[FANCA gene mutation analysis in Fanconi anemia patients].
Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo
2005-10-01
To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.
Mutational analysis of the HGO gene in Finnish alkaptonuria patients
de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.
1999-01-01
Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently. Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer
Directory of Open Access Journals (Sweden)
Maija Wolf
2005-01-01
Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.
Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.
Kim, Myeong Hee; Kang, So Young; Lee, Woo In
2017-05-01
The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017
Analysis of gene mutations in children with cholestasis of undefined etiology.
Matte, Ursula; Mourya, Reena; Miethke, Alexander; Liu, Cong; Kauffmann, Gregory; Moyer, Katie; Zhang, Kejian; Bezerra, Jorge A
2010-10-01
The discovery of genetic mutations in children with inherited syndromes of intrahepatic cholestasis allows for diagnostic specificity despite similar clinical phenotypes. Here, we aimed to determine whether mutation screening of target genes could assign a molecular diagnosis in children with idiopathic cholestasis. DNA samples were obtained from 51 subjects with cholestasis of undefined etiology and surveyed for mutations in the genes SERPINA1, JAG1, ATP8B1, ABCB11, and ABCB4 by a high-throughput gene chip. Then, the sequence readouts for all 5 genes were analyzed for mutations and correlated with clinical phenotypes. Healthy subjects served as controls. Sequence analysis of the genes identified 14 (or 27%) subjects with missense, nonsense, deletion, and splice site variants associated with disease phenotypes based on the type of mutation and/or biallelic involvement in the JAG1, ATP8B1, ABCB11, or ABCB4 genes. These patients had no syndromic features and could not be differentiated by biochemical markers or histopathology. Among the remaining subjects, 10 (or ∼20%) had sequence variants in ATP8B1 or ABCB11 that involved only 1 allele, 8 had variants not likely to be associated with disease phenotypes, and 19 had no variants that changed amino acid composition. Gene sequence analysis assigned a molecular diagnosis in 27% of subjects with idiopathic cholestasis based on the presence of variants likely to cause disease phenotypes.
DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.
Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra
2006-02-01
Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.
GPR143 gene mutation analysis in pediatric patients with albinism.
Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej
2012-09-01
X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.
Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry
2013-01-01
Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.
Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E
2015-01-01
To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Analysis of mutations in the entire coding sequence of the factor VIII gene
Energy Technology Data Exchange (ETDEWEB)
Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others
1994-09-01
Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.
Hereditary cancer genes are highly susceptible to splicing mutations
Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.
2018-01-01
Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604
Hereditary cancer genes are highly susceptible to splicing mutations.
Directory of Open Access Journals (Sweden)
Christy L Rhine
2018-03-01
Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome
Directory of Open Access Journals (Sweden)
Chia-Sui Hung
2007-01-01
Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172
Application of DNA chips in the analysis of gene mutation in HBV
International Nuclear Information System (INIS)
Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min
2005-01-01
Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
Mutation scanning of peach floral genes
Directory of Open Access Journals (Sweden)
Wilde H Dayton
2011-05-01
Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.
Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection
Energy Technology Data Exchange (ETDEWEB)
Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)
1994-03-01
Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.
Mutation analysis of the NRXN1 gene in autism spectrum disorders
Directory of Open Access Journals (Sweden)
Onay H
2016-12-01
Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.
Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L
2017-10-01
Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.
[Analysis of gene mutation of early onset epileptic spasm with unknown reason].
Yang, X; Pan, G; Li, W H; Zhang, L M; Wu, B B; Wang, H J; Zhang, P; Zhou, S Z
2017-11-02
Objective: To summarize the gene mutation of early onset epileptic spasm with unknown reason. Method: In this prospective study, data of patients with early onset epileptic spasm with unknown reason were collected from neurological department of Children's Hospital of Fudan University between March 2016 and December 2016. Patients with known disorders such as infection, metabolic, structural, immunological problems and known genetic mutations were excluded. Patients with genetic disease that can be diagnosed by clinical manifestations and phenotypic characteristics were also excluded. Genetic research methods included nervous system panel containing 1 427 epilepsy genes, whole exome sequencing (WES), analysis of copy number variation (CNV) and karyotype analysis of chromosome. The basic information, phenotypes, genetic results and the antiepileptic treatment of patients were analyzed. Result: Nine of the 17 cases with early onset epileptic spasm were boys and eight were girls. Patients' age at first seizure onset ranged from 1 day after birth to 8 months (median age of 3 months). The first hospital visit age ranged from 1 month to 2 years (median age of 4.5 months). The time of following-up ranged from 8 months to 3 years and 10 months. All the 17 patients had early onset epileptic spasm. Video electroencephalogram was used to monitor the spasm seizure. Five patients had Ohtahara syndrome, 10 had West syndrome, two had unclear classification. In 17 cases, 10 of them had detected pathogenic genes. Nine cases had point mutations, involving SCN2A, ARX, UNC80, KCNQ2, and GABRB3. Except one case of mutations in GABRB3 gene have been reported, all the other cases had new mutations. One patient had deletion mutation in CDKL5 gene. One CNV case had 6q 22.31 5.5MB repeats. Ten cases out of 17 were using 2-3 antiepileptic drugs (AEDs) and the drugs had no effect. Seven cases used adrenocorticotropic hormone (ACTH) and prednisone besides AEDs (a total course for 8 weeks
Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.
Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung
2008-01-01
The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.
Khordadpoor-Deilamani, Faravareh; Akbari, Mohammad Taghi; Karimipoor, Morteza; Javadi, Gholamreza
2015-01-01
Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented eyes (in patients with ocular albinism) or hair, skin, and eyes (in individuals with oculocutaneous albinism). It is associated with decreased visual acuity, nystagmus, strabismus, and photophobia. The tyrosinase gene is known to be involved in both oculocutaneous albinism and autosomal recessive ocular albinism. In this study, we aimed to screen the mutations in the TYR gene in the nonsyndromic OCA and autosomal recessive ocular albinism patients from Iran. The tyrosinase gene was examined in 23 unrelated patients with autosomal recessive ocular albinism or nonsyndromic OCA using DNA sequencing and bioinformatics analysis. TYR gene mutations were identified in 14 (app. 60%) albinism patients. We found 10 mutations, 3 of which were novel. No mutation was found in our ocular albinism patients, but one of them was heterozygous for the p.R402Q polymorphism.
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Directory of Open Access Journals (Sweden)
Ahmed Bouhouche
2017-10-01
Full Text Available During the last two decades, 15 different genes have been reported to be responsible for the monogenic form of Parkinson’s disease (PD, representing a worldwide frequency of 5–10%. Among them, 10 genes have been associated with autosomal recessive PD, with PRKN and PINK1 being the most frequent. In a cohort of 145 unrelated Moroccan PD patients enrolled since 2013, 19 patients were born from a consanguineous marriage, of which 15 were isolated cases and 4 familial. One patient was homozygous for the common LRRK2 G2019S mutation and the 18 others who did not carry this mutation were screened for exon rearrangements in the PRKN gene using Affymetrix Cytoscan HD microarray. Two patients were determined homozygous for PRKN exon-deletions, while another patient presented with compound heterozygous inheritance (3/18, 17%. Two other patients showed a region of homozygosity covering the 1p36.12 locus and were sequenced for the candidate PINK1 gene, which revealed two homozygous point mutations: the known Q456X mutation in exon 7 and a novel L539F variation in exon 8. The 13 remaining patients were subjected to next-generation sequencing (NGS that targeted a panel of 22 PD-causing genes and overlapping phenotypes. NGS data showed that two unrelated consanguineous patients with juvenile-onset PD (12 and 13 years carried the same homozygous stop mutation W258X in the ATP13A2 gene, possibly resulting from a founder effect; and one patient with late onset (76 years carried a novel heterozygous frameshift mutation in SYNJ1. Clinical analysis showed that patients with the ATP13A2 mutation developed juvenile-onset PD with a severe phenotype, whereas patients having either PRKN or PINK1 mutations displayed early-onset PD with a relatively mild phenotype. By identifying pathogenic mutations in 45% (8/18 of our consanguineous Moroccan PD series, we demonstrate that the combination of chromosomal microarray analysis and NGS is a powerful approach to
The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis
Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.
2014-01-01
As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.
Mutational robustness of gene regulatory networks.
Directory of Open Access Journals (Sweden)
Aalt D J van Dijk
Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.
ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS
Directory of Open Access Journals (Sweden)
Amit Kumar Tiwari
2016-11-01
Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.
Analysis of mutations in the human HPRT gene induced by accelerated heavy-ion irradiation
International Nuclear Information System (INIS)
Kagawa, Yasuhiro; Yatagai, Fumio; Hanaoka, Fumio; Suzuki, Masao; Kase, Youko; Kobayashi, Akiko; Hirano, Masahiko; Kato, Takesi; Watanabe, Masami.
1995-01-01
Multiplex PCR analysis of HPRT(-) mutations in human embryo (HE) cells induced by 230 keV/μm carbon-ion irradiation showed no large deletion around the exon regions of the locus gene in contrast to the irradiations at different LETs. To identify these mutations, the sequence alterations in a cDNA of hprt gene were determined for 18 mutant clones in this study. Missing of exon 6 was the most frequent mutational event (10 clones), and missing of both exons 6 and 8 was next most frequent event (6 clones), then base substitutions (2 clones). These characteristics were not seen in a similar analysis of spontaneous mutations, which showed base substitution (5 clones), frameshift (2 clones), missing of both exons 2 and 3 (2 clones), and a single unidentified clone. Direct sequencing and restriction enzyme digestion of the genomic DNA of the mutants which showed missing of exons 6 and 8 in the cDNA, supports the possibility that they were induced by aberrant mRNA splicing. (author)
Mutation analysis of the STRA6 gene in isolated and non-isolated anophthalmia/microphthalmia.
Chassaing, N; Ragge, N; Kariminejad, A; Buffet, A; Ghaderi-Sohi, S; Martinovic, J; Calvas, P
2013-03-01
PDAC syndrome [Pulmonary hypoplasia/agenesis, Diaphragmatic hernia/eventration, Anophthalmia/microphthalmia (A/M) and Cardiac Defect] is a condition associated with recessive mutations in the STRA6 gene in some of these patients. Recently, cases with isolated anophthalmia have been associated with STRA6 mutations. To determine the minimal findings associated with STRA6 mutations, we performed mutation analysis of the STRA6 gene in 28 cases with anophthalmia. In 7 of the cases the anophthalmia was isolated, in 14 cases it was associated with one of the major features included in PDAC and 7 had other abnormalities. Mutations were identified in two individuals: one with bilateral anophthalmia and some features included in PDAC, who was a compound heterozygote for a missense mutation and a large intragenic deletion, and the second case with all the major features of PDAC and who had a homozygous splicing mutation. This study suggests that STRA6 mutations are more likely to be identified in individuals with A/M and other abnormalities included in the PDAC spectrum, rather than in isolated A/M cases. © 2012 John Wiley & Sons A/S.
Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael
2017-07-01
Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.
Jia, Peilin; Zhao, Zhongming
2014-02-01
A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.
Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla
2018-05-31
Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.
Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome.
Essawi, Mona L; Ismail, Manal F; Afifi, Hanan H; Kobesiy, Maha M; El Kotoury, Ahmed; Barakat, Maged M
2013-11-01
Noonan syndrome (NS) is inherited as an autosomal dominant disorder with dysmorphic facies, short stature, and cardiac defects, which can be caused by missense mutations in the protein tyrosine phosphatase nonreceptor type 11 (PTPN11) gene, which encodes src homology region 2 domain containing tyrosine phosphatase-2 (SHP-2), a protein tyrosine phosphatase that acts in signal transduction downstream to growth factors and cytokines. The current study aimed to study the molecular characterization of the PTPN11 gene among Egyptian patients with Noonan syndrome. Eleven exons of the PTPN11 gene were amplified and screened by single stranded conformational polymorphism (SSCP). DNA samples showing band shift in SSCP were subjected to sequencing. Mutational analysis of the PTPN11 gene revealed T→C transition at position 854 in exon 8, predicting Phe285Ser substitution within PTP domain of SHP-2 protein, in one NS patient and -21C→T polymorphism in intron 7 in four other cases. Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS. Copyright © 2012. Published by Elsevier B.V.
Arrestin gene mutations in autosomal recessive retinitis pigmentosa.
Nakazawa, M; Wada, Y; Tamai, M
1998-04-01
To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.
International Nuclear Information System (INIS)
Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.
1998-01-01
Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)
Mutation analysis of the NSD1 gene in patients with autism spectrum disorders and macrocephaly
Directory of Open Access Journals (Sweden)
Delorme Richard
2007-11-01
Full Text Available Abstract Background Sotos syndrome is an overgrowth syndrome characterized by macrocephaly, advanced bone age, characteristic facial features, and learning disabilities, caused by mutations or deletions of the NSD1 gene, located at 5q35. Sotos syndrome has been described in a number of patients with autism spectrum disorders, suggesting that NSD1 could be involved in other cases of autism and macrocephaly. Methods We screened the NSD1 gene for mutations and deletions in 88 patients with autism spectrum disorders and macrocephaly (head circumference 2 standard deviations or more above the mean. Mutation analysis was performed by direct sequencing of all exons and flanking regions. Dosage analysis of NSD1 was carried out using multiplex ligation-dependent probe amplification. Results We identified three missense variants (R604L, S822C and E1499G in one patient each, but none is within a functional domain. In addition, segregation analysis showed that all variants were inherited from healthy parents and in two cases were also present in unaffected siblings, indicating that they are probably nonpathogenic. No partial or whole gene deletions/duplications were observed. Conclusion Our findings suggest that Sotos syndrome is a rare cause of autism spectrum disorders and that screening for NSD1 mutations and deletions in patients with autism and macrocephaly is not warranted in the absence of other features of Sotos syndrome.
Braberg, Hannes; Moehle, Erica A.; Shales, Michael; Guthrie, Christine; Krogan, Nevan J.
2014-01-01
We have achieved a residue-level resolution of genetic interaction mapping – a technique that measures how the function of one gene is affected by the alteration of a second gene – by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine. PMID:24842270
International Nuclear Information System (INIS)
Novakovic, S.; Stegel, V.
2005-01-01
Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)
Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family
Directory of Open Access Journals (Sweden)
Xiao-hua CHEN
2014-08-01
Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09
New Mutation Identified in the SRY Gene High Mobility Group (HMG
Directory of Open Access Journals (Sweden)
Feride İffet Şahin
2013-06-01
Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.
Directory of Open Access Journals (Sweden)
Dinić Jelena
2007-01-01
Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and
[Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].
Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K
2013-02-01
An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.
Turner, Andrew; Sasse, Jurgen; Varadi, Aniko
2016-10-19
Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.
Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B
2017-02-01
Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
Glucokinase gene mutations (MODY 2) in Asian Indians.
Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan
2014-03-01
Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.
Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.
Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S
2016-12-01
This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.
Diverse growth hormone receptor gene mutations in Laron syndrome.
Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U
1993-01-01
To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849
Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph
2014-07-01
Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p small-bowel cancer (p small-bowel cancer were clinically relevant predictors for Lynch syndrome. © 2013 UICC.
Gene mutations in children with chronic pancreatitis.
Witt, H
2001-01-01
In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.
Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y
2017-10-02
Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.
Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.
Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla
2009-01-01
Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.
Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis
Directory of Open Access Journals (Sweden)
Paulo Lisboa Bittencourt
2009-01-01
Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.
Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N
2011-11-24
To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Ho Duy, Binh; Zhytnik, Lidiia; Maasalu, Katre; Kändla, Ivo; Prans, Ele; Reimann, Ene; Märtson, Aare; Kõks, Sulev
2016-08-12
The genetics of osteogenesis imperfecta (OI) have not been studied in a Vietnamese population before. We performed mutational analysis of the COL1A1 and COL1A2 genes in 91 unrelated OI patients of Vietnamese origin. We then systematically characterized the mutation profiles of these two genes which are most commonly related to OI. Genomic DNA was extracted from EDTA-preserved blood according to standard high-salt extraction methods. Sequence analysis and pathogenic variant identification was performed with Mutation Surveyor DNA variant analysis software. Prediction of the pathogenicity of mutations was conducted using Alamut Visual software. The presence of variants was checked against Dalgleish's osteogenesis imperfecta mutation database. The sample consisted of 91 unrelated osteogenesis imperfecta patients. We identified 54 patients with COL1A1/2 pathogenic variants; 33 with COL1A1 and 21 with COL1A2. Two patients had multiple pathogenic variants. Seventeen novel COL1A1 and 10 novel COL1A2 variants were identified. The majority of identified COL1A1/2 pathogenic variants occurred in a glycine substitution (36/56, 64.3 %), usually serine (23/36, 63.9 %). We found two pathogenic variants of the COL1A1 gene c.2461G > A (p.Gly821Ser) in four unrelated patients and one, c.2005G > A (p.Ala669Thr), in two unrelated patients. Our data showed a lower number of collagen OI pathogenic variants in Vietnamese patients compared to reported rates for Asian populations. The OI mutational profile of the Vietnamese population is unique and related to the presence of a high number of recessive mutations in non-collagenous OI genes. Further analysis of OI patients negative for collagen mutations, is required.
Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M
2013-01-30
The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene
Directory of Open Access Journals (Sweden)
Udhaya H Kotecha
2014-01-01
Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.
Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.
Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P
2015-04-23
With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.
Directory of Open Access Journals (Sweden)
Jenifer L Marks
2007-05-01
Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.
Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload
Directory of Open Access Journals (Sweden)
Rodolfo Delfini Cançado
Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.
Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R
1998-01-01
Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363
Mutated genes as research tool
International Nuclear Information System (INIS)
1981-01-01
Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of
Mutations in the Norrie disease gene.
Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B
1995-01-01
We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)
Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.
Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare
2017-08-15
Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.
Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.
Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang
2015-01-01
Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.
DEFF Research Database (Denmark)
Riess, O; Weber, B; Nørremølle, Anne
1992-01-01
as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...
Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.
Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi
2015-05-01
This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
Screening of point mutations by multiple SSCP analysis in the dystrophin gene
Energy Technology Data Exchange (ETDEWEB)
Lasa, A.; Baiget, M.; Gallano, P. [Hospital Sant Pau, Barcelona (Spain)
1994-09-01
Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.
MutaNET: a tool for automated analysis of genomic mutations in gene regulatory networks.
Hollander, Markus; Hamed, Mohamed; Helms, Volkhard; Neininger, Kerstin
2018-03-01
Mutations in genomic key elements can influence gene expression and function in various ways, and hence greatly contribute to the phenotype. We developed MutaNET to score the impact of individual mutations on gene regulation and function of a given genome. MutaNET performs statistical analyses of mutations in different genomic regions. The tool also incorporates the mutations in a provided gene regulatory network to estimate their global impact. The integration of a next-generation sequencing pipeline enables calling mutations prior to the analyses. As application example, we used MutaNET to analyze the impact of mutations in antibiotic resistance (AR) genes and their potential effect on AR of bacterial strains. MutaNET is freely available at https://sourceforge.net/projects/mutanet/. It is implemented in Python and supported on Mac OS X, Linux and MS Windows. Step-by-step instructions are available at http://service.bioinformatik.uni-saarland.de/mutanet/. volkhard.helms@bioinformatik.uni-saarland.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Mutation analysis of the MYO7A and CDH23 genes in Japanese patients with Usher syndrome type 1.
Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Takizawa, Yoshinori; Hosono, Katsuhiro; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei
2010-12-01
Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 1 (USH1), the second common type of USH, is frequently caused by MYO7A and CDH23 mutations, accounting for 70-80% of the cases among various ethnicities, including Caucasians, Africans and Asians. However, there have been no reports of mutation analysis for any responsible genes for USH1 in Japanese patients. This study describes the first mutation analysis of MYO7A and CDH23 in Japanese USH1 patients. Five mutations (three in MYO7A and two in CDH23) were identified in four of five unrelated patients. Of these mutations, two were novel. One of them, p.Tyr1942SerfsX23 in CDH23, was a large deletion causing the loss of 3 exons. This is the first large deletion to be found in CDH23. The incidence of the MYO7A and CDH23 mutations in the study population was 80%, which is consistent with previous findings. Therefore, mutation screening for these genes is expected to be a highly sensitive method for diagnosing USH1 among the Japanese.
Ancient genes establish stress-induced mutation as a hallmark of cancer.
Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul
2017-01-01
Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to
Directory of Open Access Journals (Sweden)
LILIAN JARA
2004-01-01
Full Text Available BRCA1 gene mutations account for nearly all families with multiple cases of both early onset breast and/or ovarian cancer and about 30% of hereditary breast cancer. Although to date more than 1,237 distinct mutations, polymorphisms, and variants have been described, several mutations have been found to be recurrent in this gene. We have analyzed 63 Chilean breast/ovarian cancer families for eighteen frequent BRCA1 mutations. The analysis of the five exons and two introns in which these mutations are located was made using mismatch PCR assay, ASO hybridization assay, restriction fragment analysis, allele specific PCR assay and direct sequentiation techniques. Two BRCA1 mutations (185delAG and C61G and one variant of unknown significance (E1250K were found in four of these families. Also, a new mutation (4185delCAAG and one previously described polymorphism (E1038G were found in two other families. The 185delAG was found in a 3.17 % of the families and the others were present only in one of the families of this cohort. Therefore these mutations are not prominent in the Chilean population. The variant of unknown significance and the polymorphism detected could represent a founder effect of Spanish origin
Clinical study of DMD gene point mutation causing Becker muscular dystrophy
Directory of Open Access Journals (Sweden)
Ji-qing CAO
2015-07-01
Full Text Available Background DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD. Methods Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA. Results Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C. Conclusions DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005
Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease
Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value
1999-01-01
The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in
A novel missense mutation of ADAR1 gene in a Chinese family ...
Indian Academy of Sciences (India)
This study was mainlyto explore the pathogenic mutation of ADAR1 gene and provide genetics counselling and prenatal diagnostic testing for childbearing individuals.Mutational analysis of ADAR1 gene was performed by polymerase chain reaction (PCR) and electrophoretic separation of PCR products by 1.5% agarose ...
International Nuclear Information System (INIS)
Russell, L.B.
1982-01-01
Analysis of mouse specific-locus (SL) mutations at three loci has identified over 33 distinct complementation groups - most of which are probably overlapping deficiencies - and 13 to 14 new functional units. The complementation maps that have been generated for the d-se and c regions include numerous vital functions; however, some of the genes in these regions are non-vital. At such loci, hypomorphic mutants must represent intragenic alterations, and some viable nulls could conceivably be intragenic lesions also. Analysis of SL mutations has provided information on genetic expression. Homozygous deficiencies can be completely viable or can kill at any one of a range of developmental stages. Heterozygonus deficiencies of up to 6 cM or more in genetic length have been recovered and propagated. The time of death of homozygous and the degree of inviability of heterozygous deficiencies are related more to specific content of the missing segment than to its length. Combinations of deficiencies with x-autosome translocations that inactivate the homologous region in a mosaic fashion have shown that organismic lethals are not necessarily cell lethal. The spectrum of mutations induced depends on the nature of the mutagen and the type of germ cell exposed. Radiation of spermatogonia produces intragenic as well as null mutations. Spontaneous mutations have an admixture of types not present in populations of mutations induced in germ cells, and this raises doubts concerning the accuracy of doubling-dose calculations in genetic risk estimation. The analysis of SL mutations has yielded genetic tools for the construction of detailed gene-dosage series, cis-trans comparisons, the mapping of known genes and identification of new genes, genetic rescue of various types, and the identification and isolation of DNA sequences
[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].
Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen
2018-02-10
OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.
International Nuclear Information System (INIS)
Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha
2012-01-01
KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.
Microarray Analysis of Iris Gene Expression in Mice with Mutations Influencing Pigmentation
Trantow, Colleen M.; Cuffy, Tryphena L.; Fingert, John H.; Kuehn, Markus H.
2011-01-01
Purpose. Several ocular diseases involve the iris, notably including oculocutaneous albinism, pigment dispersion syndrome, and exfoliation syndrome. To screen for candidate genes that may contribute to the pathogenesis of these diseases, genome-wide iris gene expression patterns were comparatively analyzed from mouse models of these conditions. Methods. Iris samples from albino mice with a Tyr mutation, pigment dispersion–prone mice with Tyrp1 and Gpnmb mutations, and mice resembling exfoliation syndrome with a Lyst mutation were compared with samples from wild-type mice. All mice were strain (C57BL/6J), age (60 days old), and sex (female) matched. Microarrays were used to compare transcriptional profiles, and differentially expressed transcripts were described by functional annotation clustering using DAVID Bioinformatics Resources. Quantitative real-time PCR was performed to validate a subset of identified changes. Results. Compared with wild-type C57BL/6J mice, each disease context exhibited a large number of statistically significant changes in gene expression, including 685 transcripts differentially expressed in albino irides, 403 in pigment dispersion–prone irides, and 460 in exfoliative-like irides. Conclusions. Functional annotation clusterings were particularly striking among the overrepresented genes, with albino and pigment dispersion–prone irides both exhibiting overall evidence of crystallin-mediated stress responses. Exfoliative-like irides from mice with a Lyst mutation showed overall evidence of involvement of genes that influence immune system processes, lytic vacuoles, and lysosomes. These findings have several biologically relevant implications, particularly with respect to secondary forms of glaucoma, and represent a useful resource as a hypothesis-generating dataset. PMID:20739468
[Study of gene mutation in 62 hemophilia A children].
Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X
2017-11-02
Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense
[Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].
He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong
2015-11-01
To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.
[Mutation analysis of FAH gene in patients with tyrosinemia type 1].
Dou, Li-Min; Fang, Ling-Juan; Wang, Xiao-Hong; Lu, Wei; Chen, Rui; Li, Li-Ting; Zhao, Jing; Wang, Jian-She
2013-04-01
. Alpha-fetoprotein 412.8 µg/L, levels of tyrosine in blood and succinylacetone in urine were 835.8 µmol/L and 27.48 µmol/L. Rickets did not improve after administration of calcium and vitamine D3. She is homozygous for the mutation c.1027G > A/c.1027G > A, which predicts G343R. The parents were mutation carriers. Analysis by Clustal X on the alignment of amino acids residual reservation among different species showed that the locative amino acid was highly conserved. Polyphen software predicted G343R was probably damaging (PISC score 3.235). Children with tyrosinemia type 1 can have manifestations of persistent diarrhea or late-onset rickets. Physical examination can reveal hepatosplenomegaly, laboratory tests indicate markedly elevated serum concentration of alpha-fetoprotein and alkaline phosphatase in plasma and succinylacetone in urine, other members in family may have tyrosinemias or parents are consanguineous. Mutations c.455G > A and c.1027G > A can be detected in FAH gene of Chinese children.
Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis
Directory of Open Access Journals (Sweden)
LYU Tingxia
2016-08-01
Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.
Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates
Directory of Open Access Journals (Sweden)
Soudabeh Heidari
2013-09-01
Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.
Directory of Open Access Journals (Sweden)
Michael Seiler
2018-04-01
Full Text Available Summary: Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA, and we identified 119 splicing factor genes with significant non-silent mutation patterns, including mutation over-representation, recurrent loss of function (tumor suppressor-like, or hotspot mutation profile (oncogene-like. Furthermore, RNA sequencing analysis revealed altered splicing events associated with selected splicing factor mutations. In addition, we were able to identify common gene pathway profiles associated with the presence of these mutations. Our analysis suggests that somatic alteration of genes involved in the RNA-splicing process is common in cancer and may represent an underappreciated hallmark of tumorigenesis. : Seiler et al. report that 119 splicing factor genes carry putative driver mutations over 33 tumor types in TCGA. The most common mutations appear to be mutually exclusive and are associated with lineage-independent altered splicing. Samples with these mutations show deregulation of cell-autonomous pathways and immune infiltration. Keywords: splicing, SF3B1, U2AF1, SRSF2, RBM10, FUBP1, cancer, mutation
Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin
2010-10-01
Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.
Mutation of the S and 3c genes in genomes of feline coronaviruses.
Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi
2018-05-17
Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.
A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome
Directory of Open Access Journals (Sweden)
Maryam Taghdiri
2017-08-01
Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.
A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.
Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali
2017-01-01
Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.
Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G
2000-03-01
Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.
KMeyeDB: a graphical database of mutations in genes that cause eye diseases.
Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei
2010-06-01
KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.
Aykut, Ayça; Karaca, Emin; Onay, Hüseyin; Gökşen, Damla; Çetinkalp, Şevki; Eren, Erdal; Ersoy, Betül; Çakır, Esra Papatya; Büyükinan, Muammer; Kara, Cengiz; Anık, Ahmet; Kırel, Birgül; Özen, Samim; Atik, Tahir; Darcan, Şükran; Özkınay, Ferda
2018-01-30
Maturity onset diabetes is a genetic form of diabetes mellitus characterized by an early age at onset and several etiologic genes for this form of diabetes have been identified in many patients. Maturity onset diabetes type 2 [MODY2 (#125851)] caused by mutations in the glucokinase gene (GCK). Although its prevalence is not clear, it is estimated that 1%-2% of patients with diabetes have the monogenic form. The aim of this study was to evaluate the molecular spectrum of GCK gene mutations in 177 Turkish MODY type 2 patients. Mutations in the GCK gene were identified in 79 out of 177. All mutant alleles were identified, including 45 different GCK mutations, 20 of which were novel. Copyright © 2017. Published by Elsevier B.V.
rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.
Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi
2018-03-01
The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.
Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).
Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker
2006-12-01
To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.
Mutation analysis of the ERCC4/FANCQ gene in hereditary breast cancer.
Directory of Open Access Journals (Sweden)
Sandra Kohlhase
Full Text Available The ERCC4 protein forms a structure-specific endonuclease involved in the DNA damage response. Different cancer syndromes such as a subtype of Xeroderma pigmentosum, XPF, and recently a subtype of Fanconi Anemia, FA-Q, have been attributed to biallelic ERCC4 gene mutations. To investigate whether monoallelic ERCC4 gene defects play some role in the inherited component of breast cancer susceptibility, we sequenced the whole ERCC4 coding region and flanking untranslated portions in a series of 101 Byelorussian and German breast cancer patients selected for familial disease (set 1, n = 63 or for the presence of the rs1800067 risk haplotype (set 2, n = 38. This study confirmed six known and one novel exonic variants, including four missense substitutions but no truncating mutation. Missense substitution p.R415Q (rs1800067, a previously postulated breast cancer susceptibility allele, was subsequently screened for in a total of 3,698 breast cancer cases and 2,868 controls from Germany, Belarus or Russia. The Gln415 allele appeared protective against breast cancer in the German series, with the strongest effect for ductal histology (OR 0.67; 95%CI 0.49; 0.92; p = 0.003, but this association was not confirmed in the other two series, with the combined analysis yielding an overall Mantel-Haenszel OR of 0.94 (95% CI 0.81; 1.08. There was no significant effect of p.R415Q on breast cancer survival in the German patient series. The other three detected ERCC4 missense mutations included two known rare variants as well as a novel substitution, p.E17V, that we identified on a p.R415Q haplotype background. The p.E17V mutation is predicted to be probably damaging but was present in just one heterozygous patient. We conclude that the contribution of ERCC4/FANCQ coding mutations to hereditary breast cancer in Central and Eastern Europe is likely to be small.
X-Linked Hypohidrotic Ectodermal Dysplasia: New Features and a Novel EDA Gene Mutation.
Savasta, Salvatore; Carlone, Giorgia; Castagnoli, Riccardo; Chiappe, Francesca; Bassanese, Francesco; Piras, Roberta; Salpietro, Vincenzo; Brazzelli, Valeria; Verrotti, Alberto; Marseglia, Gian L
2017-01-01
We described a 5-year-old male with hypodontia, hypohidrosis, and facial dysmorphisms characterized by a depressed nasal bridge, maxillary hypoplasia, and protuberant lips. Chromosomal analysis revealed a normal 46,XY male karyotype. Due to the presence of clinical features of hypohidrotic ectodermal dysplasia (HED), the EDA gene, located at Xq12q13.1, of the patient and his family was sequenced. Analysis of the proband's sequence revealed a missense mutation (T to A transversion) in hemizygosity state at nucleotide position 158 in exon 1 of the EDA gene, which changes codon 53 from leucine to histidine, while heterozygosity at this position was detected in the slightly affected mother; moreover, this mutation was not found in the publically available Human Gene Mutation Database. To date, our findings indicate that a novel mutation in EDA is associated with X-linked HED, adding it to the repertoire of EDA mutations. © 2017 S. Karger AG, Basel.
Energy Technology Data Exchange (ETDEWEB)
Lee, S.T.; Nicholls, R.D.; Schnur, R. [Univ. of Wisconsin, Madison, WI (United States)]|[Case Western Reserve Univ., Cleveland, OH (United States)]|[Children`s Hospital of Philadelphia, PA (United States)] [and others
1994-09-01
OCA2 is an autosomal recessive disorder in which the biosynthesis of melanin pigment is greatly reduced in the skin, hair, and eyes. Recently, we showed that OCA2 results from mutations of the P gene, in chromosome segment 15q11-q13. In addition to OCA2, mutations of P account for OCA associated with the Prader-Willi syndrome and some cases of {open_quotes}autosomal recessive ocular albinism{close_quotes} (AROA). We have now studied 38 unrelated patients with various forms of OCA2 or AROA from a variety of different ethnic groups. None of these patients had detectable abnormalities of the tyrosinase (TYR) gene. Among 8 African-American patients with OCA2 we observed apparent locus homogeneity. We detected abnormalities of the P gene in all 8 patients, including 12 different mutations and deletions, most of which are unique to this group and none of which is predominant. In contrast, OCA2 in other populations appears to be genetically heterogeneous. Among 21 Caucasian patients we detected abnormalities of the P gene in only 8, comprising 9 different point mutations and deletions, some of which also occurred among the African-American patients. Among 3 Middle-Eastern, 3 Indo-Pakistani, and 3 Asian patients we detected mutations of the P gene in only one from each group. In a large Indo-Pakistani kindred with OCA2 we have excluded both the TYR and P genes on the basis of genetic linkage. The prevalence of mutations of the P gene thus appears to be much higher among African-Americans with OCA2 than among patients from other ethnic groups. The incidence of OCA2 in some parts of equatorial Africa is extremely high, as frequent as 1 per 1100, and the disease has been linked to P in South African Bantu. The eventual characterization of P gene mutations in Africans will be informative with regard to the origins of P gene mutations in African-American patients.
FLNC Gene Splice Mutations Cause Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Rene L. Begay, BS
2016-08-01
Full Text Available A genetic etiology has been identified in 30% to 40% of dilated cardiomyopathy (DCM patients, yet only 50% of these cases are associated with a known causative gene variant. Thus, in order to understand the pathophysiology of DCM, it is necessary to identify and characterize additional genes. In this study, whole exome sequencing in combination with segregation analysis was used to identify mutations in a novel gene, filamin C (FLNC, resulting in a cardiac-restricted DCM pathology. Here we provide functional data via zebrafish studies and protein analysis to support a model implicating FLNC haploinsufficiency as a mechanism of DCM.
Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P
2014-05-01
Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.
Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.
