bad prognosis in childhood ALL with high rate of relapse and shorter overall survival compared with the standard-risk group ( P  = .031.The event-free survival was also found to be worse ( P

  10. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    Science.gov (United States)

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  11. Recurrent and founder mutations in the PMS2 gene.

    Science.gov (United States)

    Tomsic, J; Senter, L; Liyanarachchi, S; Clendenning, M; Vaughn, C P; Jenkins, M A; Hopper, J L; Young, J; Samowitz, W; de la Chapelle, A

    2013-03-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However, some mutations are observed repeatedly across individuals not known to be related due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here, we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations and one (c.903G>T) a probable founder. One (c.1A>G) could not be evaluated for founder mutation status. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. © 2012 John Wiley & Sons A/S.

  12. Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

    Directory of Open Access Journals (Sweden)

    Soudabeh Heidari

    2013-09-01

    Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

  13. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  14. Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Fernanda Veronese Oliveira

    2014-01-01

    Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

  15. Diaphanous gene mutation affects spiral cleavage and chirality in snails

    Science.gov (United States)

    Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

    2016-01-01

    L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

  16. HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

    Science.gov (United States)

    Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

    2017-07-01

    HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

  17. Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...

    African Journals Online (AJOL)

    It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...

  18. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    OpenAIRE

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.; Papadopoulos, Nickolas; Malek, Sami N.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell...

  19. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  20. High incidence of GJB2 gene mutations among assortatively mating ...

    Indian Academy of Sciences (India)

    High incidence of GJB2 gene mutations among assortatively mating hearing impaired families in Kerala: future implications. Amritkumar Pavithra, Justin Margret Jeffrey, Jayasankaran Chandru, Arabandi Ramesh and C. R. Srikumari Srisailapathy. J. Genet. 93, 207–213. Table 1. Consolidated table of GJB2 mutation status ...

  1. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  2. Phenotypic Involvement in Females with the FMR1 Gene Mutation.

    Science.gov (United States)

    Riddle, J. E.; Cheema, A.; Sobesky, W. E.; Gardner, S. C.; Taylor, A. K.; Pennington, B. F.; Hagerman, R. J.

    1998-01-01

    A study investigated phenotypic effects seen in 114 females with premutation and 41 females (ages 18-58) with full Fragile X mental retardation gene mutation. Those with the full mutation had a greater incidence of hand-flapping, eye contact problems, special education help for reading and math, and grade retention. (Author/CR)

  3. Ataxia Telangiectasia–Mutated Gene Polymorphisms and Acute Normal Tissue Injuries in Cancer Patients After Radiation Therapy: A Systematic Review and Meta-analysis

    International Nuclear Information System (INIS)

    Dong, Lihua; Cui, Jingkun; Tang, Fengjiao; Cong, Xiaofeng; Han, Fujun

    2015-01-01

    Purpose: Studies of the association between ataxia telangiectasia–mutated (ATM) gene polymorphisms and acute radiation injuries are often small in sample size, and the results are inconsistent. We conducted the first meta-analysis to provide a systematic review of published findings. Methods and Materials: Publications were identified by searching PubMed up to April 25, 2014. Primary meta-analysis was performed for all acute radiation injuries, and subgroup meta-analyses were based on clinical endpoint. The influence of sample size and radiation injury incidence on genetic effects was estimated in sensitivity analyses. Power calculations were also conducted. Results: The meta-analysis was conducted on the ATM polymorphism rs1801516, including 5 studies with 1588 participants. For all studies, the cut-off for differentiating cases from controls was grade 2 acute radiation injuries. The primary meta-analysis showed a significant association with overall acute radiation injuries (allelic model: odds ratio = 1.33, 95% confidence interval: 1.04-1.71). Subgroup analyses detected an association between the rs1801516 polymorphism and a significant increase in urinary and lower gastrointestinal injuries and an increase in skin injury that was not statistically significant. There was no between-study heterogeneity in any meta-analyses. In the sensitivity analyses, small studies did not show larger effects than large studies. In addition, studies with high incidence of acute radiation injuries showed larger effects than studies with low incidence. Power calculations revealed that the statistical power of the primary meta-analysis was borderline, whereas there was adequate power for the subgroup analysis of studies with high incidence of acute radiation injuries. Conclusions: Our meta-analysis showed a consistency of the results from the overall and subgroup analyses. We also showed that the genetic effect of the rs1801516 polymorphism on acute radiation injuries was

  4. Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Diaz-Llopis Manuel

    2011-10-01

    Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

  5. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    with androgen insensitivity syndrome in sex-reversed XY female patients. BALACHANDRAN .... Three novel AR gene mutations associated with AIS in XY sex-reversed females. Ta b le. 1 . ( contd. ) ..... disease, 1st edition. Springer Science + ...

  6. KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

    Science.gov (United States)

    Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

    2010-06-01

    KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

  7. Identification of A Novel Missense Mutation in The Norrie Disease Gene: The First Molecular Genetic Analysis and Prenatal Diagnosis of Norrie Disease in An Iranian Family.

    Science.gov (United States)

    Talebi, Farah; Ghanbari Mardasi, Farideh; Mohammadi Asl, Javad; Lashgari, Ali; Farhadi, Freidoon

    2018-07-01

    Norrie disease (ND) is a rare X-linked recessive disorder, which is characterized by congenital blindness and, in several cases, accompanied with mental retardation and deafness. ND is caused by mutations in NDP, located on the proximal short arm of the X chromosome (Xp11.3). The disease has been observed in many ethnic groups worldwide, however, no such case has been reported from Iran. In this study, we present the molecular analysis of two patients with ND and the subsequent prenatal diagnosis. Screening of NDP identified a hemizygous missense mutation (p.Ser133Cys) in the affected male siblings of the family. The mother was the carrier for the mutation (p.Ser133Cys). In a subsequent chorionic amniotic pregnancy, we carried out prenatal diagnosis by sequencing NDP in the chorionic villi sample at 11 weeks of gestation. The fetus was carrying the mutation and thus unaffected. This is the first mutation report and prenatal diagnosis of an Iranian family with ND, and highlights the importance of prenatal diagnostic screening of this congenital disorder and relevant genetic counseling. Copyright© by Royan Institute. All rights reserved.

  8. Activating HER2 mutations in HER2 gene amplification negative breast cancer.

    Science.gov (United States)

    Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J

    2013-02-01

    Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.

  9. [Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

    Science.gov (United States)

    Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

    2008-06-01

    To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

  10. Meta-analysis diagnostic accuracy of SNP-based pathogenicity detection tools: a case of UTG1A1 gene mutations.

    Science.gov (United States)

    Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher

    2013-01-01

    Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.

  11. Analysis of S gene mutation of the hepatitis B virus in adult liver transplant recipients showing resistance to hepatitis B immunoglobulin therapy.

    Science.gov (United States)

    Park, G-C; Hwang, S; Ahn, C-S; Kim, K-H; Moon, D-B; Ha, T-Y; Song, G-W; Jung, D-H; Shin, Y W; Kim, S-H; Chang, K-H; Namgoong, J-M; Park, C-S; Park, H-W; Park, Y-H; Kang, S-H; Jung, B-H; Lee, S-G

    2013-10-01

    A considerable proportion of recipients of liver transplantations who are presented hepatitis B immunoglobulin (HBIG) monotherapy for hepatitis B virus (HBV) prophylaxis develop HBIG resistance. In this study, we investigated the mutation patterns in the major hydrophilic region (MHR) of amino acid sequences 100 to 160. Using the gene sequence analyzer for amino acid sequences 0 to 226 in the S/pre-S region we analyzed blood samples of 15 patients showing HBIG resistance after high-dose HBIG prophylaxis. Various mutations in the MHR were observed in 14/15 samples: Gly145Arg mutation in 8/13 Adr subtype and 1/2 Ayw subtype samples (60%). The next most common mutation was Gly165Trp in 8/13 Adr subtype but neither of 2 Ayw subtype samples (53.3%). Concurrent antiviral resistance was noted in 5 patients: lamivudine (n = 5), or entecavir (n = 3), but not adefovir, suggesting the occurrence of simultaneous, antiviral cross-resistances. Two patients underwent retransplantation due to the progression of HBV infection despite vigorous antiviral therapy. At diagnosis of HBV recurrence, the mean HBV DNA load was 6.5 × 10(6) copies/mL; 4 patients showed paradoxical coexistence of anti-HBs and HBsAg. Currently, 2 subjects show low-level HBV DNA replication in peripheral blood, although the other 12 had no DNA replication after prolonged antiviral therapy. This study suggested that various mutations in the "a" determinant were associated with HBIG resistance. Since treatment failure to rescue antiviral therapy was often associated with delayed detection of HBV recurrence rather than concurrent antiviral resistance, frequent HBV surveillance using more sensitive screening tests, such as HBeAg and HBV DNA polymerase chain reaction assay, seems to be mandatory. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

    2017-01-01

    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  14. rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

    Science.gov (United States)

    Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

    2018-03-01

    The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  15. Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

    Science.gov (United States)

    Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

    2012-01-01

    Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

  16. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    Science.gov (United States)

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  17. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  18. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  19. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  20. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

    Science.gov (United States)

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

    2012-12-01

    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  1. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers

    Directory of Open Access Journals (Sweden)

    Hai Hu

    2017-10-01

    Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  2. Mutation of the S and 3c genes in genomes of feline coronaviruses.

    Science.gov (United States)

    Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

    2018-05-17

    Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

  3. Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site

    Science.gov (United States)

    D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo

    2011-01-01

    The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308

  4. A novel mutation of the fibrillin gene causing Ectopia lentis

    Energy Technology Data Exchange (ETDEWEB)

    Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))

    1994-02-01

    Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.

  5. Thyroglobulin Gene Mutation with Cold Nodule on Thyroid Scintigraphy

    Directory of Open Access Journals (Sweden)

    Toshio Kahara

    2012-01-01

    Full Text Available Thyroglobulin gene mutation is a rare cause of congenital hypothyroidism, but thyroglobulin gene mutations are thought to be associated with thyroid cancer development. A 21-year-old Japanese man treated with levothyroxine for congenital hypothyroidism had an enlarged thyroid gland with undetectable serum thyroglobulin despite elevated serum TSH level. The patient was diagnosed with thyroglobulin gene mutation, with compound heterozygosity for Gly304Cys missense mutation and Arg432X nonsense mutation. Ultrasonography showed a hypovascular large tumor in the left lobe that appeared as a cold nodule on thyroid scintigraphy. He underwent total thyroidectomy, but pathological study did not reveal findings of thyroid carcinoma, but rather a hyperplastic nodule with hemorrhage. Strong cytoplasmic thyroglobulin immunostaining was observed, but sodium iodide symporter immunostaining was hardly detected in the hyperplastic nodule. The clinical characteristics of patients with thyroglobulin gene mutations are diverse, and some patients are diagnosed by chance on examination of goiter in adults. The presence of thyroid tumors that appear as cold nodules on thyroid scintigraphy should consider the potential for thyroid carcinoma, if the patient has relatively low serum thyroglobulin concentration in relation to the degree of TSH without thyroglobulin autoantibody.

  6. A PRACTICAL APPROACH TO THE DETECTION OF ANDROGEN RECEPTOR GENE-MUTATIONS AND PEDIGREE ANALYSIS IN FAMILIES WITH X-LINKED ANDROGEN INSENSITIVITY

    NARCIS (Netherlands)

    RISSTALPERS, C; HOOGENBOEZEM, T; SLEDDENS, HFBM; VERLEUNMOOIJMAN, MCT; DEGENHART, HJ; DROP, SLS; HALLEY, DJJ; Oosterwijk, Jan; HODGINS, MB; TRAPMAN, J; BRINKMANN, AO

    Androgen insensitivity syndrome (AIS) is an X-linked disorder in which defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46,XY individuals. This survey reports the analysis of 11 AIS subjects. The androgen receptor gene of

  7. A practical approach to the detection of androgen receptor gene mutations and pedigree analysis in families with x-linked androgen insensitivity

    NARCIS (Netherlands)

    Ris-Stalpers, C.; Hoogenboezem, T.; Sleddens, H. F.; Verleun-Mooijman, M. C.; Degenhart, H. J.; Drop, S. L.; Halley, D. J.; Oosterwijk, J. C.; Hodgins, M. B.; Trapman, J.

    1994-01-01

    Androgen insensitivity syndrome (AIS) is an X-linked disorder in which defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46,XY individuals. This survey reports the analysis of 11 AIS subjects. The androgen receptor gene of

  8. Discordant diagnoses obtained by different approaches in antithrombin mutation analysis

    DEFF Research Database (Denmark)

    Feddersen, Søren; Nybo, Mads

    2014-01-01

    OBJECTIVES: In hereditary antithrombin (AT) deficiency it is important to determine the underlying mutation since the future risk of thromboembolism varies considerably between mutations. DNA investigations are in general thought of as flawless and irrevocable, but the diagnostic approach can...... be critical. We therefore investigated mutation results in the AT gene, SERPINC1, with two different approaches. DESIGN AND METHODS: Sixteen patients referred to the Centre for Thrombosis and Haemostasis, Odense University Hospital, with biochemical indications of AT deficiency, but with a negative denaturing...... high-performance liquid chromatography (DHPLC) mutation screening (routine approach until recently) were included. As an alternative mutation analysis, direct sequencing of all exons and exon-intron boundaries without pre-selection by DHPLC was performed. RESULTS: Out of sixteen patients...

  9. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  10. De novo mutations in synaptic transmission genes including DNM1 cause epileptic encephalopathies

    DEFF Research Database (Denmark)

    2014-01-01

    in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p...... = 8.2 × 10(-4)), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have...... analyzed exome-sequencing data of 356 trios with the "classical" epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1...

  11. A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

    Energy Technology Data Exchange (ETDEWEB)

    Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

    1995-01-02

    Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

  12. Gene mutation-based and specific therapies in precision medicine.

    Science.gov (United States)

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  13. Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.

    Science.gov (United States)

    Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi

    2016-12-01

    Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

  14. Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

    Science.gov (United States)

    Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

    2011-07-01

    Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

  15. A novel mutation in the Norrie disease gene.

    Science.gov (United States)

    Ott, S; Patel, R J; Appukuttan, B; Wang, X; Stout, J T

    2000-04-01

    Norrie disease is an X-linked recessive disorder characterized by congenital blindness and in some cases mental retardation and deafness.(1) The variability of signs among patients often complicates diagnosis. Signs such as an ocular pseudoglioma, progressive deafness, and mental disturbance are considered classic features.(2) Only one third of patients with Norrie disease have sensorineural deafness, and approximately one half of the affected individuals exhibit mental retardation, often with psychotic features.(3) Histologic analysis has suggested that retinal dysgenesis occurs early in eye development and involves cells in the inner wall of the optic cup.(4) The gene associated with Norrie disease was identified in 1992. (5,6) We report a novel mutation identified in a patient in whom Norrie disease was diagnosed.

  16. Mutation of the planar cell polarity gene VANGL1 in adolescent idiopathic scoliosis

    DEFF Research Database (Denmark)

    Andersen, Malene Rask; Farooq, Muhammad; Koefoed, Karen

    2017-01-01

    STUDY DESIGN: Mutation analysis of a candidate disease gene in a cohort of patients with moderate to severe Adolescent idiopathic scoliosis (AIS). OBJECTIVE: To investigate if damaging mutations in the planar cell polarity gene VANGL1 could be identified in AIS patients. SUMMARY OF BACKGROUND DATA......: AIS is a spinal deformity which occurs in 1-3% of the population. The cause of AIS is often unknown, but genetic factors are important in the etiology. Rare variants in genes encoding regulators of WNT/planar cell polarity (PCP) signaling were recently identified in AIS patients. METHODS: We analyzed...