Directory of Open Access Journals (Sweden)
Jian Wang
Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Comprehensive analysis of gene mutation and phenotype of tuberous sclerosis complex in China
Directory of Open Access Journals (Sweden)
Guo-qiang HUANG
2015-04-01
Full Text Available Objective To summarize the clinical features of tuberous sclerosis complex (TSC, the distribution and description of TSC gene, and to probe into the correlation of genotype with phenotype. Methods According to the 1998 International Tuberous Sclerosis Complex Diagnostic Criteria, a total of 163 TSC patients with pathogenic mutation in TSC gene (3 cases were detected in our hospital, and the other 160 cases were collected from other institutions in China were enrolled, and their gene detection results and clinical data were analyzed. Results Among 163 cases, TSC1 mutation (31 cases accounted for 19.02% [32.26% (10/31 in exon 15, 16.13% (5/31 in exon 21, 12.90% (4/31 in exon 18], and TSC2 mutation (132 cases accounted for 80.98% [9.85% (13/132 in exon 37, 7.58% (10/132 in exon 40, 6.82%(9/132 in exon 33]. The proportion of base replacement in TSC1 was 41.94% (13/31, and 52.27% (69/132 in TSC2. Male patients exhibited significantly more subependymal nodules or calcifications than thefemale patients (χ2 = 8.016, P = 0.005. Sporadic patients exhibited significantly more cortical tubers than familial patients (χ2 = 6.273, P = 0.012. Patients with TSC2 mutations had significantly higher frequencies of hypomelanotic macules than patients with TSC1 mutations (χ2 = 6.756, P = 0.009. Patients with missense mutations were more likely to have facial angiofibromas compared with patients with other mutations (χ2 = 4.438, P = 0.035. Conclusions Exon 15, 21 and 18 of TSC1 and exon 37, 40 and 33 of TSC2 accounted for higher percentage of mutations. Correlating genotypes with phenotypes should facilitate the individualized treatment and prognostic assessment of tuberous sclerosis complex. DOI: 10.3969/j.issn.1672-6731.2015.04.013
An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies
International Nuclear Information System (INIS)
Jin Tao; Zou Liuhe; Yang Ling
2004-01-01
Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)
Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle
2011-07-01
Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.
Directory of Open Access Journals (Sweden)
Wakako Jo
2010-01-01
Full Text Available Loss-of-function mutations of the PAX8 gene are considered to mainly cause congenital hypothyroidism (CH due to thyroid hypoplasia. However, some patients with PAX8 mutation have demonstrated a normal-sized thyroid gland. Here we report a CH patient caused by a PAX8 mutation, which manifested as iodide transport defect (ITD. Hypothyroidism was detected by neonatal screening and L-thyroxine replacement was started immediately. Although 123I scintigraphy at 5 years of age showed that the thyroid gland was in the normal position and of small size, his iodide trapping was low. The ratio of the saliva/plasma radioactive iodide was low. He did not have goiter; however laboratory findings suggested that he had partial ITD. Gene analyses showed that the sodium/iodide symporter (NIS gene was normal; instead, a mutation in the PAX8 gene causing R31H substitution was identified. The present report demonstrates that individuals with defective PAX8 can have partial ITD, and thus genetic analysis is useful for differential diagnosis.
Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations
Directory of Open Access Journals (Sweden)
Diaz-Llopis Manuel
2011-10-01
Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.
Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia
Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.; Papadopoulos, Nickolas; Malek, Sami N.
2011-01-01
To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell...
HFE gene mutations and Wilson's disease in Sardinia.
Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi
2010-03-01
Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.
Mutational analysis of the BRCA1 gene in 30 Czech ovarian cancer ...
Indian Academy of Sciences (India)
Ovarian cancer is one of the most severe of oncological diseases. Inherited mutations in cancer susceptibility genes play a causal role in 5–10% of newly diagnosed tumours. BRCA1 and BRCA2 gene alterations are found in the majority of these cases. The aim of this study was to analyse the BRCA1 gene in the ovarian ...
Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.
Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W
2016-05-01
To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report
Directory of Open Access Journals (Sweden)
NING Huibin
2017-01-01
Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.
Directory of Open Access Journals (Sweden)
Naeem Muhammad
2011-07-01
Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.
[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].
Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli
2017-08-10
To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.
Mutation update for the PORCN gene
DEFF Research Database (Denmark)
Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo
2011-01-01
Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...
Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy
2017-01-01
Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular
[Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].
Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei
2008-06-01
To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.
Mutation analysis of the CHK2 gene in breast carcinoma and other cancers
International Nuclear Information System (INIS)
Ingvarsson, Sigurdur; Sigbjornsdottir, Bjarnveig I; Huiping, Chen; Hafsteinsdottir, Sigridur H; Ragnarsson, Gisli; Barkardottir, Rosa B; Arason, Adalgeir; Egilsson, Valgardur; Bergthorsson, Jon TH
2002-01-01
Mutations in the CHK2 gene at chromosome 22q12.1 have been reported in families with Li-Fraumeni syndrome. Chk2 is an effector kinase that is activated in response to DNA damage and is involved in cell-cycle pathways and p53 pathways. We screened 139 breast tumors for loss of heterozygosity at chromosome 22q, using seven microsatellite markers, and screened 119 breast tumors with single-strand conformation polymorphism and DNA sequencing for mutations in the CHK2 gene. Seventy-four of 139 sporadic breast tumors (53%) show loss of heterozygosity with at least one marker. These samples and 45 tumors from individuals carrying the BRCA2 999del5 mutation were screened for mutations in the CHK2 gene. In addition to putative polymorphic regions in short mononucleotide repeats in a non-coding exon and intron 2, a germ line variant (T59K) in the first coding exon was detected. On screening 1172 cancer patients for the T59K sequence variant, it was detected in a total of four breast-cancer patients, two colon-cancer patients, one stomach-cancer patient and one ovary-cancer patient, but not in 452 healthy individuals. A tumor-specific 5' splice site mutation at site +3 in intron 8 (TTgt [a → c]atg) was also detected. We conclude that somatic CHK2 mutations are rare in breast cancer, but our results suggest a tumor suppressor function for CHK2 in a small proportion of breast tumors. Furthermore, our results suggest that the T59K CHK2 sequence variant is a low-penetrance allele with respect to tumor growth
Numerous BAF complex genes are mutated in Coffin-Siris syndrome.
Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi
2014-09-01
Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.
Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene
Energy Technology Data Exchange (ETDEWEB)
Putnam, E.A.; Cho, M.; Milewicz, D.M. [Univ. of Texas-Houston Medical School, Houston, TX (United States)] [and others
1996-03-29
Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-based exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.
Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.
Directory of Open Access Journals (Sweden)
Quan Li
Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.
HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.
Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent
2017-07-01
HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.
Mutated Genes in Schizophrenia Map to Brain Networks
... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...
Identification of Missense Mutation (I12T in the BSND Gene and Bioinformatics Analysis
Directory of Open Access Journals (Sweden)
Hina Iqbal
2011-01-01
Full Text Available Nonsyndromic hearing loss is a paradigm of genetic heterogeneity with 85 loci and 39 nuclear disease genes reported so far. Mutations of BSND have been shown to cause Bartter syndrome type IV, characterized by significant renal abnormalities and deafness and nonsyndromic nearing loss. We studied a Pakistani consanguineous family. Clinical examinations of affected individuals did not reveal the presence of any associated signs, which are hallmarks of the Bartter syndrome type IV. Linkage analysis identified an area of 18.36 Mb shared by all affected individuals between markers D1S2706 and D1S1596. A maximum two-point LOD score of 2.55 with markers D1S2700 and multipoint LOD score of 3.42 with marker D1S1661 were obtained. BSND mutation, that is, p.I12T, cosegregated in all extant members of our pedigree. BSND mutations can cause nonsyndromic hearing loss, and it is a second report for this mutation. The respected protein, that is, BSND, was first modeled, and then, the identified mutation was further analyzed by using different bioinformatics tools; finally, this protein and its mutant was docked with CLCNKB and REN, interactions of BSND, respectively.
Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer
International Nuclear Information System (INIS)
Irshad, S.; Nawaz, T.
2008-01-01
Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)
Directory of Open Access Journals (Sweden)
Chang Jan-Gowth
2011-10-01
Full Text Available Abstract Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser and the hotspot mutation (p.Ala84Thr from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD simulations and normal mode analysis (NMA, we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.
Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem
2014-06-01
Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.
Directory of Open Access Journals (Sweden)
Shamim Saleha
2016-05-01
Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.
Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul
2016-01-01
To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.
Mutation analysis of breast cancer gene BRCA among breast cancer Jordanian females
International Nuclear Information System (INIS)
Atoum, Manar F.; Al-Kayed, Sameer A.
2004-01-01
To screen mutations of the tumor suppressor breast cancer susceptibility gene 1 (BRCA1) within 3 exons among Jordanian breast cancer females. A total of 135 Jordanian breast cancer females were genetically analyzed by denaturing gradient electrophoresis (DGGE) for mutation detection in 3 BRCA1 exons (2, 11 and 20) between 2000-2002 in Al-Basheer Hospital, Amman, Jordan. Of the studied patients 50 had a family history of breast cancer, 28 had a family history of cancer other than breast cancer, and 57 had no family history of any cancer. Five germline mutations were detected among breast cancer females with a family history of breast cancers (one in exon 2 and 4 mutations in exon 11). Another germline mutation (within exon 11) was detected among breast cancer females with family history of cancer other than breast cancer, and no mutation was detected among breast cancer females with no family history of any cancer or among normal control females. Screening mutations within exon 2, exon 11 and exon 20 showed that most screened mutations were within BRCA1 exon 11 among breast cancer Jordanian families with a family history of breast cancer. (author)
Mutations in the pericentrin (PCNT) gene cause primordial dwarfism
Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Doerfler, Arnd; Kinning, Esther; Megarbane, Andre; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Doerr, Helmuth-Guenther; Reis, Andre
2008-01-01
Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss- of- function mutations in the centrosomal pericentrin ( PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial
Mutation screening and association analysis of six candidate genes for autism on chromosome 7q
DEFF Research Database (Denmark)
Bonora, E.; Lamb, J.A.; Barnby, G.
2005-01-01
in the genes CUTL1, LAMB1 and PTPRZ1. Analysis of genetic variants provided evidence for association with autism for one of the new missense changes identified in LAMB1; this effect was stronger in a subgroup of affected male sibling pair families, implying a possible specific sex-related effect......Genetic studies have provided evidence for an autism susceptibility locus (AUTS1) on chromosome 7q. Screening for mutations in six genes mapping to 7q, CUTL1, SRPK2, SYPL, LAMB1, NRCAM and PTPRZ1 in 48 unrelated individuals with autism led to the identification of several new coding variants...
ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome
Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun
2011-01-01
We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199
High resolution melting analysis for the detection of EMS induced mutations in wheat SbeIIa genes
Directory of Open Access Journals (Sweden)
Botticella Ermelinda
2011-11-01
Full Text Available Abstract Background Manipulation of the amylose-amylopectin ratio in cereal starch has been identified as a major target for the production of starches with novel functional properties. In wheat, silencing of starch branching enzyme genes by a transgenic approach reportedly caused an increase of amylose content up to 70% of total starch, exhibiting novel and interesting nutritional characteristics. In this work, the functionality of starch branching enzyme IIa (SBEIIa has been targeted in bread wheat by TILLING. An EMS-mutagenised wheat population has been screened using High Resolution Melting of PCR products to identify functional SNPs in the three homoeologous genes encoding the target enzyme in the hexaploid genome. Results This analysis resulted in the identification of 56, 14 and 53 new allelic variants respectively for SBEIIa-A, SBEIIa-B and SBEIIa-D. The effects of the mutations on protein structure and functionality were evaluated by a bioinformatic approach. Two putative null alleles containing non-sense or splice site mutations were identified for each of the three homoeologous SBEIIa genes; qRT-PCR analysis showed a significant decrease of their gene expression and resulted in increased amylose content. Pyramiding of different single null homoeologous allowed to isolate double null mutants showing an increase of amylose content up to 21% compared to the control. Conclusion TILLING has successfully been used to generate novel alleles for SBEIIa genes known to control amylose content in wheat. Single and double null SBEIIa genotypes have been found to show a significant increase in amylose content.
Xu, Bai-Cheng; Bian, Pan-Pan; Liu, Xiao-Wen; Zhu, Yi-Ming; Yang, Xiao-Long; Ma, Jian-Li; Chen, Xing-Jian; Wang, Yan-Li; Guo, Yu-Fen
2014-09-01
The GJB2 gene mutation characteristic of Dongxiang was the interaction result of ethnic background and geographical environment, and Yugur exhibited the typical founder effect. The SLC26A4 gene mutation characteristic of Dongxiang was related to caucasian backgrounds and selection of purpose exons, i.e. ethnic background and the penetrance of ethnic specificity caused the low mtDNA1555A>G mutation frequency in Dongxiang. To determine the prevalence of GJB2 and SLC26A4 genes and mtDNA1555A>G mutations and analyze the ethnic specificity in the non-syndromic sensorineural hearing loss (NSHL) of unique ethnic groups in Gansu Province. Peripheral blood samples were obtained from Dongxiang, Yugur, Bonan, and ethnic Han groups with moderately severe to profound NSHL in Gansu Province. Bidirectional sequencing (or enzyme digestion) was applied to identify the sequence variations. The pathogenic allele frequency of the three gene mutations was different. The frequency of the GJB2 gene among the Dongxiang, Yugur, Bonan, and ethnic Han groups was 9.03%, 12.5%, 5.88%, and 12.17%, respectively. No difference was found between the ethnic groups. The frequencies of the SLC26A4 genes were 3.23%, 8.33%, 0%, and 9.81%, respectively. The mutation frequency of mtDNA1555A>G was 0%, 0%, 0%, and 6.03%, respectively. No difference was found between the ethnic groups, except for the Dongxiang and ethnic Han groups, both in SLC26A4 gene and mtDNA1555A>G.
Colakoglu, Seyma; Bayhan, Turan; Tavil, Betül; Keskin, Ebru Yılmaz; Cakir, Volkan; Gümrük, Fatma; Çetin, Mualla; Aytaç, Selin; Berber, Ergul
2018-01-01
Factor XI (FXI) deficiency is an autosomal bleeding disease associated with genetic defects in the F11 gene which cause decreased FXI levels or impaired FXI function. An increasing number of mutations has been reported in the FXI mutation database, most of which affect the serine protease domain of the protein. FXI is a heterogeneous disorder associated with a variable bleeding tendency and a variety of causative F11 gene mutations. The molecular basis of FXI deficiency in 14 patients from ten unrelated families in Turkey was analysed to establish genotype-phenotype correlations and inheritance of the mutations in the patients' families. Fourteen index cases with a diagnosis of FXI deficiency and family members of these patients were enrolled into the study. The patients' F11 genes were amplified by polymerase chain reaction and subjected to direct DNA sequencing analysis. The findings were analysed statistically using bivariate correlations, Pearson's correlation coefficient and the nonparametric Mann-Whitney test. Direct DNA sequencing analysis of the F11 genes revealed that all of the 14 patients had a F11 gene mutation. Eight different mutations were identified in the apple 1, apple 2 or serine protease domains, except one which was a splice site mutation. Six of the mutations were recurrent. Two of the mutations were novel missense mutations, p.Val522Gly and p.Cys581Arg, within the catalytic domain. The p.Trp519Stop mutation was observed in two families whereas all the other mutations were specific to a single family. Identification of mutations confirmed the genetic heterogeneity of FXI deficiency. Most of the patients with mutations did not have any bleeding complications, whereas some had severe bleeding symptoms. Genetic screening for F11 gene mutations is important to decrease the mortality and morbidity rate associated with FXI deficiency, which can be life-threatening if bleeding occurs in tissues with high fibrinolytic activity.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].
Fukuda, H; Hiramatsu, K
1997-05-01
Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.
Mutations in the pericentrin (PCNT) gene cause primordial dwarfism
Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Dörfler, Arnd; Kinning, Esther; Megarbane, André; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Dörr, Helmuth-Günther; Reis, André
2008-01-01
Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss-of-function mutations in the centrosomal pericentrin (PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial dwarfism
Tuffery, S; Lenk, U; Roberts, R G; Coubes, C; Demaille, J; Claustres, M
1995-01-01
Approximately one-third of the mutations responsible for Duchenne muscular dytrophy (DMD) do not involve gross rearrangements of the dystrophin gene. Methods for intensive mutation screening have recently been applied to this immense gene, which resulted in the identification of a number of point mutations in DMD patients, mostly translation-terminating mutations. A number of data raised the possibility that the C-terminal region of dystrophin might be involved in some cases of mental retardation associated with DMD. Using single-strand conformation analysis of products amplified by polymerase chain reaction (PCR-SSCA) to screen the terminal domains of the dystrophin gene (exons 60-79) of 20 unrelated patients with DMD or BMD, we detected two novel point mutations in two mentally retarded DMD patients: a 1-bp deletion in exon 70 (10334delC) and a 5' splice donor site alteration in intron 69 (10294 + 1G-->T). Both mutations should result in a premature translation termination of dystrophin. The possible effects on the reading frame were analyzed by the study of reverse transcripts amplified from peripheral blood lymphocytes mRNA and by the protein truncation test.
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
Cai, Tao; Yang, Liu; Cai, Wanshi; Guo, Sen; Yu, Ping; Li, Jinchen; Hu, Xueyu; Yan, Ming; Shao, Qianzhi; Jin, Yan; Sun, Zhong Sheng; Luo, Zhuo-Jing
2015-06-30
Spondylolysis is a fracture in part of the vertebra with a reported prevalence of about 3-6% in the general population. Genetic etiology of this disorder remains unknown. The present study was aimed at identifying genomic mutations in patients with dysplastic spondylolysis as well as the potential pathogenesis of the abnormalities. Whole-exome sequencing and functional analysis were performed for patients with spondylolysis. We identified a novel heterozygous mutation (c.2286A > T; p.D673V) in the sulfate transporter gene SLC26A2 in five affected subjects of a Chinese family. Two additional mutations (e.g., c.1922A > G; p.H641R and g.18654T > C in the intron 1) in the gene were identified by screening a cohort of 30 unrelated patients with the disease. In situ hybridization analysis showed that SLC26A2 is abundantly expressed in the lumbosacral spine of the mouse embryo at day 14.5. Sulfate uptake activities in CHO cells transfected with mutant SLC26A2 were dramatically reduced compared with the wild type, confirming the pathogenicity of the two missense mutations. Further analysis of the gene-disease network revealed a convergent pathogenic network for the development of lumbosacral spine. To our knowledge, our findings provide the first identification of autosomal dominant SLC26A2 mutations in patients with dysplastic spondylolysis, suggesting a new clinical entity in the pathogenesis of chondrodysplasia involving lumbosacral spine. The analysis of the gene-disease network may shed new light on the study of patients with dysplastic spondylolysis and spondylolisthesis as well as high-risk individuals who are asymptomatic.
Directory of Open Access Journals (Sweden)
Srikanta Guria
2014-01-01
Full Text Available Thyroid peroxidase (TPO is the key enzyme in the biosynthesis of thyroid hormones. We aimed to identify the spectrum of mutations in the TPO gene leading to hypothyroidism in the population of West Bengal to establish the genetic etiology of the disease. 200 hypothyroid patients (case and their corresponding sex and age matched 200 normal individuals (control were screened depending on their clinical manifestations. Genomic DNA was isolated from peripheral blood samples and TPO gene (Exon 7 to Exon 14 was amplified by PCR. The PCR products were subjected to sequencing to identify mutations. Single nucleotide changes such as Glu 641 Lys, Asp 668 Asn, Thr 725 Pro, Asp 620 Asn, Ser 398 Thr, and Ala 373 Ser were found. Changes in the TPO were assayed in vitro to compare mutant and wild-type activities. Five mutants were enzymatically inactive in the guaiacol and iodide assays. This is a strong indication that the mutations are present at crucial positions of the TPO gene, resulting in inactivated TPO. The results of this study may help to develop a genetic screening protocol for goiter and hypothyroidism in the population of West Bengal.
Energy Technology Data Exchange (ETDEWEB)
Jett, J. [Lawrence Livermore National Lab., CA (United States)
1994-12-01
While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.
Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients
Directory of Open Access Journals (Sweden)
F.V. Perícole
2005-09-01
Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.
Mutation update for the PORCN gene
Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.
2011-01-01
Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,
[Mutation analysis of seven patients with Waardenburg syndrome].
Hao, Ziqi; Zhou, Yongan; Li, Pengli; Zhang, Quanbin; Li, Jiao; Wang, Pengfei; Li, Xiangshao; Feng, Yong
2016-06-01
To perform genetic analysis for 7 patients with Waardenburg syndrome. Potential mutation of MITF, PAX3, SOX10 and SNAI2 genes was screened by polymerase chain reaction and direct sequencing. Functions of non-synonymous polymorphisms were predicted with PolyPhen2 software. Seven mutations, including c.649-651delAGA (p.R217del), c.72delG (p.G24fs), c.185T>C (p.M62T), c.118C>T (p.Q40X), c.422T>C (p.L141P), c.640C>T (p.R214X) and c.28G>T(p.G43V), were detected in the patients. Among these, four mutations of the PAX3 gene (c.72delG, c.185T>C, c.118C>T and c.128G>T) and one SOX10 gene mutation (c.422T>C) were not reported previously. Three non-synonymous SNPs (c.185T>C, c.128G>T and c.422T>C) were predicted as harmful. Genetic mutations have been detected in all patients with Waardenburg syndrome.
DEFF Research Database (Denmark)
Refsgaard, Lena; Olesen, Morten Salling; Møller, Daniel Vega
2012-01-01
INTRODUCTION: Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a genetically determined heart disease characterized by fibrofatty infiltrations in the myocardium, right and/or left ventricular involvement, and ventricular tachyarrhythmias. Although ten genes have been associated with ARVC......, only about 40% of the patients have an identifiable disease-causing mutation. In the present study we aimed at investigating the involvement of the genes SCN1B-SCN4B, FHL1, and LMNA in the pathogenesis of ARVC. METHODS: Sixty-five unrelated patients (55 fulfilling ARVC criteria and 10 borderline cases...... of the variants was non-synonymous. No disease-causing mutations were identified. CONCLUSIONS: In our limited sized cohort the six studied candidate genes were not associated with ARVC....
DEFF Research Database (Denmark)
2013-01-01
The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....
Directory of Open Access Journals (Sweden)
Zhihong CHEN
2011-10-01
Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.
Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome
Directory of Open Access Journals (Sweden)
Jose Miguel Moreno-Ortiz
2016-01-01
Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.
Investigation of mutations in the HBB gene using the 1,000 genomes database.
Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea
2017-01-01
Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.
International Nuclear Information System (INIS)
Ostrowski, Jerzy; Dobosz, Anna Jerzak Vel; Jarosz, Dorota; Ruka, Wlodzimierz; Wyrwicz, Lucjan S; Polkowski, Marcin; Paziewska, Agnieszka; Skrzypczak, Magdalena; Goryca, Krzysztof; Rubel, Tymon; Kokoszyñska, Katarzyna; Rutkowski, Piotr; Nowecki, Zbigniew I
2009-01-01
Gastrointestinal stromal tumours (GISTs) represent a heterogeneous group of tumours of mesenchymal origin characterized by gain-of-function mutations in KIT or PDGFRA of the type III receptor tyrosine kinase family. Although mutations in either receptor are thought to drive an early oncogenic event through similar pathways, two previous studies reported the mutation-specific gene expression profiles. However, their further conclusions were rather discordant. To clarify the molecular characteristics of differentially expressed genes according to GIST receptor mutations, we combined microarray-based analysis with detailed functional annotations. Total RNA was isolated from 29 frozen gastric GISTs and processed for hybridization on GENECHIP ® HG-U133 Plus 2.0 microarrays (Affymetrix). KIT and PDGFRA were analyzed by sequencing, while related mRNA levels were analyzed by quantitative RT-PCR. Fifteen and eleven tumours possessed mutations in KIT and PDGFRA, respectively; no mutation was found in three tumours. Gene expression analysis identified no discriminative profiles associated with clinical or pathological parameters, even though expression of hundreds of genes differentiated tumour receptor mutation and expression status. Functional features of genes differentially expressed between the two groups of GISTs suggested alterations in angiogenesis and G-protein-related and calcium signalling. Our study has identified novel molecular elements likely to be involved in receptor-dependent GIST development and allowed confirmation of previously published results. These elements may be potential therapeutic targets and novel markers of KIT mutation status
Mutations of the Norrie gene in Korean ROP infants.
Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup
2002-12-01
The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.
Gene mutations in hepatocellular adenomas
DEFF Research Database (Denmark)
Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben
2015-01-01
is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....
Shahrokhi, Mahdiyeh; Shafiei, Mohammad; Galehdari, Hamid; Shariati, Gholamreza
2017-01-01
Mitochondrial trifunctional protein (MTP) is a hetero-octamer composed of eight parts (subunits): four α-subunits containing LCEH (long-chain 2,3-enoyl-CoA hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and four β-subunits that possess LCKT (long-chain 3-ketoacyl-CoA thiolase) activity which catalyzes three out of four steps in β-oxidation spiral of long-chain fatty acid. Its deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases. A blood spot was collected from the patient's original newborn screening card with parental informed consent. A newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS were performed. After isolation of DNA and Amplification of all exons of the HADHA and HADHB, directly Sequence analyses of all exons and the flanking introns both of genes were performed. Here, we report a novel mutation in a patient with MTP deficiency diagnosed with newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS and then confirmed by enzyme analysis in cultured fibroblasts and direct sequencing of the HADHA and HADHB genes. Molecular analysis of causative genes showed a missense mutation (p.Q385P) c.1154A > C in exon 14 of HADHB gene. Since this mutation was not found in 50 normal control cases; so it was concluded that c.1154A > C mutation was a causative mutation. Phenotype analysis of this mutation predicted pathogenesis which reduces the stability of the MTP protein complex.
Ocular findings associated with a Cys39Arg mutation in the Norrie disease gene.
Joos, K M; Kimura, A E; Vandenburgh, K; Bartley, J A; Stone, E M
1994-12-01
To diagnose the carriers and noncarriers in a family affected with Norrie disease based on molecular analysis. Family members from three generations, including one affected patient, two obligate carriers, one carrier identified with linkage analysis, one noncarrier identified with linkage analysis, and one female family member with indeterminate carrier status, were examined clinically and electrophysiologically. Linkage analysis had previously failed to determine the carrier status of one female family member in the third generation. Blood samples were screened for mutations in the Norrie disease gene with single-strand conformation polymorphism analysis. The mutation was characterized by dideoxy-termination sequencing. Ophthalmoscopy and electroretinographic examination failed to detect the carrier state. The affected individuals and carriers in this family were found to have a transition from thymidine to cytosine in the first nucleotide of codon 39 of the Norrie disease gene, causing a cysteine-to-arginine mutation. Single-strand conformation polymorphism analysis identified a patient of indeterminate status (by linkage) to be a noncarrier of Norrie disease. Ophthalmoscopy and electroretinography could not identify carriers of this Norrie disease mutation. Single-strand conformation polymorphism analysis was more sensitive and specific than linkage analysis in identifying carriers in this family.
DRUMS: a human disease related unique gene mutation search engine.
Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan
2011-10-01
With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.
Screening for mutations in two exons of FANCG gene in Pakistani population.
Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida
2017-06-01
Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.
Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.
2012-01-01
Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608
[Clinical features and COMP gene mutation in a family with a pseudoachondroplasia child].
Lu, Chun-Ting; Guo, Li; Zahng, Zhan-Hui; Lin, Wei-Xia; Song, Yuan-Zong; Feng, Lie
2013-11-01
This study aimed to report the clinical characteristics and COMP gene mutation of a family with pseudoachondroplasia (PSACH), a relatively rare spinal and epiphyseal dysplasia that is inherited as an autosomal dominant trait. Clinical information on a 5-year-2-month-old PSACH child and his parents was collected and analyzed. Diagnosis was confirmed by PCR amplification and direct sequencing of all the 19 exons and their flanking sequences of COMP gene, and the mutation was further ascertained by cloning analysis of exon 10. The child presented with short and stubby fingers, bow leg, short limb dwarfism and metaphysic broadening in long bone as well as lumbar lordosis. A mutation c.1048_1116del (p.Asn350_Asp372del) in exon 10, inherited from his father who did not demonstrate any phenotypic feature of PSACH, was detected in the child. PSACH was diagnosed definitively by means of COMP mutation analysis, on the basis of the child's clinical and imaging features. The non-penetrance phenomenon of COMP mutation was described for the first time in PSACH.
A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis
Directory of Open Access Journals (Sweden)
Chujun Wu
2016-12-01
Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.
Energy Technology Data Exchange (ETDEWEB)
Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)
1994-09-01
Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.
NUTRIGENOMIC ANALYSIS OF C677T MUTATION OF MTHFR GENE IN SLOVAK POPULATION
Directory of Open Access Journals (Sweden)
Jozef Bulla
2011-04-01
Full Text Available Total of 124 individuals originated from Slovak Republic has been nutrignomically analysed. Analysis was focused to mutation C677T of MTHFR gene detection and analysis of mutant genotypes frequency. Observed frequency of allele 677C was 0.6998 and allelic frequency of mutant variant 677T was 0.3992. Genotype frequency of mutant heterozygotes with 71% activity of MTHFR enzyme was 0,391 and mutant homozygotes with 33% MTHFR enzyme activity was 0.153. Result shows 64% of Slovak has decreased activity of enzyme MTHFR, and 14.3% of Slovak has predisposition to cancer, cardio vascular diseases, loss of fertility and many others complications according to improper nutrition, low folic acid and B12 vitamin intake. doi:10.5219/136
Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.
Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M
2001-10-01
Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.
A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.
Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora
2012-12-01
Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.
Molecular screening of pituitary adenomas for gene mutations and rearrangements
Energy Technology Data Exchange (ETDEWEB)
Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))
1993-07-01
Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.
Thyroglobulin Gene Mutation with Cold Nodule on Thyroid Scintigraphy
Directory of Open Access Journals (Sweden)
Toshio Kahara
2012-01-01
Full Text Available Thyroglobulin gene mutation is a rare cause of congenital hypothyroidism, but thyroglobulin gene mutations are thought to be associated with thyroid cancer development. A 21-year-old Japanese man treated with levothyroxine for congenital hypothyroidism had an enlarged thyroid gland with undetectable serum thyroglobulin despite elevated serum TSH level. The patient was diagnosed with thyroglobulin gene mutation, with compound heterozygosity for Gly304Cys missense mutation and Arg432X nonsense mutation. Ultrasonography showed a hypovascular large tumor in the left lobe that appeared as a cold nodule on thyroid scintigraphy. He underwent total thyroidectomy, but pathological study did not reveal findings of thyroid carcinoma, but rather a hyperplastic nodule with hemorrhage. Strong cytoplasmic thyroglobulin immunostaining was observed, but sodium iodide symporter immunostaining was hardly detected in the hyperplastic nodule. The clinical characteristics of patients with thyroglobulin gene mutations are diverse, and some patients are diagnosed by chance on examination of goiter in adults. The presence of thyroid tumors that appear as cold nodules on thyroid scintigraphy should consider the potential for thyroid carcinoma, if the patient has relatively low serum thyroglobulin concentration in relation to the degree of TSH without thyroglobulin autoantibody.
New mutations and an updated database for the patched-1 (PTCH1) gene.
Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J
2018-05-01
Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.
LENUS (Irish Health Repository)
Fernandez, Desiree M
2012-02-03
OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.
Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.
Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh
2014-03-15
Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Neemat Kassem, N.; Abel Hamid, A.; Tarek Attia, T.; Mahmoud, S.; Moemen, E.; Baathallah, Sh.; Safwat, E.; Khalaf, M.; Shaker, O.
2011-01-01
Mutations of the nucleophosmin (NPM-1) gene have been reported in 50-60% of acute myeloid leukemia (AML) patients with normal karyotype. This work was designed to study the prevalence and nature of NPM1 gene mutations in a group of Egyptian patients with AML to get an idea about the profile of NPM1 gene mutations in our society. In 45 previously untreated patients with de novo AML, peripheral blood and/or bone marrow samples from all patients were subjected to microscopic morphologic examination, cytochemical analysis, immuno phenotyping and karyotyping. Patients with normal cytogenetic results were selected for molecular analysis of NPM1 exon 12 by PCR amplification followed by DNA sequencing of the amplified product. Twenty-one patients (46.7%) had abnormal karyotype: six cases with ;(15;17), five cases with (8;21), five cases had trisomy 8, two cases carrying inv(3) and three cases had monosomy 7. The remaining 24 patients (53.3%) had normal karyotype. These patients were then subjected to molecular analysis. Out of these 24 patients with normal karyotype, mutant NPM-1 was detected in 11 patients (45.8%) by DNA sequencing; 2 cases showed type A mutation, 2 cases were harboring [ins 1015-4019 (CACG)], with point mutation [1006C→G], while the remaining 7 cases showed heterozygous deletion of nt A [del 1178 (A)]. Conclusion: Two novel NPM1 gene mutations were detected among our study population of AML patients identified as: the insertion CACG associated with point mutation, deletion of one base, or associated with point mutation. NPM1 gene mutations may become a new tool for monitoring minimal residual disease in AML with normal karyotype. Whether these previously unreported NPM-1 mutations will confer the same better outcome as previously reported mutations is currently unknown and warrants a larger study.
Khan, Nikhat; Lipsa, Anuja; Arunachal, Gautham; Ramadwar, Mukta; Sarin, Rajiv
2017-05-22
Colo-Rectal Cancer is a common cancer worldwide with 5-10% cases being hereditary. Familial Adenomatous Polyposis (FAP) syndrome is due to germline mutations in the APC or rarely MUTYH gene. NTHL1, POLD1, POLE have been recently reported in previously unexplained FAP cases. Unlike the Caucasian population, FAP phenotype and its genotypic associations have not been widely studied in several geoethnic groups. We report the first FAP cohort from South Asia and the only non-Caucasian cohort with comprehensive analysis of APC, MUTYH, NTHL1, POLD1, POLE genes. In this cohort of 112 individuals from 53 FAP families, we detected germline APC mutations in 60 individuals (45 families) and biallelic MUTYH mutations in 4 individuals (2 families). No NTHL1, POLD1, POLE mutations were identified. Fifteen novel APC mutations and a new Indian APC mutational hotspot at codon 935 were identified. Eight very rare FAP phenotype or phenotypes rarely associated with mutations outside specific APC regions were observed. APC genotype-phenotype association studies in different geo-ethnic groups can enrich the existing knowledge about phenotypic consequences of distinct APC mutations and guide counseling and risk management in different populations. A stepwise cost-effective mutation screening approach is proposed for genetic testing of south Asian FAP patients.
Mutation of the planar cell polarity gene VANGL1 in adolescent idiopathic scoliosis
DEFF Research Database (Denmark)
Andersen, Malene Rask; Farooq, Muhammad; Koefoed, Karen
2017-01-01
STUDY DESIGN: Mutation analysis of a candidate disease gene in a cohort of patients with moderate to severe Adolescent idiopathic scoliosis (AIS). OBJECTIVE: To investigate if damaging mutations in the planar cell polarity gene VANGL1 could be identified in AIS patients. SUMMARY OF BACKGROUND DATA......: AIS is a spinal deformity which occurs in 1-3% of the population. The cause of AIS is often unknown, but genetic factors are important in the etiology. Rare variants in genes encoding regulators of WNT/planar cell polarity (PCP) signaling were recently identified in AIS patients. METHODS: We analyzed...
Directory of Open Access Journals (Sweden)
David Enrique Aguilar Rodriguez
2005-01-01
Full Text Available Fanconi anaemia (FA is a recessive autosomal disease determined by mutations in genes of at least eleven complementation groups, with distinct distributions in different populations. As far as we know, there are no reports regarding the molecular characterisation of the disease in unselected FA patients in Brazil. OBECTIVE: This study aimed to investigate the most prevalent mutations of FANCA and FANCC genes in Brazilian patients with FA. METHODS: Genomic DNA obtained from 22 racially and ethnically diverse unrelated FA patients (mean age ± SD: 14.0 ± 7.8 years; 10 male, 12 female; 14 white, 8 black was analysed by polymerase chain reaction and restriction site assays for identification of FANCA (delta3788-3790 and FANCC (delta322G, IVS4+4A -> T, W22X, L496R, R548X, Q13X, R185X, and L554P gene mutations. RESULTS: Mutations in FANCA and FANCC genes were identified in 6 (27.3% and 14 (63.6% out of 22 patients, respectively. The disease could not be attributed to the tested mutations in the two remaining patients enrolled in the study (9.1%. The registry of the two most prevalent gene abnormalities (delta3788-3790 and IVS4 + 4 -> T revealed that they were present in 18.2% and 15.9% of the FA alleles, respectively. Additional FANCC gene mutations were found in the study, with the following prevalence: delta322G (11.4%, W22X (9.1%, Q13X (2.3%, L554P (2.3%, and R548X (2.3% of total FA alleles. CONCLUSION: These results suggest that mutations of FANCA and FANCC genes are the most prevalent mutations among FA patients in Brazil.
Novel mutations in the SOX10 gene in the first two Chinese cases of type IV Waardenburg syndrome.
Jiang, Lu; Chen, Hongsheng; Jiang, Wen; Hu, Zhengmao; Mei, Lingyun; Xue, Jingjie; He, Chufeng; Liu, Yalan; Xia, Kun; Feng, Yong
2011-05-20
We analyzed the clinical features and family-related gene mutations for the first two Chinese cases of type IV Waardenburg syndrome (WS4). Two families were analyzed in this study. The analysis included a medical history, clinical analysis, a hearing test and a physical examination. In addition, the EDNRB, EDN3 and SOX10 genes were sequenced in order to identify the pathogenic mutation responsible for the WS4 observed in these patients. The two WS4 cases presented with high phenotypic variability. Two novel heterozygous mutations (c.254G>A and c.698-2A>T) in the SOX10 gene were detected. The mutations identified in the patients were not found in unaffected family members or in 200 unrelated control subjects. This is the first report of WS4 in Chinese patients. In addition, two novel mutations in SOX10 gene have been identified. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.
Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer
Directory of Open Access Journals (Sweden)
Kylie L. Gorringe
2008-11-01
Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.
Zhao, Yang; Hosono, Katsuhiro; Suto, Kimiko; Ishigami, Chie; Arai, Yuuki; Hikoya, Akiko; Hirami, Yasuhiko; Ohtsubo, Masafumi; Ueno, Shinji; Terasaki, Hiroko; Sato, Miho; Nakanishi, Hiroshi; Endo, Shiori; Mizuta, Kunihiro; Mineta, Hiroyuki; Kondo, Mineo; Takahashi, Masayo; Minoshima, Shinsei; Hotta, Yoshihiro
2014-09-01
Retinitis pigmentosa (RP) is a highly heterogeneous genetic disease. The USH2A gene, which accounts for approximately 74-90% of Usher syndrome type 2 (USH2) cases, is also one of the major autosomal recessive RP (arRP) causative genes among Caucasian populations. To identify disease-causing USH2A gene mutations in Japanese RP patients, all 73 exons were screened for mutations by direct sequencing. In total, 100 unrelated Japanese RP patients with no systemic manifestations were identified, excluding families with obvious autosomal dominant inheritance. Of these 100 patients, 82 were included in this present study after 18 RP patients with very likely pathogenic EYS (eyes shut homolog) mutations were excluded. The mutation analysis of the USH2A revealed five very likely pathogenic mutations in four patients. A patient had only one very likely pathogenic mutation and the others had two of them. Caucasian frequent mutations p.C759F in arRP and p.E767fs in USH2 were not found. All the four patients exhibited typical clinical features of RP. The observed prevalence of USH2A gene mutations was approximately 4% among Japanese arRP patients, and the profile of the USH2A gene mutations differed largely between Japanese patients and previously reported Caucasian populations.
Clinical significance of FLG gene mutations in children with atopic dermatitis
Directory of Open Access Journals (Sweden)
E. E. Varlamov
2015-01-01
Full Text Available Skin barrier dysfunction due to deficiency of the skin protein filaggrin is one of the factors involved in the pathogenesis of atopic dermatitis. Objective: to determine the clinical significance of 2282 del CAGT, R501X, R2447X, and S3247X mutations in the FLG gene in children with atopic dermatitis. The investigation included 58 children with atopic dermatitis. A molecular genetic analysis of the four mutations in the FLG gene was done in all the children. In the patients with FLG gene mutations, there was a tendency towards a higher frequency of sensitization to house dust allergens, significantly more often sensitization to cat epidermal allergen, and significantly higher levels of specific IgE to the cat epidermis. Conclusion. Mutations in the FLG gene encoding the protein filaggrin raise the risk for sensitization to domestic and epidermal allergens and, in case of already existing sensitization to the cat epidermis, the patients are found with a high degree of probability to have the high concentration of specific IgE to this allergen. The above fact justifies the need to place special emphasis on measures to eliminate house dust allergens, and cat epidermis allergen in particular, and to personalize approaches to therapy and prevention of atopic dermatitis in children.
DNA sequence analysis of the mutational specificity of u.v. light in the SUP4-o gene of yeast
International Nuclear Information System (INIS)
Kunz, B.A.; Mis, J.R.A.; Pierce, M.K.; Giroux, C.N.
1987-01-01
Mutations induced in the SUP4-o gene of Saccharomyces cerevisiae by u.v. irradiation have been characterized. DNA sequence analysis of 120 mutants revealed that u.v. induced all types of base substitutions, although transitions, in particular G:C → A:T events predominated. In addition, a small number of single base pair deletions and double mutations, occurring in tandem or separated by a few base pairs, were recovered. The base pair substitutions were not distributed randomly in the SUP4-o gene and, with one exception, were all located at sites of adjacent pyrimidines, suggesting they were targeted by u.v. photolesions. A substantial fraction of the mutations were detected at hotspots for u.v. mutagenesis. The majority of changes occurred at the 3' base of dipyrimidine sequences where both cyclobutane dimers and [6-4]-photoproducts could form. Approximately one-third of the induced base substitutions were found at potential pyrimidine dimer sites where [6-4]-photoproducts would be expected to occur rarely. Possible origins of the induced mutations and the role of cyclobutane dimers as premutational u.v. lesions in yeast are considered. (author)
Advances in sarcoma gene mutations and therapeutic targets.
Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng
2018-01-01
Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.
Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene
Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.
2015-01-01
The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870
Samaras, Anastasios; Madesis, Panagiotis; Karaoglanidis, George S
2016-01-01
Botrytis cinerea , is a high risk pathogen for fungicide resistance development. Pathogen' resistance to SDHIs is associated with several mutations in sdh gene. The diversity of mutations and their differential effect on cross-resistance patterns among SDHIs and the fitness of resistant strains necessitate the availability of a tool for their rapid identification. This study was initiated to develop and validate a high-resolution melting (HRM) analysis for the identification of P225H/F/L//T, N230I, and H272L/R/Y mutations. Based on the sequence of sdh B subunit of resistant and sensitive isolates, a universal primer pair was designed. The specificity of the HRM analysis primers was verified to ensure against the cross-reaction with other fungal species and its sensitivity was evaluated using concentrations of known amounts of mutant's DNA. The melting curve analysis generated nine distinct curve profiles, enabling the discrimination of all the four mutations located at codon 225, the N230I mutation, the three mutations located in codon 272, and the non-mutated isolates (isolates of wild-type sensitivity). Similar results were obtained when DNA was extracted directly from artificially inoculated strawberry fruit. The method was validated by monitoring the presence of sdh B mutations in samples of naturally infected strawberry fruits and stone fruit rootstock seedling plants showing damping-off symptoms. HRM analysis data were compared with a standard PIRA-PCR technique and an absolute agreement was observed suggesting that in both populations the H272R mutation was the predominant one, while H272Y, N230I, and P225H were detected in lower frequencies. The results of the study suggest that HRM analysis can be a useful tool for sensate, accurate, and rapid identification of several sdh B mutations in B. cinerea and it is expected to contribute in routine fungicide resistance monitoring or assessments of the effectiveness of anti-resistance strategies implemented in
Directory of Open Access Journals (Sweden)
Anastasios Samaras
2016-11-01
Full Text Available Botrytis cinerea, is a high-risk pathogen for fungicide resistance development. Pathogen` resistance to SDHIs is associated with several mutations in sdh gene. The diversity of mutations and their differential effect on cross-resistance patterns among SDHIs and the fitness of resistant strains necessitate the availability of a tool for their rapid identification. This study was initiated to develop and validate a high-resolution melting (HRM analysis for the identification of P225H/F/L//T, N230I and H272L/R/Y mutations. Based on the sequence of sdhB subunit of resistant and sensitive isolates, a universal primer pair was designed. The specificity of the HRM analysis primers was verified to ensure against the cross-reaction with other fungal species and its sensitivity was evaluated using concentrations of known amounts of mutant`s DNA. The melting curve analysis generated nine distinct curve profiles, enabling the discrimination of all the 4 mutations located at codon 225, the N230I mutation, the 3 mutations located in codon 272 and the non mutated isolates (isolates of wild type sensitivity. Similar results were obtained when DNA was extracted directly from artificially inoculated strawberry fruit. The method was validated by monitoring the presence of sdhB mutations in samples of naturally infected strawberry fruits and stone fruit rootstock seedling plants showing damping off symptoms. HRM analysis data were compared with a standard PIRA-PCR technique and an absolute agreement was observed suggesting that in both populations the H272R mutation was the predominant one, while H272Y, N230I and P225H were detected in lower frequencies. The results of the study suggest that HRM analysis can be a useful tool for sensate, accurate and rapid identification of several sdhB mutations in B. cinerea and it is expected to contribute in routine fungicide resistance monitoring or assessments of the effectiveness of antiresistance strategies implemented in
Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro
2011-05-01
Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Clinical profile and mutation analysis of xeroderma pigmentosum in Indian patients.
Tamhankar, Parag M; Iyer, Shruti V; Ravindran, Shyla; Gupta, Neerja; Kabra, Madhulika; Nayak, Chitra; Kura, Mahendra; Sanghavi, Swapnil; Joshi, Rajesh; Chennuri, Vasundhara Sridhar; Khopkar, Uday
2015-01-01
Xeroderma pigmentosum (XP) is an autosomal recessive genetic disorder characterized by cutaneous and ocular photosensitivity and an increased risk of developing cutaneous neoplasms. Progressive neurological abnormalities develop in a quarter of XP patients. To study the clinical profile and perform a mutation analysis in Indian patients with xeroderma pigmentosum. Ten families with 13 patients with XP were referred to our clinic over 2 years. The genes XPA, XPB and XPC were sequentially analyzed till a pathogenic mutation was identified. Homozygous mutations in the XPA gene were seen in patients with moderate to severe mental retardation (6/10 families) but not in those without neurological features. Two unrelated families with a common family name and belonging to the same community from Maharashtra were found to have an identical mutation in the XPA gene, namely c.335_338delTTATinsCATAAGAAA (p.F112SfsX2). Testing of the XPC gene in two families with four affected children led to the identification of the novel mutations c.1243C>T or p.R415X and c.1677C>A or p.Y559X. In two families, mutations could not be identified in XPA, XPB and XPC genes. The sample size is small. Indian patients who have neurological abnormalities associated with XP should be screened for mutations in the XPA gene.
Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene
Directory of Open Access Journals (Sweden)
Fernanda Veronese Oliveira
2014-01-01
Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.
Cytogenetic Profile and Gene Mutations of Childhood Acute Lymphoblastic Leukemia
Directory of Open Access Journals (Sweden)
Nawaf Alkhayat
2017-07-01
Full Text Available Background: Childhood acute lymphoblastic leukemia (ALL is characterized by recurrent genetic aberrations. The identification of those abnormalities is clinically important because they are considered significant risk-stratifying markers. Aims: There are insufficient data of cytogenetic profiles in Saudi Arabian patients with childhood ALL leukemia. We have examined a cohort of 110 cases of ALL to determine the cytogenetic profiles and prevalence of FLT3 mutations and analysis of the more frequently observed abnormalities and its correlations to other biologic factors and patient outcomes and to compare our results with previously published results. Materials and methods: Patients —We reviewed all cases from 2007 to 2016 with an established diagnosis of childhood ALL. Of the 110 patients, 98 were B-lineage ALL and 12 T-cell ALL. All the patients were treated by UKALL 2003 protocol and risk stratified according previously published criteria. Cytogenetic analysis —Chromosome banding analysis and fluorescence in situ hybridization were used to detect genetic aberrations. Analysis of FLT3 mutations —Bone marrow or blood samples were screened for FLT3 mutations (internal tandem duplications, and point mutations, D835 using polymerase chain reaction methods. Result: Cytogenetic analysis showed chromosomal anomalies in 68 out of 102 cases with an overall incidence 66.7%. The most frequent chromosomal anomalies in ALL were hyperdiploidy, t(9;22, t(12;21, and MLL gene rearrangements. Our data are in accordance with those published previously and showed that FLT3 mutations are not common in patients with ALL (4.7% and have no prognostic relevance in pediatric patients with ALL. On the contrary, t(9;22, MLL gene rearrangements and hypodiploidy were signs of a bad prognosis in childhood ALL with high rate of relapse and shorter overall survival compared with the standard-risk group ( P = .031.The event-free survival was also found to be worse ( P
Congenital Hypopituitarism due to POU1F1 Gene Mutation
Directory of Open Access Journals (Sweden)
Ni-Chung Lee
2011-01-01
Full Text Available POU1F1 (Pit-1; Gene ID 5449 is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome, elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S mutation. The rarity of the disease can result in delayed diagnosis and treatment.
Update of the androgen receptor gene mutations database.
Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M
1999-01-01
The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.
Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.
2017-01-01
Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100
Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat
2009-10-01
Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.
MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS
Directory of Open Access Journals (Sweden)
D. S. Mikhaylenko
2016-01-01
Full Text Available In the recent years, the full exome sequencing helped to reveal a set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the
Shastry, B S; Pendergast, S D; Hartzer, M K; Liu, X; Trese, M T
1997-05-01
Retinopathy of prematurity (ROP) is a retinal vascular disease occurring in infants with short gestational age and low birth weight and can lead to retinal detachment (ROP stages 4 and 5). X-linked familial exudative vitreoretinopathy is phenotypically similar to ROP and has been associated with mutations in the Norrie disease (ND) gene in some cases. To determine if similar mutations in the ND gene may play a role in the development of advanced ROP. Clinical examination and molecular genetic analysis were performed on 16 children, including 2 dizygotic and 1 monozygotic twin pairs, and their parents from 13 families. Sequencing of the amplified products revealed missense mutations (R121W and L108P) in the third exon of the ND gene in 4 patients. These mutations were not present in an unaffected premature twin, 2 children with regressed stage 3 ROP, the parents, or in 50 unrelated healthy control subjects. These findings suggest that mutations in the ND gene may play a role in the development of severe ROP in premature infants.
Isocitrate dehydrogenase 1 and 2 genes mutations and MGMT methylation in gliomas
Directory of Open Access Journals (Sweden)
D. V. Tabakov
2017-01-01
Full Text Available Gliomas are the most common brain tumors. It is difficult to detect them at early stages of disease and there is a few available therapies providing significant improvement in survival. Mutations of isocitrate dehydrogenase 1 and 2 genes (IDH1 and IDH2 play significant role in gliomogenesis, diagnostics and selection of patient therapy. We tested the distribution of IDH1 and IDH2 mutations in gliomas of different histological types and grades of malignancy by DNA melting analysis using our protocol with a sensitivity of 5 %. The results of this assay were confirmed by conventional Sanger sequencing. IDH1/2 mutations were detected in 74 % of lower grade gliomas (II and III, World Health Organization and in 14 % of glioblastomas (IV, World Health Organization. Mutation rate in gliomas with oligodendroglioma component were significantly higher then in other glioma types (р = 0.014. The IDH1 mutations was the most common (79 % of general mutation number. IDH1/2 mutations can induce aberrant gene methylation. Detection of methylation rate of the gene encoding for O6-methylguanine-DNA-methyltransferase (MGMT, predictive biomarker for treatment of gliomas with the alkylating agents, has demonstrated a partial association with IDH1/2 mutations. In 73 % of IDH1/2-mutant tumors MGMT promoter methylation were observed. At the same time IDH1/2 mutations were not revealed in 67 % tumors with MGMT promoter methylation. These results indicate existence of another mechanism of MGMT methylation in gliomas. Our data strong support for necessity of both markers testing when patient therapy is selected.
Mutations in rpoB and katG genes in Mycobacterium isolates from the Southeast of Mexico
Directory of Open Access Journals (Sweden)
R Zenteno-Cuevas
2009-05-01
Full Text Available The most frequent mutations associated with rifampin and isoniazid resistance in Mycobacterium are the substitutions at codons 531 and 315 in the rpoB and katG genes, respectively. Hence, the aim of this study was to characterize these mutations in Mycobacterium isolates from patients suspected to be infected with drug-resistant (DR pulmonary tuberculosis (TB in Veracruz, Mexico. Drug susceptibility testing of 25 clinical isolates revealed that five were susceptible while 20 (80% were DR (15% of the annual prevalence for Veracruz. Of the DR isolates, 15 (75% were resistant to rifampin, 17 (85% to isoniazid and 15 (75% were resistant to both drugs (MDR. Sequencing analysis performed in the isolates showed that 14 (93% had mutations in the rpoB gene; seven of these (47% exhibited a mutation at 531 (S[L. Ten (58% of the 20 resistant isolates showed mutations in katG; nine (52% of these 10 exhibited a mutation at 315 (S[T. In conclusion, the DR profile of the isolates suggests a significant number of different DR-TB strains with a low frequency of mutation at codons 531 and 315 in rpoB and katG, respectively. This result leads us to consider different regions of the same genes, as well as other genes for further analysis, which is important if a genetic-based diagnosis of DR-TB is to be developed for this region.
Directory of Open Access Journals (Sweden)
Li Ma
2013-08-01
Full Text Available AIM: To screen mutations in the retinitis pigmentosa 1 (RP1 gene and the rhodopsin (RHO gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800 and one non-coding variant (rs56340615 were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling
2013-01-01
To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene
International Nuclear Information System (INIS)
Romeo, G.; Hassan, H.J.; Staempfli, S.
1987-01-01
The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees
Directory of Open Access Journals (Sweden)
Hashishe Mervat M
2010-06-01
Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
Directory of Open Access Journals (Sweden)
Dong Hua Cao
2014-09-01
Full Text Available OBJECTIVE: Hemophilia B is caused by coagulation defects in the factor IX gene located in Xq27.1 on the X chromosome. A wide range of mutations, showing extensive molecular heterogeneity, have been described in hemophilia B patients. Our study was aimed at genetic analysis and prenatal diagnosis of hemophilia B in order to further elucidate the pathogenesis of the hemophilia B pedigree in China. METHODS: Polymerase chain reaction amplification and direct sequencing of all the coding regions was conducted in hemophilia B patients and carriers. Prenatal diagnosis of the proband was conducted at 20 weeks. RESULTS: We identified the novel point mutation 10.389 A>G, located upstream of the intron 3 acceptor site in hemophilia B patients. The fetus of the proband’s cousin was identified as a carrier. CONCLUSION: Our identification of a novel mutation in the F9 gene associated with hemophilia B provides novel insight into the pathogenesis of this genetically inherited disorder and also represents the basis of prenatal diagnosis.
Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome
Directory of Open Access Journals (Sweden)
Mona L. Essawi
2013-11-01
Conclusion: Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS.
Association between nucleotide mutation of eNOS gene and serum ...
African Journals Online (AJOL)
Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...
Gene mutation-based and specific therapies in precision medicine.
Wang, Xiangdong
2016-04-01
Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.
A patient with Werner syndrome and adiponectin gene mutation.
Hashimoto, Naotake; Hatanaka, Sachiko; Yokote, Koutaro; Kurosawa, Hiroko; Yoshida, Tomohiko; Iwai, Rie; Takahashi, Hidenori; Yoshida, Katsuya; Horie, Atsuya; Sakurai, Kenichi; Yagui, Kazuo; Saito, Yasushi; Yoshida, Shouji
2007-01-01
Werner syndrome is a premature aging disease characterized by genomic instability and increased cancer risk. Here, we report a 45-year-old diabetic man as the first Werner syndrome patient found to have an adiponectin gene mutation. Showing graying and loss of hair, skin atrophy, and juvenile cataract, he was diagnosed with Werner syndrome type 4 by molecular analysis. His serum adiponectin concentration was low. In the globular domain of the adiponectin gene, I164T in exon 3 was detected. When we examined effects of pioglitazone (15 mg/day) on serum adiponectin multimer and monomer concentrations using selective assays, the patient's relative percentage increased in adiponectin concentration was almost same as that in the 18 diabetic patients without an adiponectin mutation, but the absolute adiponectin concentration was half of those seen in diabetic patients treated with the same pioglitazone dose who had no adiponectin mutation. The response suggested that pioglitazone treatment might help to prevent future Werner syndrome-related acceleration of atherosclerosis. Present and further clinical relevant to atherosclerosis in this patient should be imformative concerning the pathogenesis and treatment of atherosclerosis in the presence of hypoadiponectinemia and insulin resistance.
Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.
Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil
2017-06-02
The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC
A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia
Energy Technology Data Exchange (ETDEWEB)
Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)
1995-01-02
Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.
Novel mutations in the USH1C gene in Usher syndrome patients.
Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María
2010-12-31
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.
Directory of Open Access Journals (Sweden)
Junyu Zhang
Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.
Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing
2007-11-01
Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.
Chan, Kwok Keung; Wong, Corinne Kung Yen; Lui, Vincent Chi Hang; Tam, Paul Kwong Hang; Sham, Mai Har
2003-10-15
SOX10 is a member of the SOX gene family related by homology to the high-mobility group (HMG) box region of the testis-determining gene SRY. Mutations of the transcription factor gene SOX10 lead to Waardenburg-Hirschsprung syndrome (Waardenburg-Shah syndrome, WS4) in humans. A number of SOX10 mutations have been identified in WS4 patients who suffer from different extents of intestinal aganglionosis, pigmentation, and hearing abnormalities. Some patients also exhibit signs of myelination deficiency in the central and peripheral nervous systems. Although the molecular bases for the wide range of symptoms displayed by the patients are still not clearly understood, a few target genes for SOX10 have been identified. We have analyzed the impact of six different SOX10 mutations on the activation of SOX10 target genes by yeast one-hybrid and mammalian cell transfection assays. To investigate the transactivation activities of the mutant proteins, three different SOX target binding sites were introduced into luciferase reporter gene constructs and examined in our series of transfection assays: consensus HMG domain protein binding sites; SOX10 binding sites identified in the RET promoter; and Sox10 binding sites identified in the P0 promoter. We found that the same mutation could have different transactivation activities when tested with different target binding sites and in different cell lines. The differential transactivation activities of the SOX10 mutants appeared to correlate with the intestinal and/or neurological symptoms presented in the patients. Among the six mutant SOX10 proteins tested, much reduced transactivation activities were observed when tested on the SOX10 binding sites from the RET promoter. Of the two similar mutations X467K and 1400del12, only the 1400del12 mutant protein exhibited an increase of transactivation through the P0 promoter. While the lack of normal SOX10 mediated activation of RET transcription may lead to intestinal aganglionosis
A novel mutation of the fibrillin gene causing Ectopia lentis
Energy Technology Data Exchange (ETDEWEB)
Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))
1994-02-01
Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.
Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site
D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo
2011-01-01
The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308
Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene
Energy Technology Data Exchange (ETDEWEB)
Goltsov, A.A.; Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States)); Konecki, D.S.; Lichter-Konecki, U.
1992-09-01
The HindIII RFLP in the human phenylalanine hydroxylase (PAH) gene is caused by the presence of an AT-rich (70%) minisatellite region. This region contains various multiples of 30-bp tandem repeats and is located 3 kb downstream of the final exon of the gene. PCR-mediated amplification of this region from haplotyped PAH chromosomes indicates that the previously reported 4.0-kb HindIII allele contains three of these repeats, while the 4.4-kb HindIII allele contains 12 of these repeats. The 4.2-kb HindIII fragment can contain six, seven, eight, or nine copies of this repeat. These variations permit more detailed analysis of mutant haplotypes 1, 5, 6, and, possibly, others. Kindred analysis in phenylketonuria families demonstrates Mendelian segregation of these VNTR alleles, as well as associations between theses alleles and certain PAH mutations. The R261Q mutation, associated with haplotype 1, is associated almost exclusively with an allele containing eight repeats; the R408W mutation, when occurring on a haplotype 1 background, may also be associated with the eight-repeat VNTR allele. Other PAH mutations associated with haplotype 1, R252W and P281L, do not appear to segregate with specific VNTR alleles. The IVS-10 mutation, when associated with haplotype 6, is associated exclusively with an allele containing seven repeats. The combined use of this VNTR system and the existing RFLP haplotype system will increase the performance of prenatal diagnostic tests based on haplotype analysis. In addition, this VNTR may prove useful in studies concerning the origins and distributions of PAH mutations in different human populations. 32 refs., 3 figs., 3 tabs.
Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E
2002-01-01
Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.
Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong
2016-10-01
Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.
Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).
Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R
2014-11-18
Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.
NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.
Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran
2017-09-01
To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.
Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna
2015-09-01
Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many
Investigation of the Mitochondrial ATPase 6/8 and tRNA(Lys) Genes Mutations in Autism.
Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila
2012-01-01
Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNA(Lys) genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions.
DNA mutation motifs in the genes associated with inherited diseases.
Directory of Open Access Journals (Sweden)
Michal Růžička
Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.
Directory of Open Access Journals (Sweden)
Marchiani Valentina
2011-06-01
Full Text Available Abstract Background The breadth of the clinical spectrum underlying Pelizaeus-Merzbacher disease and spastic paraplegia type 2 is due to the extensive allelic heterogeneity in the X-linked PLP1 gene encoding myelin proteolipid protein (PLP. PLP1 mutations range from gene duplications of variable size found in 60-70% of patients to intragenic lesions present in 15-20% of patients. Methods Forty-eight male patients from 38 unrelated families with a PLP1-related disorder were studied. All DNA samples were screened for PLP1 gene duplications using real-time PCR. PLP1 gene sequencing analysis was performed on patients negative for the duplication. The mutational status of all 14 potential carrier mothers of the familial PLP1 gene mutation was determined as well as 15/24 potential carrier mothers of the PLP1 duplication. Results and Conclusions PLP1 gene duplications were identified in 24 of the unrelated patients whereas a variety of intragenic PLP1 mutations were found in the remaining 14 patients. Of the 14 different intragenic lesions, 11 were novel; these included one nonsense and 7 missense mutations, a 657-bp deletion, a microdeletion and a microduplication. The functional significance of the novel PLP1 missense mutations, all occurring at evolutionarily conserved residues, was analysed by the MutPred tool whereas their potential effect on splicing was ascertained using the Skippy algorithm and a neural network. Although MutPred predicted that all 7 novel missense mutations would be likely to be deleterious, in silico analysis indicated that four of them (p.Leu146Val, p.Leu159Pro, p.Thr230Ile, p.Ala247Asp might cause exon skipping by altering exonic splicing elements. These predictions were then investigated in vitro for both p.Leu146Val and p.Thr230Ile by means of RNA or minigene studies and were subsequently confirmed in the case of p.Leu146Val. Peripheral neuropathy was noted in four patients harbouring intragenic mutations that altered RNA
2010-04-01
... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...
Association of a novel point mutation in MSH2 gene with familial multiple primary cancers
Directory of Open Access Journals (Sweden)
Hai Hu
2017-10-01
Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy.
Maugeri, A; Klevering, B J; Rohrschneider, K; Blankenagel, A; Brunner, H G; Deutman, A F; Hoyng, C B; Cremers, F P
2000-10-01
The photoreceptor cell-specific ATP-binding cassette transporter gene (ABCA4; previously denoted "ABCR") is mutated, in most patients, with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients from Germany and The Netherlands with isolated CRD. Single-strand conformation-polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans.
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Directory of Open Access Journals (Sweden)
Kamakari Smaragda
2018-01-01
Full Text Available Aim. To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1. Materials and Methods. A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results. An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%. Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%. In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions. By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations.
Wang, Hong-Han; Chen, Hong-Sheng; Li, Hai-Bo; Zhang, Hua; Mei, Ling-Yun; He, Chu-Feng; Wang, Xing-Wei; Men, Mei-Chao; Jiang, Lu; Liao, Xin-Bin; Wu, Hong; Feng, Yong
2014-03-15
Waardenburg syndrome type IV (WS4) is a rare genetic disorder, characterized by auditory-pigmentary abnormalities and Hirschsprung disease. Mutations of the EDNRB gene, EDN3 gene, or SOX10 gene are responsible for WS4. In the present study, we reported a case of a Chinese patient with clinical features of WS4. In addition, the three genes mentioned above were sequenced in order to identify whether mutations are responsible for the case. We revealed a novel nonsense mutation, c.1063C>T (p.Q355*), in the last coding exon of SOX10. The same mutation was not found in three unaffected family members or 100 unrelated controls. Then, the function and mechanism of the mutation were investigated in vitro. We found both wild-type (WT) and mutant SOX10 p.Q355* were detected at the expected size and their expression levels are equivalent. The mutant protein also localized in the nucleus and retained the DNA-binding activity as WT counterpart; however, it lost its transactivation capability on the MITF promoter and acted as a dominant-negative repressor impairing function of the WT SOX10. Copyright © 2014 Elsevier B.V. All rights reserved.
Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.
Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco
2017-01-01
Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.
Directory of Open Access Journals (Sweden)
Abdelaziz Tlili
Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.
Three novel and two known androgen receptor gene mutations ...
Indian Academy of Sciences (India)
gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.
Law-medicine interfacing: patenting of human genes and mutations.
Fialho, Arsenio M; Chakrabarty, Ananda M
2011-08-01
Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.
Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.
Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z
2016-10-31
To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
Congenital hypopituitarism due to POU1F1 gene mutation.
Lee, Ni-Chung; Tsai, Wen-Yu; Peng, Shinn-Forng; Tung, Yi-Ching; Chien, Yin-Hsiu; Hwu, Wuh-Liang
2011-01-01
POU1F1 (Pit-1; Gene ID 5449) is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome), elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S) mutation. The rarity of the disease can result in delayed diagnosis and treatment. Copyright © 2011 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All rights reserved.
Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog
Directory of Open Access Journals (Sweden)
Rosa Gagliardi B.
2013-08-01
Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.
Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S
1999-01-01
We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262
Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P
2000-08-01
We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.
Sunga, Annette Y; Ricker, Charité; Espenschied, Carin R; Castillo, Danielle; Melas, Marilena; Herzog, Josef; Bannon, Sarah; Cruz-Correa, Marcia; Lynch, Patrick; Solomon, Ilana; Gruber, Stephen B; Weitzel, Jeffrey N
2017-04-01
Lynch syndrome (LS), the most common hereditary colorectal cancer syndrome, is caused by mismatch repair (MMR) gene mutations. However, data about MMR mutations in Hispanics are limited. This study aims to describe the spectrum of MMR mutations in Hispanics with LS and explore ancestral origins. This case series involved an IRB-approved retrospective chart review of self-identified Hispanic patients (n = 397) seen for genetic cancer risk assessment at four collaborating academic institutions in California, Texas, and Puerto Rico who were evaluated by MMR genotyping and/or tumor analysis. A literature review was conducted for all mutations identified. Of those who underwent clinical genetic testing (n = 176), 71 had MMR gene mutations. Nine mutations were observed more than once. One third (3/9) of recurrent mutations and two additional mutations (seen only once) were previously reported in Spain, confirming the influence of Spanish ancestry on MMR mutations in Hispanic populations. The recurrent mutations identified (n = 9) included both previously reported mutations as well as unique mutations not in the literature. This is the largest report of Hispanic MMR mutations in North America; however, a larger sample and haplotype analyses are needed to better understand recurrent MMR mutations in Hispanic populations. Copyright © 2017. Published by Elsevier Inc.
Qin, Miao; Gong, Chunxiu; Qi, Zhan; Wu, Di; Liu, Min; Gu, Yi; Cao, Bingyan; Li, Wenjing; Liang, Xuejun
2014-12-01
delayed puberty, involving only one parent in 6 families, involving both in 2 families and the other one was an uncle having micropenis with a child. Among these 21 cases, only one boy's father had hyposmia and his first emission age was 14-15 years. Eleven patients accompanied abnormal sense of smelling and the olfactory organ abnormalities on MRI, 4 had olfactory organ abnormalities on MRI while they had good smelling function self-reportedly. We got 15 samples (12 KS and 3 nIHH cases) to screen the mutation of KAL1 (14 exons) and FGFR1 (18 exons). A splicing mutation c.1062+1G>A in KAL1 is identified in case 17 with IHH. One novel heterozygous FGFR1 mutation, a single base deletion mutation on the exon 1 c.27delC is identified in case 14. This mutation causes the premature termination codons. This pilot research showed that IHH/KS diagnosis in children depends on clinical manifestation rather than gene analysis. Small penis or cryptorchidism, smelling abnormality and positive familial history may contribute to the KS/HH diagnosis. MRI of olfactory bulb acts as important proof for diagnosis of KS. Mutations in KAL1 and FGFR1 gene are not main causes of Kallmann syndrome.
Mutational profile of KIT and PDGFRA genes in gastrointestinal stromal tumors in Peruvian samples
Directory of Open Access Journals (Sweden)
José Buleje
2015-02-01
Full Text Available Introduction: Gastrointestinal stromal tumors (GISTs are mesenchymal neoplasms usually caused by somatic mutations in the genes KIT (c-KIT or PDGFRA. Mutation characterization has become an important exam for GIST patients because it is useful in predicting the response to the inhibitors of receptor tyrosine kinase (RTK. Objectives: The aim of this study was to determine the frequency of KIT and PDGFRA mutations in 25 GIST samples collected over two years at two national reference hospitals in Peru. There were 21 samples collected from the Instituto Nacional de Enfermedades Neoplásicas (INEN, national cancer center and 4 samples collected from Hospital A. Loayza. Methods and materials: In this retrospective study, we performed polymerase chain reaction (PCR amplification and deoxyribonucleic acid (DNA sequencing of KIT (exons 9, 11, 13, and 17 and PDGFRA (exons 12 and 18 genes in 20 FFPE (formalin-fixed, paraffin-embedded and 5 frozen GIST samples. Results: We report 21 mutations, including deletions, duplications, and missense, no mutations in 2 samples, and 2 samples with no useful DNA for further analysis. Eighty-six percent of these mutations were located in exon 11 of KIT, and 14 % were located in exon 18 of PDGFRA. Conclusions: Our study identified mutations in 21 out of 25 GIST samples from 2 referential national hospitals in Peru, and the mutation proportion follows a global tendency observed from previous studies (i.e., the majority of samples presented KIT mutations followed by a minor percentage of PDGFRA mutations. This study presents the first mutation data of the KIT and PDGFRA genes from Peruvian individuals with GIST.
Energy Technology Data Exchange (ETDEWEB)
Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Choi, Seong-Jun [Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Shim, Hosup, E-mail: shim@dku.edu [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Department of Physiology, Dankook University School of Medicine, Cheonan (Korea, Republic of)
2014-10-03
Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.