  17. A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Chujun Wu

    2016-12-01

    Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.

  18. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  19. Mutational profile of KIT and PDGFRA genes in gastrointestinal stromal tumors in Peruvian samples

    Directory of Open Access Journals (Sweden)

    José Buleje

    2015-02-01

    Full Text Available Introduction: Gastrointestinal stromal tumors (GISTs are mesenchymal neoplasms usually caused by somatic mutations in the genes KIT (c-KIT or PDGFRA. Mutation characterization has become an important exam for GIST patients because it is useful in predicting the response to the inhibitors of receptor tyrosine kinase (RTK. Objectives: The aim of this study was to determine the frequency of KIT and PDGFRA mutations in 25 GIST samples collected over two years at two national reference hospitals in Peru. There were 21 samples collected from the Instituto Nacional de Enfermedades Neoplásicas (INEN, national cancer center and 4 samples collected from Hospital A. Loayza. Methods and materials: In this retrospective study, we performed polymerase chain reaction (PCR amplification and deoxyribonucleic acid (DNA sequencing of KIT (exons 9, 11, 13, and 17 and PDGFRA (exons 12 and 18 genes in 20 FFPE (formalin-fixed, paraffin-embedded and 5 frozen GIST samples. Results: We report 21 mutations, including deletions, duplications, and missense, no mutations in 2 samples, and 2 samples with no useful DNA for further analysis. Eighty-six percent of these mutations were located in exon 11 of KIT, and 14 % were located in exon 18 of PDGFRA. Conclusions: Our study identified mutations in 21 out of 25 GIST samples from 2 referential national hospitals in Peru, and the mutation proportion follows a global tendency observed from previous studies (i.e., the majority of samples presented KIT mutations followed by a minor percentage of PDGFRA mutations. This study presents the first mutation data of the KIT and PDGFRA genes from Peruvian individuals with GIST.

  20. Glutaric acidemia type II: gene structure and mutations of the electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) gene.

    Science.gov (United States)

    Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E

    2002-01-01

    Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.

  1. TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    T. W. Hoffman

    2016-01-01

    Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

  2. Detailed analysis of targeted gene mutations caused by the Platinum-Fungal TALENs in Aspergillus oryzae RIB40 strain and a ligD disruptant.

    Science.gov (United States)

    Mizutani, Osamu; Arazoe, Takayuki; Toshida, Kenji; Hayashi, Risa; Ohsato, Shuichi; Sakuma, Tetsushi; Yamamoto, Takashi; Kuwata, Shigeru; Yamada, Osamu

    2017-03-01

    Transcription activator-like effector nucleases (TALENs), which can generate DNA double-strand breaks at specific sites in the desired genome locus, have been used in many organisms as a tool for genome editing. In Aspergilli, including Aspergillus oryzae, however, the use of TALENs has not been validated. In this study, we performed genome editing of A. oryzae wild-type strain via error of nonhomologous end-joining (NHEJ) repair by transient expression of high-efficiency Platinum-Fungal TALENs (PtFg TALENs). Targeted mutations were observed as various mutation patterns. In particular, approximately half of the PtFg TALEN-mediated deletion mutants had deletions larger than 1 kb in the TALEN-targeting region. We also conducted PtFg TALEN-based genome editing in A. oryzae ligD disruptant (ΔligD) lacking the ligD gene involved in the final step of the NHEJ repair and found that mutations were still obtained as well as wild-type. In this case, the ratio of the large deletions reduced compared to PtFg TALEN-based genome editing in the wild-type. In conclusion, we demonstrate that PtFg TALENs are sufficiently functional to cause genome editing via error of NHEJ in A. oryzae. In addition, we reveal that genome editing using TALENs in A. oryzae tends to cause large deletions at the target region, which were partly suppressed by deletion of ligD. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. Analysis of APC mutation in human ameloblastoma and clinical significance.

    Science.gov (United States)

    Li, Ning; Liu, Bing; Sui, Chengguang; Jiang, Youhong

    2016-01-01

    As a highly conserved signaling pathway, Wnt/β-catenin signal transduction pathway plays an important role in many processes. Either in the occurrence or development of tumor, activation of this pathway takes an important place. APC inhibits Wnt/β-catenin pathway to regulate cell proliferation and differentiation. This study aimed to investigate the function of cancer suppressor gene. PCR amplification and sequencing method was used to analyze APC mutations of human clinical specimens. The pathological specimens were collected for PCR and clear electrophoretic bands were obtained after electrophoresis. The gene sequence obtained after purification and sequencing analysis was compared with the known APC gene sequence (NM_000038.5). Base mutations at APC 1543 (T → C), APC-4564 (G → A), APC-5353 (T → G), APC-5550 (T → A) and APC-5969 (G → A) locus existed in 22 (27.5 %), 12 (15 %), 5 (6.25 %), 13 (16.25 %) and 12 patients (15 %), respectively. Gene mutations existed in ameloblastoma, and the mutation loci were 1543 locus (T → C), 4564 locus (G → A), 5353 locus (T → G), 5550 locus (T → A) and 5969 locus (G → A) 15 %, respectively. APC mutation plays a certain role in monitoring the tumor malignant degree as it may indicate the transition process of ameloblastoma malignant phenotype.

  4. RADIA: RNA and DNA integrated analysis for somatic mutation detection.

    Directory of Open Access Journals (Sweden)

    Amie J Radenbaugh

    Full Text Available The detection of somatic single nucleotide variants is a crucial component to the characterization of the cancer genome. Mutation calling algorithms thus far have focused on comparing the normal and tumor genomes from the same individual. In recent years, it has become routine for projects like The Cancer Genome Atlas (TCGA to also sequence the tumor RNA. Here we present RADIA (RNA and DNA Integrated Analysis, a novel computational method combining the patient-matched normal and tumor DNA with the tumor RNA to detect somatic mutations. The inclusion of the RNA increases the power to detect somatic mutations, especially at low DNA allelic frequencies. By integrating an individual's DNA and RNA, we are able to detect mutations that would otherwise be missed by traditional algorithms that examine only the DNA. We demonstrate high sensitivity (84% and very high precision (98% and 99% for RADIA in patient data from endometrial carcinoma and lung adenocarcinoma from TCGA. Mutations with both high DNA and RNA read support have the highest validation rate of over 99%. We also introduce a simulation package that spikes in artificial mutations to patient data, rather than simulating sequencing data from a reference genome. We evaluate sensitivity on the simulation data and demonstrate our ability to rescue back mutations at low DNA allelic frequencies by including the RNA. Finally, we highlight mutations in important cancer genes that were rescued due to the incorporation of the RNA.

  5. Law-medicine interfacing: patenting of human genes and mutations.

    Science.gov (United States)

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  6. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  7. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Junyu Zhang

    Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  8. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    Directory of Open Access Journals (Sweden)

    Jose Miguel Moreno-Ortiz

    2016-01-01

    Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  9. R102W mutation in the RS1 gene responsible for retinoschisis and recurrent glaucoma

    Directory of Open Access Journals (Sweden)

    Xiu-Feng Huang

    2014-02-01

    Full Text Available AIM: To identify the mutations in RS1 gene associated with typical phenotype of X-linked juvenile retinoschisis (XLRS and a rare condition of concomitant glaucoma.METHODS: Complete ophthalmic examinations were performed in the proband. The coding regions of the RS1 gene that encode retinoschisin were amplified by polymerase chain reaction and directly sequenced.RESULTS: The proband showed a typical phenotype of XLRS with large peripheral retinal schisis in both eyes, involving the macula and combined with foveal cystic change, reducing visual acuity. A typical phenotype of recurrent glaucoma with high intraocular pressure (IOP and reduced visual field was also demonstrated with the patient. Mutation analysis of RS1 gene revealed R102W (c.304C>T mutations in the affected male, and his mother was proved to be a carrier with the causative mutation and another synonymous polymorphism (c.576C>CT.CONCLUSION: We identified the genetic variations of a Chinese family with typical phenotype of XLRS and glaucoma. The severe XLRS phenotypes associated with R102W mutations reveal that the mutation determines a notable alteration in the function of the retinoschisin protein. Identification of the disease-causing mutation is beneficial for future clinical references.

  10. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

  11. Glaucoma and Cytochrome P4501B1 Gene Mutations

    Directory of Open Access Journals (Sweden)

    Mukesh Tanwar

    2010-01-01

    Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

  12. Major gene mutations in fruit tree domestication

    International Nuclear Information System (INIS)

    Spiegel-Roy, P.

    1989-01-01

    Though fruit gathering from the wild began long before domestication, fruit tree domestication started only after the establishment of grain agriculture. Banana, fig, date, grape and olive were among the first fruit trees domesticated. Most fruit trees are outbreeders, highly heterozygous and vegetatively propagated. Knowledge of genetics and economic traits controlled by major genes is limited. Ease of vegetative propagation has played a prominent part in domestication; advances in propagation technology will play a role in domestication of new crops. Changes toward domestication affected by major genes include self-fertility in peach, apricot and sour cherry, while the emergence of self-fertile almond populations is more recent and due probably to introgression from Amygdalus webbii. Self-compatibility in the sweet cherry has been attained only by pollen irradiation. A single gene controls sex in Vitis. Wild grapes are dioecious, with most domesticated cultivars hermaphrodite, and only a few females. In the papaya changes from dioecism to hermaphroditism have also occurred. Self-compatible systems have also been selected during domestication in Rubus. Changes towards parthenocarpy and seedlessness during domestication occurred in the banana, citrus, grape, fig and pineapple. In the banana, parthenocarpy is due to three complementary dominant genes; stenospermocarpy in the grape depends on two complementary recessive genes; parthenocarpy and sterility in citrus seems more complicated; however, it can be induced in genetic material of suitable background with ease by irradiation. Presence of persistent syconia in the fig is controlled by a mutant allele P dominant to wild +. Thornlessness in blackberry is recessive, while in the pineapple spineless forms are dominant. Changes affecting fruit composition owing to major genes include the disappearance of amygdalin present in bitter almonds (bitter kernel recessive to sweet), shell hardness in almond, and a recessive

  13. Common filaggrin gene mutations and risk of cervical cancer

    DEFF Research Database (Denmark)

    Bager, Peter; Wohlfahrt, Jan; Sørensen, Erik

    2015-01-01

    BACKGROUND: As carriers of filaggrin gene (FLG) mutations may have a compromised cervical mucosal barrier against human papillomavirus infection, our primary objective was to study their risk of cervical cancer. METHODS: We genotyped 586 cervical cancer patients for the two most common FLG...... mutations, R501X and 2282del4, using blood from the Copenhagen Hospital Biobank, Denmark. Controls (n = 8050) were genotyped in previous population-based studies. Information on cervical cancer, mortality and emigration were obtained from national registers. Odds ratios (OR) were estimated by logistic...... and stratification by cancer stage. RESULTS: The primary results showed that FLG mutations were not associated with the risk of cervical cancer (6.3% of cases and 7.7% of controls were carriers; OR adjusted 0.81, 95% CI 0.57-1.14; OR adjusted+ weighted 0.96, 95% CI 0.58-1.57). Among cases, FLG mutations increased...

  14. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Directory of Open Access Journals (Sweden)

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  15. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Science.gov (United States)

    Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

    2012-01-01

    Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  16. Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I

    Science.gov (United States)

    Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.

    2008-01-01

    Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

  17. Novel mutations in the SOX10 gene in the first two Chinese cases of type IV Waardenburg syndrome.

    Science.gov (United States)

    Jiang, Lu; Chen, Hongsheng; Jiang, Wen; Hu, Zhengmao; Mei, Lingyun; Xue, Jingjie; He, Chufeng; Liu, Yalan; Xia, Kun; Feng, Yong

    2011-05-20

    We analyzed the clinical features and family-related gene mutations for the first two Chinese cases of type IV Waardenburg syndrome (WS4). Two families were analyzed in this study. The analysis included a medical history, clinical analysis, a hearing test and a physical examination. In addition, the EDNRB, EDN3 and SOX10 genes were sequenced in order to identify the pathogenic mutation responsible for the WS4 observed in these patients. The two WS4 cases presented with high phenotypic variability. Two novel heterozygous mutations (c.254G>A and c.698-2A>T) in the SOX10 gene were detected. The mutations identified in the patients were not found in unaffected family members or in 200 unrelated control subjects. This is the first report of WS4 in Chinese patients. In addition, two novel mutations in SOX10 gene have been identified. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  18. MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

    Directory of Open Access Journals (Sweden)

    D. S. Mikhaylenko

    2016-01-01

    Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

  19. Identification of Constrained Cancer Driver Genes Based on Mutation Timing

    Science.gov (United States)

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148

  20. Mutations in the glucocerebrosidase gene are common in patients with Parkinson's disease from Eastern Canada.

    Science.gov (United States)

    Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E

    2016-01-01

    Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.

  1. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations

    NARCIS (Netherlands)

    Sijmons, Rolf H.; Hofstra, Robert M. W.

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive

  2. Olaparib Approved for Breast Cancers with BRCA Gene Mutations

    Science.gov (United States)

    The Food and Drug Administration has approved olaparib (Lynparza®) to treat metastatic breast cancers that have inherited mutations in the BRCA1 or BRCA2 genes as well as a companion diagnostic test for selecting candidates for the therapy.

  3. Mutations in the AXIN1 gene in advanced prostate cancer

    DEFF Research Database (Denmark)

    Yardy, George W; Bicknell, David C; Wilding, Jennifer L

    2009-01-01

    The Wnt signalling pathway directs aspects of embryogenesis and is thought to contribute to maintenance of certain stem cell populations. Disruption of the pathway has been observed in many different tumour types. In bowel, stomach, and endometrial cancer, this is usually due to mutation of genes...

  4. Two novel mutations in ILDR1 gene cause autosomal recessive ...

    Indian Academy of Sciences (India)

    In a recent screening programme on hearing loss (HL), we examined 17 common autosomal recessive nonsyndromic hearing loss (ARNSHL) genes in every consanguineous Ira- nian family with ARNSHL that was referred to our centre. We first screened GJB2 mutations and then utilized a panel of three to four short ...

  5. Rare suprasellar chordoid meningioma with INI1 gene mutation ...

    African Journals Online (AJOL)

    Background: Chordoid Meningioma is a rare brain tumour characterized genetically by loss of genetic material from chromosome 22q at cytogenetic level resulting in mutation of NF2 gene. Objectives and case report: In the present report, we described a rare case of suprasellar chordoid meningioma, which presented in a ...

  6. Hypocaeruloplasminaemia with heteroallelic caeruloplasmin gene mutation: MRI of the brain

    International Nuclear Information System (INIS)

    Daimon, M.; Moriai, S.; Susa, S.; Yamatani, K.; Kato, T.; Hosoya, T.

    1999-01-01

    We present two patients with hypocaeruloplasminaemia and a heteroallelic caeruloplasmin gene mutation (HypoCPGM). These patients had diabetes mellitus and tremor of the hands, respectively. T2-weighted fast spin-echo MRI showed mildly reduced intensity of the putamen, much more marked on echo-planar imaging. (orig.) (orig.)