International Nuclear Information System (INIS)
Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung; Choi, Seong-Jun; Shim, Hosup
2014-01-01
Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies
R102W mutation in the RS1 gene responsible for retinoschisis and recurrent glaucoma
Directory of Open Access Journals (Sweden)
Xiu-Feng Huang
2014-02-01
Full Text Available AIM: To identify the mutations in RS1 gene associated with typical phenotype of X-linked juvenile retinoschisis (XLRS and a rare condition of concomitant glaucoma.METHODS: Complete ophthalmic examinations were performed in the proband. The coding regions of the RS1 gene that encode retinoschisin were amplified by polymerase chain reaction and directly sequenced.RESULTS: The proband showed a typical phenotype of XLRS with large peripheral retinal schisis in both eyes, involving the macula and combined with foveal cystic change, reducing visual acuity. A typical phenotype of recurrent glaucoma with high intraocular pressure (IOP and reduced visual field was also demonstrated with the patient. Mutation analysis of RS1 gene revealed R102W (c.304C>T mutations in the affected male, and his mother was proved to be a carrier with the causative mutation and another synonymous polymorphism (c.576C>CT.CONCLUSION: We identified the genetic variations of a Chinese family with typical phenotype of XLRS and glaucoma. The severe XLRS phenotypes associated with R102W mutations reveal that the mutation determines a notable alteration in the function of the retinoschisin protein. Identification of the disease-causing mutation is beneficial for future clinical references.
Simplifying the detection of MUTYH mutations by high resolution melting analysis
International Nuclear Information System (INIS)
López-Villar, Isabel; Martínez-López, Joaquín; Ayala, Rosa; Wesselink, Jan; Morillas, Juan Diego; López, Elena; Marín, José Carlos; Díaz-Tasende, José; González, Sara; Robles, Luis
2010-01-01
MUTYH-associated polyposis (MAP) is a disorder caused by bi-allelic germline MUTYH mutation, characterized by multiple colorectal adenomas. In order to identify mutations in MUTYH gene we applied High Resolution Melting (HRM) genotyping. HRM analysis is extensively employed as a scanning method for the detection of heterozygous mutations. Therefore, we applied HRM to show effectiveness in detecting homozygous mutations for these clinically important and frequent patients. In this study, we analyzed phenotype and genotype data from 82 patients, with multiple (>= 10) synchronous (19/82) or metachronous (63/82) adenomas and negative APC study (except one case). Analysis was performed by HRM-PCR and direct sequencing, in order to identify mutations in MUTYH exons 7, 12 and 13, where the most prevalent mutations are located. In monoallelic mutation carriers, we evaluated entire MUTYH gene in search of another possible alteration. HRM-PCR was performed with strict conditions in several rounds: the first one to discriminate the heteroduplex patterns and homoduplex patterns and the next ones, in order to refine and confirm parameters. The genotypes obtained were correlated to phenotypic features (number of adenomas (synchronous or metachronous), colorectal cancer (CRC) and family history). MUTYH germline mutations were found in 15.8% (13/82) of patients. The hot spots, Y179C (exon 7) and G396D (exon 13), were readily identified and other mutations were also detected. Each mutation had a reproducible melting profile by HRM, both heterozygous mutations and homozygous mutations. In our study of 82 patients, biallelic mutation is associated with being a carrier of ≥10 synchronous polyps (p = 0.05) and there is no association between biallelic mutation and CRC (p = 0.39) nor family history (p = 0.63). G338H non-pathogenic polymorphism (exon 12) was found in 23.1% (19/82) of patients. In all cases there was concordance between HRM (first and subsequent rounds) and sequencing
The origin of the p.E180 growth hormone receptor gene mutation.
Ostrer, Harry
2016-06-01
Laron syndrome, an autosomal recessive condition of extreme short stature, is caused by the absence or dysfunction of the growth hormone receptor. A recurrent mutation in the GHR gene, p.E180, did not alter the encoded amino acid, but activated a cryptic splice acceptor resulting in a receptor protein with an 8-amino acid deletion in the extracellular domain. This mutation has been observed among Sephardic Jews and among individuals in Ecuador, Brazil and Chile, most notably in a large genetic isolate in Loja, Ecuador. A common origin has been postulated based on a shared genetic background of markers flanking this mutation, suggesting that the Lojanos (and others) may have Sephardic (Converso) Jewish ancestry. Analysis of the population structure of Lojanos based on genome-wide analysis demonstrated European, Sephardic Jewish and Native American ancestry in this group. X-autosomal comparison and monoallelic Y chromosomal and mitochondrial genetic analysis demonstrated gender-biased admixture between Native American women and European and Sephardic Jewish men. These findings are compatible with the co-occurrence of the Inquisition and the colonization of the Americas, including Converso Jews escaping the Inquisition in the Iberian Peninsula. Although not found among Lojanos, Converso Jews also brought founder mutations to contemporary Hispanic and Latino populations in the BRCA1 (c.68_69delAG) and BLM (c.2207_2212delATCTGAinsTAGATTC) genes. Copyright © 2015 Elsevier Ltd. All rights reserved.
TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis
Directory of Open Access Journals (Sweden)
T. W. Hoffman
2016-01-01
Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.
Two novel mutations in the PPIB gene cause a rare pedigree of osteogenesis imperfecta type IX.
Jiang, Yu; Pan, Jingxin; Guo, Dongwei; Zhang, Wei; Xie, Jie; Fang, Zishui; Guo, Chunmiao; Fang, Qun; Jiang, Weiying; Guo, Yibin
2017-06-01
Osteogenesis imperfecta (OI) is a rare genetic skeletal disorder characterized by increased bone fragility and vulnerability to fractures. PPIB is identified as a candidate gene for OI-IX, here we detect two pathogenic mutations in PPIB and analyze the genotype-phenotype correlation in a Chinese family with OI. Next-generation sequencing (NGS) was used to screen the whole exome of the parents of proband. Screening of variation frequency, evolutionary conservation comparisons, pathogenicity evaluation, and protein structure prediction were conducted to assess the pathogenicity of the novel mutations. Sanger sequencing was used to confirm the candidate variants. RTQ-PCR was used to analyze the PPIB gene expression. All mutant genes screened out by NGS were excluded except PPIB. Two novel heterozygous PPIB mutations (father, c.25A>G; mother, c.509G>A) were identified in relation to osteogenesis imperfecta type IX. Both mutations were predicted to be pathogenic by bioinformatics analysis and RTQ-PCR analysis revealed downregulated PPIB expression in the two carriers. We report a rare pedigree with an autosomal recessive osteogenesis imperfecta type IX (OI-IX) caused by two novel PPIB mutations identified for the first time in China. The current study expands our knowledge of PPIB mutations and their associated phenotypes, and provides new information on the genetic defects associated with this disease for clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Deep learning of mutation-gene-drug relations from the literature.
Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo
2018-01-25
Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be
Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J
2016-12-01
Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.
Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.
2001-01-01
Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by
International Nuclear Information System (INIS)
Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza
2006-01-01
We explored the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA Ser(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA Ser(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene
DEFF Research Database (Denmark)
Nagirnaja, Liina; Venclovas, Česlovas; Rull, Kristiina
2012-01-01
Heterodimeric hCG is one of the key hormones determining early pregnancy success. We have previously identified rare missense mutations in hCGβ genes with potential pathophysiological importance. The present study assessed the impact of these mutations on the structure and function of hCG by appl...... of intact hCG as also supported by an in silico analysis. In summary, the accumulated data indicate that only mutations with neutral or mild functional consequences might be tolerated in the major hCGβ genes CGB5 and CGB8.......Heterodimeric hCG is one of the key hormones determining early pregnancy success. We have previously identified rare missense mutations in hCGβ genes with potential pathophysiological importance. The present study assessed the impact of these mutations on the structure and function of h......CG by applying a combination of in silico (sequence and structure analysis, molecular dynamics) and in vitro (co-immunoprecipitation, immuno- and bioassays) approaches. The carrier status of each mutation was determined for 1086 North-Europeans [655 patients with recurrent miscarriage (RM)/431 healthy controls...
Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Saito, Riho; Furuta, Yutaka; Miyadera, Keiki; Tokura, Taichiro; Marumo, Atushi; Omori, Ikuko; Sakaguchi, Masahiro; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Arai, Kunihito; Kitano, Tomoaki; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti
2018-04-16
BCOR gene is a transcription regulatory factor that plays an essential role in normal hematopoiesis. The wider introduction of next-generation sequencing technology has led to reports in recent years of mutations in the BCOR gene in acute myeloid leukemia (AML), but the related clinical characteristics and prognosis are not sufficiently understood. We investigated the clinical characteristics and prognosis of 377 de novo AML cases with BCOR or BCORL1 mutation. BCOR or BCORL1 gene mutations were found in 28 cases (7.4%). Among cases aged 65 years or below that were also FLT3-ITD-negative and in the intermediate cytogenetic prognosis group, BCOR or BCORL1 gene mutations were observed in 11% of cases (12 of 111 cases), and this group had significantly lower 5-year overall survival (OS) (13.6% vs. 55.0%, P=0.0021) and relapse-free survival (RFS) (14.3% vs. 44.5%, P=0.0168) compared to cases without BCOR or BCORL1 gene mutations. Multivariate analysis demonstrated that BCOR mutations were an independent unfavorable prognostic factor (P=0.0038, P=0.0463) for both OS and RFS. In cases of AML that are FLT3-ITD-negative, aged 65 years or below, and in the intermediate cytogenetic prognosis group, which are considered to have relatively favorable prognosis, BCOR gene mutations appear to be an important prognostic factor. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.
Yagasaki, Hiroshi; Hamanoue, Satoshi; Oda, Tsukasa; Nakahata, Tatsutoshi; Asano, Shigetaka; Yamashita, Takayuki
2004-12-01
Fanconi anemia (FA) is a rare autosomal recessive disorder of hematopoiesis, with at least 11 complementation groups. FANCA, a gene for group A, accounts for the majority of FA patients. Previous studies of FANCA mutations revealed high allelic heterogeneity, frequent occurrence of large deletions, and interpopulation differences. However, systematic mutational analysis, including gene dosage assay to detect large deletions, has not been documented for Asian populations. A newly developed TaqMan quantitative PCR-based gene dosage assay, combined with sequencing of exons and cDNA fragments, allowed for detection of 48 mutant alleles of FANCA in 27 (77%) of 35 unrelated Japanese FA families with no detectable mutations in FANCC or FANCG. We identified 29 different mutations (21 nucleotide substitutions or small deletions/insertions and eight large deletions), at least 20 of which were novel. The FANCA mutational spectrum of the Japanese was different from that of other ethnic groups so far studied. This is the largest scale of mutation analysis of FANCA in the Japanese population. Characterization of these mutations provided new information regarding the mutagenesis mechanisms and structure-function relationship of FANCA. Specifically, our data suggest that diverse mechanisms including nonhomologous recombination as well as Alu-mediated homologous recombination are involved in the generation of large deletions in FANCA. Copyright 2004 Wiley-Liss, Inc.
Sheen, Patricia
2017-10-11
Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.
Sheen, Patricia; Requena, David; Gushiken, Eduardo; Gilman, Robert H.; Antiparra, Ricardo; Lucero, Bryan; Lizá rraga, Pilar; Cieza, Basilio; Roncal, Elisa; Grandjean, Louis; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; Moore, David; Zimic, Mirko
2017-01-01
Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.
Four novel mutations in the lactase gene (LCT) underlying congenital lactase deficiency (CLD).
Torniainen, Suvi; Freddara, Roberta; Routi, Taina; Gijsbers, Carolien; Catassi, Carlo; Höglund, Pia; Savilahti, Erkki; Järvelä, Irma
2009-01-22
Congenital lactase deficiency (CLD) is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT) gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.
Four novel mutations in the lactase gene (LCT underlying congenital lactase deficiency (CLD
Directory of Open Access Journals (Sweden)
Höglund Pia
2009-01-01
Full Text Available Abstract Background Congenital lactase deficiency (CLD is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Methods Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Results Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. Conclusion This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.
Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...
African Journals Online (AJOL)
It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...
Severe Hypertriglyceridemia due to a novel p.Q240H mutation in the Lipoprotein Lipase gene.
Soto, Angela Ganan; McIntyre, Adam; Agrawal, Sungeeta; Bialo, Shara R; Hegele, Robert A; Boney, Charlotte M
2015-09-04
Lipoprotein Lipase (LPL) deficiency is a rare autosomal recessive disorder with a heterogeneous clinical presentation. Several mutations in the LPL gene have been identified to cause decreased activity of the enzyme. An 11-week-old, exclusively breastfed male presented with coffee-ground emesis, melena, xanthomas, lipemia retinalis and chylomicronemia. Genomic DNA analysis identified lipoprotein lipase deficiency due to compound heterozygosity including a novel p.Q240H mutation in exon 5 of the lipoprotein lipase (LPL) gene. His severe hypertriglyceridemia, including xanthomas, resolved with dietary long-chain fat restriction. We describe a novel mutation of the LPL gene causing severe hypertriglyceridemia and report the response to treatment. A review of the current literature regarding LPL deficiency syndrome reveals a few potential new therapies under investigation.
Mutation analysis of the PAH gene in phenylketonuria patients from Rio de Janeiro, Southeast Brazil.
Vieira Neto, Eduardo; Laranjeira, Francisco; Quelhas, Dulce; Ribeiro, Isaura; Seabra, Alexandre; Mineiro, Nicole; D M Carvalho, Lilian; Lacerda, Lúcia; G Ribeiro, Márcia
2018-05-10
Phenylketonuria (PKU) is an autosomal recessive disease resulting from mutations in the PAH gene. Most of the patients are compound heterozygotes, and genotype is a major factor in determining the phenotypic variability of PKU. More than 1,000 variants have been described in the PAH gene. Rio de Janeiro's population has a predominance of Iberian, followed by African and Amerindian ancestries. It is expected that most PKU variants in this Brazilian state have originated in the Iberian Peninsula. However, rare European, African or pathogenic variants that are characteristic of the admixed population of the state might also be found. A total of 102 patients were included in this study. Genomic DNA was isolated from dried blood spots. Sanger sequencing was used for PAH gene variant identification. Deletions and duplications were also screened using MLPA analysis. Haplotypes were also determined. Nine (8.8%) homozygous and 93 (91.2%) compound heterozygous patients were found. The spectrum included 37 causative mutations. Missense, nonsense, and splicing pathogenic variants corresponded to 63.7%, 2.9%, and 22.6% of the mutant alleles, respectively. Large (1.5%), and small deletions, inframe (5.4%) and with frameshift (3.9%), comprised the remainder. The most frequent pathogenic variants were: p.V388M (12.7%), p.R261Q (11.8%), IVS10-11G>A (10.3%), IVS2+5G>C (6.4%), p.S349P (6.4%), p.R252W (5.4%), p.I65T (4.4%), p.T323del (4.4%), and p.P281L (3.4%). One novel variant was detected: c.934G>T (p.G312C) [rs763115697]. The three most frequent pathogenic variants in our study (34.8% of the alleles) were also the most common in other Brazilian states, Portugal, and Spain (p.V388M, p.R261Q, IVS10-11G>A), corroborating that the Iberian Peninsula is the major source of PAH mutations in Rio de Janeiro. Pathogenic variants that have other geographical origins, such IVS2+5G>C, p.G352Vfs*48, and IVS12+1G>A were also detected. Genetic drift and founder effect may have also played a role
Energy Technology Data Exchange (ETDEWEB)
Mercier, B.; Audrezet, M.P.; Guillermit, H.; Quere, I.; Verlingue, C.; Ferec, C. (CDTS, Brest (France)); Lissens, W.; Bonduelle, M.; Liebaers, I. (University Hospital VUB, Brussels (Belgium)); Novelli, G.; Sangiuolo, F.; Dallapiccola, B. (IRCCS, Rotondo (Italy)); Kalaydjieva, L. (Inst. of Obstetrics, Sofia (Bulgaria)); Arce, M. De; Cashman, S. (Trinity College, Dublin (Ireland)); Kapranov, N. (NRC of medical Genetics, Moscow (Russian Federation)); Canki Klain, N. (Tozd Univerzitetna Ginekoloska Klinika, Ljubljana (Yugoslavia)); Lenoir, G. (Hopital des Enfants Malades Necker, Paris (France)); Chauveau, P. (Centre Hospitalier General, Le Havre (France)); Lanaerts, C. (Centre Hospitalier Regional et Universitaire, Amiens (France)); Rault, G. (Centre Helio-Marin, Roscoff (France))
1993-04-01
Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene, particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.
Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.
Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle
2016-10-01
Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.
Directory of Open Access Journals (Sweden)
Chih-Ping Chen
2006-01-01
Full Text Available Cardiac rhabdomyomas are prenatal echocardiographic markers for tuberous sclerosis complex (TSC. TSC is caused by mutations in the genes TSC1 and TSC2. We report a 28-year-old, gravida 5, para 2, woman with an uncomplicated pregnancy until prenatal ultrasound at 34 weeks' gestation revealed fetal cardiac tumors. Ultrafast magnetic resonance imaging (MRI at 36 weeks' gestation showed cardiac rhab-domyomas and small subependymal tubers. At 39 weeks' gestation, a 2262 g female infant was delivered uneventfully. Postnatal echocardiography confirmed cardiac rhabdomyomas and MRI verified small cerebral subependymal tubers. Mutational analysis of TSC1 and TSC2 genes using denaturing high-performance liquid chromatography and direct sequencing of the genes was performed and revealed that the parents had wildtype DNA, while the proband was heterozygous for a novel de novo nonsense mutation, c.4830 G > A, in exon 36 of the TSC2 gene, resulting in a change of codon 1610 TGG (tryptophan to TGA (stop codon. The mutation predicted a W1610X premature termination of the tuberin protein. These findings support an association between a TSC2 de novo nonsense mutation and prenatally detected cardiac rhabdomyomas and cerebral tuberous sclerosis. Familial molecular analysis of TSC1 and TSC2 in cases with prenatally diagnosed cardiac rhabdomyomas and cerebral tuberous sclerosis lesions is helpful in prenatal diagnosis and genetic counseling.
Alport Syndrome: De Novo Mutation in the COL4A5 Gene Converting Glycine 1205 to Valine
Directory of Open Access Journals (Sweden)
Pilar Antón-Martín
2012-01-01
Full Text Available Background Alport syndrome is a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family. It is a genetically heterogeneous disease with different mutations and forms of inheritance that presents with renal affection, hearing loss and eye defects. Several new mutations related to X-linked forms have been previously determined. Methods We report the case of a 12 years old male and his family diagnosed with Alport syndrome after genetic analysis was performed. Result Anew mutation determining a nucleotide change C.3614G > T (p. Gly1205Val in hemizygosis in the COL4A5 gene was found. This molecular defect has not been previously described. Conclusion Molecular biology has helped us to comprehend the mechanisms of pathophysiology in Alport syndrome. Genetic analysis provides the only conclusive diagnosis of the disorder at the moment. Our contribution with a new mutation further supports the need of more sophisticated molecular methods to increase the mutation detection rates with lower costs and less time.
Mutations du gene de la filamine et syndromes malformatifs | Koffi ...
African Journals Online (AJOL)
Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...
Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu
2015-10-01
Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.
Towards linked open gene mutations data
2012-01-01
Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives
Towards linked open gene mutations data.
Zappa, Achille; Splendiani, Andrea; Romano, Paolo
2012-03-28
With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on
Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru
2014-02-25
Hanefeld variants of RTT and 2 with early-onset epileptic encephalopathy in 71 girls as well as for 1 infantile spasms in 31 males. There are some differences in the phenotypes among genders with CDKL5 gene mutations and CDKL5 gene mutation analysis should be considered in both genders.
Directory of Open Access Journals (Sweden)
Ella R Thompson
2012-09-01
Full Text Available Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multi-generational breast cancer predisposition is unknown. In this study, we used whole-exome sequencing of thirty-three individuals from 15 breast cancer families to identify potential predisposing genes. Our analysis identified families with heterozygous, deleterious mutations in the DNA repair genes FANCC and BLM, which are responsible for the autosomal recessive disorders Fanconi Anemia and Bloom syndrome. In total, screening of all exons in these genes in 438 breast cancer families identified three with truncating mutations in FANCC and two with truncating mutations in BLM. Additional screening of FANCC mutation hotspot exons identified one pathogenic mutation among an additional 957 breast cancer families. Importantly, none of the deleterious mutations were identified among 464 healthy controls and are not reported in the 1,000 Genomes data. Given the rarity of Fanconi Anemia and Bloom syndrome disorders among Caucasian populations, the finding of multiple deleterious mutations in these critical DNA repair genes among high-risk breast cancer families is intriguing and suggestive of a predisposing role. Our data demonstrate the utility of intra-family exome-sequencing approaches to uncover cancer predisposition genes, but highlight the major challenge of definitively validating candidates where the incidence of sporadic disease is high, germline mutations are not fully penetrant, and individual predisposition genes may only account for a tiny proportion of breast cancer families.
A case of pseudohypoaldosteronism type 1 with a mutation in the mineralocorticoid receptor gene
Directory of Open Access Journals (Sweden)
Se Eun Lee
2011-02-01
Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare form of mineralocorticoid resistance characterized in newborns by salt wasting with dehydration, hyperkalemia and failure to thrive. This disease is heterogeneous in etiology and includes autosomal dominant PHA1 owing to mutations of the NR3C2 gene encoding the mineralocorticoid receptor, autosomal recessive PHA1 due to mutations of the epithelial sodium channel (ENaC gene, and secondary PHA1 associated with urinary tract diseases. Amongst these diseases, autosomal dominant PHA1 shows has manifestations restricted to renal tubules including a mild salt loss during infancy and that shows a gradual improvement with advancing age. Here, we report a neonatal case of PHA1 with a NR3C2 gene mutation (a heterozygous c.2146_2147insG in exon 5, in which the patient showed failure to thrive, hyponatremia, hyperkalemia, and elevated plasma renin and aldosterone levels. This is the first case of pseudohypoaldosteronism type 1 confirmed by genetic analysis in Korea.
Directory of Open Access Journals (Sweden)
Tixier-Boichard Michèle
2008-01-01
Full Text Available Abstract Background The lavender phenotype in the chicken causes the dilution of both black (eumelanin and red/brown (phaeomelanin pigments. Defects in three genes involved in intracellular melanosomal transport, previously described in mammals, give rise to similar diluted pigmentation phenotypes as those seen in lavender chickens. Results We have used a candidate-gene approach based on an expectation of homology with mammals to isolate a gene involved in pigmentation in chicken. Comparative sequence analysis of candidate genes in the chicken identified a strong association between a mutation in the MLPH gene and the diluted pigmentation phenotype. This mutation results in the amino acid change R35W, at a site also associated with similar phenotypes in mice, humans and cats. Conclusion This is the first time that an avian species with a mutation in the MLPH gene has been reported.
Yoshida, S; Honda, M; Yoshida, A; Nakao, S; Goto, Y; Nakamura, T; Fujisawa, K; Ishibashi, T
2005-02-01
To report a novel mutation of the ABCC6 gene in a Japanese family that had a case of pseudoxanthoma elasticum (PXE) another with PXE and retinitis pigmentosa. Ophthalmologic examinations were performed, and the ABCC6 gene was analysed by direct genomic sequencing. Fundus examinations of the 48-year-old proband disclosed angioid streaks and a peud'orange appearance of the retina of the both eyes, whereas both of his 25- and 20-year-old daughters had pigmentary degeneration and angioid streaks. In the sibilings, the mixed cone-rod ERG was almost nondetectable, whereas that of the proband was well-preserved. Molecular genetic analysis revealed that the proband has a homozygous nonsense mutation at the 595 bp in the ABCC6, and the siblings were heterozygous for the same mutation. This mutation was not detected in Japanese subjects in the JSNP database (http://snp.ims.u-tokyo.ac.jp/). Our results demonstrated an association between a novel mutation in the ABCC6 gene and PXE in a Japanese family.
Leenen, C H M; Geurts-Giele, W R R; Dubbink, H J; Reddingius, R; van den Ouweland, A M; Tops, C M J; van de Klift, H M; Kuipers, E J; van Leerdam, M E; Dinjens, W N M; Wagner, A
2011-12-01
Heterozygous germline mutations in the mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 cause Lynch syndrome. Biallelic mutations in the MMR genes are associated with a childhood cancer syndrome [constitutional mismatch repair deficiency (CMMR-D)]. This is predominantly characterized by hematological malignancies and tumors of the bowel and brain, often associated with signs of neurofibromatosis type 1 (NF1). Diagnostic strategies for selection of patients for MMR gene analysis include analysis of microsatellite instability (MSI) and immunohistochemical (IHC) analysis of MMR proteins in tumor tissue. We report the clinical characterization and molecular analyses of tumor specimens from a family with biallelic PMS2 germline mutations. This illustrates the pitfalls of present molecular screening strategies. Tumor tissues of five family members were analyzed for MSI and IHC. MSI was observed in only one of the analyzed tissues. However, IHC analysis of brain tumor tissue of the index patient and his sister showed absence of PMS2 expression, and germline mutation analyses showed biallelic mutations in PMS2: p.Ser46IIe and p.Pro246fs. The same heterozygous mutations were confirmed in the father and mother, respectively. These data support the conclusion that in case of a clinical phenotype of CMMR-D, it is advisable to routinely combine MSI analysis with IHC analysis for the expression of MMR proteins. With inconclusive or conflicting results, germline mutation analysis of the MMR genes should be considered after thorough counselling of the patients and/or their relatives. © 2011 John Wiley & Sons A/S.
Optimization of heteroduplex analysis for the detection of BRCA mutations and SNPs
Directory of Open Access Journals (Sweden)
Lucian Negura
2011-02-01
Full Text Available BRCA1 and BRCA2 are tumour suppressor genes whose mutant phenotypes predispose to breast and ovarian cancer. Screening for mutations in these genes is now standard practice for hereditary breast and ovarian cancer (HBOC cases in Europe, and permits medical follow-up and genetic counselling adapted to the needs of individuals in such families. Currently, most laboratories performing diagnostic analysis of the BRCA genes use PCR of exons and intron-exon boundaries coupled to a pre-screening step to identify anomalous amplicons. The techniques employed for the detection of mutations and SNPs have evolved over time and vary in sensitivity, specificity and cost-effectiveness. As a variant for pre-screening techniques, we chose the recently developed Surveyor® heteroduplex cleavage method as a sensitive and specific technique to reveal anomalous amplicons of the BRCA genes, using only basic laboratory equipment and agarose gel electrophoresis. Here we present the detection of either mutations or SNPs within the BRCA1 exon 7, using heteroduplex analysis (HA by mismatch-specific endonuclease, confirmed by dideoxy sequencing.
Hamzeiy, Hossein; Vahdati-Mashhadian, Nasser; Edwards, Helen J; Goldfarb, Peter S
2002-03-20
Human CYP3A4 is the major cytochrome P450 isoenzyme in adult human liver and is known to metabolise many xenobiotic and endogenous compounds. There is substantial inter-individual variation in the hepatic levels of CYP3A4. Although, polymorphic mutations have been reported in the 5' regulatory region of the CYP3A4 gene, those that have been investigated so far do not appear to have any effect on gene expression. To determine whether other mutations exist in this region of the gene, we have performed a new population screen on a panel of 101 human DNA samples. A 1140 bp section of the 5' proximal regulatory region of the CYP3A4 gene, containing numerous regulatory motifs, was amplified from genomic DNA as three overlapping segments. The 300 bp distal enhancer region at -7.9kb containing additional regulatory motifs was also amplified. Mutation analysis of the resulting PCR products was carried out using non-radioactive single strand conformation polymorphism (SSCP) and confirmatory sequencing of both DNA strands in those samples showing extra SSCP bands. In addition to detection of the previously reported CYP3A4*1B allele in nine subjects, three novel alleles were found: CYP3A4*1E (having a T-->A transversion at -369 in one subject), CYP3A4*1F (having a C-->G tranversion at -747 in 17 subjects) and CYP3A4*15B containing a nine-nucleotide insertion between -845 and -844 linked to an A-->G transition at -392 and a G-->A transition in exon 6 (position 485 in the cDNA) in one subject. All the novel alleles were heterozygous. No mutations were found in the upstream distal enhancer region. Our results clearly indicate that this rapid and simple SSCP approach can reveal mutant alleles in drug metabolising enzyme genes. Detection and determination of the frequency of novel alleles in CYP3A4 will assist investigation of the relationship between genotype, xenobiotic metabolism and toxicity in the CYP3A family of isoenzymes.
Geographical distribution of β-globin gene mutations in Syria.
Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A
2018-04-11
Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.
Energy Technology Data Exchange (ETDEWEB)
Hartman, P S; De Wilde, D; Dwarakanath, V N [Texas Christian Univ., Fort Worth, TX (United States). Dept. of Biology
1995-06-01
The utility of a new target gene (fem-3) is described for investigating the molecular nature of mutagenesis in the nematode Caenorhabditis elegans. As a principal attribute, this system allows for the selection, maintenance and molecular analysis of any type of mutation that disrupts the gene, including deletions. In this study, 86 mutant strains were isolated, of which 79 proved to have mutations in fem-3. Twenty of these originally tested as homozygous inviable. Homozygous inviability was expected, as Stewart and coworkers had previously observed that, unlike in other organisms, most UV radiation-induced mutations in C. elegans are chromosomal rearrangements of deficiencies (Mutat. Res 249, 37-54, 1991). However, additional data, including Southern blot analyses on 49 of the strains, indicated that most of the UV radiation-induced fem-3 mutations were not deficiencies, as originally inferred from their homozygous inviability. Instead, the lethals were most likely ``coincident mutations`` in linked, essential genes that were concomitantly induced. As such, they were lost owing to genetic recombination during stock maintenance. As in mammalian cells, yeast and bacteria, the frequency of coincident mutations was much higher than would be predicted by chance. (Author).
c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness.
Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak
2016-02-01
Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Monteiro Santos, Erika Maria [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Silva Junior, Wilson Araujo da [Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil); Carraro, Dirce Maria [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Rossi, Benedito Mauro; Valentin, Mev Dominguez [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Carneiro, Felipe [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Oliveira, Ligia Petrolini de [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Oliveira Ferreira, Fabio de; Junior, Samuel Aguiar [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Hereditary Colorectal Cancer Registry, AC Camargo Hospital, Sao Paulo (Brazil); Nakagawa, Wilson Toshihiko [Hereditary Colorectal Cancer Registry, AC Camargo Hospital, Sao Paulo (Brazil); Gomy, Israel [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil); Faria Ferraz, Victor Evangelista de [Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil)
2012-02-09
Lynch syndrome (LS) is the most common form of inherited predisposition to colorectal cancer (CRC), accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1), mutS homolog 2 (MSH2), postmeiotic segregation increased 1 (PMS1), post-meiotic segregation increased 2 (PMS2) and mutS homolog 6 (MSH6). Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846), Barnetson (0.850), MMRpro (0.821) and Wijnen (0.807) models did not present significant statistical difference. The Myriad model presented lower AUC (0.704) than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad) and 0.87 (Wijnen) and specificity ranged from 0 (Myriad) to 0.38 (Barnetson). The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models.
International Nuclear Information System (INIS)
Monteiro Santos, Erika Maria; Silva Junior, Wilson Araujo da; Carraro, Dirce Maria; Rossi, Benedito Mauro; Valentin, Mev Dominguez; Carneiro, Felipe; Oliveira, Ligia Petrolini de; Oliveira Ferreira, Fabio de; Junior, Samuel Aguiar; Nakagawa, Wilson Toshihiko; Gomy, Israel; Faria Ferraz, Victor Evangelista de
2012-01-01
Lynch syndrome (LS) is the most common form of inherited predisposition to colorectal cancer (CRC), accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1), mutS homolog 2 (MSH2), postmeiotic segregation increased 1 (PMS1), post-meiotic segregation increased 2 (PMS2) and mutS homolog 6 (MSH6). Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846), Barnetson (0.850), MMRpro (0.821) and Wijnen (0.807) models did not present significant statistical difference. The Myriad model presented lower AUC (0.704) than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad) and 0.87 (Wijnen) and specificity ranged from 0 (Myriad) to 0.38 (Barnetson). The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models
Barker, Emily N; Stranieri, Angelica; Helps, Chris R; Porter, Emily L; Davidson, Andrew D; Day, Michael J; Knowles, Toby; Kipar, Anja; Tasker, Séverine
2017-10-05
Feline infectious peritonitis (FIP) is a fatal disease of cats, and a sequela of systemic feline coronavirus (FCoV) infection. Mutations in the viral spike (S) gene have been associated with FCoVs found in tissues from cats with FIP, but not FCoVs found in faeces from healthy cats, and are implicated in monocyte/macrophage tropism and systemic spread. This study was designed to determine whether S gene mutation analysis can reliably diagnose FIP. Cats were categorised as with FIP (n = 57) or without FIP (n = 45) based on gross post-mortem and histopathological examination including immunohistochemistry for FCoV antigen. RNA was purified from available tissue, fluid and faeces. Reverse-transcriptase quantitative-PCR (RT-qPCR) was performed on all samples using FCoV-specific primers, followed by sequencing of a section of the S gene on RT-qPCR positive samples. Samples were available from a total of 102 cats. Tissue, fluid, and faecal samples from cats with FIP were more likely to be FCoV RT-qPCR-positive (90.4, 78.4 and 64.6% respectively) than those from cats without FIP (7.8, 2.1 and 20% respectively). Identification of S gene mutated FCoVs as an additional step to the detection of FCoV alone, only moderately increased specificity for tissue samples (from 92.6 to 94.6%) but specificity was unchanged for fluid samples (97.9%) for FIP diagnosis; however, sensitivity was markedly decreased for tissue (from 89.8 to 80.9%) and fluid samples (from 78.4 to 60%) for FIP diagnosis. These findings demonstrate that S gene mutation analysis in FCoVs does not substantially improve the ability to diagnose FIP as compared to detection of FCoV alone.
Calderón-Garcidueñas, Ana Laura; Ruiz-Flores, Pablo; Cerda-Flores, Ricardo M; Barrera-Saldaña, Hugo A
2005-01-01
This study describes the presence of mutations in BRCA1 and BRCA2 genes in a group of Mexican women and the clinical evolution of early onset breast cancer (EOBC). A prospective hospital-based study was performed in a sample of 22 women with EOBC (7 in clinical stage IIA, 8 in IIB, and 7 in IIIA). The patients attended a tertiary care hospital in northeastern Mexico in 1997 and were followed up over a 5-year period. Molecular analysis included: 1) a mutation screening by heteroduplex analysis (HA) of BRCA1 and BRCA2 genes and 2) a sequence analysis. Of 22 patients, 14 (63.6%) showed a variant band detected by heteroduplex analysis of the BRCA1 and BRCA2 genes: 8 polymorphisms, 4 mutations of uncertain significance, and 2 novel truncated protein mutations, one in BRCAI (exon 11, 3587delT) and the other in the BRCA2 gene (exon 11, 2664InsA). These findings support future studies to determine the significance and impact of the genetic factor in this Mexican women population.
Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela
2011-03-01
Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.
Identification of Genetic Susceptibility to Childhood Cancer through Analysis of Genes in Parallel
Plon, Sharon E.; Wheeler, David A.; Strong, Louise C.; Tomlinson, Gail E.; Pirics, Michael; Meng, Qingchang; Cheung, Hannah C.; Begin, Phyllis R.; Muzny, Donna M.; Lewis, Lora; Biegel, Jaclyn A.; Gibbs, Richard A.