  7. Mutational landscape of the human Y chromosome-linked genes ...

    Indian Academy of Sciences (India)

    Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism. Deepali Pathak, Sandeep Kumar Yadav, Leena Rawal and Sher Ali. J. Genet. 94, 677–687. Table 1. Details showing age, sex, karyotype, clinical features and diagnosis results of the patients with H. Hormone profile.

  8. Mutational analysis and clinical correlation of metastatic colorectal cancer.

    Science.gov (United States)

    Russo, Andrea L; Borger, Darrell R; Szymonifka, Jackie; Ryan, David P; Wo, Jennifer Y; Blaszkowsky, Lawrence S; Kwak, Eunice L; Allen, Jill N; Wadlow, Raymond C; Zhu, Andrew X; Murphy, Janet E; Faris, Jason E; Dias-Santagata, Dora; Haigis, Kevin M; Ellisen, Leif W; Iafrate, Anthony J; Hong, Theodore S

    2014-05-15

    Early identification of mutations may guide patients with metastatic colorectal cancer toward targeted therapies that may be life prolonging. The authors assessed tumor genotype correlations with clinical characteristics to determine whether mutational profiling can account for clinical similarities, differences, and outcomes. Under Institutional Review Board approval, 222 patients with metastatic colon adenocarcinoma (n = 158) and rectal adenocarcinoma (n = 64) who underwent clinical tumor genotyping were reviewed. Multiplexed tumor genotyping screened for >150 mutations across 15 commonly mutated cancer genes. The chi-square test was used to assess genotype frequency by tumor site and additional clinical characteristics. Cox multivariate analysis was used to assess the impact of genotype on overall survival. Broad-based tumor genotyping revealed clinical and anatomic differences that could be linked to gene mutations. NRAS mutations were associated with rectal cancer versus colon cancer (12.5% vs 0.6%; P colon cancer (13% vs 3%; P = .024) and older age (15.8% vs 4.6%; P = .006). TP53 mutations were associated with rectal cancer (30% vs 18%; P = .048), younger age (14% vs 28.7%; P = .007), and men (26.4% vs 14%; P = .03). Lung metastases were associated with PIK3CA mutations (23% vs 8.7%; P = .004). Only mutations in BRAF were independently associated with decreased overall survival (hazard ratio, 2.4; 95% confidence interval, 1.09-5.27; P = .029). The current study suggests that underlying molecular profiles can differ between colon and rectal cancers. Further investigation is warranted to assess whether the differences identified are important in determining the optimal treatment course for these patients. © 2014 American Cancer Society.

  9. Advances in sarcoma gene mutations and therapeutic targets.

    Science.gov (United States)

    Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

    2018-01-01

    Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

  10. Two novel mutations in the PPIB gene cause a rare pedigree of osteogenesis imperfecta type IX.

    Science.gov (United States)

    Jiang, Yu; Pan, Jingxin; Guo, Dongwei; Zhang, Wei; Xie, Jie; Fang, Zishui; Guo, Chunmiao; Fang, Qun; Jiang, Weiying; Guo, Yibin

    2017-06-01

    Osteogenesis imperfecta (OI) is a rare genetic skeletal disorder characterized by increased bone fragility and vulnerability to fractures. PPIB is identified as a candidate gene for OI-IX, here we detect two pathogenic mutations in PPIB and analyze the genotype-phenotype correlation in a Chinese family with OI. Next-generation sequencing (NGS) was used to screen the whole exome of the parents of proband. Screening of variation frequency, evolutionary conservation comparisons, pathogenicity evaluation, and protein structure prediction were conducted to assess the pathogenicity of the novel mutations. Sanger sequencing was used to confirm the candidate variants. RTQ-PCR was used to analyze the PPIB gene expression. All mutant genes screened out by NGS were excluded except PPIB. Two novel heterozygous PPIB mutations (father, c.25A>G; mother, c.509G>A) were identified in relation to osteogenesis imperfecta type IX. Both mutations were predicted to be pathogenic by bioinformatics analysis and RTQ-PCR analysis revealed downregulated PPIB expression in the two carriers. We report a rare pedigree with an autosomal recessive osteogenesis imperfecta type IX (OI-IX) caused by two novel PPIB mutations identified for the first time in China. The current study expands our knowledge of PPIB mutations and their associated phenotypes, and provides new information on the genetic defects associated with this disease for clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Investigation of mutations in the HBB gene using the 1,000 genomes database.

    Science.gov (United States)

    Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

    2017-01-01

    Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

  12. Specific gene mutations induced by heavy ions

    International Nuclear Information System (INIS)

    Freeling, M.; Karoly, C.W.; Cheng, D.S.K.

    1980-01-01

    This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens

  13. Mapping of gene mutations in drosophila melanogaster

    OpenAIRE

    Halvorsen, Charlotte Marie

    2004-01-01

    In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

  14. Geographical distribution of β-globin gene mutations in Syria.

    Science.gov (United States)

    Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

    2018-04-11

    Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

  15. Gene-guided Gefitinib switch maintenance therapy for patients with advanced EGFR mutation-positive Non-small cell lung cancer: an economic analysis

    International Nuclear Information System (INIS)

    Zhu, Jun; Li, Te; Wang, Xiaohui; Ye, Ming; Cai, Jian; Xu, Yuejuan; Wu, Bin

    2013-01-01

    Maintenance therapy with gefitinib notably improves survival in patients with advanced non-small cell lung cancer (NSCLC) and EGFR mutation-positive tumors, but the economic impact of this practice is unclear. A decision-analytic model was developed to simulate 21-day patient transitions in a 10-year time horizon. The clinical data were primarily obtained from the results of a pivotal phase III trial that assessed gefitinib maintenance treatment in patients with advanced NSCLC. The cost data were derived from the perspective of the Chinese health care system. The primary outcome was the incremental cost-effectiveness ratio (ICER) at a willingness-to-pay (WTP) threshold of 3 times the per capita GDP of China. Sensitivity analyses were used to explore the impact of uncertainty regarding the results. The impact of the gefitinib patient assistance program (GPAP) was evaluated. After EGFR genotyping, gefitinib maintenance treatment for advanced NSCLC with EGFR mutations increased the life expectancy by 0.74 years and 0.46 QALYs compared with routine follow-up at an additional cost of $26,149.90 USD ($7,178.20 with the GPAP). The ICER for gefitinib maintenance was $57,066.40 and $15,664.80 per QALY gained (at a 3% discount rate) without and with the GPAP, respectively. The utility of progression free survival, the hazard ratio of progression-free survival for gefitinib treatment and the cost of gefitinib per dose were the three factors that had the greatest influence on the results. These results indicate that gene-guided maintenance therapy with gefitinib with the GPAP might be a cost-effective treatment option

  16. Gene-guided Gefitinib switch maintenance therapy for patients with advanced EGFR mutation-positive Non-small cell lung cancer: an economic analysis

    Directory of Open Access Journals (Sweden)

    Zhu Jun

    2013-01-01

    Full Text Available Abstract Background Maintenance therapy with gefitinib notably improves survival in patients with advanced non-small cell lung cancer (NSCLC and EGFR mutation-positive tumors, but the economic impact of this practice is unclear. Methods A decision-analytic model was developed to simulate 21-day patient transitions in a 10-year time horizon. The clinical data were primarily obtained from the results of a pivotal phase III trial that assessed gefitinib maintenance treatment in patients with advanced NSCLC. The cost data were derived from the perspective of the Chinese health care system. The primary outcome was the incremental cost-effectiveness ratio (ICER at a willingness-to-pay (WTP threshold of 3 times the per capita GDP of China. Sensitivity analyses were used to explore the impact of uncertainty regarding the results. The impact of the gefitinib patient assistance program (GPAP was evaluated. Results After EGFR genotyping, gefitinib maintenance treatment for advanced NSCLC with EGFR mutations increased the life expectancy by 0.74 years and 0.46 QALYs compared with routine follow-up at an additional cost of $26,149.90 USD ($7,178.20 with the GPAP. The ICER for gefitinib maintenance was $57,066.40 and $15,664.80 per QALY gained (at a 3% discount rate without and with the GPAP, respectively. The utility of progression free survival, the hazard ratio of progression-free survival for gefitinib treatment and the cost of gefitinib per dose were the three factors that had the greatest influence on the results. Conclusions These results indicate that gene-guided maintenance therapy with gefitinib with the GPAP might be a cost-effective treatment option.

  17. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  18. Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.

    Directory of Open Access Journals (Sweden)

    Jian Wang

    Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.

  19. Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

    Science.gov (United States)

    Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

    2016-05-01

    To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

  20. [Mutation analysis of seven patients with Waardenburg syndrome].

    Science.gov (United States)

    Hao, Ziqi; Zhou, Yongan; Li, Pengli; Zhang, Quanbin; Li, Jiao; Wang, Pengfei; Li, Xiangshao; Feng, Yong

    2016-06-01

    To perform genetic analysis for 7 patients with Waardenburg syndrome. Potential mutation of MITF, PAX3, SOX10 and SNAI2 genes was screened by polymerase chain reaction and direct sequencing. Functions of non-synonymous polymorphisms were predicted with PolyPhen2 software. Seven mutations, including c.649-651delAGA (p.R217del), c.72delG (p.G24fs), c.185T>C (p.M62T), c.118C>T (p.Q40X), c.422T>C (p.L141P), c.640C>T (p.R214X) and c.28G>T(p.G43V), were detected in the patients. Among these, four mutations of the PAX3 gene (c.72delG, c.185T>C, c.118C>T and c.128G>T) and one SOX10 gene mutation (c.422T>C) were not reported previously. Three non-synonymous SNPs (c.185T>C, c.128G>T and c.422T>C) were predicted as harmful. Genetic mutations have been detected in all patients with Waardenburg syndrome.

  1. Exome sequencing identifies rare deleterious mutations in DNA repair genes FANCC and BLM as potential breast cancer susceptibility alleles.

    Directory of Open Access Journals (Sweden)

    Ella R Thompson

    2012-09-01

    Full Text Available Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multi-generational breast cancer predisposition is unknown. In this study, we used whole-exome sequencing of thirty-three individuals from 15 breast cancer families to identify potential predisposing genes. Our analysis identified families with heterozygous, deleterious mutations in the DNA repair genes FANCC and BLM, which are responsible for the autosomal recessive disorders Fanconi Anemia and Bloom syndrome. In total, screening of all exons in these genes in 438 breast cancer families identified three with truncating mutations in FANCC and two with truncating mutations in BLM. Additional screening of FANCC mutation hotspot exons identified one pathogenic mutation among an additional 957 breast cancer families. Importantly, none of the deleterious mutations were identified among 464 healthy controls and are not reported in the 1,000 Genomes data. Given the rarity of Fanconi Anemia and Bloom syndrome disorders among Caucasian populations, the finding of multiple deleterious mutations in these critical DNA repair genes among high-risk breast cancer families is intriguing and suggestive of a predisposing role. Our data demonstrate the utility of intra-family exome-sequencing approaches to uncover cancer predisposition genes, but highlight the major challenge of definitively validating candidates where the incidence of sporadic disease is high, germline mutations are not fully penetrant, and individual predisposition genes may only account for a tiny proportion of breast cancer families.

  2. Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

    Directory of Open Access Journals (Sweden)

    Kamakari Smaragda

    2018-01-01

    Full Text Available Aim. To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1. Materials and Methods. A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results. An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%. Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%. In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions. By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations.

  3. Induced marker gene mutations in soybean

    International Nuclear Information System (INIS)

    Sawada, S.; Palmer, R.G.

    1989-01-01

    Full text: Non-fluorescent root mutants in soybean are useful as markers in genetic studies. 13 such mutants were detected among more than 150 000 seedlings derived from soybean lines treated with 6 mutagens. One of them, derived from variety 'Williams' treated with 20 kR gamma rays, did not correspond to the already known spontaneous non-fluorescent mutants. It was assigned the identification no. T285 and the gene symbol fr5. The other mutants corresponded with known loci fr1, fr2 or fr4. (author)

  4. Structural analysis of the 5' flanking region of the β-globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

    International Nuclear Information System (INIS)

    Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.

    1988-01-01

    Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa

  5. Isocitrate dehydrogenase 1 and 2 genes mutations and MGMT methylation in gliomas

    Directory of Open Access Journals (Sweden)

    D. V. Tabakov

    2017-01-01

    Full Text Available Gliomas are the most common brain tumors. It is difficult to detect them at early stages of disease and there is a few available therapies providing significant improvement in survival. Mutations of isocitrate dehydrogenase 1 and 2 genes (IDH1 and IDH2 play significant role in gliomogenesis, diagnostics and selection of patient therapy. We tested the distribution of IDH1 and IDH2 mutations in gliomas of different histological types and grades of malignancy by DNA melting analysis using our protocol with a sensitivity of 5 %. The results of this assay were confirmed by conventional Sanger sequencing. IDH1/2 mutations were detected in 74 % of lower grade gliomas (II and III, World Health Organization and in 14 % of glioblastomas (IV, World Health Organization. Mutation rate in gliomas with oligodendroglioma component were significantly higher then in other glioma types (р = 0.014. The IDH1 mutations was the most common (79 % of general mutation number. IDH1/2 mutations can induce aberrant gene methylation. Detection of methylation rate of the gene encoding for O6-methylguanine-DNA-methyltransferase (MGMT, predictive biomarker for treatment of gliomas with the alkylating agents, has demonstrated a partial association with IDH1/2 mutations. In 73 % of IDH1/2-mutant tumors MGMT promoter methylation were observed. At the same time IDH1/2 mutations were not revealed in 67 % tumors with MGMT promoter methylation. These results indicate existence of another mechanism of MGMT methylation in gliomas. Our data strong support for necessity of both markers testing when patient therapy is selected.

  6. Four novel mutations in the lactase gene (LCT) underlying congenital lactase deficiency (CLD).

    Science.gov (United States)

    Torniainen, Suvi; Freddara, Roberta; Routi, Taina; Gijsbers, Carolien; Catassi, Carlo; Höglund, Pia; Savilahti, Erkki; Järvelä, Irma

    2009-01-22

    Congenital lactase deficiency (CLD) is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT) gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  7. Four novel mutations in the lactase gene (LCT underlying congenital lactase deficiency (CLD

    Directory of Open Access Journals (Sweden)

    Höglund Pia

    2009-01-01

    Full Text Available Abstract Background Congenital lactase deficiency (CLD is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Methods Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Results Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. Conclusion This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  8. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  9. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

    Science.gov (United States)

    Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

    2017-01-01

    Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

  10. Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

    Science.gov (United States)

    Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

    2015-09-01

    Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many

  11. Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

    Science.gov (United States)

    Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

    2016-10-31

    To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

  12. New mutations and an updated database for the patched-1 (PTCH1) gene.

    Science.gov (United States)

    Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

    2018-05-01

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  13. EPILEPSY CAUSED BY PCDH19 GENE MUTATION: A REVIEW OF LITERATURE AND THE AUTHORS’ OBSERVATIONS

    Directory of Open Access Journals (Sweden)

    K. Yu. Mukhin

    2016-01-01

    Full Text Available Mutation in the PCDH19 gene was first described by L.M. Dibbens et al. in 2008. Mutations in this gene are associated with epilepsy and mental retardation limited to females. The clinical manifestations that are observed in some patients with PCDH19 mutation and Dravet syndrome that is caused by mutation in the SCN1A gene include the onset of febrile and afebrile seizures in infancy, serial seizures during fever, and regression in development after the onset of seizures. Due to the fact that the two diseases have common clinical signs, it is best to test for PCDH19 mutation in patients with the clinical picture of Dravet syndrome and a negative test for SCN1A. In general, the number of scientific papers devoted to analysis and recommendations for the choice of therapy in patients with rare genetic pathology is small now. We analyzed the specific features of clinical signs and therapy in our two observed female patients aged 4 and 11 years with verified PCDH19 mutation. Both patients were noted to have severe epilepsy with febrile convulsions with the development of status epilepticus and to be unresponsive to antiepileptic therapy. The use of different antiepileptic drugs (valproate, oxcarbazepine, phenobarbital, topiramate, levetiracetam at different combinations failed to control the course of epilepsy in the 4-year-old patient whereas the 11-year-old patient who took a combination of valproic acid and benzodiazepines achieved a positive effect.

  14. Detecting negative selection on recurrent mutations using gene genealogy

    Science.gov (United States)

    2013-01-01

    Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

  15. Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

    Science.gov (United States)

    Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

    2012-01-01

    PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  16. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Choi, Seong-Jun [Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Shim, Hosup, E-mail: shim@dku.edu [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Department of Physiology, Dankook University School of Medicine, Cheonan (Korea, Republic of)

    2014-10-03

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.

  17. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    International Nuclear Information System (INIS)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung; Choi, Seong-Jun; Shim, Hosup

    2014-01-01

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies

  18. Identification of a Novel HADHB Gene Mutation in an Iranian Patient with Mitochondrial Trifunctional Protein Deficiency.

    Science.gov (United States)

    Shahrokhi, Mahdiyeh; Shafiei, Mohammad; Galehdari, Hamid; Shariati, Gholamreza

    2017-01-01

    Mitochondrial trifunctional protein (MTP) is a hetero-octamer composed of eight parts (subunits): four α-subunits containing LCEH (long-chain 2,3-enoyl-CoA  hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and four β-subunits that possess LCKT (long-chain  3-ketoacyl-CoA thiolase) activity which catalyzes three out of four steps in β-oxidation spiral of long-chain fatty acid. Its deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases. A blood spot was collected from the patient's original newborn screening card with parental informed consent. A newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS were performed. After isolation of DNA and Amplification of all exons of the HADHA and HADHB, directly Sequence analyses of all exons and the flanking introns both of genes were performed. Here, we report a novel mutation in a patient with MTP deficiency diagnosed with newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS and then confirmed by enzyme analysis in cultured fibroblasts and direct sequencing of the HADHA and HADHB genes. Molecular analysis of causative genes showed a missense mutation (p.Q385P) c.1154A > C in exon 14 of HADHB gene. Since this mutation was not found in 50 normal control cases; so it was concluded that c.1154A > C mutation was a causative mutation. Phenotype analysis of this mutation predicted pathogenesis which reduces the stability of the MTP protein complex.

  19. Identification of missense mutations in the Norrie disease gene associated with advanced retinopathy of prematurity.

    Science.gov (United States)

    Shastry, B S; Pendergast, S D; Hartzer, M K; Liu, X; Trese, M T

    1997-05-01

    Retinopathy of prematurity (ROP) is a retinal vascular disease occurring in infants with short gestational age and low birth weight and can lead to retinal detachment (ROP stages 4 and 5). X-linked familial exudative vitreoretinopathy is phenotypically similar to ROP and has been associated with mutations in the Norrie disease (ND) gene in some cases. To determine if similar mutations in the ND gene may play a role in the development of advanced ROP. Clinical examination and molecular genetic analysis were performed on 16 children, including 2 dizygotic and 1 monozygotic twin pairs, and their parents from 13 families. Sequencing of the amplified products revealed missense mutations (R121W and L108P) in the third exon of the ND gene in 4 patients. These mutations were not present in an unaffected premature twin, 2 children with regressed stage 3 ROP, the parents, or in 50 unrelated healthy control subjects. These findings suggest that mutations in the ND gene may play a role in the development of severe ROP in premature infants.

  20. Mu Opioid Receptor Gene: New Point Mutations in Opioid Addicts

    Directory of Open Access Journals (Sweden)

    Amin Dinarvand

    2014-02-01

    Full Text Available Introduction: Association between single-nucleotide polymorphisms (SNPs in mu opioid receptor gene and drug addiction has been shown in various studies. Here, we have evaluated the existence of polymorphisms in exon 3 of this gene in Iranian population and investigated the possible association between these mutations and opioid addiction.  Methods: 79 opioid-dependent subjects (55 males, 24 females and 134 non-addict or control individuals (74 males, 60 females participated in the study. Genomic DNA was extracted from volunteers’ peripheral blood and exon 3 of the mu opioid receptor gene was amplified by polymerase chain reaction (PCR whose products were then sequenced.  Results: Three different heterozygote polymorphisms were observed in 3 male individuals: 759T>C and 877G>A mutations were found in 2 control volunteers and 1043G>C substitution was observed in an opioid-addicted subject. Association between genotype and opioid addiction for each mutation was not statistically significant.  Discussion: It seems that the sample size used in our study is not enough to confirm or reject any association between 759T>C, 877G>A and 1043G>C substitutions in exon 3 of the mu opioid receptor gene and opioid addiction susceptibility in Iranian population.

  1. Relationship between ELA2 gene mutations, clinical and laboratory parameters in severe congenital and cyclic neutropenia

    Directory of Open Access Journals (Sweden)

    Farhoodi A

    2007-09-01

    Full Text Available   Background: Mutations of ELA2, the gene encoding neutrophil elastase (NE are known to be associated with cyclic neutropenia (CN and severe congenital neutropenia (SCN. However, high variability of these mutations has been reported. This study was designed to describe the analysis of the ELA2 gene, clinical manifestations and demographic characteristics in patients with CN and SCN.Methods: A series of 21 patients with CN or SCN were selected, based on SCINR criteria, from the immunology ward of the Pediatric Medicine Center, Tehran, Iran, from March 2004 to August 2005. The ELA2 gene, isolated from blood samples, was analyzed using RT-PCR and automated capillary sequencing. Informed consent was obtained under the tenets of the Helsinki Declaration and the Ethical Committee of the Tehran University of Medical Sciences.Results: Kostmann's syndrome and CN was diagnosed in three and 18 patients respectively. Of all the patients, one or two mutations were found in 18 cases (85.7%, including all three patients with SCN and 15 of the patients with CN. Exons two and four had the most mutations (eight and seven cases, respectively. Seven patients had double mutations in two distinct exons. Overall, 16 different mutations were found. At the time of presentation, the mean age of patients was 13.4 ±17.6 months, ranging from one month to seven years. Overall, 61.9% of patients had consanguineous parents. The mean absolute neutrophil count was 830.5 ±419.4 (150-2000/mm3. On average, each patient had been admitted to the hospital 2.2 ±1.6 times. The neutrophil counts of the SCN patients were significantly higher than those of the CN patients. However, there was no significant difference in the neutrophil counts between patients with mutations and those without mutations. All patients with SCN had two or more infectious complications, although the prevalence of infectious or non-infectious complications did not correlate with ELA2 mutations or the

  2. Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population

    Directory of Open Access Journals (Sweden)

    Simonas Juzėnas

    2016-01-01

    Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.

  3. HFE gene: Structure, function, mutations, and associated iron abnormalities.

    Science.gov (United States)

    Barton, James C; Edwards, Corwin Q; Acton, Ronald T

    2015-12-15

    The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Directory of Open Access Journals (Sweden)

    Mehul Mistri

    Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  5. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Science.gov (United States)

    Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh

    2012-01-01

    Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  6. Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Putnam, E.A.; Cho, M.; Milewicz, D.M. [Univ. of Texas-Houston Medical School, Houston, TX (United States)] [and others

    1996-03-29

    Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-based exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.

  7. Predictive models for mutations in mismatch repair genes: implication for genetic counseling in developing countries

    Directory of Open Access Journals (Sweden)

    Monteiro Santos Erika

    2012-02-01

    Full Text Available Abstract Background Lynch syndrome (LS is the most common form of inherited predisposition to colorectal cancer (CRC, accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1, mutS homolog 2 (MSH2, postmeiotic segregation increased 1 (PMS1, post-meiotic segregation increased 2 (PMS2 and mutS homolog 6 (MSH6. Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Methods Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Results Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846, Barnetson (0.850, MMRpro (0.821 and Wijnen (0.807 models did not present significant statistical difference. The Myriad model presented lower AUC (0.704 than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad and 0.87 (Wijnen and specificity ranged from 0 (Myriad to 0.38 (Barnetson. Conclusions The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models.

  8. Predictive models for mutations in mismatch repair genes: implication for genetic counseling in developing countries

    Energy Technology Data Exchange (ETDEWEB)

    Monteiro Santos, Erika Maria [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Silva Junior, Wilson Araujo da [Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil); Carraro, Dirce Maria [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Rossi, Benedito Mauro; Valentin, Mev Dominguez [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Carneiro, Felipe [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Oliveira, Ligia Petrolini de [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Oliveira Ferreira, Fabio de; Junior, Samuel Aguiar [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Hereditary Colorectal Cancer Registry, AC Camargo Hospital, Sao Paulo (Brazil); Nakagawa, Wilson Toshihiko [Hereditary Colorectal Cancer Registry, AC Camargo Hospital, Sao Paulo (Brazil); Gomy, Israel [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil); Faria Ferraz, Victor Evangelista de [Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil)

    2012-02-09

    Lynch syndrome (LS) is the most common form of inherited predisposition to colorectal cancer (CRC), accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1), mutS homolog 2 (MSH2), postmeiotic segregation increased 1 (PMS1), post-meiotic segregation increased 2 (PMS2) and mutS homolog 6 (MSH6). Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846), Barnetson (0.850), MMRpro (0.821) and Wijnen (0.807) models did not present significant statistical difference. The Myriad model presented lower AUC (0.704) than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad) and 0.87 (Wijnen) and specificity ranged from 0 (Myriad) to 0.38 (Barnetson). The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models.

  9. Predictive models for mutations in mismatch repair genes: implication for genetic counseling in developing countries

    International Nuclear Information System (INIS)

    Monteiro Santos, Erika Maria; Silva Junior, Wilson Araujo da; Carraro, Dirce Maria; Rossi, Benedito Mauro; Valentin, Mev Dominguez; Carneiro, Felipe; Oliveira, Ligia Petrolini de; Oliveira Ferreira, Fabio de; Junior, Samuel Aguiar; Nakagawa, Wilson Toshihiko; Gomy, Israel; Faria Ferraz, Victor Evangelista de

    2012-01-01

    Lynch syndrome (LS) is the most common form of inherited predisposition to colorectal cancer (CRC), accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1), mutS homolog 2 (MSH2), postmeiotic segregation increased 1 (PMS1), post-meiotic segregation increased 2 (PMS2) and mutS homolog 6 (MSH6). Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846), Barnetson (0.850), MMRpro (0.821) and Wijnen (0.807) models did not present significant statistical difference. The Myriad model presented lower AUC (0.704) than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad) and 0.87 (Wijnen) and specificity ranged from 0 (Myriad) to 0.38 (Barnetson). The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models

  10. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  11. Biochemical Diagnosis of Common Gene Mutations in Galactosemia

    Directory of Open Access Journals (Sweden)

    Farzaneh Mirzajani

    2005-04-01

    Full Text Available Objective: Galactosemia is an inborn error of galactose metabolism that is inherited in an autosomal recessive trait. Classical galactosemia is caused by deficient activity of the galactose-1-phosphate uridyltransferase (GALT enzyme that can result in galactosemia complications. Materials & Methods: 135 unrelated families, clinically suspected to galactosemia, were screened by qualitative measurement of galactose-1-phosphate uridyl transferase (GALT activity in blood RBCs by using Beutler method. Results: Deficient enzyme activity (classical galactosemia were confirmed in 16 families. All of these 16 families were submitted to the diagnosis of six common mutations in GALT gene including Q188R, K285N, S135L, L195P, X380R and Q169K by using PCR-RFLP method which resulted in detection of 68% of the mutated alleles. Eight patients were homozygote for Q188R mutation, while one patient homozygote for S135L mutation and one heterozygote for K285N mutation. Conclusion: Biochemnical diagnosis of Galactosemia in Grand infant hospital is very important and necessary.

  12. Ocular findings associated with a Cys39Arg mutation in the Norrie disease gene.

    Science.gov (United States)

    Joos, K M; Kimura, A E; Vandenburgh, K; Bartley, J A; Stone, E M

    1994-12-01

    To diagnose the carriers and noncarriers in a family affected with Norrie disease based on molecular analysis. Family members from three generations, including one affected patient, two obligate carriers, one carrier identified with linkage analysis, one noncarrier identified with linkage analysis, and one female family member with indeterminate carrier status, were examined clinically and electrophysiologically. Linkage analysis had previously failed to determine the carrier status of one female family member in the third generation. Blood samples were screened for mutations in the Norrie disease gene with single-strand conformation polymorphism analysis. The mutation was characterized by dideoxy-termination sequencing. Ophthalmoscopy and electroretinographic examination failed to detect the carrier state. The affected individuals and carriers in this family were found to have a transition from thymidine to cytosine in the first nucleotide of codon 39 of the Norrie disease gene, causing a cysteine-to-arginine mutation. Single-strand conformation polymorphism analysis identified a patient of indeterminate status (by linkage) to be a noncarrier of Norrie disease. Ophthalmoscopy and electroretinography could not identify carriers of this Norrie disease mutation. Single-strand conformation polymorphism analysis was more sensitive and specific than linkage analysis in identifying carriers in this family.

  13. High-resolution melting (HRM) re-analysis of a polyposis patients cohort reveals previously undetected heterozygous and mosaic APC gene mutations.

    Science.gov (United States)

    Out, Astrid A; van Minderhout, Ivonne J H M; van der Stoep, Nienke; van Bommel, Lysette S R; Kluijt, Irma; Aalfs, Cora; Voorendt, Marsha; Vossen, Rolf H A M; Nielsen, Maartje; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Tops, Carli M J; Hes, Frederik J

    2015-06-01

    Familial adenomatous polyposis is most frequently caused by pathogenic variants in either the APC gene or the MUTYH gene. The detection rate of pathogenic variants depends on the severity of the phenotype and sensitivity of the screening method, including sensitivity for mosaic variants. For 171 patients with multiple colorectal polyps without previously detectable pathogenic variant, APC was reanalyzed in leukocyte DNA by one uniform technique: high-resolution melting (HRM) analysis. Serial dilution of heterozygous DNA resulted in a lowest detectable allelic fraction of 6% for the majority of variants. HRM analysis and subsequent sequencing detected pathogenic fully heterozygous APC variants in 10 (6%) of the patients and pathogenic mosaic variants in 2 (1%). All these variants were previously missed by various conventional scanning methods. In parallel, HRM APC scanning was applied to DNA isolated from polyp tissue of two additional patients with apparently sporadic polyposis and without detectable pathogenic APC variant in leukocyte DNA. In both patients a pathogenic mosaic APC variant was present in multiple polyps. The detection of pathogenic APC variants in 7% of the patients, including mosaics, illustrates the usefulness of a complete APC gene reanalysis of previously tested patients, by a supplementary scanning method. HRM is a sensitive and fast pre-screening method for reliable detection of heterozygous and mosaic variants, which can be applied to leukocyte and polyp derived DNA.