2011-01-01
Clinical cancer genetic susceptibility analysis typically proceeds sequentially beginning with the most likely causative gene. The process is time consuming and the yield is low particularly for families with unusual patterns of cancer. We determined the results of in parallel mutation analysis of a large cancer-associated gene panel. We performed deletion analysis and sequenced the coding regions of 45 genes (8 oncogenes and 37 tumor suppressor or DNA repair genes) in 48 childhood cancer patients who also (1) were diagnosed with a second malignancy under age 30, (2) have a sibling diagnosed with cancer under age 30 and/or (3) have a major congenital anomaly or developmental delay. Deleterious mutations were identified in 6 of 48 (13%) families, 4 of which met the sibling criteria. Mutations were identified in genes previously implicated in both dominant and recessive childhood syndromes including SMARCB1, PMS2, and TP53. No pathogenic deletions were identified. This approach has provided efficient identification of childhood cancer susceptibility mutations and will have greater utility as additional cancer susceptibility genes are identified. Integrating parallel analysis of large gene panels into clinical testing will speed results and increase diagnostic yield. The failure to detect mutations in 87% of families highlights that a number of childhood cancer susceptibility genes remain to be discovered. PMID:21356188
Novel mutations in the genes TGM1 and ALOXE3 underlying autosomal recessive congenital ichthyosis
Ullah, Rahim; Ansar, Muhammad; Durrani, Zaka Ullah; Lee, Kwanghyuk; Santos-Cortez, Regie Lyn P.; Muhammad, Dost; Ali, Mahboob; Zia, Muhammad; Ayub, Muhammad; Khan, Suliman; Smith, Josh D.; Nickerson, Deborah A.; Shendure, Jay; Bamshad, Michael; Leal, Suzanne M.; Ahmad, Wasim
2016-01-01
Background Ichthyoses are clinically characterized by scaling or hyperkeratosis of the skin or both. It can be an isolated condition limited to the skin or appear secondarily with involvement of other cutaneous or systemic abnormalities. Methods The present study investigated clinical and molecular characterization of three consanguineous families (A, B, C) segregating two different forms of autosomal recessive congenital ichthyosis (ARCI). Linkage in three consanguineous families (A, B, C) segregating two different forms of ARCI was searched by typing microsatellite and single nucleotide polymorphism marker analysis. Sequencing of the two genes TGM1 and ALOXE3 was performed by the dideoxy chain termination method. Results Genome-wide linkage analysis established linkage in family A to TGM1 gene on chromosome 14q11 and in families B and C to ALOXE3 gene on chromosome 17p13. Subsequently, sequencing of these genes using samples from affected family members led to the identification of three novel mutations: a missense variant p.Trp455Arg in TGM1 (family A); a nonsense variant p.Arg140* in ALOXE3 (family B); and a complex rearrangement in ALOXE3 (family C). Conclusion The present study further extends the spectrum of mutations in the two genes involved in causing ARCI. Characterizing the clinical spectrum resulting from mutations in the TGM1 and ALOXE3 genes will improve diagnosis and may direct clinical care of the family members. PMID:26578203
Yu, Fang; Cai, Wenping; Jiang, Beizhan; Xu, Laijun; Liu, Shangfeng; Zhao, Shouliang
2018-01-01
Supernumerary teeth are teeth that are present in addition to normal teeth. Although several hypotheses and some molecular signalling pathways explain the formation of supernumerary teeth, but their exact disease pathogenesis is unknown. To study the molecular mechanisms of supernumerary tooth-related syndrome (Gardner syndrome), a deeper understanding of the aetiology of supernumerary teeth and the associated syndrome is needed, with the goal of inhibiting disease inheritance via prenatal diagnosis. We recruited a Chinese family with Gardner syndrome. Haematoxylin and eosin staining of supernumerary teeth and colonic polyp lesion biopsies revealed that these patients exhibited significant pathological characteristics. APC gene mutations were detected by PCR and direct sequencing. We revealed the pathological pathway involved in human supernumerary tooth development and the mouse tooth germ development expression profile by RNA sequencing (RNA-seq). Sequencing analysis revealed that an APC gene mutation in exon 15, namely 4292-4293-Del GA, caused Gardner syndrome in this family. This mutation not only initiated the various manifestations typical of Gardner syndrome but also resulted in odontoma and supernumerary teeth in this case. Furthermore, RNA-seq analysis of human supernumerary teeth suggests that the APC gene is the key gene involved in the development of supernumerary teeth in humans. The mouse tooth germ development expression profile shows that the APC gene plays an important role in tooth germ development. We identified a new mutation in the APC gene that results in supernumerary teeth in association with Gardner syndrome. This information may shed light on the molecular pathogenesis of supernumerary teeth. Gene-based diagnosis and gene therapy for supernumerary teeth may become available in the future, and our study provides a high-resolution reference for treating other syndromes associated with supernumerary teeth. © 2017 The Authors. Journal of
Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H
2016-12-15
PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.
The Androgen Receptor Gene Mutations Database.
Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M
1998-01-01
The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).
The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.
Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena
2015-11-01
Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.
A novel mutation in the SH3BP2 gene causes cherubism: case report
Directory of Open Access Journals (Sweden)
Yu Shi-Feng
2006-12-01
Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
The p. N103K mutation of leptin (LEP gene and severe early onset obesity in Pakistan
Directory of Open Access Journals (Sweden)
Shabana
Full Text Available BACKGROUND: Obesity is a complex disorder and has been increasing globally at alarming rates including Pakistan. However, there is scarce research on understanding obesity genetics in Pakistan. Leptin is a hormone secreted by adipocytes in response to satiety and correlates with body weight. Any mutations in the LEP gene have an adverse effect on energy regulation pathway and lead to severe, early onset obesity. To date, only eight mutations have been described in the LEP gene of which p. N103K is one. METHODS: We aimed to analyze the prevalence of this mutation in Pakistani subjects. A total of 475 subjects were genotyped by PCR-RFLP analysis and their serum profiling was done. RESULTS: Results showed that this mutation was present only in one male child with early onset obesity (10 year. He had very low serum leptin levels suggestive of functional impact of the mutation. The prevalence of such mutations is, however, low due to the drastic effects on the energy regulation. CONCLUSION: In conclusion, LEP gene mutations contribute significantly to the monogenic forms of obesity and are important due to the availability of treatment options. Such mutations may exert their effect by directly affecting energy regulation pathway and are more prominent in the early stages of life only.
Ala397Asp mutation of myosin VIIA gene segregating in a Spanish family with type-Ib Usher syndrome.
Espinós, C; Millán, J M; Sánchez, F; Beneyto, M; Nájera, C
1998-06-01
In the current study, 12 Spanish families affected by type-I Usher syndrome, that was previously linked to chromosome 11q, were screened for the presence of mutations in the N-terminal coding portion of the motor domain of the myosin VIIA gene by single-strand conformation polymorphism analysis of the first 14 exons. A mutation (Ala397Asp) segregating with the disease was identified, and several polymorphisms were also detected. It is presumed that the other USHIB mutations in these families could be located in the unscreened regions of the gene.
Detection of mutations in the COL4A5 gene by SSCP in X-linked Alport syndrome
DEFF Research Database (Denmark)
Hertz, Jens Michael; Juncker, I; Persson, U
2001-01-01
, three in-frame deletions, four nonsense mutations, and six splice site mutations. Twenty-two of the mutations have not previously been reported. Furthermore, we found one non-pathogenic amino acid substitution, one rare variant in a non-coding region, and one polymorphism with a heterozygosity of 28...... of type IV-collagen. We performed mutation analysis of the COL4A5 gene by PCR-SSCP analysis of each of the 51 exons with flanking intronic sequences in 81 patients suspected of X-linked Alport syndrome including 29 clear X-linked cases, 37 cases from families with a pedigree compatible with X...
Domain-restricted mutation analysis to identify novel driver events in human cancer
Directory of Open Access Journals (Sweden)
Sanket Desai
2017-10-01
Full Text Available Analysis of mutational spectra across various cancer types has given valuable insights into tumorigenesis. Different approaches have been used to identify novel drivers from the set of somatic mutations, including the methods which use sequence conservation, geometric localization and pathway information. Recent computational methods suggest use of protein domain information for analysis and understanding of the functional consequence of non-synonymous mutations. Similarly, evidence suggests recurrence at specific position in proteins is robust indicators of its functional impact. Building on this, we performed a systematic analysis of TCGA exome derived somatic mutations across 6089 PFAM domains and significantly mutated domains were identified using randomization approach. Multiple alignment of individual domain allowed us to prioritize for conserved residues mutated at analogous positions across different proteins in a statistically disciplined manner. In addition to the known frequently mutated genes, this analysis independently identifies low frequency Meprin and TRAF-Homology (MATH domain in Speckle Type BTB/POZ (SPOP protein, in prostate adenocarcinoma. Results from this analysis will help generate hypotheses about the downstream molecular mechanism resulting in cancer phenotypes.
Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco
2017-07-01
We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.
Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.
Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco
2016-12-27
In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.
Hemochromatosis C282Y gene mutation as a potential susceptibility ...
African Journals Online (AJOL)
G.M. Mokhtar
2017-08-12
Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.
Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.
Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng
2017-01-01
Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Analysis of APC mutation in human ameloblastoma and clinical significance.
Li, Ning; Liu, Bing; Sui, Chengguang; Jiang, Youhong
2016-01-01
As a highly conserved signaling pathway, Wnt/β-catenin signal transduction pathway plays an important role in many processes. Either in the occurrence or development of tumor, activation of this pathway takes an important place. APC inhibits Wnt/β-catenin pathway to regulate cell proliferation and differentiation. This study aimed to investigate the function of cancer suppressor gene. PCR amplification and sequencing method was used to analyze APC mutations of human clinical specimens. The pathological specimens were collected for PCR and clear electrophoretic bands were obtained after electrophoresis. The gene sequence obtained after purification and sequencing analysis was compared with the known APC gene sequence (NM_000038.5). Base mutations at APC 1543 (T → C), APC-4564 (G → A), APC-5353 (T → G), APC-5550 (T → A) and APC-5969 (G → A) locus existed in 22 (27.5 %), 12 (15 %), 5 (6.25 %), 13 (16.25 %) and 12 patients (15 %), respectively. Gene mutations existed in ameloblastoma, and the mutation loci were 1543 locus (T → C), 4564 locus (G → A), 5353 locus (T → G), 5550 locus (T → A) and 5969 locus (G → A) 15 %, respectively. APC mutation plays a certain role in monitoring the tumor malignant degree as it may indicate the transition process of ameloblastoma malignant phenotype.
A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene
Energy Technology Data Exchange (ETDEWEB)
Fendri-Kriaa, Nourhene, E-mail: nourhene.fendri@gmail.com [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Hsairi, Ines [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Kifagi, Chamseddine [Laboratoire internationale associe LIA135, Centre de Biotechnologie de Sfax (Tunisia); Ellouze, Emna [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Mkaouar-Rebai, Emna [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Triki, Chahnez [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Fakhfakh, Faiza [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia)
2011-06-03
Highlights: {yields} Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. {yields} A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. {yields} The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 months of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.
A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene
International Nuclear Information System (INIS)
Fendri-Kriaa, Nourhene; Hsairi, Ines; Kifagi, Chamseddine; Ellouze, Emna; Mkaouar-Rebai, Emna; Triki, Chahnez; Fakhfakh, Faiza
2011-01-01
Highlights: → Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. → A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. → The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 months of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.
Directory of Open Access Journals (Sweden)
Nasibe Karimi
2017-03-01
Full Text Available Introduction: Cystic fibrosis (CF is a common genetic disorder in white populations with an autosomal recessive pattern, caused by mutations in the CFTR gene. The frequency of more than 1950 various mutations reported in the CFTR gene significantly varies in different populations. ∆F508 is a common mutation in exon 10, which is first addressed in the molecular analysis of the disease. Other exons are required to be investigated owing to failing to identify mutations in the patients. The present study was conducted to investigate mutations in exons 4, 11 and 21 of the CFTR gene using the sequencing method in CF patients in Kermanshah province, Iran. Methods: The present descriptive study was conducted on all patients with CF presenting to the medical genetics center in Kermanshah in 2010-2011. After taking blood samples and extracting DNA using saturated NaCl solution, sequences of exons were amplified using PCR and sequenced for identifying mutations. Results: The frequency of mutations was found to be respectively 0, 0 and 5.5% in exon 11, 21 and 4. The D110H mutation was found to be homozygous in one subject and heterozygous in another. Moreover, the 4029A>G polymorphism (12.9% was found to be homozygous in two subjects and heterozygous in three others. Conclusion: The D110H mutation is recommended to be included in the screening programs of the study population. The results obtained support the effects of ethnic and geographical factors on the distribution of CF mutations.
Mutation analysis of COL4A3 and COL4A4 genes in a Chinese
Indian Academy of Sciences (India)
Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutationsin COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical ...
Directory of Open Access Journals (Sweden)
Kentaro Mori
Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.
2014-01-01
Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025
Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis
Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard
2014-01-01
Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...
De novo mutations in synaptic transmission genes including DNM1 cause epileptic encephalopathies
DEFF Research Database (Denmark)
2014-01-01
in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p...... = 8.2 × 10(-4)), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have...... analyzed exome-sequencing data of 356 trios with the "classical" epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1...
Gonzalez-Rodriguez, J; Pelcastre, E L; Tovilla-Canales, J L; Garcia-Ortiz, J E; Amato-Almanza, M; Villanueva-Mendoza, C; Espinosa-Mattar, Z; Zenteno, J C
2010-08-01
Microphthalmia-anophthalmia-coloboma (MAC) are congenital eye malformations causing a significant percentage of visually impairments in children. Although these anomalies can arise from prenatal exposure to teratogens, mutations in well-defined genes originate potentially heritable forms of MAC. Mutations in genes such as CHX10, GDF6, RAX, SOX2 and OTX2, among others, have been recognised in dominant or recessive MAC. SOX2 and OTX2 are the two most commonly mutated genes in monogenic MAC. However, as more numerous samples of MAC subjects would be analysed, a better estimation of the actual involvement of specific MAC-genes could be made. Here, a comprehensive mutational analysis of the CHX10, GDF6, RAX, SOX2 and OTX2 genes was performed in 50 MAC subjects. PCR amplification and direct automated DNA sequencing of all five genes in 50 unrelated subjects. Eight mutations (16% prevalence) were recognised, including four GDF6 mutations (one novel), two novel RAX mutations, one novel OTX2 mutation and one SOX2 mutation. Anophthalmia and nanophthalmia, not previously associated with GDF6 mutations, were observed in two subjects carrying defects in this gene, expanding the spectrum of GDF6-linked ocular anomalies. Our study underscores the importance of genotyping large groups of patients from distinct ethnic origins for improving the estimation of the global involvement of particular MAC-causing genes.
International Nuclear Information System (INIS)
Kotturi, G.; Erfle, H.; Koop, B.F.; Boer, J.G. de; Glickman, B.W.
1994-01-01
Automated DNA sequencers can be readily adapted for various types of sequence-based nucleic acid analysis: more recently it was determined the distribution of UV photoproducts in the E. coli laci gene using techniques developed for automated fluorescence-based analysis. We have been working to improve the automated approach of damage distribution. Our current method is more rigorous. We have new software that integrates the area under the individual peaks, rather than measuring the height of the curve. In addition, we now employ an internal standard. The analysis can also be partially automated. Detection limits for both major types of UV-photoproducts (cyclobutane dimers and pyrimidine (6-4) pyrimidone photoproducts) are reported. The UV-induced damage distribution in the hprt gene is compared to the mutational spectra in human and rodents cells
International Nuclear Information System (INIS)
Rozovski, Uri; Li, Ping; Harris, David; Ohanian, Maro; Kantarjian, Hagop; Estrov, Zeev
2014-01-01
Somatic mutations in cancer cell genes are classified according to their functional significance. Those that provide the malignant cells with significant advantage are collectively referred to as driver mutations and those that do not, are the passenger mutations. Accordingly, analytical criteria to distinguish driver mutations from passenger mutations have been recently suggested. Recent studies revealed mutations in interleukin-7 receptor-α (IL7R) gene in 10% of pediatric T-cell acute lymphoblastic leukemia (T-ALL) patients and in only a few cases of pediatric B-ALL. IL7R mutations are also frequently found in patients with lung cancer, but whereas in pediatric T-ALL IL7R mutations are “drivers” (consisting of gain-of-function mutations within a narrow 50-base pair interval at exon 6 that confer cytokine-independent cell growth and promote tumor transformation), in lung cancer, mutations are substitution mutations randomly distributed across the gene and are probably only “passenger” events. Because the treatment response of adult T-ALL is significantly poorer than that of childhood T-ALL and because exon 6 IL7R mutations play a role in the pathogenesis of childhood T-ALL, we sought to determine how the pattern of IL7R mutations varies between adult and childhood T-ALL. To that end, we sequenced the 50-base pair interval in exon 6 of the IL7R of DNA obtained from bone marrow samples of 35 randomly selected adult patients with T-ALL. Our analysis revealed that none of these 35 samples carried an IL7R mutation in exon 6. Whether differences in the genetic makeup of adult and childhood T-ALL explain the differential response to therapy remains to be determined
Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome
Directory of Open Access Journals (Sweden)
Marianna P.R. Porto
2010-01-01
Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.
Splice Site Mutations in the ATP7A Gene
DEFF Research Database (Denmark)
Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk
2011-01-01
Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...... to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations...
Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo
2016-04-01
Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy
2005-01-01
A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
Directory of Open Access Journals (Sweden)
Nicole Forbes
Full Text Available The NS1 protein of influenza A virus (IAV is a multifunctional virulence factor. We have previously characterized gain-of-function mutations in the NS1 protein arising from the experimental adaptation of the human isolate A/Hong Kong/1/1968(H3N2 (HK to the mouse. The majority of these mouse adapted NS1 mutations were demonstrated to increase virulence, viral fitness, and interferon antagonism, but differ in binding to the post-transcriptional processing factor cleavage and polyadenylation specificity factor 30 (CPSF30. Because nuclear trafficking is a major genetic determinant of influenza virus host adaptation, we assessed subcellular localization and host gene expression of NS1 adaptive mutations. Recombinant HK viruses with adaptive mutations in the NS1 gene were assessed for NS1 protein subcellular localization in mouse and human cells using confocal microscopy and cellular fractionation. In human cells the HK wild-type (HK-wt virus NS1 protein partitioned equivalently between the cytoplasm and nucleus but was defective in cytoplasmic localization in mouse cells. Several adaptive mutations increased the proportion of NS1 in the cytoplasm of mouse cells with the greatest effects for mutations M106I and D125G. The host gene expression profile of the adaptive mutants was determined by microarray analysis of infected mouse cells to show either high or low extents of host-gene regulation (HGR or LGR phenotypes. While host genes were predominantly down regulated for the HGR group of mutants (D2N, V23A, F103L, M106I+L98S, L98S, M106V, and M106V+M124I, the LGR phenotype mutants (D125G, M106I, V180A, V226I, and R227K were characterized by a predominant up regulation of host genes. CPSF30 binding affinity of NS1 mutants did not predict effects on host gene expression. To our knowledge this is the first report of roles of adaptive NS1 mutations that impact intracellular localization and regulation of host gene expression.
Major gene mutations and domestication of plants
International Nuclear Information System (INIS)
Ashri, A.
1989-01-01
From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs
Mutations of the phenylalanine hydroxylase gene in patients with phenylketonuria in Shanxi, China
Directory of Open Access Journals (Sweden)
Yong-An Zhou
2012-01-01
Full Text Available The variation in mutations in exons 3, 6, 7, 11 and 12 of the phenylalanine hydroxylase (PAH gene was investigated in 59 children with phenylketonuria (PKU and 100 normal children. Three single nucleotide polymorphisms were detected by sequence analysis. The mutational frequencies of cDNA 696, cDNA 735 and cDNA 1155 in patients were 96.2%, 76.1% and 7.6%, respectively, whereas in healthy children the corresponding frequencies were 97.0%, 77.3% and 8.3%. In addition, 81 mutations accounted for 61.0% of the mutant alleles. R111X, H64 > TfsX9 and S70 del accounted for 5.1%, 0.8% and 0.8% mutation of alleles in exon 3, whereas EX6-96A > G accounted for 10.2% mutation of alleles in exon 6. R243Q had the highest incidence in exon 7 (12.7%, followed by Ivs7 +2T>A (5.1% and T278I (2.5%. G247V, R252Q, L255S, R261Q and E280K accounted for 0.8% while Y356X and V399V accounted for 5.9% and 5.1%, respectively, in exon 11. R413P and A434D accounted for 5.9% and 2.5%, respectively, in exon 12. Seventy-two variant alleles accounted for the 16 mutations observed here. The mutation characteristics and distributions demonstrated that EX6-96A > G and R243Q were the hot regions for mutations in the PAH gene in Shanxi patients with PKU.
A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.
Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P
2003-04-08
We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.
Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.
2017-11-01
Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.
Stenson, Peter D; Mort, Matthew; Ball, Edward V; Shaw, Katy; Phillips, Andrew; Cooper, David N
2014-01-01
The Human Gene Mutation Database (HGMD®) is a comprehensive collection of germline mutations in nuclear genes that underlie, or are associated with, human inherited disease. By June 2013, the database contained over 141,000 different lesions detected in over 5,700 different genes, with new mutation entries currently accumulating at a rate exceeding 10,000 per annum. HGMD was originally established in 1996 for the scientific study of mutational mechanisms in human genes. However, it has since acquired a much broader utility as a central unified disease-oriented mutation repository utilized by human molecular geneticists, genome scientists, molecular biologists, clinicians and genetic counsellors as well as by those specializing in biopharmaceuticals, bioinformatics and personalized genomics. The public version of HGMD (http://www.hgmd.org) is freely available to registered users from academic institutions/non-profit organizations whilst the subscription version (HGMD Professional) is available to academic, clinical and commercial users under license via BIOBASE GmbH.
Glaucoma and Cytochrome P4501B1 Gene Mutations
Directory of Open Access Journals (Sweden)
Mukesh Tanwar
2010-01-01
Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.
Pan-Cancer Mutational and Transcriptional Analysis of the Integrator Complex
Directory of Open Access Journals (Sweden)
Antonio Federico
2017-04-01
Full Text Available The integrator complex has been recently identified as a key regulator of RNA Polymerase II-mediated transcription, with many functions including the processing of small nuclear RNAs, the pause-release and elongation of polymerase during the transcription of protein coding genes, and the biogenesis of enhancer derived transcripts. Moreover, some of its components also play a role in genome maintenance. Thus, it is reasonable to hypothesize that their functional impairment or altered expression can contribute to malignancies. Indeed, several studies have described the mutations or transcriptional alteration of some Integrator genes in different cancers. Here, to draw a comprehensive pan-cancer picture of the genomic and transcriptomic alterations for the members of the complex, we reanalyzed public data from The Cancer Genome Atlas. Somatic mutations affecting Integrator subunit genes and their transcriptional profiles have been investigated in about 11,000 patients and 31 tumor types. A general heterogeneity in the mutation frequencies was observed, mostly depending on tumor type. Despite the fact that we could not establish them as cancer drivers, INTS7 and INTS8 genes were highly mutated in specific cancers. A transcriptome analysis of paired (normal and tumor samples revealed that the transcription of INTS7, INTS8, and INTS13 is significantly altered in several cancers. Experimental validation performed on primary tumors confirmed these findings.
Rodriguez, David Enrique Aguilar; Lima, Carmen Silvia Passos; Lourenço, Gustavo Jacob; Figueiredo, Maria Estela; Carneiro, Jorge David Aivazoglu; Tone, Luiz Gonzaga; Llerena Jr., Juan Clinton; Toscano, Raquel Alves; Brandalise, Silvia; Pinto Júnior, Walter; Costa, Fernando Ferreira; Bertuzzo, Carmen Sílvia
2005-01-01
Fanconi anaemia (FA) is a recessive autosomal disease determined by mutations in genes of at least eleven complementation groups, with distinct distributions in different populations. As far as we know, there are no reports regarding the molecular characterisation of the disease in unselected FA patients in Brazil. OBECTIVE: This study aimed to investigate the most prevalent mutations of FANCA and FANCC genes in Brazilian patients with FA. METHODS: Genomic DNA obtained from 22 racially and et...
Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings
Energy Technology Data Exchange (ETDEWEB)
Poussaint, T.Y. [Dept. of Radiology, Children' s Hospital, Boston, MA (United States); Fox, J.W.; Walsh, C.A. [Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA (United States); Dept. of Neurology, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, MA (United States); Dobyns, W.B. [Department of Human Genetics, The University of Chicago, Chicago, IL (United States); Radtke, R. [Division of Neurology, Duke University Medical Center, Durham, NC (United States); Scheffer, I.E.; Berkovic, S.F. [Department of Neurology, University of Melbourne, Austin and Repatriation Medical Centre, Heidelberg (Australia); Barnes, P.D. [Department of Radiology, Children' s Hospital and Harvard Medical School, Boston, MA (United States); Huttenlocher, P.R. [Department of Pediatrics, University of Chicago, Chicago, Illinois (United States)
2000-11-01
Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)
Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings
International Nuclear Information System (INIS)
Poussaint, T.Y.; Fox, J.W.; Walsh, C.A.; Dobyns, W.B.; Radtke, R.; Scheffer, I.E.; Berkovic, S.F.; Barnes, P.D.; Huttenlocher, P.R.
2000-01-01
Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)
Detection of somatic mutations by high-resolution DNA melting (HRM) analysis in multiple cancers.
Gonzalez-Bosquet, Jesus; Calcei, Jacob; Wei, Jun S; Garcia-Closas, Montserrat; Sherman, Mark E; Hewitt, Stephen; Vockley, Joseph; Lissowska, Jolanta; Yang, Hannah P; Khan, Javed; Chanock, Stephen
2011-01-17
Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM) curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each). HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples.
Detection of somatic mutations by high-resolution DNA melting (HRM analysis in multiple cancers.
Directory of Open Access Journals (Sweden)
Jesus Gonzalez-Bosquet
Full Text Available Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each. HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples.
Caridi, Gianluca; Malaventura, Cristina; Dagnino, Monica; Leonardi, Emanuela; Artifoni, Lina; Ghiggeri, Gian Marco; Tosatto, Silvio C.E.; Murer, Luisa
2010-01-01
Background and objectives: Wilms tumor-suppressor gene-1 (WT1) plays a key role in kidney development and function. WT1 mutations usually occur in exons 8 and 9 and are associated with Denys-Drash, or in intron 9 and are associated with Frasier syndrome. However, overlapping clinical and molecular features have been reported. Few familial cases have been described, with intrafamilial variability. Sporadic cases of WT1 mutations in isolated diffuse mesangial sclerosis or focal segmental glomerulosclerosis have also been reported. Design, setting, participants, & measurements: Molecular analysis of WT1 exons 8 and 9 was carried out in five members on three generations of a family with late-onset isolated proteinuria. The effect of the detected amino acid substitution on WT1 protein's structure was studied by bioinformatics tools. Results: Three family members reached end-stage renal disease in full adulthood. None had genital abnormalities or Wilms tumor. Histologic analysis in two subjects revealed focal segmental glomerulosclerosis. The novel sequence variant c.1208G>A in WT1 exon 9 was identified in all of the affected members of the family. Conclusions: The lack of Wilms tumor or other related phenotypes suggests the expansion of WT1 gene analysis in patients with focal segmental glomerulosclerosis, regardless of age or presence of typical Denys-Drash or Frasier syndrome clinical features. Structural analysis of the mutated protein revealed that the mutation hampers zinc finger-DNA interactions, impairing target gene transcription. This finding opens up new issues about WT1 function in the maintenance of the complex gene network that regulates normal podocyte function. PMID:20150449
Directory of Open Access Journals (Sweden)
Georgina L Ryland
Full Text Available MicroRNAs are key regulators of gene expression and have been shown to have altered expression in a variety of cancer types, including epithelial ovarian cancer. MiRNA function is most often achieved through binding to the 3'-untranslated region of the target protein coding gene. Mutation screening using massively-parallel sequencing of 712 miRNA genes in 86 ovarian cancer cases identified only 5 mutated miRNA genes, each in a different case. One mutation was located in the mature miRNA, and three mutations were predicted to alter the secondary structure of the miRNA transcript. Screening of the 3'-untranslated region of 18 candidate cancer genes identified one mutation in each of AKT2, EGFR, ERRB2 and CTNNB1. The functional effect of these mutations is unclear, as expression data available for AKT2 and EGFR showed no increase in gene transcript. Mutations in miRNA genes and 3'-untranslated regions are thus uncommon in ovarian cancer.
Induced mutations of rust resistance genes in wheat
International Nuclear Information System (INIS)
McIntosh, R.A.
1983-01-01
Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)
A high-throughput protocol for mutation scanning of the BRCA1 and BRCA2 genes
International Nuclear Information System (INIS)
Hondow, Heather L; Fox, Stephen B; Mitchell, Gillian; Scott, Rodney J; Beshay, Victoria; Wong, Stephen Q; Dobrovic, Alexander
2011-01-01
Detection of mutations by DNA sequencing can be facilitated by scanning methods to identify amplicons which may have mutations. Current scanning methods used for the detection of germline sequence variants are laborious as they require post-PCR manipulation. High resolution melting (HRM) is a cost-effective rapid screening strategy, which readily detects heterozygous variants by melting curve analysis of PCR products. It is well suited to screening genes such as BRCA1 and BRCA2 as germline pathogenic mutations in these genes are always heterozygous. Assays for the analysis of all coding regions and intron-exon boundaries of BRCA1 and BRCA2 were designed, and optimised. A final set of 94 assays which ran under identical amplification conditions were chosen for BRCA1 (36) and BRCA2 (58). Significant attention was placed on primer design to enable reproducible detection of mutations within the amplicon while minimising unnecessary detection of polymorphisms. Deoxyinosine residues were incorporated into primers that overlay intronic polymorphisms. Multiple 384 well plates were used to facilitate high throughput. 169 BRCA1 and 239 BRCA2 known sequence variants were used to test the amplicons. We also performed an extensive blinded validation of the protocol with 384 separate patient DNAs. All heterozygous variants were detected with the optimised assays. This is the first HRM approach to screen the entire coding region of the BRCA1 and BRCA2 genes using one set of reaction conditions in a multi plate 384 well format using specifically designed primers. The parallel screening of a relatively large number of samples enables better detection of sequence variants. HRM has the advantages of decreasing the necessary sequencing by more than 90%. This markedly reduced cost of sequencing will result in BRCA1 and BRCA2 mutation testing becoming accessible to individuals who currently do not undergo mutation testing because of the significant costs involved
International Nuclear Information System (INIS)
Tsuji, Takehito; Kondo, Eri; Yasoda, Akihiro; Inamoto, Masataka; Kiyosu, Chiyo; Nakao, Kazuwa; Kunieda, Tetsuo
2008-01-01
Long bone abnormality (lbab/lbab) is a spontaneous mutant mouse characterized by dwarfism with shorter long bones. A missense mutation was reported in the Nppc gene, which encodes C-type natriuretic peptide (CNP), but it has not been confirmed whether this mutation is responsible for the dwarf phenotype. To verify that the mutation causes the dwarfism of lbab/lbab mice, we first investigated the effect of CNP in lbab/lbab mice. By transgenic rescue with chondrocyte-specific expression of CNP, the dwarf phenotype in lbab/lbab mice was completely compensated. Next, we revealed that CNP derived from the lbab allele retained only slight activity to induce cGMP production through its receptor. Histological analysis showed that both proliferative and hypertrophic zones of chondrocytes in the growth plate of lbab/lbab mice were markedly reduced. Our results demonstrate that lbab/lbab mice have a hypomorphic mutation in the Nppc gene that is responsible for dwarfism caused by impaired endochondral ossification
Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I
Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.
2008-01-01
Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043
Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa
Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.
2015-01-01
Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133
Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy
2007-02-01
To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.
Discordant diagnoses obtained by different approaches in antithrombin mutation analysis
DEFF Research Database (Denmark)
Feddersen, Søren; Nybo, Mads
2014-01-01
OBJECTIVES: In hereditary antithrombin (AT) deficiency it is important to determine the underlying mutation since the future risk of thromboembolism varies considerably between mutations. DNA investigations are in general thought of as flawless and irrevocable, but the diagnostic approach can...... be critical. We therefore investigated mutation results in the AT gene, SERPINC1, with two different approaches. DESIGN AND METHODS: Sixteen patients referred to the Centre for Thrombosis and Haemostasis, Odense University Hospital, with biochemical indications of AT deficiency, but with a negative denaturing...... high-performance liquid chromatography (DHPLC) mutation screening (routine approach until recently) were included. As an alternative mutation analysis, direct sequencing of all exons and exon-intron boundaries without pre-selection by DHPLC was performed. RESULTS: Out of sixteen patients...
Mutations in the LHX2 gene are not a frequent cause of micro/anophthalmia.
Desmaison, Annaïck; Vigouroux, Adeline; Rieubland, Claudine; Peres, Christine; Calvas, Patrick; Chassaing, Nicolas
2010-12-18
Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (orthodenticle homeobox 2 [OTX2], retina and anterior neural fold homeobox [RAX], SRY-box 2 [SOX2], CEH10 homeodomain-containing homolog [CHX10], and growth differentiation factor 6 [GDF6]) have been implicated mainly in isolated micro/anophthalmia but causative mutations of these genes explain less than a quarter of these developmental defects. The essential role of the LIM homeobox 2 (LHX2) transcription factor in early eye development has recently been documented. We postulated that mutations in this gene could lead to micro/anophthalmia, and thus performed molecular screening of its sequence in patients having micro/anophthalmia. Seventy patients having non-syndromic forms of colobomatous microphthalmia (n=25), isolated microphthalmia (n=18), or anophthalmia (n=17), and syndromic forms of micro/anophthalmia (n=10) were included in this study after negative molecular screening for OTX2, RAX, SOX2, and CHX10 mutations. Mutation screening of LHX2 was performed by direct sequencing of the coding sequences and intron/exon boundaries. Two heterozygous variants of unknown significance (c.128C>G [p.Pro43Arg]; c.776C>A [p.Pro259Gln]) were identified in LHX2 among the 70 patients. These variations were not identified in a panel of 100 control patients of mixed origins. The variation c.776C>A (p.Pro259Gln) was considered as non pathogenic by in silico analysis, while the variation c.128C>G (p.Pro43Arg) considered as deleterious by in silico analysis and was inherited from the asymptomatic father. Mutations in LHX2 do not represent a frequent cause of micro/anophthalmia.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.
Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza
2012-01-01
Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.
Collodion Baby with TGM1 gene mutation
Directory of Open Access Journals (Sweden)
Sharma D
2015-09-01
Full Text Available Deepak Sharma,1 Basudev Gupta,2 Sweta Shastri,3 Aakash Pandita,1 Smita Pawar4 1Department of Neonatology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, 2Department of Pediatrics, Civil Hospital, Palwal, Haryana, 3Department of Pathology, NKP Salve Medical College, Nagpur, Maharashtra, 4Department of Obstetrics and Gynaecology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, IndiaAbstract: Collodion baby (CB is normally diagnosed at the time of birth and refers to a newborn infant that is delivered with a lambskin-like membrane encompassing the total body surface. CB is not a specific disease entity, but is a common phenotype in conditions like harlequin ichthyosis, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, and trichothiodystrophy. We report a CB that was brought to our department and later diagnosed to have TGM1 gene c.984+1G>A mutation. However, it could not be ascertained whether the infant had lamellar ichthyosis or congenital ichthyosiform erythroderma (both having the same mutation. The infant was lost to follow-up.Keywords: cellophane membrane, c.984+1G>A mutation, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, parchment membrane, TGM1 gene
Directory of Open Access Journals (Sweden)
Monteiro Santos Erika
2012-02-01
Full Text Available Abstract Background Lynch syndrome (LS is the most common form of inherited predisposition to colorectal cancer (CRC, accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1, mutS homolog 2 (MSH2, postmeiotic segregation increased 1 (PMS1, post-meiotic segregation increased 2 (PMS2 and mutS homolog 6 (MSH6. Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Methods Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Results Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846, Barnetson (0.850, MMRpro (0.821 and Wijnen (0.807 models did not present significant statistical difference. The Myriad model presented lower AUC (0.704 than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad and 0.87 (Wijnen and specificity ranged from 0 (Myriad to 0.38 (Barnetson. Conclusions The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models.