  14. Mutational analysis of the PHEX, FGF23, DMP1, SLC34A3, and CLCN5 genes in patients with Hypophosphatemic Rickets

    DEFF Research Database (Denmark)

    Beck-Nielsen, Signe; Brixen, Kim; Gram, Jeppe

    The aim of this study was to identify the underlying genetic mutation in patients with hypophosphatemic rickets (HR). The HR patients studied were recruited from a cross-sectional study of 59 HR patients living in Denmark. Genomic DNA was analysed for mutations in PHEX, FGF23, DMP1, SCL34A3...

  15. Novel mutations of the nucleophosmin (NPM-1) gene in Egyptian patients with acute myeloid leukemia: A pilot study

    International Nuclear Information System (INIS)

    Neemat Kassem, N.; Abel Hamid, A.; Tarek Attia, T.; Mahmoud, S.; Moemen, E.; Baathallah, Sh.; Safwat, E.; Khalaf, M.; Shaker, O.

    2011-01-01

    Mutations of the nucleophosmin (NPM-1) gene have been reported in 50-60% of acute myeloid leukemia (AML) patients with normal karyotype. This work was designed to study the prevalence and nature of NPM1 gene mutations in a group of Egyptian patients with AML to get an idea about the profile of NPM1 gene mutations in our society. In 45 previously untreated patients with de novo AML, peripheral blood and/or bone marrow samples from all patients were subjected to microscopic morphologic examination, cytochemical analysis, immuno phenotyping and karyotyping. Patients with normal cytogenetic results were selected for molecular analysis of NPM1 exon 12 by PCR amplification followed by DNA sequencing of the amplified product. Twenty-one patients (46.7%) had abnormal karyotype: six cases with ;(15;17), five cases with (8;21), five cases had trisomy 8, two cases carrying inv(3) and three cases had monosomy 7. The remaining 24 patients (53.3%) had normal karyotype. These patients were then subjected to molecular analysis. Out of these 24 patients with normal karyotype, mutant NPM-1 was detected in 11 patients (45.8%) by DNA sequencing; 2 cases showed type A mutation, 2 cases were harboring [ins 1015-4019 (CACG)], with point mutation [1006C→G], while the remaining 7 cases showed heterozygous deletion of nt A [del 1178 (A)]. Conclusion: Two novel NPM1 gene mutations were detected among our study population of AML patients identified as: the insertion CACG associated with point mutation, deletion of one base, or associated with point mutation. NPM1 gene mutations may become a new tool for monitoring minimal residual disease in AML with normal karyotype. Whether these previously unreported NPM-1 mutations will confer the same better outcome as previously reported mutations is currently unknown and warrants a larger study.

  16. Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

    Science.gov (United States)

    Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

    2001-10-01

    Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

  17. Detection of mutations in the COL4A5 gene by SSCP in X-linked Alport syndrome

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Juncker, I; Persson, U

    2001-01-01

    , three in-frame deletions, four nonsense mutations, and six splice site mutations. Twenty-two of the mutations have not previously been reported. Furthermore, we found one non-pathogenic amino acid substitution, one rare variant in a non-coding region, and one polymorphism with a heterozygosity of 28...... of type IV-collagen. We performed mutation analysis of the COL4A5 gene by PCR-SSCP analysis of each of the 51 exons with flanking intronic sequences in 81 patients suspected of X-linked Alport syndrome including 29 clear X-linked cases, 37 cases from families with a pedigree compatible with X...

  18. Mutation inactivation of Nijmegen breakage syndrome gene (NBS1 in hepatocellular carcinoma and intrahepatic cholangiocarcinoma.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available Nijmegen breakage syndrome (NBS with NBS1 germ-line mutation is a human autosomal recessive disease characterized by genomic instability and enhanced cancer predisposition. The NBS1 gene codes for a protein, Nbs1(p95/Nibrin, involved in the processing/repair of DNA double-strand breaks. Hepatocellular carcinoma (HCC is a complex and heterogeneous tumor with several genomic alterations. Recent studies have shown that heterozygous NBS1 mice exhibited a higher incidence of HCC than did wild-type mice. The objective of the present study is to assess whether NBS1 mutations play a role in the pathogenesis of human primary liver cancer, including HBV-associated HCC and intrahepatic cholangiocarcinoma (ICC. Eight missense NBS1 mutations were identified in six of 64 (9.4% HCCs and two of 18 (11.1% ICCs, whereas only one synonymous mutation was found in 89 control cases of cirrhosis and chronic hepatitis B. Analysis of the functional consequences of the identified NBS1 mutations in Mre11-binding domain showed loss of nuclear localization of Nbs1 partner Mre11, one of the hallmarks for Nbs1 deficiency, in one HCC and two ICCs with NBS1 mutations. Moreover, seven of the eight tumors with NBS1 mutations had at least one genetic alteration in the TP53 pathway, including TP53 mutation, MDM2 amplification, p14ARF homozygous deletion and promoter methylation, implying a synergistic effect of Nbs1 disruption and p53 inactivation. Our findings provide novel insight on the molecular pathogenesis of primary liver cancer characterized by mutation inactivation of NBS1, a DNA repair associated gene.

  19. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Jett, J. [Lawrence Livermore National Lab., CA (United States)

    1994-12-01

    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  20. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    Directory of Open Access Journals (Sweden)

    Guilhem Lignon

    2017-05-01

    Full Text Available Background and objective:FAM20A gene mutations result in enamel renal syndrome (ERS associated with amelogenesis imperfecta (AI, nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects.Methods: Tooth sections were analyzed by Scanning Electron Microscopy (SEM, Energy Dispersive Spectroscopy (EDS, X-Ray Diffraction (XRD, and X-Ray Fluorescence (XRF.Results: SEM revealed that prisms were restricted to the inner-most enamel zones. The bulk of the mineralized matter covering the crown was formed by layers with varying electron-densities organized into lamellae and micronodules. Tissue porosity progressively increased at the periphery, ending with loose and unfused nanonodules also observed in the adjoining soft tissues. Thus, the enamel layer covering the dentin in all ERS patients (except a limited layer of enamel at the dentino-enamel junction displayed an ultrastructural globular pattern similar to one observed in ectopic mineralization of soft tissue, notably in the gingiva of Fam20a knockout mice. XRD analysis confirmed the existence of alterations in crystallinity and composition (vs. sound enamel. XRF identified lower levels of calcium and phosphorus in ERS enamel. Finally, EDS confirmed the reduced amount of calcium in ERS enamel, which appeared similar to dentin.Conclusion: This study suggests that, after an initial normal start to amelogenesis, the bulk of the tissue covering coronal dentin would be formed by different mechanisms based on nano- to micro-nodule aggregation. This evocated ectopic mineralization process is known to intervene in several soft tissues in FAM20A gene mutant.

  1. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    Science.gov (United States)

    Lignon, Guilhem; Beres, Fleur; Quentric, Mickael; Rouzière, Stephan; Weil, Raphael; De La Dure-Molla, Muriel; Naveau, Adrien; Kozyraki, Renata; Dessombz, Arnaud; Berdal, Ariane

    2017-01-01

    Background and objective: FAM20A gene mutations result in enamel renal syndrome (ERS) associated with amelogenesis imperfecta (AI), nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects. Methods: Tooth sections were analyzed by Scanning Electron Microscopy (SEM), Energy Dispersive Spectroscopy (EDS), X-Ray Diffraction (XRD), and X-Ray Fluorescence (XRF). Results: SEM revealed that prisms were restricted to the inner-most enamel zones. The bulk of the mineralized matter covering the crown was formed by layers with varying electron-densities organized into lamellae and micronodules. Tissue porosity progressively increased at the periphery, ending with loose and unfused nanonodules also observed in the adjoining soft tissues. Thus, the enamel layer covering the dentin in all ERS patients (except a limited layer of enamel at the dentino-enamel junction) displayed an ultrastructural globular pattern similar to one observed in ectopic mineralization of soft tissue, notably in the gingiva of Fam20a knockout mice. XRD analysis confirmed the existence of alterations in crystallinity and composition (vs. sound enamel). XRF identified lower levels of calcium and phosphorus in ERS enamel. Finally, EDS confirmed the reduced amount of calcium in ERS enamel, which appeared similar to dentin. Conclusion: This study suggests that, after an initial normal start to amelogenesis, the bulk of the tissue covering coronal dentin would be formed by different mechanisms based on nano- to micro-nodule aggregation. This evocated ectopic mineralization process is known to intervene in several soft tissues in FAM20A gene mutant.

  2. Characterization and mutational analysis of omega-class GST (GSTO1 from Apis cerana cerana, a gene involved in response to oxidative stress.

    Directory of Open Access Journals (Sweden)

    Fei Meng

    Full Text Available The Omega-class of GSTs (GSTOs is a class of cytosolic GSTs that have specific structural and functional characteristics that differ from those of other GST groups. In this study, we demonstrated the involvement of the GSTO1 gene from A. cerana cerana in the oxidative stress response and further investigated the effects of three cysteine residues of GSTO1 protein on this response. Real-time quantitative PCR (qPCR showed that AccGSTO1 was highly expressed in larvae and foragers, primarily in the midgut, epidermis, and flight muscles. The AccGSTO1 mRNA was significantly induced by cold and heat at 1 h and 3 h. The TBA (2-Thiobarbituric acid method indicated that cold or heat resulted in MDA accumulation, but silencing of AccGSTO1 by RNAi in honeybees increased the concentration of MDA. RNAi also increased the temperature sensitivity of honeybees and markedly reduced their survival. Disc diffusion assay indicated that overexpression of AccGSTO1 in E. coli caused the resistance to long-term oxidative stress. Furthermore, AccGSTO1 was active in an in vitro DNA protection assay. Mutations in Cys-28, Cys-70, and Cys-124 affected the catalytic activity and antioxidant activity of AccGSTO1. The predicted three-dimensional structure of AccGSTO1 was also influenced by the replacement of these cysteine residues. These findings suggest that AccGSTO1 plays a protective role in the response to oxidative stress.

  3. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    Science.gov (United States)

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

    2017-01-01

    Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

  4. Congenital Hypothyroidism Caused by a PAX8 Gene Mutation Manifested as Sodium/Iodide Symporter Gene Defect

    Directory of Open Access Journals (Sweden)

    Wakako Jo

    2010-01-01

    Full Text Available Loss-of-function mutations of the PAX8 gene are considered to mainly cause congenital hypothyroidism (CH due to thyroid hypoplasia. However, some patients with PAX8 mutation have demonstrated a normal-sized thyroid gland. Here we report a CH patient caused by a PAX8 mutation, which manifested as iodide transport defect (ITD. Hypothyroidism was detected by neonatal screening and L-thyroxine replacement was started immediately. Although 123I scintigraphy at 5 years of age showed that the thyroid gland was in the normal position and of small size, his iodide trapping was low. The ratio of the saliva/plasma radioactive iodide was low. He did not have goiter; however laboratory findings suggested that he had partial ITD. Gene analyses showed that the sodium/iodide symporter (NIS gene was normal; instead, a mutation in the PAX8 gene causing R31H substitution was identified. The present report demonstrates that individuals with defective PAX8 can have partial ITD, and thus genetic analysis is useful for differential diagnosis.

  5. Numerous BAF complex genes are mutated in Coffin-Siris syndrome.

    Science.gov (United States)

    Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

    2014-09-01

    Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.

  6. Analysis of IgV gene mutations in B cell chronic lymphocytic leukaemia according to antigen-driven selection identifies subgroups with different prognosis and usage of the canonical somatic hypermutation machinery.

    Science.gov (United States)

    Degan, Massimo; Bomben, Riccardo; Bo, Michele Dal; Zucchetto, Antonella; Nanni, Paola; Rupolo, Maurizio; Steffan, Agostino; Attadia, Vincenza; Ballerini, Pier Ferruccio; Damiani, Daniela; Pucillo, Carlo; Poeta, Giovanni Del; Colombatti, Alfonso; Gattei, Valter

    2004-07-01

    Cases of B-cell chronic lymphocytic leukaemia (B-CLL) with mutated (M) IgV(H) genes have a better prognosis than unmutated (UM) cases. We analysed the IgV(H) mutational status of B-CLL according to the features of a canonical somatic hypermutation (SHM) process, correlating this data with survival. In a series of 141 B-CLLs, 124 cases were examined for IgV(H) gene per cent mutations and skewing of replacement/silent mutations in the framework/complementarity-determining regions as evidence of antigen-driven selection; this identified three B-CLL subsets: significantly mutated (sM), with evidence of antigen-driven selection, not significantly mutated (nsM) and UM, without such evidence and IgV(H) gene per cent mutations above or below the 2% cut-off. sM B-CLL patients had longer survival within the good prognosis subgroup that had more than 2% mutations of IgV(H) genes. sM, nsM and UM B-CLL were also characterized for the biased usage of IgV(H) families, intraclonal IgV(H) gene diversification, preference of mutations to target-specific nucleotides or hotspots, and for the expression of enzymes involved in SHM (translesion DNA polymerase zeta and eta and activation-induced cytidine deaminase). These findings indicate the activation of a canonical SHM process in nsM and sM B-CLLs and underscore the role of the antigen in defining the specific clinical and biological features of B-CLL.

  7. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  8. Novel mutations in the genes TGM1 and ALOXE3 underlying autosomal recessive congenital ichthyosis

    Science.gov (United States)

    Ullah, Rahim; Ansar, Muhammad; Durrani, Zaka Ullah; Lee, Kwanghyuk; Santos-Cortez, Regie Lyn P.; Muhammad, Dost; Ali, Mahboob; Zia, Muhammad; Ayub, Muhammad; Khan, Suliman; Smith, Josh D.; Nickerson, Deborah A.; Shendure, Jay; Bamshad, Michael; Leal, Suzanne M.; Ahmad, Wasim

    2016-01-01

    Background Ichthyoses are clinically characterized by scaling or hyperkeratosis of the skin or both. It can be an isolated condition limited to the skin or appear secondarily with involvement of other cutaneous or systemic abnormalities. Methods The present study investigated clinical and molecular characterization of three consanguineous families (A, B, C) segregating two different forms of autosomal recessive congenital ichthyosis (ARCI). Linkage in three consanguineous families (A, B, C) segregating two different forms of ARCI was searched by typing microsatellite and single nucleotide polymorphism marker analysis. Sequencing of the two genes TGM1 and ALOXE3 was performed by the dideoxy chain termination method. Results Genome-wide linkage analysis established linkage in family A to TGM1 gene on chromosome 14q11 and in families B and C to ALOXE3 gene on chromosome 17p13. Subsequently, sequencing of these genes using samples from affected family members led to the identification of three novel mutations: a missense variant p.Trp455Arg in TGM1 (family A); a nonsense variant p.Arg140* in ALOXE3 (family B); and a complex rearrangement in ALOXE3 (family C). Conclusion The present study further extends the spectrum of mutations in the two genes involved in causing ARCI. Characterizing the clinical spectrum resulting from mutations in the TGM1 and ALOXE3 genes will improve diagnosis and may direct clinical care of the family members. PMID:26578203

  9. Multigenerational Brazilian family with malignant hyperthermia and a novel mutation in the RYR1 gene.

    Science.gov (United States)

    Matos, A R; Sambuughin, N; Rumjanek, F D; Amoedo, N D; Cunha, L B P; Zapata-Sudo, G; Sudo, R T

    2009-12-01

    Malignant hyperthermia (MH) is a pharmacogenetic disease triggered in susceptible individuals by the administration of volatile halogenated anesthetics and/or succinylcholine, leading to the development of a hypermetabolic crisis, which is caused by abnormal release of Ca2+ from the sarcoplasmic reticulum, through the Ca2+ release channel ryanodine receptor 1 (RyR1). Mutations in the RYR1 gene are associated with MH in the majority of susceptible families. Genetic screening of a 5-generation Brazilian family with a history of MH-related deaths and a previous MH diagnosis by the caffeine halothane contracture test (CHCT) in some individuals was performed using restriction and sequencing analysis. A novel missense mutation, Gly4935Ser, was found in an important functional and conserved locus of this gene, the transmembrane region of RyR1. In this family, 2 MH-susceptible individuals previously diagnosed with CHCT carry this novel mutation and another 24 not previously diagnosed members also carry it. However, this same mutation was not found in another MH-susceptible individual whose CHCT was positive to the test with caffeine but not to the test with halothane. None of the 5 MH normal individuals of the family, previously diagnosed by CHCT, carry this mutation, nor do 100 controls from control Brazilian and USA populations. The Gly4932Ser variant is a candidate mutation for MH, based on its co-segregation with disease phenotype, absence among controls and its location within the protein.

  10. Prognostic signature and clonality pattern of recurrently mutated genes in inactive chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Hurtado, A M; Chen-Liang, T-H; Przychodzen, B; Hamedi, C; Muñoz-Ballester, J; Dienes, B; García-Malo, M D; Antón, A I; Arriba, F de; Teruel-Montoya, R; Ortuño, F J; Vicente, V; Maciejewski, J P; Jerez, A

    2015-01-01

    An increasing numbers of patients are being diagnosed with asymptomatic early-stage chronic lymphocytic leukemia (CLL), with no treatment indication at baseline. We applied a high-throughput deep-targeted analysis, especially designed for covering widely TP53 and ATM genes, in 180 patients with inactive disease at diagnosis, to test the independent prognostic value of CLL somatic recurrent mutations. We found that 40/180 patients harbored at least one acquired variant with ATM (n=17, 9.4%), NOTCH1 (n=14, 7.7%), TP53 (n=14, 7.7%) and SF3B1 (n=10, 5.5%) as most prevalent mutated genes. Harboring one ‘sub-Sanger' TP53 mutation granted an independent 3.5-fold increase of probability of needing treatment. Those patients with a double-hit ATM lesion (mutation+11q deletion) had the shorter median time to first treatment (17 months). We found that a genomic variable: TP53 mutations, most of them under the sensitivity of conventional techniques; a cell phenotypic factor: CD38-positive expression; and a classical marker as β2-microglobulin, remained as the unique independent predictors of outcome. The high-throughput determination of TP53 status, particularly in this set of patients frequently lacking high-risk chromosomal aberrations, emerges as a key step, not only for prediction modeling, but also for exploring mutation-specific therapeutic approaches and minimal residual disease monitoring

  11. c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness.

    Science.gov (United States)

    Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak

    2016-02-01

    Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  12. [Observation and analysis on mutation of routine STR locus].

    Science.gov (United States)

    Li, Qiu-yang; Feng, Wei-jun; Yang, Qin-gen

    2005-05-01

    To observe and analyze the characteristic of mutation at STR locus. 27 mutant genes observed in 1211 paternity testing cases were checked by PAGE-silver stained and PowerPlex 16 System Kit and validated by sequencing. Mutant genes locate on 15 loci. The pattern of mutation was accord with stepwise mutation model. The mutation ratio of male-to-female was 8:1 and correlated to the age of father. Mutation rate is correlated to the geometric mean of the number of homogeneous repeats of locus. The higher the mean, the higher the mutation rate. These loci are not so appropriate for use in paternity testing.

  13. A novel mutation of adenomatous polyposis coli (APC) gene results in the formation of supernumerary teeth.

    Science.gov (United States)

    Yu, Fang; Cai, Wenping; Jiang, Beizhan; Xu, Laijun; Liu, Shangfeng; Zhao, Shouliang

    2018-01-01

    Supernumerary teeth are teeth that are present in addition to normal teeth. Although several hypotheses and some molecular signalling pathways explain the formation of supernumerary teeth, but their exact disease pathogenesis is unknown. To study the molecular mechanisms of supernumerary tooth-related syndrome (Gardner syndrome), a deeper understanding of the aetiology of supernumerary teeth and the associated syndrome is needed, with the goal of inhibiting disease inheritance via prenatal diagnosis. We recruited a Chinese family with Gardner syndrome. Haematoxylin and eosin staining of supernumerary teeth and colonic polyp lesion biopsies revealed that these patients exhibited significant pathological characteristics. APC gene mutations were detected by PCR and direct sequencing. We revealed the pathological pathway involved in human supernumerary tooth development and the mouse tooth germ development expression profile by RNA sequencing (RNA-seq). Sequencing analysis revealed that an APC gene mutation in exon 15, namely 4292-4293-Del GA, caused Gardner syndrome in this family. This mutation not only initiated the various manifestations typical of Gardner syndrome but also resulted in odontoma and supernumerary teeth in this case. Furthermore, RNA-seq analysis of human supernumerary teeth suggests that the APC gene is the key gene involved in the development of supernumerary teeth in humans. The mouse tooth germ development expression profile shows that the APC gene plays an important role in tooth germ development. We identified a new mutation in the APC gene that results in supernumerary teeth in association with Gardner syndrome. This information may shed light on the molecular pathogenesis of supernumerary teeth. Gene-based diagnosis and gene therapy for supernumerary teeth may become available in the future, and our study provides a high-resolution reference for treating other syndromes associated with supernumerary teeth. © 2017 The Authors. Journal of

  14. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    Science.gov (United States)

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  15. Sarcomeric gene mutations in sudden infant death syndrome (SIDS).

    Science.gov (United States)

    Brion, Maria; Allegue, Catarina; Santori, Montserrat; Gil, Rocio; Blanco-Verea, Alejandro; Haas, Cordula; Bartsch, Christine; Poster, Simone; Madea, Burkhard; Campuzano, Oscar; Brugada, Ramon; Carracedo, Angel

    2012-06-10

    In developed countries, sudden infant death syndrome (SIDS) represents the most prevalent cause of death in children between 1 month and 1 year of age. SIDS is a diagnosis of exclusion, a negative autopsy which requires the absence of structural organ disease. Although investigators have confirmed that a significant percentage of SIDS cases are actually channelopathies, no data have been made available as to whether other sudden cardiac death-associated diseases, such as hypertrophic cardiomyopathy (HCM), could be responsible for some cases of SIDS. The presence of a genetic mutation in the sarcomeric protein usually affects the force of contraction of the myocyte, whose weakness is compensated with progressive hypertrophy and disarray. However, it is unclear whether in the most incipient forms, that is, first years of life, the lack of these phenotypes still confers a risk of arrhythmogenesis. The main goal of the present study is to wonder whether genetic defects in the sarcomeric proteins, previously associated with HCM, could be responsible for SIDS. We have analysed 286 SIDS cases for the most common genes implicated in HCM in adults. A total of 680 mutations localised in 16 genes were analysed by semi-automated matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDITOF-MS) using the Sequenom MassARRAY(®) System. Ten subjects with completely normal hearts showed mutated alleles at nine of the genetic variants analysed, and one additional novel mutation was detected by conventional sequencing. Therefore, a genetic mutation associated with HCM may cause sudden cardiac death in the absence of an identifiable phenotype. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. A novel mutation in the SH3BP2 gene causes cherubism: case report

    Directory of Open Access Journals (Sweden)

    Yu Shi-Feng

    2006-12-01

    Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  17. Novel mutation in ABCC6 gene in a Japanese pedigree with pseudoxanthoma elasticum and retinitis pigmentosa.

    Science.gov (United States)

    Yoshida, S; Honda, M; Yoshida, A; Nakao, S; Goto, Y; Nakamura, T; Fujisawa, K; Ishibashi, T

    2005-02-01

    To report a novel mutation of the ABCC6 gene in a Japanese family that had a case of pseudoxanthoma elasticum (PXE) another with PXE and retinitis pigmentosa. Ophthalmologic examinations were performed, and the ABCC6 gene was analysed by direct genomic sequencing. Fundus examinations of the 48-year-old proband disclosed angioid streaks and a peud'orange appearance of the retina of the both eyes, whereas both of his 25- and 20-year-old daughters had pigmentary degeneration and angioid streaks. In the sibilings, the mixed cone-rod ERG was almost nondetectable, whereas that of the proband was well-preserved. Molecular genetic analysis revealed that the proband has a homozygous nonsense mutation at the 595 bp in the ABCC6, and the siblings were heterozygous for the same mutation. This mutation was not detected in Japanese subjects in the JSNP database (http://snp.ims.u-tokyo.ac.jp/). Our results demonstrated an association between a novel mutation in the ABCC6 gene and PXE in a Japanese family.

  18. Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

    International Nuclear Information System (INIS)

    Romeo, G.; Hassan, H.J.; Staempfli, S.

    1987-01-01

    The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees

  19. Interleukin-7 receptor-α gene mutations are not detected in adult T-cell acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Rozovski, Uri; Li, Ping; Harris, David; Ohanian, Maro; Kantarjian, Hagop; Estrov, Zeev

    2014-01-01

    Somatic mutations in cancer cell genes are classified according to their functional significance. Those that provide the malignant cells with significant advantage are collectively referred to as driver mutations and those that do not, are the passenger mutations. Accordingly, analytical criteria to distinguish driver mutations from passenger mutations have been recently suggested. Recent studies revealed mutations in interleukin-7 receptor-α (IL7R) gene in 10% of pediatric T-cell acute lymphoblastic leukemia (T-ALL) patients and in only a few cases of pediatric B-ALL. IL7R mutations are also frequently found in patients with lung cancer, but whereas in pediatric T-ALL IL7R mutations are “drivers” (consisting of gain-of-function mutations within a narrow 50-base pair interval at exon 6 that confer cytokine-independent cell growth and promote tumor transformation), in lung cancer, mutations are substitution mutations randomly distributed across the gene and are probably only “passenger” events. Because the treatment response of adult T-ALL is significantly poorer than that of childhood T-ALL and because exon 6 IL7R mutations play a role in the pathogenesis of childhood T-ALL, we sought to determine how the pattern of IL7R mutations varies between adult and childhood T-ALL. To that end, we sequenced the 50-base pair interval in exon 6 of the IL7R of DNA obtained from bone marrow samples of 35 randomly selected adult patients with T-ALL. Our analysis revealed that none of these 35 samples carried an IL7R mutation in exon 6. Whether differences in the genetic makeup of adult and childhood T-ALL explain the differential response to therapy remains to be determined

  20. Genetic study of the PAH locus in the Iranian population: familial gene mutations and minihaplotypes.

    Science.gov (United States)

    Razipour, Masoumeh; Alavinejad, Elaheh; Sajedi, Seyede Zahra; Talebi, Saeed; Entezam, Mona; Mohajer, Neda; Kazemi-Sefat, Golnaz-Ensieh; Gharesouran, Jalal; Setoodeh, Aria; Mohaddes Ardebili, Seyyed Mojtaba; Keramatipour, Mohammad

    2017-10-01

    Phenylketonuria (PKU), one of the most common inborn errors of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene (PAH). PKU has wide allelic heterogeneity, and over 600 different disease-causing mutations in PAH have been detected to date. Up to now, there have been no reports on the minihaplotype (VNTR/STR) analysis of PAH locus in the Iranian population. The aims of the present study were to determine PAH mutations and minihaplotypes in Iranian families with PAH deficiency and to investigate the correlation between them. A total of 81 Iranian families with PAH deficiency were examined using PCR-sequencing of all 13 PAH exons and their flanking intron regions to identify sequence variations. Fragment analysis of the PAH minihaplotypes was performed by capillary electrophoresis for 59 families. In our study, 33 different mutations were found accounting for 95% of the total mutant alleles. The majority of these mutations (72%) were distributed across exons 7, 11, 2 and their flanking intronic regions. Mutation c.1066-11G > A was the most common with a frequency of 20.37%. The less frequent mutations, p.Arg261Gln (8%), p.Arg243Ter (7.4%), p.Leu48Ser (7.4%), p.Lys363Asnfs*37 (6.79%), c.969 + 5G > A (6.17%), p.Pro281Leu (5.56), c.168 + 5G > C (5.56), and p.Arg261Ter (4.94) together comprised about 52% of all mutant alleles. In this study, a total of seventeen PAH gene minihaplotypes were detected, six of which associated exclusively with particular mutations. Our findings indicate a broad PAH mutation spectrum in the Iranian population, which is consistent with previous studies reporting a wide range of PAH mutations, most likely due to ethnic heterogeneity. High prevalence of c.1066-11G > A mutation linked to minihaplotype 7/250 among both Iranian and Mediterranean populations is indicative of historical and geographical links between them. Also, strong association between particular mutations and minihaplotypes

  1. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    Science.gov (United States)

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  2. Usefulness of BCOR gene mutation as a prognostic factor in acute myeloid leukemia with intermediate cytogenetic prognosis.

    Science.gov (United States)

    Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Saito, Riho; Furuta, Yutaka; Miyadera, Keiki; Tokura, Taichiro; Marumo, Atushi; Omori, Ikuko; Sakaguchi, Masahiro; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Arai, Kunihito; Kitano, Tomoaki; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti

    2018-04-16

    BCOR gene is a transcription regulatory factor that plays an essential role in normal hematopoiesis. The wider introduction of next-generation sequencing technology has led to reports in recent years of mutations in the BCOR gene in acute myeloid leukemia (AML), but the related clinical characteristics and prognosis are not sufficiently understood. We investigated the clinical characteristics and prognosis of 377 de novo AML cases with BCOR or BCORL1 mutation. BCOR or BCORL1 gene mutations were found in 28 cases (7.4%). Among cases aged 65 years or below that were also FLT3-ITD-negative and in the intermediate cytogenetic prognosis group, BCOR or BCORL1 gene mutations were observed in 11% of cases (12 of 111 cases), and this group had significantly lower 5-year overall survival (OS) (13.6% vs. 55.0%, P=0.0021) and relapse-free survival (RFS) (14.3% vs. 44.5%, P=0.0168) compared to cases without BCOR or BCORL1 gene mutations. Multivariate analysis demonstrated that BCOR mutations were an independent unfavorable prognostic factor (P=0.0038, P=0.0463) for both OS and RFS. In cases of AML that are FLT3-ITD-negative, aged 65 years or below, and in the intermediate cytogenetic prognosis group, which are considered to have relatively favorable prognosis, BCOR gene mutations appear to be an important prognostic factor. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  3. Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy.

    Science.gov (United States)

    Maugeri, A; Klevering, B J; Rohrschneider, K; Blankenagel, A; Brunner, H G; Deutman, A F; Hoyng, C B; Cremers, F P

    2000-10-01

    The photoreceptor cell-specific ATP-binding cassette transporter gene (ABCA4; previously denoted "ABCR") is mutated, in most patients, with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients from Germany and The Netherlands with isolated CRD. Single-strand conformation-polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans.

  4. Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

    Directory of Open Access Journals (Sweden)

    Li Ma

    2013-08-01

    Full Text Available AIM: To screen mutations in the retinitis pigmentosa 1 (RP1 gene and the rhodopsin (RHO gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800 and one non-coding variant (rs56340615 were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

  5. Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento.

    Science.gov (United States)

    Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

    2013-01-01

    To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

  6. Preoperative RAS Mutational Analysis Is of Great Value in Predicting Follicular Variant of Papillary Thyroid Carcinoma

    Directory of Open Access Journals (Sweden)

    Tae Sook Hwang

    2015-01-01

    Full Text Available Follicular variant of papillary thyroid carcinoma (FVPTC, particularly the encapsulated subtype, often causes a diagnostic dilemma. We reconfirmed the molecular profiles in a large number of FVPTCs and investigated the efficacy of the preoperative mutational analysis in indeterminate thyroid nodules. BRAF V600E/K601E and RAS mutational analysis was performed on 187 FVPTCs. Of these, 132 (70.6% had a point mutation in one of the BRAF V600E (n=57, BRAF K601E (n=11, or RAS (n=64 genes. All mutations were mutually exclusive. The most common RAS mutations were at NRAS codon 61. FNA aspirates from 564 indeterminate nodules were prospectively tested for BRAF and RAS mutation and the surgical outcome was correlated with the mutational status. Fifty-seven and 47 cases were positive for BRAF and RAS mutation, respectively. Twenty-seven RAS-positive patients underwent surgery and all except one patient had FVPTC. The PPV and accuracy of RAS mutational analysis for predicting FVPTC were 96% and 84%, respectively. BRAF or RAS mutations were present in more than two-thirds of FVPTCs and these were mutually exclusive. BRAF mutational analysis followed by N, H, and KRAS codon 61 mutational analysis in indeterminate thyroid nodules would streamline the management of patients with malignancies, mostly FVPTC.

  7. Dysplastic spondylolysis is caused by mutations in the diastrophic dysplasia sulfate transporter gene.

    Science.gov (United States)

    Cai, Tao; Yang, Liu; Cai, Wanshi; Guo, Sen; Yu, Ping; Li, Jinchen; Hu, Xueyu; Yan, Ming; Shao, Qianzhi; Jin, Yan; Sun, Zhong Sheng; Luo, Zhuo-Jing

    2015-06-30

    Spondylolysis is a fracture in part of the vertebra with a reported prevalence of about 3-6% in the general population. Genetic etiology of this disorder remains unknown. The present study was aimed at identifying genomic mutations in patients with dysplastic spondylolysis as well as the potential pathogenesis of the abnormalities. Whole-exome sequencing and functional analysis were performed for patients with spondylolysis. We identified a novel heterozygous mutation (c.2286A > T; p.D673V) in the sulfate transporter gene SLC26A2 in five affected subjects of a Chinese family. Two additional mutations (e.g., c.1922A > G; p.H641R and g.18654T > C in the intron 1) in the gene were identified by screening a cohort of 30 unrelated patients with the disease. In situ hybridization analysis showed that SLC26A2 is abundantly expressed in the lumbosacral spine of the mouse embryo at day 14.5. Sulfate uptake activities in CHO cells transfected with mutant SLC26A2 were dramatically reduced compared with the wild type, confirming the pathogenicity of the two missense mutations. Further analysis of the gene-disease network revealed a convergent pathogenic network for the development of lumbosacral spine. To our knowledge, our findings provide the first identification of autosomal dominant SLC26A2 mutations in patients with dysplastic spondylolysis, suggesting a new clinical entity in the pathogenesis of chondrodysplasia involving lumbosacral spine. The analysis of the gene-disease network may shed new light on the study of patients with dysplastic spondylolysis and spondylolisthesis as well as high-risk individuals who are asymptomatic.

  8. p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

    International Nuclear Information System (INIS)

    Ikehata, Hironobu

    1998-01-01

    Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

  9. [Clinical features and COMP gene mutation in a family with a pseudoachondroplasia child].

    Science.gov (United States)

    Lu, Chun-Ting; Guo, Li; Zahng, Zhan-Hui; Lin, Wei-Xia; Song, Yuan-Zong; Feng, Lie

    2013-11-01

    This study aimed to report the clinical characteristics and COMP gene mutation of a family with pseudoachondroplasia (PSACH), a relatively rare spinal and epiphyseal dysplasia that is inherited as an autosomal dominant trait. Clinical information on a 5-year-2-month-old PSACH child and his parents was collected and analyzed. Diagnosis was confirmed by PCR amplification and direct sequencing of all the 19 exons and their flanking sequences of COMP gene, and the mutation was further ascertained by cloning analysis of exon 10. The child presented with short and stubby fingers, bow leg, short limb dwarfism and metaphysic broadening in long bone as well as lumbar lordosis. A mutation c.1048_1116del (p.Asn350_Asp372del) in exon 10, inherited from his father who did not demonstrate any phenotypic feature of PSACH, was detected in the child. PSACH was diagnosed definitively by means of COMP mutation analysis, on the basis of the child's clinical and imaging features. The non-penetrance phenomenon of COMP mutation was described for the first time in PSACH.

  10. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  11. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  12. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  13. Clinical significance of FLG gene mutations in children with atopic dermatitis

    Directory of Open Access Journals (Sweden)

    E. E. Varlamov

    2015-01-01

    Full Text Available Skin barrier dysfunction due to deficiency of the skin protein filaggrin is one of the factors involved in the pathogenesis of atopic dermatitis. Objective: to determine the clinical significance of 2282 del CAGT, R501X, R2447X, and S3247X mutations in the FLG gene in children with atopic dermatitis. The investigation included 58 children with atopic dermatitis. A molecular genetic analysis of the four mutations in the FLG gene was done in all the children. In the patients with FLG gene mutations, there was a tendency towards a higher frequency of sensitization to house dust allergens, significantly more often sensitization to cat epidermal allergen, and significantly higher levels of specific IgE to the cat epidermis. Conclusion. Mutations in the FLG gene encoding the protein filaggrin raise the risk for sensitization to domestic and epidermal allergens and, in case of already existing sensitization to the cat epidermis, the patients are found with a high degree of probability to have the high concentration of specific IgE to this allergen. The above fact justifies the need to place special emphasis on measures to eliminate house dust allergens, and cat epidermis allergen in particular, and to personalize approaches to therapy and prevention of atopic dermatitis in children. 

  14. Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

    Science.gov (United States)

    Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

    2017-01-01

    Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

  15. A single point-mutation within the melanophilin gene causes the lavender plumage colour dilution phenotype in the chicken

    Directory of Open Access Journals (Sweden)

    Tixier-Boichard Michèle

    2008-01-01

    Full Text Available Abstract Background The lavender phenotype in the chicken causes the dilution of both black (eumelanin and red/brown (phaeomelanin pigments. Defects in three genes involved in intracellular melanosomal transport, previously described in mammals, give rise to similar diluted pigmentation phenotypes as those seen in lavender chickens. Results We have used a candidate-gene approach based on an expectation of homology with mammals to isolate a gene involved in pigmentation in chicken. Comparative sequence analysis of candidate genes in the chicken identified a strong association between a mutation in the MLPH gene and the diluted pigmentation phenotype. This mutation results in the amino acid change R35W, at a site also associated with similar phenotypes in mice, humans and cats. Conclusion This is the first time that an avian species with a mutation in the MLPH gene has been reported.

  16. Mutations of the phenylalanine hydroxylase gene in patients with phenylketonuria in Shanxi, China

    Directory of Open Access Journals (Sweden)

    Yong-An Zhou

    2012-01-01

    Full Text Available The variation in mutations in exons 3, 6, 7, 11 and 12 of the phenylalanine hydroxylase (PAH gene was investigated in 59 children with phenylketonuria (PKU and 100 normal children. Three single nucleotide polymorphisms were detected by sequence analysis. The mutational frequencies of cDNA 696, cDNA 735 and cDNA 1155 in patients were 96.2%, 76.1% and 7.6%, respectively, whereas in healthy children the corresponding frequencies were 97.0%, 77.3% and 8.3%. In addition, 81 mutations accounted for 61.0% of the mutant alleles. R111X, H64 > TfsX9 and S70 del accounted for 5.1%, 0.8% and 0.8% mutation of alleles in exon 3, whereas EX6-96A > G accounted for 10.2% mutation of alleles in exon 6. R243Q had the highest incidence in exon 7 (12.7%, followed by Ivs7 +2T>A (5.1% and T278I (2.5%. G247V, R252Q, L255S, R261Q and E280K accounted for 0.8% while Y356X and V399V accounted for 5.9% and 5.1%, respectively, in exon 11. R413P and A434D accounted for 5.9% and 2.5%, respectively, in exon 12. Seventy-two variant alleles accounted for the 16 mutations observed here. The mutation characteristics and distributions demonstrated that EX6-96A > G and R243Q were the hot regions for mutations in the PAH gene in Shanxi patients with PKU.

  17. Splicing aberrations caused by constitutional RB1 gene mutations in ...

    Indian Academy of Sciences (India)

    in this family revealed skipping of exon 22 in three members of this family. In one proband, a ... This study reveals novel effects of RB1 mutations on splicing and suggests the utility of RNA analysis as an ... of life) and presence of multiple tumors (multifocal). The ..... spliced RNA have been linked to parent of origin as well as.

  18. Identification and functional analysis of three distinct mutations in the human galactose-1-phosphate uridyltransferase gene associated with galactosemia in a single family

    Energy Technology Data Exchange (ETDEWEB)

    Fridovich-Keil, J.L.; Langley, S.D.; Mazur, L.A.; Lennon, J.C.; Dembure, P.O.; Elsas, L.J. II [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1995-03-01

    We have identified three mutations associated with transferase-deficiency galactosemia in a three-generation family including affected members in two generations and have modeled all three mutations in a yeast-expression system. A sequence of pedigree, biochemical, and molecular analyses of the galactose-1-phosphate uridyltransferase (GALT) enzyme and genetic locus in both affected and carrier individuals revealed three distinct base substitutions in this family, two (Q188R and S135L) that had been reported previously and one (V151A) that was novel. Biochemical analyses of red-blood-cell lysates from the relevant family members suggested that each of these mutations was associated with dramatic impairment of GALT activity in these cells. While this observation was consistent with our previous findings concerning the Q188R mutation expressed both in humans and in a yeast-model system, it was at odds with a report by Reichardt and colleagues, indicating that in their COS cell-expression system the S135L substitution behaved as a neutral polymorphism. To address this apparent paradox, as well as to investigate the functional significance of the newly identified V151A substitution, all three mutations were recreated by site-directed mutagenesis of the otherwise wild-type human GALT sequence and were expressed both individually and in the appropriate allelic combinations in a GALT-deficient strain of the yeast Saccharomyces cerevisiae. The results of these yeast-modeling studies were fully consistent with the patient data, leading us to conclude that, at least within the context of the cell types studied, in the homozygous state Q188R is a mutation that eliminates GALT activity, and S135L and V151A are both mutations that impair GALT activity to <6% of wild-type values. 22 refs., 5 figs.

  19. Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6 causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

    Directory of Open Access Journals (Sweden)

    Takao Sasado

    Full Text Available Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68. CPSF6 is a component of the Cleavage Factor Im complex (CFIm which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

  20. Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

    Science.gov (United States)

    Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

    2017-01-01

    Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

  1. NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

    Science.gov (United States)

    Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

    2003-01-01

    The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

  2. Optimal control of gene mutation in DNA replication.

    Science.gov (United States)

    Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong

    2012-01-01

    We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.

  3. [The audiological analysis in the patients homozygous for the c.-23+1G>A mutation in the GJB2 gene presenting with the loss of hearing in Yakutiya].

    Science.gov (United States)

    Teryutin, F M; Barashkov, N A; Kunel'skaya, N L; Pshennikova, V G; Solov'ev, A V

    2016-01-01

    In the course of previous investigations carried out in the Republic of Sakha (Yakutiya), we have identified the main molecular-genetic factor responsible for the hereditary impairment of hearing among the indigenous population (mostly the Yakuts).The disease was shown to be attributable to the c.-23+1G>A mutation localized in the splice donor site (exon 1) of the GJB2 (Cx26) gene. The present study involved the comprehensive audiological analysis of the patients homozygous for the c.-23+1G>A mutation in the GJB2 gene based on the results of the study of a large sample of the patients residing in Yakutiya. All individuals with the GJB2 genotype c.-23+1G>A/c.-23-1G>A (n=108) at the mean age of 14.32±4.7 years (all ethnic Yakuts)were examined with the use oftonal threshold audiometry for air conduction testing at the frequencies of 0.25, 0.5, 1.0, 2.0, 4.0, and 8.0 kHz and bone conduction testing at the frequencies of 0.25, 0.5, 1.0, and 4.0 with a step of 5.0 dB.The results of the ASSR test were used whenever tonal threshold audiometry proved impracticable The data obtained in the study characterize the allelic form of the disease associated with the GJB2 genotype c.-23+1G>A/c.-23-1G>A as the congenital bilateral symmetric (90.1%), sensorineural (90.1%) form of hearing impairment of variable severity (from grade 1 to complete deafness) with the «flat» audiological profile (median slope not more than 5.0 dB in the extended frequency range (EFR) of 0.5, 1.0, 2.0, and 4.0, kHz). It is concluded that the results of the audiological analysis performed in the present study give evidence of relatively homogeneous but variable in terms of severity impairment of hearing in the patients homozygous for the c.-23+1G>A mutation in the GJB2 (Cx26) gene. It may serve as a positive prognostic sign to be used in the development and prescription of hearing aids.

  4. Novel compound heterozygous mutations in MYO7A gene associated with autosomal recessive sensorineural hearing loss in a Chinese family.

    Science.gov (United States)

    Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo

    2016-04-01

    Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  6. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    Science.gov (United States)

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Hanefeld variants of RTT and 2 with early-onset epileptic encephalopathy in 71 girls as well as for 1 infantile spasms in 31 males. There are some differences in the phenotypes among genders with CDKL5 gene mutations and CDKL5 gene mutation analysis should be considered in both genders.

  7. Ala397Asp mutation of myosin VIIA gene segregating in a Spanish family with type-Ib Usher syndrome.

    Science.gov (United States)

    Espinós, C; Millán, J M; Sánchez, F; Beneyto, M; Nájera, C

    1998-06-01

    In the current study, 12 Spanish families affected by type-I Usher syndrome, that was previously linked to chromosome 11q, were screened for the presence of mutations in the N-terminal coding portion of the motor domain of the myosin VIIA gene by single-strand conformation polymorphism analysis of the first 14 exons. A mutation (Ala397Asp) segregating with the disease was identified, and several polymorphisms were also detected. It is presumed that the other USHIB mutations in these families could be located in the unscreened regions of the gene.

  8. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  9. A high-throughput protocol for mutation scanning of the BRCA1 and BRCA2 genes

    International Nuclear Information System (INIS)

    Hondow, Heather L; Fox, Stephen B; Mitchell, Gillian; Scott, Rodney J; Beshay, Victoria; Wong, Stephen Q; Dobrovic, Alexander

    2011-01-01

    Detection of mutations by DNA sequencing can be facilitated by scanning methods to identify amplicons which may have mutations. Current scanning methods used for the detection of germline sequence variants are laborious as they require post-PCR manipulation. High resolution melting (HRM) is a cost-effective rapid screening strategy, which readily detects heterozygous variants by melting curve analysis of PCR products. It is well suited to screening genes such as BRCA1 and BRCA2 as germline pathogenic mutations in these genes are always heterozygous. Assays for the analysis of all coding regions and intron-exon boundaries of BRCA1 and BRCA2 were designed, and optimised. A final set of 94 assays which ran under identical amplification conditions were chosen for BRCA1 (36) and BRCA2 (58). Significant attention was placed on primer design to enable reproducible detection of mutations within the amplicon while minimising unnecessary detection of polymorphisms. Deoxyinosine residues were incorporated into primers that overlay intronic polymorphisms. Multiple 384 well plates were used to facilitate high throughput. 169 BRCA1 and 239 BRCA2 known sequence variants were used to test the amplicons. We also performed an extensive blinded validation of the protocol with 384 separate patient DNAs. All heterozygous variants were detected with the optimised assays. This is the first HRM approach to screen the entire coding region of the BRCA1 and BRCA2 genes using one set of reaction conditions in a multi plate 384 well format using specifically designed primers. The parallel screening of a relatively large number of samples enables better detection of sequence variants. HRM has the advantages of decreasing the necessary sequencing by more than 90%. This markedly reduced cost of sequencing will result in BRCA1 and BRCA2 mutation testing becoming accessible to individuals who currently do not undergo mutation testing because of the significant costs involved

  10. Mutational pattern of the nurse shark antigen receptor gene (NAR) is similar to that of mammalian Ig genes and to spontaneous mutations in evolution: the translesion synthesis model of somatic hypermutation.

    Science.gov (United States)

    Diaz, M; Velez, J; Singh, M; Cerny, J; Flajnik, M F

    1999-05-01

    The pattern of somatic mutations of shark and frog Ig is distinct from somatic hypermutation of Ig in mammals in that there is a bias to mutate GC base pairs and a low frequency of mutations. Previous analysis of the new antigen receptor gene in nurse sharks (NAR), however, revealed no bias to mutate GC base pairs and the frequency of mutation was comparable to that of mammalian IgG. Here, we analyzed 1023 mutations in NAR and found no targeting of the mechanism to any particular nucleotide but did obtain strong evidence for a transition bias and for strand polarity. As seen for all species studied to date, the serine codon AGC/T in NAR was a mutational hotspot. The NAR mutational pattern is most similar to that of mammalian IgG and furthermore both are strikingly akin to mutations acquired during the neutral evolution of nuclear pseudogenes, suggesting that a similar mechanism is at work for both processes. In yeast, most spontaneous mutations are introduced by the translesion synthesis DNA polymerase zeta (REV3) and in various DNA repair-deficient backgrounds transitions were more often REV3-dependent than were transversions. Therefore, we propose a model of somatic hypermutation where DNA polymerase zeta is recruited to the Ig locus. An excess of DNA glycosylases in germinal center reactions may further enhance the mutation frequency by a REV3-dependent mutagenic process known as imbalanced base excision repair.

  11. Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

    Science.gov (United States)

    Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

    2016-10-01

    Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

  12. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Science.gov (United States)

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  13. Mutational screening of CHX10, GDF6, OTX2, RAX and SOX2 genes in 50 unrelated microphthalmia-anophthalmia-coloboma (MAC) spectrum cases.

    Science.gov (United States)

    Gonzalez-Rodriguez, J; Pelcastre, E L; Tovilla-Canales, J L; Garcia-Ortiz, J E; Amato-Almanza, M; Villanueva-Mendoza, C; Espinosa-Mattar, Z; Zenteno, J C

    2010-08-01

    Microphthalmia-anophthalmia-coloboma (MAC) are congenital eye malformations causing a significant percentage of visually impairments in children. Although these anomalies can arise from prenatal exposure to teratogens, mutations in well-defined genes originate potentially heritable forms of MAC. Mutations in genes such as CHX10, GDF6, RAX, SOX2 and OTX2, among others, have been recognised in dominant or recessive MAC. SOX2 and OTX2 are the two most commonly mutated genes in monogenic MAC. However, as more numerous samples of MAC subjects would be analysed, a better estimation of the actual involvement of specific MAC-genes could be made. Here, a comprehensive mutational analysis of the CHX10, GDF6, RAX, SOX2 and OTX2 genes was performed in 50 MAC subjects. PCR amplification and direct automated DNA sequencing of all five genes in 50 unrelated subjects. Eight mutations (16% prevalence) were recognised, including four GDF6 mutations (one novel), two novel RAX mutations, one novel OTX2 mutation and one SOX2 mutation. Anophthalmia and nanophthalmia, not previously associated with GDF6 mutations, were observed in two subjects carrying defects in this gene, expanding the spectrum of GDF6-linked ocular anomalies. Our study underscores the importance of genotyping large groups of patients from distinct ethnic origins for improving the estimation of the global involvement of particular MAC-causing genes.

  14. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

  16. BESTROPHINOPATHY: A Spectrum of Ocular Abnormalities Caused by the c.614T>C Mutation in the BEST1 Gene

    NARCIS (Netherlands)

    Toto, L.; Boon, C.J.F.; Antonio, L. Di; Parodi, M. Battaglia; Mastropasqua, R.; Antonucci, I.; Stuppia, L.; Mastropasqua, L.

    2016-01-01

    PURPOSE: To describe the variable ocular phenotype associated with a heterozygous mutation in the BEST1 gene. METHODS: Clinical and genetic assessment was performed in five members of the same family. Molecular genetic analysis of the BEST1 gene was performed by direct sequencing. Extensive

  17. Recurrently Mutated Genes Differ between Leptomeningeal and Solid Lung Cancer Brain Metastases.

    Science.gov (United States)

    Li, Yingmei; Liu, Boxiang; Connolly, Ian David; Kakusa, Bina Wasunga; Pan, Wenying; Nagpal, Seema; Montgomery, Stephen B; Hayden Gephart, Melanie

    2018-03-29

    When compared with solid brain metastases from NSCLC, leptomeningeal disease (LMD) has unique growth patterns and is rapidly fatal. Patients with LMD do not undergo surgical resection, limiting the tissue available for scientific research. In this study we performed whole exome sequencing on eight samples of LMD to identify somatic mutations and compared the results with those for 26 solid brain metastases. We found that taste 2 receptor member 31 gene (TAS2R31) and phosphodiesterase 4D interacting protein gene (PDE4DIP) were recurrently mutated among LMD samples, suggesting involvement in LMD progression. Together with a retrospective review of the charts of an additional 44 patients with NSCLC LMD, we discovered a surprisingly low number of KRAS mutations (n = 4 [7.7%]) but a high number of EGFR mutations (n = 33 [63.5%]). The median interval for development of LMD from NSCLC was shorter in patients with mutant EGFR (16.3 months) than in patients with wild-type EGFR (23.9 months) (p = 0.017). Targeted analysis of recurrent mutations thus presents a useful complement to the existing diagnostic tool kit, and correlations of EGFR in LMD and KRAS in solid metastases suggest that molecular distinctions or systemic treatment pressure underpin the differences in growth patterns within the brain. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  18. Mutations in rpoB and katG genes in Mycobacterium isolates from the Southeast of Mexico

    Directory of Open Access Journals (Sweden)

    R Zenteno-Cuevas

    2009-05-01

    Full Text Available The most frequent mutations associated with rifampin and isoniazid resistance in Mycobacterium are the substitutions at codons 531 and 315 in the rpoB and katG genes, respectively. Hence, the aim of this study was to characterize these mutations in Mycobacterium isolates from patients suspected to be infected with drug-resistant (DR pulmonary tuberculosis (TB in Veracruz, Mexico. Drug susceptibility testing of 25 clinical isolates revealed that five were susceptible while 20 (80% were DR (15% of the annual prevalence for Veracruz. Of the DR isolates, 15 (75% were resistant to rifampin, 17 (85% to isoniazid and 15 (75% were resistant to both drugs (MDR. Sequencing analysis performed in the isolates showed that 14 (93% had mutations in the rpoB gene; seven of these (47% exhibited a mutation at 531 (S[L. Ten (58% of the 20 resistant isolates showed mutations in katG; nine (52% of these 10 exhibited a mutation at 315 (S[T. In conclusion, the DR profile of the isolates suggests a significant number of different DR-TB strains with a low frequency of mutation at codons 531 and 315 in rpoB and katG, respectively. This result leads us to consider different regions of the same genes, as well as other genes for further analysis, which is important if a genetic-based diagnosis of DR-TB is to be developed for this region.

  19. the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

    International Nuclear Information System (INIS)

    Abass, M.M.E.

    2004-01-01

    β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

  20. Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

    Directory of Open Access Journals (Sweden)

    Hashishe Mervat M

    2010-06-01

    Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

  1. A Classic Case of Maple Syrup Urine Disease and a Novel Mutation in the BCKDHA Gene

    Directory of Open Access Journals (Sweden)

    Alieh Mirzaee

    2017-09-01

    Full Text Available Background: Maple syrup urine disease (MSUD is an inherited branched-chain amino acid metabolic disorder caused by the deficiency in the branched-chain alpha-keto acid dehydrogenase (BCKD complex. In MSUD, elevation of the branched-chain amino acids, such as alpha-keto acid and alpha-hydroxy acid, occurs due to the BCKDC gene deficiency, appearing in the blood, urine, and cerebrospinal fluid, which leads to neurological damage and mental retardation. MSUD phenotypically penetrates due to the mutations in the coding genes of four subunits of the BCKD complex, including the BCKDHA, BCKDHB, DBT, and DLD genes.Case report: We aimed to report the cases of three families whose children were affected by MSUD and presented with symptomatic features during the first week of birth, which were identified by mass spectrometry. DNA study was performed as a diagnosis panel containing four encoded BCKDC subunit genes.Conclusion: In the current study, DNA analysis and phenotypic manifestations indicated a novel mutation of c.143delT, p.L48Rfs*15 in the BCKDHA gene in a homozygous state, which is a causative mutation for the classic MSUD phenotype. Early diagnosis and neonatal screening are recommended for the accurate and effective treatment of this disease

  2. The origin of the p.E180 growth hormone receptor gene mutation.

    Science.gov (United States)

    Ostrer, Harry

    2016-06-01

    Laron syndrome, an autosomal recessive condition of extreme short stature, is caused by the absence or dysfunction of the growth hormone receptor. A recurrent mutation in the GHR gene, p.E180, did not alter the encoded amino acid, but activated a cryptic splice acceptor resulting in a receptor protein with an 8-amino acid deletion in the extracellular domain. This mutation has been observed among Sephardic Jews and among individuals in Ecuador, Brazil and Chile, most notably in a large genetic isolate in Loja, Ecuador. A common origin has been postulated based on a shared genetic background of markers flanking this mutation, suggesting that the Lojanos (and others) may have Sephardic (Converso) Jewish ancestry. Analysis of the population structure of Lojanos based on genome-wide analysis demonstrated European, Sephardic Jewish and Native American ancestry in this group. X-autosomal comparison and monoallelic Y chromosomal and mitochondrial genetic analysis demonstrated gender-biased admixture between Native American women and European and Sephardic Jewish men. These findings are compatible with the co-occurrence of the Inquisition and the colonization of the Americas, including Converso Jews escaping the Inquisition in the Iberian Peninsula. Although not found among Lojanos, Converso Jews also brought founder mutations to contemporary Hispanic and Latino populations in the BRCA1 (c.68_69delAG) and BLM (c.2207_2212delATCTGAinsTAGATTC) genes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Epidural Analgesia with Ropivacaine during Labour in a Patient with a SCN5A Gene Mutation

    Directory of Open Access Journals (Sweden)

    A. L. M. J. van der Knijff-van Dortmont

    2016-01-01

    Full Text Available SCN5A gene mutations can lead to ion channel defects which can cause cardiac conduction disturbances. In the presence of specific ECG characteristics, this mutation is called Brugada syndrome. Many drugs are associated with adverse events, making anesthesia in patients with SCN5A gene mutations or Brugada syndrome challenging. In this case report, we describe a pregnant patient with this mutation who received epidural analgesia using low dose ropivacaine and sufentanil during labour.

  4. Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis

    OpenAIRE

    Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard

    2014-01-01

    Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...

  5. Dysmorphic Facial Features and Other Clinical Characteristics in Two Patients with PEX1 Gene Mutations

    Science.gov (United States)

    Gunduz, Mehmet

    2016-01-01

    Peroxisomal disorders are a group of genetically heterogeneous metabolic diseases related to dysfunction of peroxisomes. Dysmorphic features, neurological abnormalities, and hepatic dysfunction can be presenting signs of peroxisomal disorders. Here we presented dysmorphic facial features and other clinical characteristics in two patients with PEX1 gene mutation. Follow-up periods were 3.5 years and 1 year in the patients. Case I was one-year-old girl that presented with neurodevelopmental delay, hepatomegaly, bilateral hearing loss, and visual problems. Ophthalmologic examination suggested septooptic dysplasia. Cranial magnetic resonance imaging (MRI) showed nonspecific gliosis at subcortical and periventricular deep white matter. Case II was 2.5-year-old girl referred for investigation of global developmental delay and elevated liver enzymes. Ophthalmologic examination findings were consistent with bilateral nystagmus and retinitis pigmentosa. Cranial MRI was normal. Dysmorphic facial features including broad nasal root, low set ears, downward slanting eyes, downward slanting eyebrows, and epichantal folds were common findings in two patients. Molecular genetic analysis indicated homozygous novel IVS1-2A>G mutation in Case I and homozygous p.G843D (c.2528G>A) mutation in Case II in the PEX1 gene. Clinical findings and developmental prognosis vary in PEX1 gene mutation. Kabuki-like phenotype associated with liver pathology may indicate Zellweger spectrum disorders (ZSD). PMID:27882258

  6. Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene

    Energy Technology Data Exchange (ETDEWEB)

    Goltsov, A.A.; Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States)); Konecki, D.S.; Lichter-Konecki, U.

    1992-09-01

    The HindIII RFLP in the human phenylalanine hydroxylase (PAH) gene is caused by the presence of an AT-rich (70%) minisatellite region. This region contains various multiples of 30-bp tandem repeats and is located 3 kb downstream of the final exon of the gene. PCR-mediated amplification of this region from haplotyped PAH chromosomes indicates that the previously reported 4.0-kb HindIII allele contains three of these repeats, while the 4.4-kb HindIII allele contains 12 of these repeats. The 4.2-kb HindIII fragment can contain six, seven, eight, or nine copies of this repeat. These variations permit more detailed analysis of mutant haplotypes 1, 5, 6, and, possibly, others. Kindred analysis in phenylketonuria families demonstrates Mendelian segregation of these VNTR alleles, as well as associations between theses alleles and certain PAH mutations. The R261Q mutation, associated with haplotype 1, is associated almost exclusively with an allele containing eight repeats; the R408W mutation, when occurring on a haplotype 1 background, may also be associated with the eight-repeat VNTR allele. Other PAH mutations associated with haplotype 1, R252W and P281L, do not appear to segregate with specific VNTR alleles. The IVS-10 mutation, when associated with haplotype 6, is associated exclusively with an allele containing seven repeats. The combined use of this VNTR system and the existing RFLP haplotype system will increase the performance of prenatal diagnostic tests based on haplotype analysis. In addition, this VNTR may prove useful in studies concerning the origins and distributions of PAH mutations in different human populations. 32 refs., 3 figs., 3 tabs.