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
EPILEPSY CAUSED BY PCDH19 GENE MUTATION: A REVIEW OF LITERATURE AND THE AUTHORS’ OBSERVATIONS
Directory of Open Access Journals (Sweden)
K. Yu. Mukhin
2016-01-01
Full Text Available Mutation in the PCDH19 gene was first described by L.M. Dibbens et al. in 2008. Mutations in this gene are associated with epilepsy and mental retardation limited to females. The clinical manifestations that are observed in some patients with PCDH19 mutation and Dravet syndrome that is caused by mutation in the SCN1A gene include the onset of febrile and afebrile seizures in infancy, serial seizures during fever, and regression in development after the onset of seizures. Due to the fact that the two diseases have common clinical signs, it is best to test for PCDH19 mutation in patients with the clinical picture of Dravet syndrome and a negative test for SCN1A. In general, the number of scientific papers devoted to analysis and recommendations for the choice of therapy in patients with rare genetic pathology is small now. We analyzed the specific features of clinical signs and therapy in our two observed female patients aged 4 and 11 years with verified PCDH19 mutation. Both patients were noted to have severe epilepsy with febrile convulsions with the development of status epilepticus and to be unresponsive to antiepileptic therapy. The use of different antiepileptic drugs (valproate, oxcarbazepine, phenobarbital, topiramate, levetiracetam at different combinations failed to control the course of epilepsy in the 4-year-old patient whereas the 11-year-old patient who took a combination of valproic acid and benzodiazepines achieved a positive effect.
Gene mutation in ATM/PI3K region of nasopharyngeal carcinoma cell lines
International Nuclear Information System (INIS)
Wang Hongmei; Wu Xinyao; Xia Yunfei
2002-01-01
Objective: To define the correlation between nasopharyngeal carcinoma (NPC) cell radiosensitivity and gene mutation in the ATM/PI3K coding region. Methods: The gene mutation in the ATM/PI3K region of nasopharyngeal carcinoma cell lines which vary in radiosensitivity, was monitored by reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence-marked ddNTP cycle sequencing technique. Results: No gene mutation was detected in the ATM/PI3K region of either CNE1 or CNE2. Conclusion: Disparity in intrinsic radiosensitivity between different NPC cell lines depends on some other factors and mechanism without being related to ATM/PI3K mutations
Kim, Hong-Il; Noh, Tae-Hwan; Lee, Chang-Soo; Park, Young-Jin
2015-01-01
Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight (BB) in rice. To study its function, a random insertion mutation library of Xoo was constructed using the Tn5 transposon. A mutant strain with decreased virulence against the susceptible rice cultivar IR24 was isolated from the library (aroE mutant), which also had extremely low pigment production. Thermal asymmetric interlaced-polymerase chain reaction (TAIL-PCR) and sequence analysis of the mutant revealed that the transposon was inserted into the aroE gene (encoding shikimate dehydrogenase). To investigate gene expression changes in the pigment- and virulence-deficient mutant, DNA microarray analysis was performed, which showed downregulation of 20 genes involved in the chemotaxis of Xoo. Our findings reveal that mutation of the aroE gene affects virulence and pigment production, as well as expression of genes involved in Xoo chemotaxis. Copyright © 2014 Elsevier GmbH. All rights reserved.
Mutational analysis of the promoter and the coding region of the 5-HT1A gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others
1994-09-01
Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
Recurrently Mutated Genes Differ between Leptomeningeal and Solid Lung Cancer Brain Metastases.
Li, Yingmei; Liu, Boxiang; Connolly, Ian David; Kakusa, Bina Wasunga; Pan, Wenying; Nagpal, Seema; Montgomery, Stephen B; Hayden Gephart, Melanie
2018-03-29
When compared with solid brain metastases from NSCLC, leptomeningeal disease (LMD) has unique growth patterns and is rapidly fatal. Patients with LMD do not undergo surgical resection, limiting the tissue available for scientific research. In this study we performed whole exome sequencing on eight samples of LMD to identify somatic mutations and compared the results with those for 26 solid brain metastases. We found that taste 2 receptor member 31 gene (TAS2R31) and phosphodiesterase 4D interacting protein gene (PDE4DIP) were recurrently mutated among LMD samples, suggesting involvement in LMD progression. Together with a retrospective review of the charts of an additional 44 patients with NSCLC LMD, we discovered a surprisingly low number of KRAS mutations (n = 4 [7.7%]) but a high number of EGFR mutations (n = 33 [63.5%]). The median interval for development of LMD from NSCLC was shorter in patients with mutant EGFR (16.3 months) than in patients with wild-type EGFR (23.9 months) (p = 0.017). Targeted analysis of recurrent mutations thus presents a useful complement to the existing diagnostic tool kit, and correlations of EGFR in LMD and KRAS in solid metastases suggest that molecular distinctions or systemic treatment pressure underpin the differences in growth patterns within the brain. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
Mutational analysis and clinical correlation of metastatic colorectal cancer.
Russo, Andrea L; Borger, Darrell R; Szymonifka, Jackie; Ryan, David P; Wo, Jennifer Y; Blaszkowsky, Lawrence S; Kwak, Eunice L; Allen, Jill N; Wadlow, Raymond C; Zhu, Andrew X; Murphy, Janet E; Faris, Jason E; Dias-Santagata, Dora; Haigis, Kevin M; Ellisen, Leif W; Iafrate, Anthony J; Hong, Theodore S
2014-05-15
Early identification of mutations may guide patients with metastatic colorectal cancer toward targeted therapies that may be life prolonging. The authors assessed tumor genotype correlations with clinical characteristics to determine whether mutational profiling can account for clinical similarities, differences, and outcomes. Under Institutional Review Board approval, 222 patients with metastatic colon adenocarcinoma (n = 158) and rectal adenocarcinoma (n = 64) who underwent clinical tumor genotyping were reviewed. Multiplexed tumor genotyping screened for >150 mutations across 15 commonly mutated cancer genes. The chi-square test was used to assess genotype frequency by tumor site and additional clinical characteristics. Cox multivariate analysis was used to assess the impact of genotype on overall survival. Broad-based tumor genotyping revealed clinical and anatomic differences that could be linked to gene mutations. NRAS mutations were associated with rectal cancer versus colon cancer (12.5% vs 0.6%; P colon cancer (13% vs 3%; P = .024) and older age (15.8% vs 4.6%; P = .006). TP53 mutations were associated with rectal cancer (30% vs 18%; P = .048), younger age (14% vs 28.7%; P = .007), and men (26.4% vs 14%; P = .03). Lung metastases were associated with PIK3CA mutations (23% vs 8.7%; P = .004). Only mutations in BRAF were independently associated with decreased overall survival (hazard ratio, 2.4; 95% confidence interval, 1.09-5.27; P = .029). The current study suggests that underlying molecular profiles can differ between colon and rectal cancers. Further investigation is warranted to assess whether the differences identified are important in determining the optimal treatment course for these patients. © 2014 American Cancer Society.
Eight previously unidentified mutations found in the OA1 ocular albinism gene
Directory of Open Access Journals (Sweden)
Dufier Jean-Louis
2006-04-01
Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.
Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana; Blume, Carolin; Sellner, Leopold; Jauch, Anna; Sill, Martin; Kater, Arnon P.; te Raa, G. Doreen; Geisler, Christian; van Oers, Marinus; Dietrich, Sascha; Dreger, Peter; Ho, Anthony D.; Paruzynski, Anna; Schmidt, Manfred; von Kalle, Christof; Glimm, Hanno; Zenz, Thorsten
2013-01-01
Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were
DEFF Research Database (Denmark)
Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana
2013-01-01
Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were...
Cruz, António José; Castro, Alexandra
2013-01-22
A 32-year-old woman with no significant medical history was sent to our consultation due to hypokalaemia (syndrome (GS) came negative. CLCNKB gene mutation analysis present in both GS and Bartter (BS) type 3 syndromes was positive. The patient is now being treated with potassium and magnesium oral supplements, ramipril and spironolactone with stable near-normal potassium and magnesium levels. This article presents the case of a patient with hypokalaemia caused by CLCNKB gene mutation hard to categorise as GS or BS type 3.
Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A
2003-01-01
The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.
Directory of Open Access Journals (Sweden)
Francesco Gatto
2016-07-01
Full Text Available Mutations are the basis of the clonal evolution of most cancers. Nevertheless, a systematic analysis of whether mutations are selected in cancer because they lead to the deregulation of specific biological processes independent of the type of cancer is still lacking. In this study, we correlated the genome and transcriptome of 1,082 tumors. We found that nine commonly mutated genes correlated with substantial changes in gene expression, which primarily converged on metabolism. Further network analyses circumscribed the convergence to a network of reactions, termed AraX, that involves the glutathione- and oxygen-mediated metabolism of arachidonic acid and xenobiotics. In an independent cohort of 4,462 samples, all nine mutated genes were consistently correlated with the deregulation of AraX. Among all of the metabolic pathways, AraX deregulation represented the strongest predictor of patient survival. These findings suggest that oncogenic mutations drive a selection process that converges on the deregulation of the AraX network.
Chen, L; Ding, X P; Wei, X; Li, L X
2014-03-12
We investigated the molecular genetic mechanism of sex reversal by exploring the relationship between mutations in the sex-determining genes SRY, SOX9, and DAX1 with genetic sex reversal disease. Mutations in the three key genes were detected by polymerase chain reaction (PCR) and sequencing after karyotype analysis. The mutations detected were then aligned with a random sample of 100 normal sequences and the NCBI sequence database in order to confirm any new mutations. Furthermore, the copy number of SOX9 was measured by fluorescence quantitative PCR. Seven of the 10 male sex reversal patients (46, XX) contained an excess copy of the SRY gene, while one of the eight female sex reversal patients (46, XY) was lacking the SRY gene. Additionally, a new mutation (T-A, Asp24Lys) was detected in one female sex reversal patient (46, XY). No other mutation was detected in the analysis of SOX9 and DAX1, with the exception of an insertion mutation (c.35377791insG) found in the testicular-specific enhancer (TESCO) sequences in an SRY-positive female sex reversal patient (46, XY). Eight of the 18 sex reversal cases (44.4%) showed obvious connections with SRY gene translocations, mutations, or deletions, which was significantly higher than that reported previously (33.3%), indicating a need to further expand the range of sample collection. Overall, these results indicated that the main mechanism of sex reversal are not associated with mutations in the coding regions of SOX9 and DAX1 or copy number variations of SOX9, which is consistent with results of previous studies.
In silico data analyses of the hotspot mutations of CHM gene in choroideremia disease
Directory of Open Access Journals (Sweden)
Saber Imani
2018-06-01
Full Text Available This data article provides compelling computational analysis of the hotspot CHM gene mutations that contribute to the progressive causativeness and susceptibility of Choroideremia in patients. We performed structural and molecular dynamics (MD simulation analysis on abnormal states of the CHM protein caused by deleterious and disease-causing hotspot mutant forms of CHM: S89C, E177K, and V529H. Within 40 ns, MD simulation time composed of the E177K mutant shows conformational alteration especially in several parts of the variant. Mathematically, we applied eigenvector analysis to determine the modes of flexibility and atomic positional fluctuations that contribute significantly to the overall motion of the CHM protein in terms of structural alteration, free energy landscapes (FEL, entropy, enthalpy, and principal component analysis (PCA.The data described here are related to the article entitled “Molecular Genetics Characterization and Homology Modeling of the CHM Gene Mutation: A study on Its Association with Choroideremia” (Imani et al., 2018 [1]. Keywords: In silico, Choroideremia, Rab escort protein 1, Molecular dynamic simulation
Directory of Open Access Journals (Sweden)
Morteza Bagheri
2015-07-01
Full Text Available Objective(s:Phenylketonuria (PKU is a genetic inborn error of phenylalanine (Phe metabolism resulting from insufficiency in the hepatic enzyme, phenylalanine hydroxylase (PAH, which leads to elevated levels of Phe in the blood. The present study was carried out for mutation analysis of the PAH gene in West Azerbaijan province of Iran. Materials and Methods:A total of 218 alleles from 40 PKU families were studied using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR method. Results:The frequencies of IVS10-11, S67P, R261Q, R252W, IVS11nt-1 g>c, R408Q, and Q232Q mutations were 28(35, 17(21.25, 15(18.75, 3(3.75, 3(3.75, 2(2.5, and 1(1.25, in cases group, and 51(23.4, 31(14.2, 27(12.4, 6(2.75, 6(2.75, 4(1.83, and 2(0.92 in total group, respectively. The mutations of R243Q, 364delG, L333F, 261X, I65T, and R408W were not detected in our samples. Conclusion: It can be concluded that the IVS10-11 mutation has the highest frequency in the tested population. To our knowledge, this report is the first in its own kind and provides better understanding of the genetic heterogeneity, the origin and distributions of PAH mutations in West Azerbaijan province of Iran.
Molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster
International Nuclear Information System (INIS)
Aleksandrov, I.D.; Aleksandrova, M.V.; Lapidus, I.L.; Karpovskij, A.L.
1996-01-01
The classical paradigm of spatially unrelated lesions for gene mutations and chromosomal exchange breakpoints induced by ionizing radiations in eukaryotic cells was re-examined in the experiments on the mapping of gamma-ray- or neutron-induced breakpoints in and outside of white (w) and vestigial (vg) genes of Drosophila melanogaster using the in situ hybridization of the large fragments of the genes under study with the polythene chromosomes of the relevant mutants. The results for the random sample of 60 inversion and translocation breakpoints analysed to date have shown that (i) 50% of them are mapped as the hot spots within big introns of both the genes, and (ii) 21 of 60 breaks (35%) are located outside of genes. It is important to note that 26% (16/60) of the breakpoints analysed are flanked by the deletions, the sizes of which vary from the quarter to a whole of the gene. It was found that the deletions flank both the inversion and translocation breakpoints and arise more often after action of neutrons than photons. An unexpectedly high frequency of the multiple-damaged w and vg mutants that have the gene/point mutation and additional, but separate, chromosome exchange (the so-called double- or triple-site mutants) has shown that the genetic danger of ionizing radiation is higher than usually accepted on the base of single gene/point mutation assessments. 11 refs., 3 figs
Association of mutations in the hemochromatosis gene with shorter life expectancy
DEFF Research Database (Denmark)
Bathum, L; Christiansen, L; Nybo, H
2001-01-01
BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....
BRAF, KIT, NRAS, GNAQ and GNA11 mutation analysis in cutaneous melanomas in Turkish population
Directory of Open Access Journals (Sweden)
Ismail Yilmaz
2015-01-01
Full Text Available Background: KIT and mitogen-activated protein kinase cascade are important for melanomagenesis. In the present study, we analyzed the frequency of BRAF, NRAS, KIT, GNAQ and GNA11 gene mutations and investigated their association with clinicopathological features of melanomas in Turkish population. Materials and Methods: Forty-seven primary cutaneous melanomas were included in our study. Sanger sequencing method was used for mutation analysis in all cases. Results: Mean age was 62.1 (29-101 years. Female:male ratio was 17:30. Among 47 melanomas, 14 (29.8% BRAF, 10 (21.3% NRAS, 4 (8.5% KIT and 1(2.1% GNAQ gene mutations were detected. Two of the KIT mutations were found in acral lentiginous melanoma (ALM. In the head and neck region, mutation frequency was significantly lower than in other locations (P = 0.035. The only GNAQ gene mutation (p.Q209L was detected in a melanoma arising from blue nevus located on the scalp. None of the melanomas harbored NRAS exon 2, KIT exon 13/17/18, GNAQ exon 4 and GNA11 exon 4/5 mutations. Overall mutation frequency did not show significant difference between metastatic (8/14, 57.1% and nonmetastatic (18/33, 54.5% patients. We did not observe any significant association between mutation status and gender or age of various patients. Conclusions: Our results support that BRAF and NRAS gene mutations are common in cutaneous melanomas. The activating mutations of KIT gene are rare and especially seen in ALM. GNAQ and GNA11 mutations are infrequent in cutaneous melanomas and may be associated only with melanomas arising from blue nevus.
HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.
Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J
2017-07-01
Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.
Activating HER2 mutations in HER2 gene amplification negative breast cancer.
Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J
2013-02-01
Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.
Analysis of PIK3CA Mutations and Activation Pathways in Triple Negative Breast Cancer.
Directory of Open Access Journals (Sweden)
Paolo Cossu-Rocca
Full Text Available Triple Negative Breast Cancer (TNBC accounts for 12-24% of all breast carcinomas, and shows worse prognosis compared to other breast cancer subtypes. Molecular studies demonstrated that TNBCs are a heterogeneous group of tumors with different clinical and pathologic features, prognosis, genetic-molecular alterations and treatment responsivity. The PI3K/AKT is a major pathway involved in the regulation of cell survival and proliferation, and is the most frequently altered pathway in breast cancer, apparently with different biologic impact on specific cancer subtypes. The most common genetic abnormality is represented by PIK3CA gene activating mutations, with an overall frequency of 20-40%. The aims of our study were to investigate PIK3CA gene mutations on a large series of TNBC, to perform a wider analysis on genetic alterations involving PI3K/AKT and BRAF/RAS/MAPK pathways and to correlate the results with clinical-pathologic data.PIK3CA mutation analysis was performed by using cobas® PIK3CA Mutation Test. EGFR, AKT1, BRAF, and KRAS genes were analyzed by sequencing. Immunohistochemistry was carried out to identify PTEN loss and to investigate for PI3K/AKT pathways components.PIK3CA mutations were detected in 23.7% of TNBC, whereas no mutations were identified in EGFR, AKT1, BRAF, and KRAS genes. Moreover, we observed PTEN loss in 11.3% of tumors. Deregulation of PI3K/AKT pathways was revealed by consistent activation of pAKT and p-p44/42 MAPK in all PIK3CA mutated TNBC.Our data shows that PIK3CA mutations and PI3K/AKT pathway activation are common events in TNBC. A deeper investigation on specific TNBC genomic abnormalities might be helpful in order to select patients who would benefit from current targeted therapy strategies.
Analysis of PIK3CA Mutations and Activation Pathways in Triple Negative Breast Cancer.
Cossu-Rocca, Paolo; Orrù, Sandra; Muroni, Maria Rosaria; Sanges, Francesca; Sotgiu, Giovanni; Ena, Sara; Pira, Giovanna; Murgia, Luciano; Manca, Alessandra; Uras, Maria Gabriela; Sarobba, Maria Giuseppina; Urru, Silvana; De Miglio, Maria Rosaria
2015-01-01
Triple Negative Breast Cancer (TNBC) accounts for 12-24% of all breast carcinomas, and shows worse prognosis compared to other breast cancer subtypes. Molecular studies demonstrated that TNBCs are a heterogeneous group of tumors with different clinical and pathologic features, prognosis, genetic-molecular alterations and treatment responsivity. The PI3K/AKT is a major pathway involved in the regulation of cell survival and proliferation, and is the most frequently altered pathway in breast cancer, apparently with different biologic impact on specific cancer subtypes. The most common genetic abnormality is represented by PIK3CA gene activating mutations, with an overall frequency of 20-40%. The aims of our study were to investigate PIK3CA gene mutations on a large series of TNBC, to perform a wider analysis on genetic alterations involving PI3K/AKT and BRAF/RAS/MAPK pathways and to correlate the results with clinical-pathologic data. PIK3CA mutation analysis was performed by using cobas® PIK3CA Mutation Test. EGFR, AKT1, BRAF, and KRAS genes were analyzed by sequencing. Immunohistochemistry was carried out to identify PTEN loss and to investigate for PI3K/AKT pathways components. PIK3CA mutations were detected in 23.7% of TNBC, whereas no mutations were identified in EGFR, AKT1, BRAF, and KRAS genes. Moreover, we observed PTEN loss in 11.3% of tumors. Deregulation of PI3K/AKT pathways was revealed by consistent activation of pAKT and p-p44/42 MAPK in all PIK3CA mutated TNBC. Our data shows that PIK3CA mutations and PI3K/AKT pathway activation are common events in TNBC. A deeper investigation on specific TNBC genomic abnormalities might be helpful in order to select patients who would benefit from current targeted therapy strategies.
Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population
Directory of Open Access Journals (Sweden)
Simonas Juzėnas
2016-01-01
Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.
Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.
Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi
2016-12-01
Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.
Study of the effect of HFE gene mutations on iron overload in ...
African Journals Online (AJOL)
Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...
Klevering, B.J.; Ijzer, S.; Rohrschneider, K.; Zonneveld-Vrieling, M.N.; Allikmets, R.; Born, L.I. van den; Maugeri, A.; Hoyng, C.B.; Cremers, F.P.M.
2004-01-01
Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.
Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah
2016-05-01
Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.
Klevering, B Jeroen; Yzer, Suzanne; Rohrschneider, Klaus; Zonneveld, Marijke; Allikmets, Rando; van den Born, L Ingeborgh; Maugeri, Alessandra; Hoyng, Carel B; Cremers, Frans P M
2004-12-01
Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or autosomal recessive CRD (54 cases) or RP (90 cases). We performed detailed ophthalmologic examinations and identified at least one ABCA4 mutation in 18 patients (33%) with CRD and in five patients (5.6%) with RP. Single-strand conformation polymorphism (SSCP) analysis and subsequent DNA sequencing revealed four novel missense mutations (R24C, E161K, P597S, G618E) and a novel 1-bp deletion (5888delG). Ophthalmoscopic abnormalities in CRD patients ranged from minor granular pigmentary changes in the posterior pole to widespread atrophy. In 12 patients with recordable electroretinogram (ERG) tracings, a cone-rod pattern was detected. Three patients demonstrated progression from a retinal dystrophy resembling STGD1 to a more widespread degeneration, and were subsequently diagnosed as CRD. In addition to a variable degree of atrophy, all RP patients displayed ophthalmologic characteristics of classic RP. When detectable, ERG recordings in these patients demonstrated rod-cone patterns of photoreceptor degeneration. In conclusion, in this study, we show that the ABCA4 mutation chip is an efficient first screening tool for arCRD.
Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian
2017-11-01
High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar
2018-01-02
Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong
2010-12-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.
International Nuclear Information System (INIS)
Hurtado, A M; Chen-Liang, T-H; Przychodzen, B; Hamedi, C; Muñoz-Ballester, J; Dienes, B; García-Malo, M D; Antón, A I; Arriba, F de; Teruel-Montoya, R; Ortuño, F J; Vicente, V; Maciejewski, J P; Jerez, A
2015-01-01
An increasing numbers of patients are being diagnosed with asymptomatic early-stage chronic lymphocytic leukemia (CLL), with no treatment indication at baseline. We applied a high-throughput deep-targeted analysis, especially designed for covering widely TP53 and ATM genes, in 180 patients with inactive disease at diagnosis, to test the independent prognostic value of CLL somatic recurrent mutations. We found that 40/180 patients harbored at least one acquired variant with ATM (n=17, 9.4%), NOTCH1 (n=14, 7.7%), TP53 (n=14, 7.7%) and SF3B1 (n=10, 5.5%) as most prevalent mutated genes. Harboring one ‘sub-Sanger' TP53 mutation granted an independent 3.5-fold increase of probability of needing treatment. Those patients with a double-hit ATM lesion (mutation+11q deletion) had the shorter median time to first treatment (17 months). We found that a genomic variable: TP53 mutations, most of them under the sensitivity of conventional techniques; a cell phenotypic factor: CD38-positive expression; and a classical marker as β2-microglobulin, remained as the unique independent predictors of outcome. The high-throughput determination of TP53 status, particularly in this set of patients frequently lacking high-risk chromosomal aberrations, emerges as a key step, not only for prediction modeling, but also for exploring mutation-specific therapeutic approaches and minimal residual disease monitoring
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H
2014-07-01
Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.
[An overview of oculocutaneous albinism: TYR gene mutations in five Colombian individuals].
Sanabria, Diana; Groot, Helena; Guzmán, Julio; Lattig, María Claudia
2012-06-01
Oculocutaneus albinism is a pigment-related inherited disorder characterized by hypopigmentation of the skin, hair and eyes, foveal hypoplasia and low vision. To date, 230 mutations in the TYR gene have been reported as responsible for oculocutaneus albinism type 1 worldwide. TYR gene encodes the enzyme tyrosinase involved in the metabolic pathway of melanin synthesis. Mutations were identified in the TYR gene as responsible for oculocutaneous albinism type 1 in five Colombian individuals, and a new ophthalmic system was tested that corrected visual defects and symptoms in a patient with oculocutaneous albinism. Samples were taken from 5 individuals, four of whom belong to a single family, along with a fifth individual not related to the family. Five exons in the TYR gene were sequenced to search for the gene carriers in the family and in the non-related individual. In addition, clinical ophthalmological evaluation and implementation of an new oculo-visual system was undertaken. A G47D and 1379delTT mutation was identified in the family. The unrelated individual carried a compound heterozygote for the G47D and D42N mutations. The oculo-visual corrective system was able to increase visual acuity and to diminish the nystagmus and photophobia. This is the first study in Colombia where albinism mutations are reported. The methods developed will enable future molecular screening studies in Colombian populations.
Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun
2018-05-12
Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.
Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin
2014-02-25
Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.
[Observation and analysis on mutation of routine STR locus].
Li, Qiu-yang; Feng, Wei-jun; Yang, Qin-gen
2005-05-01
To observe and analyze the characteristic of mutation at STR locus. 27 mutant genes observed in 1211 paternity testing cases were checked by PAGE-silver stained and PowerPlex 16 System Kit and validated by sequencing. Mutant genes locate on 15 loci. The pattern of mutation was accord with stepwise mutation model. The mutation ratio of male-to-female was 8:1 and correlated to the age of father. Mutation rate is correlated to the geometric mean of the number of homogeneous repeats of locus. The higher the mean, the higher the mutation rate. These loci are not so appropriate for use in paternity testing.
Ávila-Fernández, Almudena; Cantalapiedra, Diego; Aller, Elena; Vallespín, Elena; Aguirre-Lambán, Jana; Blanco-Kelly, Fiona; Corton, M; Riveiro-Álvarez, Rosa; Allikmets, Rando; Trujillo-Tiebas, María José; Millán, José M; Cremers, Frans P M; Ayuso, Carmen
2010-12-03
Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by progressive loss of vision. The aim of this study was to identify the causative mutations in 272 Spanish families using a genotyping microarray. 272 unrelated Spanish families, 107 with autosomal recessive RP (arRP) and 165 with sporadic RP (sRP), were studied using the APEX genotyping microarray. The families were also classified by clinical criteria: 86 juveniles and 186 typical RP families. Haplotype and sequence analysis were performed to identify the second mutated allele. At least one-gene variant was found in 14% and 16% of the juvenile and typical RP groups respectively. Further study identified four new mutations, providing both causative changes in 11% of the families. Retinol Dehydrogenase 12 (RDH12) was the most frequently mutated gene in the juvenile RP group, and Usher Syndrome 2A (USH2A) and Ceramide Kinase-Like (CERKL) were the most frequently mutated genes in the typical RP group. The only variant found in CERKL was p.Arg257Stop, the most frequent mutation. The genotyping microarray combined with segregation and sequence analysis allowed us to identify the causative mutations in 11% of the families. Due to the low number of characterized families, this approach should be used in tandem with other techniques.
Energy Technology Data Exchange (ETDEWEB)
Jingyong, Zhao; Yongzhong, Xu; Tao, Zhao; Fengmei, Cui; Liuyi, Wang; Qinhua, Lao [Suzhou Univ., Suzhou (China). Radiation Medicine Department
2001-07-01
HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides was performed and the relationships between mutation frequency and dose were studied. Rats were injected intravenously with radionuclides, the blood was sampled at different time after injection; HPRT gene locus mutation frequency (GMF) were examined by methods of multi-nucleus cell and Brdurd assay, working out the Dose-response function. GMF rose with the increase of dose and dose-rates and were clearly interrelated. The HPRT gene locus mutation is very sensitive to radiation and may be used as a biological dosimeter.
Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.
Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J
2012-01-01
PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.
A novel homozygous mutation in the FSHR gene is causative for primary ovarian insufficiency.
Liu, Hongli; Xu, Xiaofei; Han, Ting; Yan, Lei; Cheng, Lei; Qin, Yingying; Liu, Wen; Zhao, Shidou; Chen, Zi-Jiang
2017-12-01
To identify the potential FSHR mutation in a Chinese woman with primary ovarian insufficiency (POI). Genetic and functional studies. University-based reproductive medicine center. A POI patient, her family members, and another 192 control women with regular menstruation. Ovarian biopsy was performed in the patient. Sanger sequencing was carried out for the patient, her sister, and parents. The novel variant identified was further confirmed with the use of control subjects. Sanger sequencing and genotype analysis to identify the potential variant of the FSHR gene; hematoxylin and eosin staining of the ovarian section to observe the follicular development; Western blotting and immunofluorescence to detect FSH receptor (FSHR) expression; and cyclic adenosine monophosphate (cAMP) assay to monitor FSH-induced signaling. Histologic examination of the ovaries in the patient revealed follicular development up to the early antral stage. Mutational screening and genotype analysis of the FSHR gene identified a novel homozygous mutation c.175C>T (p.R59X) in exon 2, which was inherited in the autosomal recessive mode from her heterozygous parents but was absent in her sister and the 192 control women. Functional studies demonstrated that in vitro the nonsense mutation caused the loss of full-length FSHR expression and that p.R59X mutant showed no response to FSH stimulation in the cAMP level. The mutation p.R59X in FSHR is causative for POI by means of arresting folliculogenesis. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Genomic analysis of primordial dwarfism reveals novel disease genes.
Shaheen, Ranad; Faqeih, Eissa; Ansari, Shinu; Abdel-Salam, Ghada; Al-Hassnan, Zuhair N; Al-Shidi, Tarfa; Alomar, Rana; Sogaty, Sameera; Alkuraya, Fowzan S
2014-02-01
Primordial dwarfism (PD) is a disease in which severely impaired fetal growth persists throughout postnatal development and results in stunted adult size. The condition is highly heterogeneous clinically, but the use of certain phenotypic aspects such as head circumference and facial appearance has proven helpful in defining clinical subgroups. In this study, we present the results of clinical and genomic characterization of 16 new patients in whom a broad definition of PD was used (e.g., 3M syndrome was included). We report a novel PD syndrome with distinct facies in two unrelated patients, each with a different homozygous truncating mutation in CRIPT. Our analysis also reveals, in addition to mutations in known PD disease genes, the first instance of biallelic truncating BRCA2 mutation causing PD with normal bone marrow analysis. In addition, we have identified a novel locus for Seckel syndrome based on a consanguineous multiplex family and identified a homozygous truncating mutation in DNA2 as the likely cause. An additional novel PD disease candidate gene XRCC4 was identified by autozygome/exome analysis, and the knockout mouse phenotype is highly compatible with PD. Thus, we add a number of novel genes to the growing list of PD-linked genes, including one which we show to be linked to a novel PD syndrome with a distinct facial appearance. PD is extremely heterogeneous genetically and clinically, and genomic tools are often required to reach a molecular diagnosis.
Directory of Open Access Journals (Sweden)
Mehul Mistri
Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.
Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh
2012-01-01
Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.
Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.
Directory of Open Access Journals (Sweden)
Elizabeth A. Robb
Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.
Analysis of SLX4/FANCP in non-BRCA1/2-mutated breast cancer families
Directory of Open Access Journals (Sweden)
Fernández-Rodríguez Juana
2012-03-01
Full Text Available Abstract Background Genes that, when mutated, cause Fanconi anemia or greatly increase breast cancer risk encode for proteins that converge on a homology-directed DNA damage repair process. Mutations in the SLX4 gene, which encodes for a scaffold protein involved in the repair of interstrand cross-links, have recently been identified in unclassified Fanconi anemia patients. A mutation analysis of SLX4 in German or Byelorussian familial cases of breast cancer without detected mutations in BRCA1 or BRCA2 has been completed, with globally negative results. Methods The genomic region of SLX4, comprising all exons and exon-intron boundaries, was sequenced in 94 Spanish familial breast cancer cases that match a criterion indicating the potential presence of a highly-penetrant germline mutation, following exclusion of BRCA1 or BRCA2 mutations. Results This mutational analysis revealed extensive genetic variation of SLX4, with 21 novel single nucleotide variants; however, none could be linked to a clear alteration of the protein function. Nonetheless, genotyping 10 variants (nine novel, all missense amino acid changes in a set of controls (138 women and 146 men did not detect seven of them. Conclusions Overall, while the results of this study do not identify clearly pathogenic mutations of SLX4 contributing to breast cancer risk, further genetic analysis, combined with functional assays of the identified rare variants, may be warranted to conclusively assess the potential link with the disease.
Analysis of SLX4/FANCP in non-BRCA1/2-mutated breast cancer families
International Nuclear Information System (INIS)
Fernández-Rodríguez, Juana; Schindler, Detlev; Capellá, Gabriel; Brunet, Joan; Lázaro, Conxi; Pujana, Miguel Angel; Quiles, Francisco; Blanco, Ignacio; Teulé, Alex; Feliubadaló, Lídia; Valle, Jesús del; Salinas, Mónica; Izquierdo, Àngel; Darder, Esther
2012-01-01
Genes that, when mutated, cause Fanconi anemia or greatly increase breast cancer risk encode for proteins that converge on a homology-directed DNA damage repair process. Mutations in the SLX4 gene, which encodes for a scaffold protein involved in the repair of interstrand cross-links, have recently been identified in unclassified Fanconi anemia patients. A mutation analysis of SLX4 in German or Byelorussian familial cases of breast cancer without detected mutations in BRCA1 or BRCA2 has been completed, with globally negative results. The genomic region of SLX4, comprising all exons and exon-intron boundaries, was sequenced in 94 Spanish familial breast cancer cases that match a criterion indicating the potential presence of a highly-penetrant germline mutation, following exclusion of BRCA1 or BRCA2 mutations. This mutational analysis revealed extensive genetic variation of SLX4, with 21 novel single nucleotide variants; however, none could be linked to a clear alteration of the protein function. Nonetheless, genotyping 10 variants (nine novel, all missense amino acid changes) in a set of controls (138 women and 146 men) did not detect seven of them. Overall, while the results of this study do not identify clearly pathogenic mutations of SLX4 contributing to breast cancer risk, further genetic analysis, combined with functional assays of the identified rare variants, may be warranted to conclusively assess the potential link with the disease
Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.
Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa
2012-10-15
Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Novel nonsense mutation in the katA gene of a catalase-negative Staphylococcus aureus strain.
Lagos, Jaime; Alarcón, Pedro; Benadof, Dona; Ulloa, Soledad; Fasce, Rodrigo; Tognarelli, Javier; Aguayo, Carolina; Araya, Pamela; Parra, Bárbara; Olivares, Berta; Hormazábal, Juan Carlos; Fernández, Jorge
2016-01-01
We report the first description of a rare catalase-negative strain of Staphylococcus aureus in Chile. This new variant was isolated from blood and synovial tissue samples of a pediatric patient. Sequencing analysis revealed that this catalase-negative strain is related to ST10 strain, which has earlier been described in relation to S. aureus carriers. Interestingly, sequence analysis of the catalase gene katA revealed presence of a novel nonsense mutation that causes premature translational truncation of the C-terminus of the enzyme leading to a loss of 222 amino acids. Our study suggests that loss of catalase activity in this rare catalase-negative Chilean strain is due to this novel nonsense mutation in the katA gene, which truncates the enzyme to just 283 amino acids. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.
Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A
2017-08-01
Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society
Directory of Open Access Journals (Sweden)
Satoshi Katagiri
Full Text Available OBJECTIVE: The purpose of this study was to investigate frequent disease-causing gene mutations in autosomal recessive retinitis pigmentosa (arRP in the Japanese population. METHODS: In total, 99 Japanese patients with non-syndromic and unrelated arRP or sporadic RP (spRP were recruited in this study and ophthalmic examinations were conducted for the diagnosis of RP. Among these patients, whole exome sequencing analysis of 30 RP patients and direct sequencing screening of all CNGA1 exons of the other 69 RP patients were performed. RESULTS: Whole exome sequencing of 30 arRP/spRP patients identified disease-causing gene mutations of CNGA1 (four patients, EYS (three patients and SAG (one patient in eight patients and potential disease-causing gene variants of USH2A (two patients, EYS (one patient, TULP1 (one patient and C2orf71 (one patient in five patients. Screening of an additional 69 arRP/spRP patients for the CNGA1 gene mutation revealed one patient with a homozygous mutation. CONCLUSIONS: This is the first identification of CNGA1 mutations in arRP Japanese patients. The frequency of CNGA1 gene mutation was 5.1% (5/99 patients. CNGA1 mutations are one of the most frequent arRP-causing mutations in Japanese patients.
Diffusion tensor imaging of brain white matter in Huntington gene mutation individuals
Directory of Open Access Journals (Sweden)
Roberta Arb Saba
Full Text Available ABSTRACT Objective To evaluate the role of the involvement of white matter tracts in huntingtin gene mutation patients as a potential biomarker of the progression of the disease. Methods We evaluated 34 participants (11 symptomatic huntingtin gene mutation, 12 presymptomatic huntingtin gene mutation, and 11 controls. We performed brain magnetic resonance imaging to assess white matter integrity using diffusion tensor imaging, with measurement of fractional anisotropy. Results We observed a significant decrease of fractional anisotropy in the cortical spinal tracts, corona radiate, corpus callosum, external capsule, thalamic radiations, superior and inferior longitudinal fasciculus, and inferior frontal-occipital fasciculus in the Huntington disease group compared to the control and presymptomatic groups. Reduction of fractional anisotropy is indicative of a degenerative process and axonal loss. There was no statistically significant difference between the presymptomatic and control groups. Conclusion White matter integrity is affected in huntingtin gene mutation symptomatic individuals, but other studies with larger samples are required to assess its usefulness in the progression of the neurodegenerative process.
A Gene Module-Based eQTL Analysis Prioritizing Disease Genes and Pathways in Kidney Cancer
Directory of Open Access Journals (Sweden)
Mary Qu Yang
Full Text Available Clear cell renal cell carcinoma (ccRCC is the most common and most aggressive form of renal cell cancer (RCC. The incidence of RCC has increased steadily in recent years. The pathogenesis of renal cell cancer remains poorly understood. Many of the tumor suppressor genes, oncogenes, and dysregulated pathways in ccRCC need to be revealed for improvement of the overall clinical outlook of the disease. Here, we developed a systems biology approach to prioritize the somatic mutated genes that lead to dysregulation of pathways in ccRCC. The method integrated multi-layer information to infer causative mutations and disease genes. First, we identified differential gene modules in ccRCC by coupling transcriptome and protein-protein interactions. Each of these modules consisted of interacting genes that were involved in similar biological processes and their combined expression alterations were significantly associated with disease type. Then, subsequent gene module-based eQTL analysis revealed somatic mutated genes that had driven the expression alterations of differential gene modules. Our study yielded a list of candidate disease genes, including several known ccRCC causative genes such as BAP1 and PBRM1, as well as novel genes such as NOD2, RRM1, CSRNP1, SLC4A2, TTLL1 and CNTN1. The differential gene modules and their driver genes revealed by our study provided a new perspective for understanding the molecular mechanisms underlying the disease. Moreover, we validated the results in independent ccRCC patient datasets. Our study provided a new method for prioritizing disease genes and pathways. Keywords: ccRCC, Causative mutation, Pathways, Protein-protein interaction, Gene module, eQTL
Paloma, E; Martínez-Mir, A; Vilageliu, L; Gonzàlez-Duarte, R; Balcells, S
2001-06-01
The ABCA4 gene has been involved in several forms of inherited macular dystrophy. In order to further characterize the complex genotype-phenotype relationships involving this gene, we have performed a mutation analysis of ABCA4 in 14 Spanish patients comprising eight STGD (Stargardt), four FFM (fundus flavimaculatus), and two CRD (Cone-rod dystrophy) patients. SSCP (single-strand conformation polymorphism) analysis and DNA sequencing of the coding and 5' upstream regions of this gene allowed the identification of 16 putatively pathogenic alterations, nine of which are novel. Most of these were missense changes, and no patient was found to carry two null alleles. Overall, the new data agree with a working model relating the different pathogenic phenotypes to the severity of the mutations. When considering the information presented here together with that of previous reports, a picture of the geographic distribution of three particular mutations emerges. The R212C change has been found in French, Italian, Dutch, German, and Spanish but not in British patients. In the Spanish collection, R212C was found in a CRD patient, indicating that it may be a rather severe change. In contrast, c.2588G>C, a very common mild allele in the Dutch population, is rarely found in Southern Europe. Interestingly, the c.2588G>C mutation has been found in a double mutant allele together with the missense R1055W. Finally, the newly described L1940P was found in two unrelated Spanish patients, and may be a moderate to severe allele. Copyright 2001 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Bittencourt P.L.
2002-01-01
Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.
RFLP analysis of rice semi-dwarf mutation induced by high energy argon ion radiation
International Nuclear Information System (INIS)
Zhuang Chuxiong; Hu Weimin; Mei Mantong
1997-01-01
Two Indica rice varieties, Bianpizhan and Xiangzhan, and their semi-dwarf mutants induced by high energy argon ion radiation, Ar-10, and Xiang-Ar-1, were examined with restriction fragment length polymorphism (RFLP) analysis by using 97 rice single copy genomic clones mapped on 12 chromosomes of molecular genetic map, combined with 5 restriction enzymes. Among the markers screened, 9 detected polymorphism were between Bianpizhen and Ar-10, and 11 detected polymorphism were between Xiangzhan and Xiang-Ar-1. Moreover, two or more restriction enzymes could generate RFLP patterns when screened with a given marker for several polymorphic markers. Based on the polymorphic allelic loci, the mutation frequencies were estimated as 5.15% and 6.39% for Ar-10 and Xiang-Ar-1 respectively. These results suggested that the nature of mutation on the DNA level was probably large genetic changes rather than point mutation. Genetic analysis and gene tagging of semi-dwarf mutation in one of the mutant line, Ar-10, indicated that this mutation was controlled by a major recessive gene, which was preliminary located on chromosome 4
RFLP Analysis of rice semi dwarf mutation induced by high energy argon ion radiation
International Nuclear Information System (INIS)
Zhuang Chuxiong; Hu Weimin; Mei Mantong
1997-01-01
Two Indica rice varieties, Bianpizhan and Xiangzhan, and their semi dwarf mutants induced by high energy argon ion radiation, Ar 10, and Xiang Ar 1, were examined with restriction fragment length polymorphism(RFLP)analysis by using 97 rice single copy genomic clones mapped on 12 chromosomes of molecular genetic map, combined with 5 restriction enzymes.Among the markers screened, 9 detected polymorphism were between Bianpizhan and Ar 10, and 11 detected polymorphism were between Xiangzhan and Xiang Ar 1.Moreover, two or more restriction enzymes could generate RFLP patterns when screened with a given marker for several polymorphic markers. Based on the polymorphic allelic loci, the mutation frequencies were estimated as 5 15% and 6 39% for Ar 10 and Xiang Ar 1 respectively.These results suggested that the nature of mutation on the DNA level was probably large genetic changes rather than point mutation.Genetic analysis and gene tagging of semi dwarf mutation in one of the mutant line, Ar 10, indicated that this mutation was controlled by a major recessive gene, which was preliminary located on chromosome 4. (author)
High incidence of GJB2 gene mutations among assortatively mating ...
Indian Academy of Sciences (India)
High incidence of GJB2 gene mutations among assortatively mating hearing impaired families in Kerala: future implications. Amritkumar Pavithra, Justin Margret Jeffrey, Jayasankaran Chandru, Arabandi Ramesh and C. R. Srikumari Srisailapathy. J. Genet. 93, 207–213. Table 1. Consolidated table of GJB2 mutation status ...
Shiba, Norio
2015-12-01
A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.
The functional importance of disease-associated mutation
Directory of Open Access Journals (Sweden)
Klein Teri E
2002-09-01
Full Text Available Abstract Background For many years, scientists believed that point mutations in genes are the genetic switches for somatic and inherited diseases such as cystic fibrosis, phenylketonuria and cancer. Some of these mutations likely alter a protein's function in a manner that is deleterious, and they should occur in functionally important regions of the protein products of genes. Here we show that disease-associated mutations occur in regions of genes that are conserved, and can identify likely disease-causing mutations. Results To show this, we have determined conservation patterns for 6185 non-synonymous and heritable disease-associated mutations in 231 genes. We define a parameter, the conservation ratio, as the ratio of average negative entropy of analyzable positions with reported mutations to that of every analyzable position in the gene sequence. We found that 84.0% of the 231 genes have conservation ratios less than one. 139 genes had eleven or more analyzable mutations and 88.0% of those had conservation ratios less than one. Conclusions These results indicate that phylogenetic information is a powerful tool for the study of disease-associated mutations. Our alignments and analysis has been made available as part of the database at http://cancer.stanford.edu/mut-paper/. Within this dataset, each position is annotated with the analysis, so the most likely disease-causing mutations can be identified.
Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion.
Ivanov, E L; Kovaltzova, S V; Korolev, V G
1989-08-01
We have developed a method to isolate yeast (Saccharomyces cerevisiae) mutants with enhanced induced mutagenesis based on nitrous acid-induced reversion of the ade2-42 allele. Six mutants have been isolated and designated him (high induced mutagenesis), and 4 of them were studied in more detail. The him mutants displayed enhanced reversion of the ade2-42 allele, either spontaneous or induced by nitrous acid, UV light, and the base analog 6-N-hydroxylaminopurine, but not by gamma-irradiation. It is worth noting that the him mutants turned out not to be sensitive to the lethal effects of the mutagens used. The enhancement in mutation induced by nitrous acid, UV light, and 6-N-hydroxylaminopurine has been confirmed in a forward-mutation assay (induction of mutations in the ADE1, ADE2 genes). The latter agent revealed the most apparent differences between the him mutants and the wild-type strain and was, therefore, chosen for the genetic analysis of mutants, him mutations analyzed behaved as a single Mendelian trait; complementation tests indicated 3 complementation groups (HIM1, HIM2, and HIM3), each containing 1 mutant allele. Uracil-DNA glycosylase activity was determined in crude cell extracts, and no significant differences between the wild-type and him strains were detected. Spontaneous mitotic gene conversion at the ADE2 locus is altered in him1 strains, either increased or decreased, depending on the particular heteroallelic combination. Genetic evidence strongly suggests him mutations to be involved in a process of mismatch correction of molecular heteroduplexes.
Tatsi, Christina; Kanaka-Gantenbein, Christina; Vazeou-Gerassimidi, Adriani; Chrysis, Dionysios; Delis, Dimitrios; Tentolouris, Nikolaos; Dacou-Voutetakis, Catherine; Chrousos, George P; Sertedaki, Amalia
2013-11-01
Maturity-Onset Diabetes of the Young (MODY) is the most common type of monogenic diabetes accounting for 1-2% of the population with diabetes. The relative incidence of HNF1A-MODY (MODY3) is high in European countries; however, data are not available for the Greek population. The aims of this study were to determine the relative frequency of MODY3 in Greece, the type of the mutations observed, and their relation to the phenotype of the patients. Three hundred ninety-five patients were referred to our center because of suspected MODY during a period of 15 yr. The use of Denaturing Gradient Gel Electrophoresis of polymerase chain reaction amplified DNA revealed 72 patients carrying Glucokinase gene mutations (MODY2) and 8 patients carrying HNF1A gene mutations (MODY3). After using strict criteria, 54 patients were selected to be further evaluated by direct sequencing or by multiplex ligation probe amplification (MLPA) for the presence of HNF1A gene mutations. In 16 unrelated patients and 13 of their relatives, 15 mutations were identified in the HNF1A gene. Eight of these mutations were previously reported, whereas seven were novel. Clinical features, such as age of diabetes at diagnosis or severity of hyperglycemia, were not related to the mutation type or location. In our cohort of patients fulfilling strict clinical criteria for MODY, 12% carried an HNF1A gene mutation, suggesting that defects of this gene are responsible for a significant proportion of monogenic diabetes in the Greek population. No clear phenotype-genotype correlations were identified. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Zampieri, Stefania; Montalvo, Annalisa; Blanco, Mariana; Zanin, Irene; Amartino, Hernan; Vlahovicek, Kristian; Szlago, Marina; Schenone, Andrea; Pittis, Gabriela; Bembi, Bruno; Dardis, Andrea
2012-05-15
Tay-Sachs disease (TSD) is a recessively inherited disorder caused by the deficient activity of hexosaminidase A due to mutations in the HEXA gene. Up to date there is no information regarding the molecular genetics of TSD in Argentinean patients. In the present study we have studied 17 Argentinean families affected by TSD, including 20 patients with the acute infantile form and 3 with the sub-acute form. Overall, we identified 14 different mutations accounting for 100% of the studied alleles. Eight mutations were novel: 5 were single base changes leading to drastic residue changes or truncated proteins, 2 were small deletions and one was an intronic mutation that may cause a splicing defect. Although the spectrum of mutations was highly heterogeneous, a high frequency of the c.459+5G>A mutation, previously described in different populations was found among the studied cohort. Haplotype analysis suggested that in these families the c.459+5G>A mutation might have arisen by a single mutational event. Copyright © 2012 Elsevier B.V. All rights reserved.
Mutational analysis of the HLA-DQ3.2 insulin-dependent diabetes mellitus susceptibility gene
International Nuclear Information System (INIS)
Kwok, W.W.; Lotshaw, C.; Milner, E.C.B.; Knitter-Jack, N.; Nepom, G.T.
1989-01-01
The human major histocompatibility complex includes approximately 14 class II HLA genes within the HLA-D region, most of which exist in multiple allelic forms. One of these genes, the DQ3.2β gene, accounts for the well-documented association of HLA-DR4 with insulin-dependent diabetes mellitus and is the single allele most highly correlated with this disease. The authors analyzed the amino acid substitutions that lead to the structural differences distinguishing DQ3.2β from its nondiabetogenic, but closely related allele, DQ3.1β. Site-directed mutagenesis of the DQ3.2β gene was used to convert key nucleotides into DQ3.2β codons. Subsequent expression studies of these mutated DQ3.2β clones using retroviral vectors defined amino acid 45 as critical for generating serologic epitopes characterizing the DQw3.1β and DQw3.2β molecules
Clinical impact of recurrently mutated genes on lymphoma diagnostics: state-of-the-art and beyond.
Rosenquist, Richard; Rosenwald, Andreas; Du, Ming-Qing; Gaidano, Gianluca; Groenen, Patricia; Wotherspoon, Andrew; Ghia, Paolo; Gaulard, Philippe; Campo, Elias; Stamatopoulos, Kostas
2016-09-01
Similar to the inherent clinical heterogeneity of most, if not all, lymphoma entities, the genetic landscape of these tumors is markedly complex in the majority of cases, with a rapidly growing list of recurrently mutated genes discovered in recent years by next-generation sequencing technology. Whilst a few genes have been implied to have diagnostic, prognostic and even predictive impact, most gene mutations still require rigorous validation in larger, preferably prospective patient series, to scrutinize their potential role in lymphoma diagnostics and patient management. In selected entities, a predominantly mutated gene is identified in almost all cases (e.g. Waldenström's macroglobulinemia/lymphoplasmacytic lymphoma and hairy-cell leukemia), while for the vast majority of lymphomas a quite diverse mutation pattern is observed, with a limited number of frequently mutated genes followed by a seemingly endless tail of genes with mutations at a low frequency. Herein, the European Expert Group on NGS-based Diagnostics in Lymphomas (EGNL) summarizes the current status of this ever-evolving field, and, based on the present evidence level, segregates mutations into the following categories: i) immediate impact on treatment decisions, ii) diagnostic impact, iii) prognostic impact, iv) potential clinical impact in the near future, or v) should only be considered for research purposes. In the coming years, coordinated efforts aiming to apply targeted next-generation sequencing in large patient series will be needed in order to elucidate if a particular gene mutation will have an immediate impact on the lymphoma classification, and ultimately aid clinical decision making. Copyright© Ferrata Storti Foundation.
Rapid detection of single nucleotide mutation in p53 gene based on ...
Indian Academy of Sciences (India)
mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.
Effects of missense mutations in sortase A gene on enzyme activity in Streptococcus mutans.
Zhuang, P L; Yu, L X; Tao, Y; Zhou, Y; Zhi, Q H; Lin, H C
2016-04-11
Streptococcus mutans (S. mutans) is the major aetiological agent of dental caries, and the transpeptidase Sortase A (SrtA) plays a major role in cariogenicity. The T168G and G470A missense mutations in the srtA gene may be linked to caries susceptibility, as demonstrated in our previous studies. This study aimed to investigate the effects of these missense mutations of the srtA gene on SrtA enzyme activity in S. mutans. The point mutated recombinant S.mutans T168G and G470A sortases were expressed in expression plasmid pET32a. S. mutans UA159 sortase coding gene srtA was used as the template for point mutation. Enzymatic activity was assessed by quantifying increases in the fluorescence intensity generated when a substrate Dabcyl-QALPNTGEE-Edans was cleaved by SrtA. The kinetic constants were calculated based on the curve fit for the Michaelis-Menten equation. SrtA△N40(UA159) and the mutant enzymes, SrtA△N40(D56E) and SrtA△N40(R157H), were expressed and purified. A kinetic analysis showed that the affinity of SrtA△N40(D56E) and SrtA△N40(R157H) remained approximately equal to the affinity of SrtA△N40(UA159), as determined by the Michaelis constant (K m ). However, the catalytic rate constant (k cat ) and catalytic efficiency (k cat /K m ) of SrtA△N40(D56E) were reduced compared with those of SrtA△N40(R157H) and SrtA△N40(UA159), whereas the k cat and k cat /K m values of SrtA△N40(R157H) were slightly lower than those of SrtA△N40(UA159). The findings of this study indicate that the T168G missense mutation of the srtA gene results in a significant reduction in enzymatic activity compared with S. mutans UA159, suggesting that the T168G missense mutation of the srtA gene may be related to low cariogenicity.
Directory of Open Access Journals (Sweden)
Anna Ka-Yee Kwong
Full Text Available Epileptic Encephalopathy (EE is a heterogeneous condition in which cognitive, sensory and/or motor functions deteriorate as a consequence of epileptic activity, which consists of frequent seizures and/or major interictal paroxysmal activity. There are various causes of EE and they may occur at any age in early childhood. Genetic mutations have been identified to contribute to an increasing number of children with early onset EE which had been previously considered as cryptogenic. We identified 26 patients with Infantile Epileptic Encephalopathy (IEE of unknown etiology despite extensive workup and without any specific epilepsy syndromic phenotypes. We performed genetic analysis on a panel of 7 genes (ARX, CDKL5, KCNQ2, PCDH19, SCN1A, SCN2A, STXBP1 and identified 10 point mutations [ARX (1, CDKL5 (3, KCNQ2 (2, PCDH19 (1, SCN1A (1, STXBP1 (2] as well as one microdeletion involving both SCN1A and SCN2A. The high rate (42% of mutations suggested that genetic testing of this IEE panel of genes is recommended for cryptogenic IEE with no etiology identified. These 7 genes are associated with channelopathies or synaptic transmission and we recommend early genetic testing if possible to guide the treatment strategy.
Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa
International Nuclear Information System (INIS)
Dryja, T.P.; Han, L.B.; Cowley, G.S.; McGee, T.L.; Berson, E.L.
1991-01-01
The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150 patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene
Detecting negative selection on recurrent mutations using gene genealogy
2013-01-01
Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their
[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].
Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong
2014-10-18
To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in
International Nuclear Information System (INIS)
Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun
2009-01-01
Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II
Mutation analysis of COL4A3 and COL4A4 genes in a Chinese ...
Indian Academy of Sciences (India)
2016-10-24
,. People's Republic of China ... mutations in COL4A3 and COL4A4 genes which encode type IV collagen α3 and α4 chainsrespectively can .... hematuria and evidence for activation of the unfolded protein response. Focal and ...
Missense Mutation in Fam83H Gene in Iranian Patients with Amelogenesis Imperfecta.
Pourhashemi, S Jalal; Ghandehari Motlagh, Mehdi; Meighani, Ghasem; Ebrahimi Takaloo, Azadeh; Mansouri, Mahsa; Mohandes, Fatemeh; Mirzaii, Maryam; Khoshzaban, Ahad; Moshtaghi, Faranak; Abedkhojasteh, Hoda; Heidari, Mansour
2014-12-01
Amelogenesis Imperfecta (AI) is a disorder of tooth development where there is an abnormal formation of enamel or the external layer of teeth. The aim of this study was to screen mutations in the four most important candidate genes, ENAM, KLK4, MMP20 and FAM83H responsible for amelogenesis imperfect. Geneomic DNA was isolated from five Iranian families with 22 members affected with enamel malformations. The PCR amplifications were typically carried out for amplification the coding regions for AI patients and unaffected family members. The PCR products were subjected to direct sequencing. The pedigree analysis was performed using Cyrillic software. One family had four affected members with autosomal dominant hypocalcified amelogenesis imperfecta (ADHPCAI); pedigree analysis revealed four consanguineous families with 18 patients with autosomal recessive hypoplastic amelogenesis imperfecta (ARHPAI). One non-synonymous single-nucleotide substitution, c.1150T>A, p. Ser 342Thr was identified in the FAM83H, which resulted in ADHCAI. Furthermore, different polymorphisms or unclassified variants were detected in MMP20, ENAM and KLK4. Our results are consistent with other studies and provide further evidence for pathogenic mutations of FAM83H gene. These findings suggest different loci and genes could be implicated in the pathogenesis of AI.
Directory of Open Access Journals (Sweden)
Anna Galicka
2012-06-01
Full Text Available Recent investigations revealed that the “brittle bone” phenotype in osteogenesis imperfecta (OI is caused not only by dominant mutations in collagen type I genes, but also by recessively inherited mutations in genes responsible for the post-translational processing of type I procollagen as well as for bone formation. The phenotype of patients with mutations in noncollagen genes overlaps with very severe type III and lethal type II OI caused by mutations in collagen genes. Mutations in genes that encode proteins involved in collagen prolyl 3-hydroxylation (P3H1/CRTAP/CyPB eliminated Pro986 hydroxylation and caused an increase in modification of collagen helix by prolyl 4-hydroxylase and lysyl hydroxylase. However, the importance of these disturbances in the disease pathomechanism is not known. Loss of complex proteins’ function as collagen chaperones may dominate the disease mechanism. The latest findings added to the spectrum of OI-causing and collagen-influencing factors other chaperones (HSP47 and FKBP65 and protein BMP-1, which emphasizes the complexity of collagen folding and secretion as well as their importance in bone formation. Furthermore, mutations in genes encoding transcription factor SP7/Osterix and pigment epithelium-derived factor (PEDF constitute a novel mechanism for OI, which is independent of changes in biosynthesis and processing of collagen.
Autosomal dominant pseudohypoaldosteronism type 1 with a novel splice site mutation in MR gene
Directory of Open Access Journals (Sweden)
Kaito Hiroshi
2009-11-01
Full Text Available Abstract Background Autosomal dominant pseudohypoaldosteronism type 1 (PHA1 is a rare inherited condition that is characterized by renal resistance to aldosterone as well as salt wasting, hyperkalemia, and metabolic acidosis. Renal PHA1 is caused by mutations of the human mineralcorticoid receptor gene (MR, but it is a matter of debate whether MR mutations cause mineralcorticoid resistance via haploinsufficiency or dominant negative mechanism. It was previously reported that in a case with nonsense mutation the mutant mRNA was absent in lymphocytes because of nonsense mediated mRNA decay (NMD and therefore postulated that haploinsufficiency alone can give rise to the PHA1 phenotype in patients with truncated mutations. Methods and Results We conducted genomic DNA analysis and mRNA analysis for familial PHA1 patients extracted from lymphocytes and urinary sediments and could detect one novel splice site mutation which leads to exon skipping and frame shift result in premature termination at the transcript level. The mRNA analysis showed evidence of wild type and exon-skipped RT-PCR products. Conclusion mRNA analysis have been rarely conducted for PHA1 because kidney tissues are unavailable for this disease. However, we conducted RT-PCR analysis using mRNA extracted from urinary sediments. We could demonstrate that NMD does not fully function in kidney cells and that haploinsufficiency due to NMD with premature termination is not sufficient to give rise to the PHA1 phenotype at least in this mutation of our patient. Additional studies including mRNA analysis will be needed to identify the exact mechanism of the phenotype of PHA.
Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang
2017-01-01
Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610
A Classic Case of Maple Syrup Urine Disease and a Novel Mutation in the BCKDHA Gene
Directory of Open Access Journals (Sweden)
Alieh Mirzaee
2017-09-01
Full Text Available Background: Maple syrup urine disease (MSUD is an inherited branched-chain amino acid metabolic disorder caused by the deficiency in the branched-chain alpha-keto acid dehydrogenase (BCKD complex. In MSUD, elevation of the branched-chain amino acids, such as alpha-keto acid and alpha-hydroxy acid, occurs due to the BCKDC gene deficiency, appearing in the blood, urine, and cerebrospinal fluid, which leads to neurological damage and mental retardation. MSUD phenotypically penetrates due to the mutations in the coding genes of four subunits of the BCKD complex, including the BCKDHA, BCKDHB, DBT, and DLD genes.Case report: We aimed to report the cases of three families whose children were affected by MSUD and presented with symptomatic features during the first week of birth, which were identified by mass spectrometry. DNA study was performed as a diagnosis panel containing four encoded BCKDC subunit genes.Conclusion: In the current study, DNA analysis and phenotypic manifestations indicated a novel mutation of c.143delT, p.L48Rfs*15 in the BCKDHA gene in a homozygous state, which is a causative mutation for the classic MSUD phenotype. Early diagnosis and neonatal screening are recommended for the accurate and effective treatment of this disease
Jinjun, Cao; Wenjuan, Qiu; Ruinan, Zhang; Jun, Ye; Lianshu, Han; Huiwen, Zhang; Qigang, Zhang; Xuefan, Gu
2015-04-01
To investigate the clinical and laboratory features of very long chain acyl-CoA dehydrogenase deficiency ( VLCADD ) and the correlations between its genotype and phenotype. Eleven patients diagnosed as VLCADD of Shanghai Jiaotong University School of Medicine seen from September 2006 to May 2014 were included. There were 9 boys and 2 girls, whose age was 2 d-17 years. Analysis was performed on clinical features, routine laboratory examination, and tandem mass spectrometry (MS-MS) , gas chromatography mass spectrometry (GC-MS) and genetic analysis were conducted. All cases had elevated levels of blood tetradecanoylcarnitine (C14:1) recognized as the characteristic biomarker for VLCADD. The eleven patients were classified into three groups: six cases in neonatal onset group, three in infancy onset group form patients and two in late onset group. Neonatal onset patients were characterized by hypoactivity, hypoglycemia shortly after birth. Infancy onset patients presented hepatomegaly and hypoglycemia in infancy. The two adolescent patients showed initial manifestations of exercise intolerance or rhabdomyolysis. Six of the eleven patients died at the age of 2-8 months, including four neonatal onset and two infant onset patients, with one or two null mutations. The other two neonatal onset patients were diagnosed since early birth through neonatal screening and their clinical manifestation are almost normal after treatments. Among 11 patients, seventeen different mutations in the ACADVL gene were identified, with a total mutation detection rate of 95.45% (21/22 alleles), including eleven reported mutations ( p. S22X, p. G43D, p. R511Q, p. W427X, p. A213T, p. C215R, p. G222R, p. R450H, p. R456H, c. 296-297delCA, c. 1605 + 1G > T) and six novel mutations (p. S72F, p. Q100X, p. M437T, p. D466Y, c. 1315delG insAC, IVS7 + 4 A > G). The p. R450H was the most frequent mutation identified in three alleles (13.63%, 3/22 alleles), followed by p. S22X and p. D466Y mutations which
Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.
Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu
2006-01-01
To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.
Razipour, Masoumeh; Alavinejad, Elaheh; Sajedi, Seyede Zahra; Talebi, Saeed; Entezam, Mona; Mohajer, Neda; Kazemi-Sefat, Golnaz-Ensieh; Gharesouran, Jalal; Setoodeh, Aria; Mohaddes Ardebili, Seyyed Mojtaba; Keramatipour, Mohammad
2017-10-01
Phenylketonuria (PKU), one of the most common inborn errors of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene (PAH). PKU has wide allelic heterogeneity, and over 600 different disease-causing mutations in PAH have been detected to date. Up to now, there have been no reports on the minihaplotype (VNTR/STR) analysis of PAH locus in the Iranian population. The aims of the present study were to determine PAH mutations and minihaplotypes in Iranian families with PAH deficiency and to investigate the correlation between them. A total of 81 Iranian families with PAH deficiency were examined using PCR-sequencing of all 13 PAH exons and their flanking intron regions to identify sequence variations. Fragment analysis of the PAH minihaplotypes was performed by capillary electrophoresis for 59 families. In our study, 33 different mutations were found accounting for 95% of the total mutant alleles. The majority of these mutations (72%) were distributed across exons 7, 11, 2 and their flanking intronic regions. Mutation c.1066-11G > A was the most common with a frequency of 20.37%. The less frequent mutations, p.Arg261Gln (8%), p.Arg243Ter (7.4%), p.Leu48Ser (7.4%), p.Lys363Asnfs*37 (6.79%), c.969 + 5G > A (6.17%), p.Pro281Leu (5.56), c.168 + 5G > C (5.56), and p.Arg261Ter (4.94) together comprised about 52% of all mutant alleles. In this study, a total of seventeen PAH gene minihaplotypes were detected, six of which associated exclusively with particular mutations. Our findings indicate a broad PAH mutation spectrum in the Iranian population, which is consistent with previous studies reporting a wide range of PAH mutations, most likely due to ethnic heterogeneity. High prevalence of c.1066-11G > A mutation linked to minihaplotype 7/250 among both Iranian and Mediterranean populations is indicative of historical and geographical links between them. Also, strong association between particular mutations and minihaplotypes
Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair
2015-01-01
Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.
Directory of Open Access Journals (Sweden)
Gianluigi Laccetta
2017-11-01
Full Text Available Sotos syndrome (SoS is characterized by overgrowth of prenatal onset, learning disability, and characteristic facial appearance; it is usually due to haploinsufficiency of NSD1 gene at chromosome 5q35. An Italian child was born at 37 weeks of gestation (weight 2,910 g, 25th–50th centiles; length 50 cm, 75th centile; head circumference 36 cm, 97th centile showing cryptorchidism on the right side, hypertelorism, dolichocephaly, broad and prominent forehead, and narrow jaw; the pregnancy was worsened by maternal preeclampsia and gestational diabetes, and his mother had a previous history of four early miscarriages. The patient showed neonatal jaundice, hypotonia, feeding difficulties, frequent vomiting, and gastroesophageal reflux. After the age of 6 months, his weight, length, and head circumference were above the 97th centile; psychomotor development was delayed. At the age of 9 years, the patient showed also joint laxity and scoliosis. DNA sequence analysis of NSD1 gene detected a novel heterozygous mutation (c.521T>A, p.Val174Asp in exon 2. The same mutant allele was also found in the mother and in the maternal grandfather of the proband; both the mother and the maternal grandfather of the proband showed isolated overgrowth with height above the 97th centile in absence of other features of SoS. At present 23 familial cases of SoS have been described (two cases with mutation in exon 2 of NSD1 gene; no familial cases of SoS with mutation of NSD1 gene and isolated overgrowth have been reported. Probably, point mutations of NSD1 gene, and particularly mutations between exon 20 and exon 23, are not likely to affect reproductive fitness. Epigenetic mechanisms and intrauterine environment may influence phenotypes, therefore genetic tests are not useful to predict the phenotype but they are indispensable for the diagnosis of SoS. This is the first Italian familial case of SoS with genetic confirmation and the third report in which a
Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan
2014-05-15
Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.
Directory of Open Access Journals (Sweden)
Shuyu D. Li
2017-10-01
Full Text Available Abstract Background Next-generation sequencing (NGS of cancer gene panels are widely applied to enable personalized cancer therapy and to identify novel oncogenic mutations. Methods We performed targeted NGS on 932 clinical cases of non-small-cell lung cancers (NSCLCs using the Ion AmpliSeq™ Cancer Hotspot panel v2 assay. Results Actionable mutations were identified in 65% of the cases with available targeted therapeutic options, including 26% of the patients with mutations in National Comprehensive Cancer Network (NCCN guideline genes. Most notably, we discovered JAK2 p.V617F somatic mutation, a hallmark of myeloproliferative neoplasms, in 1% (9/932 of the NSCLCs. Analysis of cancer cell line pharmacogenomic data showed that a high level of JAK2 expression in a panel of NSCLC cell lines is correlated with increased sensitivity to a selective JAK2 inhibitor. Further analysis of TCGA genomic data revealed JAK2 gain or loss due to genetic alterations in NSCLC clinical samples are associated with significantly elevated or reduced PD-L1 expression, suggesting that the activating JAK2 p.V617F mutation could confer sensitivity to both JAK inhibitors and anti-PD1 immunotherapy. We also detected JAK3 germline activating mutations in 6.7% (62/932 of the patients who may benefit from anti-PD1 treatment, in light of recent findings that JAK3 mutations upregulate PD-L1 expression. Conclusion Taken together, this study demonstrated the clinical utility of targeted NGS with a focused hotspot cancer gene panel in NSCLCs and identified activating mutations in JAK2 and JAK3 with clinical implications inferred through integrative analysis of cancer genetic, genomic, and pharmacogenomic data. The potential of JAK2 and JAK3 mutations as response markers for the targeted therapy against JAK kinases or anti-PD1 immunotherapy warrants further investigation.
Brugada syndrome with a novel missense mutation in SCN5A gene: A case report from Bangladesh
Directory of Open Access Journals (Sweden)
Md. Zahidus Sayeed
2014-01-01
Full Text Available Brugada syndrome is an inherited cardiac arrhythmia that follows autosomal dominant transmission and can cause sudden death. We report a case of Brugada syndrome in a 55-year-old male patient presented with recurrent palpitation, atypical chest pain and presyncope. ECG changes were consistent with type 1 Brugada. Gene analysis revealed a novel missense mutation in SCN5A gene with a genetic variation of D785N and a nucleotide change at 2353G-A. One of his children also had the same mutation. To our knowledge this is the first genetically proved case of Brugada syndrome in Bangladesh.
In silico analysis of a novel MKRN3 missense mutation in familial central precocious puberty.
Neocleous, Vassos; Shammas, Christos; Phelan, Marie M; Nicolaou, Stella; Phylactou, Leonidas A; Skordis, Nicos
2016-01-01
The onset of puberty is influenced by the interplay of stimulating and restraining factors, many of which have a genetic origin. Premature activation of the GnRH secretion in central precocious puberty (CPP) may arise either from gain-of-function mutations of the KISS1 and KISS1R genes or from loss-of-function manner mutations of the MKRN3 gene leading to MKRN3 deficiency. To explore the genetic causes responsible for CPP and the potential role of the RING finger protein 3 (MKRN3) gene. We investigated potential sequence variations in the intronless MKRN3 gene by Sanger sequencing of the entire 507 amino acid coding region of exon 1 in a family with two affected girls presented with CPP at the age of 6 and 5·7 years, respectively. A novel heterozygous g.Gly312Asp missense mutation in the MKRN3 gene was identified in these siblings. The imprinted MKRN3 missense mutation was also identified as expected in the unaffected father and followed as expected an imprinted mode of inheritance. In silico analysis of the altered missense variant using the computational algorithms Polyphen2, SIFT and Mutation Taster predicted a damage and pathogenic alteration causing CPP. The pathogenicity of the alteration at the protein level via an in silico structural model is also explored. A novel mutation in the MKRN3 gene in two sisters with CPP was identified, supporting the fundamental role of this gene in the suppression of the hypothalamic GnRH neurons. © 2015 John Wiley & Sons Ltd.
Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.
Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri
2012-01-01
The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.
Directory of Open Access Journals (Sweden)
Yasuko eKikuchi
2013-12-01
Full Text Available Cancer arises through accumulation of epigenetic and genetic alteration. Aberrant promoter methylation is a common epigenetic mechanism of gene silencing in cancer cells. We here performed genome-wide analysis of DNA methylation of promoter regions by Infinium HumanMethylation27 BeadChip, using 14 clinical papillary thyroid cancer samples and 10 normal thyroid samples. Among the 14 papillary cancer cases, 11 showed frequent aberrant methylation, but the other three cases showed no aberrant methylation at all. Distribution of the hypermethylation among cancer samples was non-random, which implied existence of a subset of preferentially methylated papillary thyroid cancer. Among 25 frequently methylated genes, methylation status of six genes (HIST1H3J, POU4F2, SHOX2, PHKG2, TLX3, HOXA7 was validated quantitatively by pyrosequencing. Epigenetic silencing of these genes in methylated papillary thyroid cancer cell lines was confirmed by gene re-expression following treatment with 5-aza-2'-deoxycytidine and trichostatin A, and detected by real-time RT-PCR. Methylation of these six genes was validated by analysis of additional 20 papillary thyroid cancer and 10 normal samples. Among the 34 cancer samples in total, 26 cancer samples with preferential methylation were significantly associated with mutation of BRAF/RAS oncogene (P=0.04, Fisher’s exact test. Thus we identified new genes with frequent epigenetic hypermethylation in papillary thyroid cancer, two subsets of either preferentially methylated or hardly methylated papillary thyroid cancer, with a concomitant occurrence of oncogene mutation and gene methylation. These hypermethylated genes may constitute potential biomarkers for papillary thyroid cancer.
Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.
Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim
2016-03-01
Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.
Directory of Open Access Journals (Sweden)
Garuti Rita
2010-10-01
Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.
Energy Technology Data Exchange (ETDEWEB)
Magovcevic, I.; Weremowicz, S.; Morton, C.C. [Harvard Medical School, Boston, MA (United States)] [and others
1994-09-01
Transducin {alpha} subunits are members of a large family of G-proteins and play an important role in phototransduction in rod and cone photoreceptors. We report the localization of the human cone {alpha} transducin (GNAT2) gene using fluorescence in situ hybridization (FISH) on chromosome 1 in band p13. The recent assignment of a gene for Stargardt`s disease to the same chromosomal region by linkage analysis prompted us to investigate the possible role of GNAT2 in the pathogenesis of this disease. Stargardt`s disease is characterized by degeneration in late childhood or early adulthood of the macula of the retina, a region rich in cones. We screened patients with Stargardt`s disease, with or without peripheral cone involvement as monitored by the full-field ERG, for mutations in this gene. We investigated 66 unrelated patients including 22 with peripheral cone dysfunction for mutations in the coding region of the GNAT2 gene using polymerase chain reaction-single strand conformation polymorphism analysis (SSCP) and direct sequencing. One patient (034-16) was heterozygous for a silent change in exon VI, Asp238Asp (GAT to GAC). Two patients, one (035-005) with peripheral cone involvement and one (071-001) without peripheral cone involvement, were heterozygous for the missense change Val124Met (GTG to ATG) in exon IV. A subsequent screen of 96 unrelated, unaffected controls revealed one individual (N10) who was also heterozygous for the Val124Met alteration. We concluded that Asp238Asp and Val124Met are rare variants not causing Stargardt`s disease. Hence, no disease-specific mutations were found indicating that GNAT2 is probably not involved in the pathogenesis of most cases of Stargardt`s disease.
Li, Huafeng; Li, Yongli; Zhang, Li
2017-06-10
To explore the characteristics of (PAH) gene mutations among patients with phenylketonuria (PKU) from Linyi area of Shandong Province. For 51 children affected with PKU and their parents, the 13 exons and their flanking intronic sequences of the PAH gene were directly sequenced with Sanger method. PAH gene mutations were detected in all of the 102 alleles of the patients, which included 31 types of mutations. Common mutations included R243Q (17/102, 16.67%), IVS4-1G to A (9/102, 8.82%), R241C (8/102, 7.84%), R111X (8/102, 7.84%), and V399V (8/102, 7.84%). In addition, two novel mutations, D101N, 345-347del, have been detected. The 31 types of mutations included missense, nonsense, deletion, and splicing mutations, which were mainly located in exons 7 (29, 28.43%), 11 (18, 17.65%), 3 (16, 15.69%) and 12 (13, 12.75%). Mutations of the PAH gene in Linyi region mainly distributed in exons 7, 11, and 3, and the most common mutation were R243Q. Two novel mutations, D101N and 345-347del, have been detected.
Directory of Open Access Journals (Sweden)
Matei Irina
2001-08-01
Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.
Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo
2001-01-01
Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193
Identification of Constrained Cancer Driver Genes Based on Mutation Timing
Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko
2015-01-01
Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148
Directory of Open Access Journals (Sweden)
Farhoodi A
2007-09-01
Full Text Available Background: Mutations of ELA2, the gene encoding neutrophil elastase (NE are known to be associated with cyclic neutropenia (CN and severe congenital neutropenia (SCN. However, high variability of these mutations has been reported. This study was designed to describe the analysis of the ELA2 gene, clinical manifestations and demographic characteristics in patients with CN and SCN.Methods: A series of 21 patients with CN or SCN were selected, based on SCINR criteria, from the immunology ward of the Pediatric Medicine Center, Tehran, Iran, from March 2004 to August 2005. The ELA2 gene, isolated from blood samples, was analyzed using RT-PCR and automated capillary sequencing. Informed consent was obtained under the tenets of the Helsinki Declaration and the Ethical Committee of the Tehran University of Medical Sciences.Results: Kostmann's syndrome and CN was diagnosed in three and 18 patients respectively. Of all the patients, one or two mutations were found in 18 cases (85.7%, including all three patients with SCN and 15 of the patients with CN. Exons two and four had the most mutations (eight and seven cases, respectively. Seven patients had double mutations in two distinct exons. Overall, 16 different mutations were found. At the time of presentation, the mean age of patients was 13.4 ±17.6 months, ranging from one month to seven years. Overall, 61.9% of patients had consanguineous parents. The mean absolute neutrophil count was 830.5 ±419.4 (150-2000/mm3. On average, each patient had been admitted to the hospital 2.2 ±1.6 times. The neutrophil counts of the SCN patients were significantly higher than those of the CN patients. However, there was no significant difference in the neutrophil counts between patients with mutations and those without mutations. All patients with SCN had two or more infectious complications, although the prevalence of infectious or non-infectious complications did not correlate with ELA2 mutations or the
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.
Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B
2006-09-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.
Phenotypic Involvement in Females with the FMR1 Gene Mutation.
Riddle, J. E.; Cheema, A.; Sobesky, W. E.; Gardner, S. C.; Taylor, A. K.; Pennington, B. F.; Hagerman, R. J.
1998-01-01
A study investigated phenotypic effects seen in 114 females with premutation and 41 females (ages 18-58) with full Fragile X mental retardation gene mutation. Those with the full mutation had a greater incidence of hand-flapping, eye contact problems, special education help for reading and math, and grade retention. (Author/CR)
Energy Technology Data Exchange (ETDEWEB)
Mahadtanapuk, S. [Faculty of Agriculture and Natural Resources, University of Phayao, Maeka, Muang, Phayao 56000 (Thailand); Teraarusiri, W. [Central Laboratory, University of Phayao, Maeka, Muang, Phayao 56000 (Thailand); Nanakorn, W. [The Crown Property Bureau, 173 Nakhonratchasrima Road, Dusit, Bangkok 10300 (Thailand); Yu, L.D., E-mail: yuld@thep-center.org [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Thongkumkoon, P. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Anuntalabhochai, S., E-mail: soanu.1@gmail.com [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2014-05-01
Highlights: • Ion beam bombardment induced mutation in bacterial B. licheniformis. • A mutant lost antifungal activity. • DNA fingerprint of the mutant was analyzed. • The lost gene was indentified to code for TrxR gene. • TrxR gene from B. licheniformis expressed the flower antagonism to fungi. - Abstract: This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection.
International Nuclear Information System (INIS)
Mahadtanapuk, S.; Teraarusiri, W.; Nanakorn, W.; Yu, L.D.; Thongkumkoon, P.; Anuntalabhochai, S.
2014-01-01
Highlights: • Ion beam bombardment induced mutation in bacterial B. licheniformis. • A mutant lost antifungal activity. • DNA fingerprint of the mutant was analyzed. • The lost gene was indentified to code for TrxR gene. • TrxR gene from B. licheniformis expressed the flower antagonism to fungi. - Abstract: This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection
Mutations in rpoB and katG genes of multidrug resistant ...
African Journals Online (AJOL)
Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...
Leblond, Claire S; Nava, Caroline; Polge, Anne; Gauthier, Julie; Huguet, Guillaume; Lumbroso, Serge; Giuliano, Fabienne; Stordeur, Coline; Depienne, Christel; Mouzat, Kevin; Pinto, Dalila; Howe, Jennifer; Lemière, Nathalie; Durand, Christelle M; Guibert, Jessica; Ey, Elodie; Toro, Roberto; Peyre, Hugo; Mathieu, Alexandre; Amsellem, Frédérique; Rastam, Maria; Gillberg, I Carina; Rappold, Gudrun A; Holt, Richard; Monaco, Anthony P; Maestrini, Elena; Galan, Pilar; Heron, Delphine; Jacquette, Aurélia; Afenjar, Alexandra; Rastetter, Agnès; Brice, Alexis; Devillard, Françoise; Assouline, Brigitte; Laffargue, Fanny; Lespinasse, James; Chiesa, Jean; Rivier, François; Bonneau, Dominique; Regnault, Beatrice; Zelenika, Diana; Delepine, Marc; Lathrop, Mark; Sanlaville, Damien; Schluth-Bolard, Caroline; Edery, Patrick; Perrin, Laurence; Tabet, Anne Claude; Schmeisser, Michael J; Boeckers, Tobias M; Coleman, Mary; Sato, Daisuke; Szatmari, Peter; Scherer, Stephen W; Rouleau, Guy A; Betancur, Catalina; Leboyer, Marion; Gillberg, Christopher; Delorme, Richard; Bourgeron, Thomas
2014-09-01
SHANK genes code for scaffold proteins located at the post-synaptic density of glutamatergic synapses. In neurons, SHANK2 and SHANK3 have a positive effect on the induction and maturation of dendritic spines, whereas SHANK1 induces the enlargement of spine heads. Mutations in SHANK genes have been associated with autism spectrum disorders (ASD), but their prevalence and clinical relevance remain to be determined. Here, we performed a new screen and a meta-analysis of SHANK copy-number and coding-sequence variants in ASD. Copy-number variants were analyzed in 5,657 patients and 19,163 controls, coding-sequence variants were ascertained in 760 to 2,147 patients and 492 to 1,090 controls (depending on the gene), and, individuals carrying de novo or truncating SHANK mutations underwent an extensive clinical investigation. Copy-number variants and truncating mutations in SHANK genes were present in ∼1% of patients with ASD: mutations in SHANK1 were rare (0.04%) and present in males with normal IQ and autism; mutations in SHANK2 were present in 0.17% of patients with ASD and mild intellectual disability; mutations in SHANK3 were present in 0.69% of patients with ASD and up to 2.12% of the cases with moderate to profound intellectual disability. In summary, mutations of the SHANK genes were detected in the whole spectrum of autism with a gradient of severity in cognitive impairment. Given the rare frequency of SHANK1 and SHANK2 deleterious mutations, the clinical relevance of these genes remains to be ascertained. In contrast, the frequency and the penetrance of SHANK3 mutations in individuals with ASD and intellectual disability-more than 1 in 50-warrant its consideration for mutation screening in clinical practice.
Directory of Open Access Journals (Sweden)
Claire S Leblond
2014-09-01
Full Text Available SHANK genes code for scaffold proteins located at the post-synaptic density of glutamatergic synapses. In neurons, SHANK2 and SHANK3 have a positive effect on the induction and maturation of dendritic spines, whereas SHANK1 induces the enlargement of spine heads. Mutations in SHANK genes have been associated with autism spectrum disorders (ASD, but their prevalence and clinical relevance remain to be determined. Here, we performed a new screen and a meta-analysis of SHANK copy-number and coding-sequence variants in ASD. Copy-number variants were analyzed in 5,657 patients and 19,163 controls, coding-sequence variants were ascertained in 760 to 2,147 patients and 492 to 1,090 controls (depending on the gene, and, individuals carrying de novo or truncating SHANK mutations underwent an extensive clinical investigation. Copy-number variants and truncating mutations in SHANK genes were present in ∼1% of patients with ASD: mutations in SHANK1 were rare (0.04% and present in males with normal IQ and autism; mutations in SHANK2 were present in 0.17% of patients with ASD and mild intellectual disability; mutations in SHANK3 were present in 0.69% of patients with ASD and up to 2.12% of the cases with moderate to profound intellectual disability. In summary, mutations of the SHANK genes were detected in the whole spectrum of autism with a gradient of severity in cognitive impairment. Given the rare frequency of SHANK1 and SHANK2 deleterious mutations, the clinical relevance of these genes remains to be ascertained. In contrast, the frequency and the penetrance of SHANK3 mutations in individuals with ASD and intellectual disability-more than 1 in 50-warrant its consideration for mutation screening in clinical practice.
Pachyonychia congenita: Report of two cases and mutation analysis
Directory of Open Access Journals (Sweden)
Jia-Ming Yeh
2012-09-01
Full Text Available Pachyonychia congenita (PC comprises a group of rare autosomal dominant genetic disorders that involve ectodermal dysplasia. It is characterized by hypertrophic nail dystrophy, focal palmoplantar keratoderma, follicular keratoses, and oral leukokeratosis. Historically, PC has been subdivided into two subtypes, PC-1 or PC-2, on the basis of clinical presentation. However, differential diagnosis based on clinical grounds, especially in young and/or not fully penetrant patients, can be difficult. In addition, clinical analysis of the large case series has shown that there is considerable phenotypic overlap between these two subtypes recently. Based on the advent of molecular genetics and the identification of the genes causing PC, more specific nomenclature has been adopted. Therefore, diagnosis at the molecular level is useful and important to confirm the clinical impression. In this report, we describe two typical cases of PC with mutation analysis revealed a small deletion (514_516delACC, Asn172del and a point mutation (487 G > A, GAG → AAG, Glu163Lys in the KRT6A gene.
Gunduz, Mehmet
2016-01-01
Peroxisomal disorders are a group of genetically heterogeneous metabolic diseases related to dysfunction of peroxisomes. Dysmorphic features, neurological abnormalities, and hepatic dysfunction can be presenting signs of peroxisomal disorders. Here we presented dysmorphic facial features and other clinical characteristics in two patients with PEX1 gene mutation. Follow-up periods were 3.5 years and 1 year in the patients. Case I was one-year-old girl that presented with neurodevelopmental delay, hepatomegaly, bilateral hearing loss, and visual problems. Ophthalmologic examination suggested septooptic dysplasia. Cranial magnetic resonance imaging (MRI) showed nonspecific gliosis at subcortical and periventricular deep white matter. Case II was 2.5-year-old girl referred for investigation of global developmental delay and elevated liver enzymes. Ophthalmologic examination findings were consistent with bilateral nystagmus and retinitis pigmentosa. Cranial MRI was normal. Dysmorphic facial features including broad nasal root, low set ears, downward slanting eyes, downward slanting eyebrows, and epichantal folds were common findings in two patients. Molecular genetic analysis indicated homozygous novel IVS1-2A>G mutation in Case I and homozygous p.G843D (c.2528G>A) mutation in Case II in the PEX1 gene. Clinical findings and developmental prognosis vary in PEX1 gene mutation. Kabuki-like phenotype associated with liver pathology may indicate Zellweger spectrum disorders (ZSD). PMID:27882258
HFE gene mutations in coronary atherothrombotic disease
Directory of Open Access Journals (Sweden)
Calado R.T.
2000-01-01
Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.
Klevering, B Jeroen; Blankenagel, Anita; Maugeri, Alessandra; Cremers, Frans P M; Hoyng, Carel B; Rohrschneider, Klaus
2002-06-01
To describe the phenotype of 12 patients with autosomal recessive or isolated cone-rod types of progressive retinal degeneration (CRD) caused by mutations in the ABCA4 gene. The charts of patients who had originally received a diagnosis of isolated or autosomal recessive CRD were reviewed after molecular analysis revealed mutations in the ABCA4 gene. In two of the patients both the photopic and scotopic electroretinogram were nonrecordable. In the remainder, the photopic cone b-wave amplitudes appeared to be more seriously affected than the scotopic rod b-wave amplitudes. Although the clinical presentation was heterogeneous, all patients experienced visual loss early in life, impaired color vision, and a central scotoma. Fundoscopy revealed evidence of early-onset maculopathy, sometimes accompanied by involvement of the retinal periphery in the later stages of the disease. Mutations in the ABCA4 gene are the pathologic cause of the CRD-like dystrophy in these patients, and the resultant clinical pictures are complex and heterogeneous. Given this wide clinical spectrum of CRD-like phenotypes associated with ABCA4 mutations, detailed clinical subclassifications are difficult and may not be very useful.
Doubaj, Yassamine; Pingault, Véronique; Elalaoui, Siham C; Ratbi, Ilham; Azouz, Mohamed; Zerhouni, Hicham; Ettayebi, Fouad; Sefiani, Abdelaziz
2015-02-01
Waardenburg syndrome (WS) is a neurocristopathy disorder combining sensorineural deafness and pigmentary abnormalities. The presence of additional signs defines the 4 subtypes. WS type IV, also called Shah-Waardenburg syndrome (SWS), is characterized by the association with congenital aganglionic megacolon (Hirschsprung disease). To date, 3 causative genes have been related to this congenital disorder. Mutations in the EDNRB and EDN3 genes are responsible for the autosomal recessive form of SWS, whereas SOX10 mutations are inherited in an autosomal dominant manner. We report here the case of a 3-month-old Morrocan girl with WS type IV, born to consanguineous parents. The patient had 3 cousins who died in infancy with the same symptoms. Molecular analysis by Sanger sequencing revealed the presence of a novel homozygous missense mutation c.1133A>G (p.Asn378Ser) in the EDNRB gene. The proband's parents as well as the parents of the deceased cousins are heterozygous carriers of this likely pathogenic mutation. This molecular diagnosis allows us to provide genetic counseling to the family and eventually propose prenatal diagnosis to prevent recurrence of the disease in subsequent pregnancies.
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
Mu Opioid Receptor Gene: New Point Mutations in Opioid Addicts
Directory of Open Access Journals (Sweden)
Amin Dinarvand
2014-02-01
Full Text Available Introduction: Association between single-nucleotide polymorphisms (SNPs in mu opioid receptor gene and drug addiction has been shown in various studies. Here, we have evaluated the existence of polymorphisms in exon 3 of this gene in Iranian population and investigated the possible association between these mutations and opioid addiction. Methods: 79 opioid-dependent subjects (55 males, 24 females and 134 non-addict or control individuals (74 males, 60 females participated in the study. Genomic DNA was extracted from volunteers’ peripheral blood and exon 3 of the mu opioid receptor gene was amplified by polymerase chain reaction (PCR whose products were then sequenced. Results: Three different heterozygote polymorphisms were observed in 3 male individuals: 759T>C and 877G>A mutations were found in 2 control volunteers and 1043G>C substitution was observed in an opioid-addicted subject. Association between genotype and opioid addiction for each mutation was not statistically significant. Discussion: It seems that the sample size used in our study is not enough to confirm or reject any association between 759T>C, 877G>A and 1043G>C substitutions in exon 3 of the mu opioid receptor gene and opioid addiction susceptibility in Iranian population.
HPRT gene mutation frequency and the factor of influence in adult peripheral blood lymphocytes
International Nuclear Information System (INIS)
Zhao Jingyong; Zheng Siying; Cui Fengmei; Wang Liuyi; Lao Qinhua; Wu Hongliang
2002-01-01
Objective: To study the HPRT gene loci mutation frequencies and the factor of influence in peripheral blood lymphocytes of adult with ages ranging from 21-50. Methods: HPRT gene mutation frequency (GMf) were examined by the technique of multinuclear cell assay. Relation between GMf and years were fitted with a computer. Results: Relation could be described by the following equation: y = 0.7555 + 0.0440x, r = 0.9829. Smoking has influence on GMf and sex hasn't. Conclusion: HPRT gene mutation frequency increases with increasing of age. Increasing rate is 0.00440% per year
DEFF Research Database (Denmark)
Milman, N; Ursin, K; Rødevand, E
2009-01-01
BACKGROUND: Blau syndrome is a chronic granulomatous disease with an autosomal dominant trait characterized by the triad granulomatous dermatitis, arthritis, and uveitis. It is caused by mutations in the NOD2 gene, also termed the CARD15 gene. OBJECTIVE: To report a novel mutation in the NOD2 gen...... with an autosomal dominant heritage. Most likely the mutation has arisen de novo in the proband. Genetic counselling and antenatal diagnostics should be available to the involved families....... associated with Blau syndrome. METHODS AND RESULTS: The proband was a 68-year-old ethnic Norwegian male who had uveitis and arthritis since 10 years of age followed by lifelong recurrent arthritis and chronic eye involvement. Genetic analysis showed a heterozygous c.1814 C>A, T605N mutation in NOD2 that has...
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
Novel Missense Mitochondrial ND4L Gene Mutations in Friedreich's Ataxia
Directory of Open Access Journals (Sweden)
Mohammad Mehdi Heidari
2011-05-01
Full Text Available AbstractObjective(sThe mitochondrial defects in Friedreich's ataxia have been reported in many researches. Mitochondrial DNA is one of the candidates for defects in mitochondrion, and complex I is the first and one of the largest catalytic complexes of oxidative phosphorylation (OXPHOS system. Materials and MethodsWe searched the mitochondrial ND4L gene for mutations by TTGE and sequencing on 30 FRDA patients and 35 healthy controls.ResultsWe found 3 missense mutations [m.10506A>G (T13A, m.10530G>A (V21M, and m.10653G>A (A62T] in four patients whose m.10530G>A and m.10653G>A were not reported previously. In two patients, heteroplasmic m.10530G>A mutation was detected. They showed a very early ataxia syndrome. Our results showed that the number of mutations in FRDA patients was higher than that in the control cases (P= 0.0287.ConclusionAlthough this disease is due to nuclear gene mutation, the presence of these mutations might be responsible for further mitochondrial defects and the increase of the gravity of the disease. Thus, it should be considered in patients with this disorder.
Directory of Open Access Journals (Sweden)
Serbulent Yigit
2012-01-01
Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.
Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E
2016-01-01
Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.
International Nuclear Information System (INIS)
Matar, S.N.A.
2011-01-01
Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD
Araki, Yuya; Rai, Tatemitsu; Sohara, Eisei; Mori, Takayasu; Inoue, Yuichi; Isobe, Kiyoshi; Kikuchi, Eriko; Ohta, Akihito; Sasaki, Sei; Uchida, Shinichi
2015-10-21
Pseudohypoaldosteronism type II (PHAII) is a hereditary hypertensive disease caused by mutations in four different genes: with-no-lysine kinases (WNK) 1 and 4, Kelch-like family member 3 (KLHL3), and cullin 3 (Cul3). Cul3 and KLHL3 form an E3 ligase complex that ubiquitinates and reduces the expression level of WNK4. PHAII-causing mutations in WNK4 and KLHL3 impair WNK4 ubiquitination. However, the molecular pathogenesis of PHAII caused by Cul3 mutations is unclear. In cultured cells and human leukocytes, PHAII-causing Cul3 mutations result in the skipping of exon 9, producing mutant Cul3 protein lacking 57 amino acids. However, whether this phenomenon occurs in the kidneys and is responsible for the pathogenesis of PHAII in vivo is unknown. We generated knock-in mice carrying a mutation in the C-terminus of intron 8 of Cul3, c.1207-1G>A, which corresponds to a PHAII-causing mutation in the human Cul3 gene. Heterozygous Cul3(G(-1)A/+) knock-in mice did not exhibit PHAII phenotypes, and the skipping of exon 9 was not evident in their kidneys. However, the level of Cul3 mRNA expression in the kidneys of heterozygous knock-in mice was approximately half that of wild-type mice. Furthermore, homozygous knock-in mice were nonviable. It suggested that the mutant allele behaved like a knockout allele and did not produce Cul3 mRNA lacking exon 9. A reduction in Cul3 expression alone was not sufficient to develop PHAII in the knock-in mice. Our findings highlighted the pathogenic role of mutant Cul3 protein and provided insight to explain why PHAII-causing mutations in Cul3 cause kidney-predominant PHAII phenotypes. © 2015. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Lamia Elfandi
2016-03-01
Full Text Available Background: Breast cancer is the most common malignancy among women. It is estimated that 1 in 10 women worldwide is affected by breast cancer during their lifetime. In 5 to 10% of breast cancer patients, the disease results from a hereditary predisposition, which can be attributable to mutations in either of two tumor suppressor genes, BRCA1 and BRCA2 to a large extent. BRCA2 6174delT mutation constitutes the common mutant alleles which predispose to hereditary breast cancer in the Ashkenazi population with a reported carrier frequency of 1.52%. In this study, we investigated the presence of the 6174delT mutation of the BRCA2 gene in Libyan woman affected with breast cancer and compared the results with those of other population groups.Methods: Eighty- five Libyan women with breast cancer in additions to 5 relatives of the patients (healthy individuals were recruited to this study. We obtained clinical information, family history, and peripheral blood for DNA extraction and analyzed the data using multiplex mutagenic polymerase chain reaction (MS-PCR for detection of 6174delT mutation in the BRCA2 gene. Results: The 6174delT of the BRCA2 gene was not detected either in the 85 patients with breast cancer (18 with familial breast cancer and 67 with sporadic breast cancer nor in the 5 healthy individuals. Conclusions: The present study showed that the 6174delT of the BRCA2 gene was not detectable using mutagenic PCR in the Libyan patients with breast cancer and can be considered to be exceedingly rare
Directory of Open Access Journals (Sweden)
Wong Nora
2006-01-01
Full Text Available Abstract Background Germline mutations of the SDHD, SDHB and SDHC genes, encoding three of the four subunits of succinate dehydrogenase, are a major cause of hereditary paraganglioma and pheochromocytoma, and demonstrate that these genes are classic tumor suppressors. Succinate dehydrogenase is a heterotetrameric protein complex and a component of both the Krebs cycle and the mitochondrial respiratory chain (succinate:ubiquinone oxidoreductase or complex II. Methods Using conformation sensitive gel electrophoresis (CSGE and direct DNA sequencing to analyse genomic DNA from peripheral blood lymphocytes, here we describe the mutation analysis of the SDHB and SDHC genes in 37 patients with sporadic (i.e. no known family history head and neck paraganglioma and five pheochromocytoma and/or paraganglioma families. Results Two sporadic patients were found to have a SDHB splice site mutation in intron 4, c.423+1G>A, which produces a mis-spliced transcript with a 54 nucleotide deletion, resulting in an 18 amino acid in-frame deletion. A third patient was found to carry the c.214C>T (p.Arg72Cys missense mutation in exon 4 of SDHC, which is situated in a highly conserved protein motif that constitutes the quinone-binding site of the succinate: ubiquinone oxidoreductase (SQR complex in E. coli. Together with our previous results, we found 27 germline mutations of SDH genes in 95 cases (28% of sporadic head and neck paraganglioma. In addition all index patients of five families showing hereditary pheochromocytoma-paraganglioma were found to carry germline mutations of SDHB: four of which were novel, c.343C>T (p.Arg115X, c.141G>A (p.Trp47X, c.281G>A (p.Arg94Lys, and c.653G>C (p.Trp218Ser, and one reported previously, c.136C>T, p.Arg46X. Conclusion In conclusion, these data indicate that germline mutations of SDHB and SDHC play a minor role in sporadic head and neck paraganglioma and further underline the importance of germline SDHB mutations in cases of
Association between nucleotide mutation of eNOS gene and serum ...
African Journals Online (AJOL)
Galaxy
2013-05-15
May 15, 2013 ... spasm among Japanese (Nakayama et al., 1999; Casas et al., 2006). It is believed that these mutations might result in altered NO metabolism and impaired .... ship between T-786C mutation of eNOS gene and CAD specifically in the Iranian population. To our knowledge, this polymorphism has never been ...
Zaw, Myo T; Emran, Nor A; Lin, Zaw
2018-04-26
Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation
International Nuclear Information System (INIS)
Ikehata, Hironobu
1998-01-01
Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)
Mutation of the PAX6 gene in a sporadic patient with atypical aniridia
Energy Technology Data Exchange (ETDEWEB)
Zhu, D.; Li, Y.; Traboulsi, E.I. [Wilmer Eye Institute, Baltimore, MD (United States)] [and others
1994-09-01
A 28 year-old man presented with poor vision since childhood and gradual further decline of several years duration. His visual acuity measures 20/200 OD with -11.50 + 0.50 x 150 and 20/100 OS with -12.25 + 0.25 x 35. He had a fine nystagmus. His visual fields were full. There was a circumferential pannus with areas of corneal stromal opacification. The iris was hypoplastic with atypical colobomatous defects. The lenses had scattered cortical opacities. The intraocular pressures were normal. The optic nerves had cup disk ratios of 0.6 OU. The family history was negative for similar defects. A diagnosis of aniridia was made and blood was drawn for analysis of the PAX6 gene. PCR amplification of exon 5 showed heterozygous fragments with one allele being larger than normal. Direct DNA sequencing of the individual heterozygous allele showed a 41 base pair insertion at nucleotide 483 in exon 5 of the paired domain. This frameshift mutation changed codon 71 to a stop codon. The diagnosis of aniridia was confirmed in this atypical patient, who will need to be monitored for his high risk of glaucoma. The risk of developing Wilms` tumor in patients with mutations within the aniridia gene is presumably negligible since the neighboring Wilms` tumor gene is unaffected. The identification of intragenic mutations of the PAX6 gene in patients with sporadic aniridia modifies the management of such patients because of recognition of the increased risk of glaucoma and by reducing the necessity for frequent monitoring for the presence of Wilms` tumor.
Directory of Open Access Journals (Sweden)
Parmigiani Giovanni
2009-08-01
Full Text Available Abstract Background A major challenge in computational biology is to extract knowledge about the genetic nature of disease from high-throughput data. However, an important obstacle to both biological understanding and clinical applications is the "black box" nature of the decision rules provided by most machine learning approaches, which usually involve many genes combined in a highly complex fashion. Achieving biologically relevant results argues for a different strategy. A promising alternative is to base prediction entirely upon the relative expression ordering of a small number of genes. Results We present a three-gene version of "relative expression analysis" (RXA, a rigorous and systematic comparison with earlier approaches in a variety of cancer studies, a clinically relevant application to predicting germline BRCA1 mutations in breast cancer and a cross-study validation for predicting ER status. In the BRCA1 study, RXA yields high accuracy with a simple decision rule: in tumors carrying mutations, the expression of a "reference gene" falls between the expression of two differentially expressed genes, PPP1CB and RNF14. An analysis of the protein-protein interactions among the triplet of genes and BRCA1 suggests that the classifier has a biological foundation. Conclusion RXA has the potential to identify genomic "marker interactions" with plausible biological interpretation and direct clinical applicability. It provides a general framework for understanding the roles of the genes involved in decision rules, as illustrated for the difficult and clinically relevant problem of identifying BRCA1 mutation carriers.
Molecular analysis on germline mutation caused by low-dose irradiation
International Nuclear Information System (INIS)
Uchiyama, R.; Fujikawa, K.; Nishimura, M.; Adzuma, H.; Shimada, Y.; Yamauchi, M.
2003-01-01
Full text: Genetic heterogeneity and a low frequency of germline mutation at single-copy gene loci have limited the direct measurement of germline mutation in human populations. Two conflicting results have been reported for the effect of ionizing radiation on germline mutation in human populations. A study conducted on the first-generation progeny of the survivors of the atomic bombs at Hiroshima and Nagasaki found no significant increase in germline mutations. On the other hand, a significant increase in germline mutation was reported among the human population in the Belarus area after the Chernobyl accident in 1986. We investigated the germline mutation at the molecular level using experimental mouse strains with different genetic backgrounds to assess the risk of ionizing radiation on human populations. The C3H male parents were exposed to X ray (0, 0.3, 1, and 3Gy) and mated with unexposed C57BL females after two weeks interval, so as to detect the germline mutation occurred at the spermatid stage. Genomic DNA samples were prepared from the both parents and F1s, and the genomic DNA sequences were compared between parents and offspring at the specific genomic gene loci, such as adenine phosphoribosyl transferase (aprt) gene and cytidine triphosphate synthetase (ctps) gene, using the automated DNA sequencer. Also hypervariable Pc-1 (Ms6-hm) minisatellite repeat locus was analyzed by using Southern blot hybridization technique. Our preliminary results indicated that the changes of the restriction DNA fragment length in offspring did not reflect the occurrence of the mutation, such as point mutation, insertion, and deletion, in the genomic gene loci including the intervening sequence (intron)
Biochemical Diagnosis of Common Gene Mutations in Galactosemia
Directory of Open Access Journals (Sweden)
Farzaneh Mirzajani
2005-04-01
Full Text Available Objective: Galactosemia is an inborn error of galactose metabolism that is inherited in an autosomal recessive trait. Classical galactosemia is caused by deficient activity of the galactose-1-phosphate uridyltransferase (GALT enzyme that can result in galactosemia complications. Materials & Methods: 135 unrelated families, clinically suspected to galactosemia, were screened by qualitative measurement of galactose-1-phosphate uridyl transferase (GALT activity in blood RBCs by using Beutler method. Results: Deficient enzyme activity (classical galactosemia were confirmed in 16 families. All of these 16 families were submitted to the diagnosis of six common mutations in GALT gene including Q188R, K285N, S135L, L195P, X380R and Q169K by using PCR-RFLP method which resulted in detection of 68% of the mutated alleles. Eight patients were homozygote for Q188R mutation, while one patient homozygote for S135L mutation and one heterozygote for K285N mutation. Conclusion: Biochemnical diagnosis of Galactosemia in Grand infant hospital is very important and necessary.
Directory of Open Access Journals (Sweden)
Melissa K Boles
2009-12-01
Full Text Available An accurate and precisely annotated genome assembly is a fundamental requirement for functional genomic analysis. Here, the complete DNA sequence and gene annotation of mouse Chromosome 11 was used to test the efficacy of large-scale sequencing for mutation identification. We re-sequenced the 14,000 annotated exons and boundaries from over 900 genes in 41 recessive mutant mouse lines that were isolated in an N-ethyl-N-nitrosourea (ENU mutation screen targeted to mouse Chromosome 11. Fifty-nine sequence variants were identified in 55 genes from 31 mutant lines. 39% of the lesions lie in coding sequences and create primarily missense mutations. The other 61% lie in noncoding regions, many of them in highly conserved sequences. A lesion in the perinatal lethal line l11Jus13 alters a consensus splice site of nucleoredoxin (Nxn, inserting 10 amino acids into the resulting protein. We conclude that point mutations can be accurately and sensitively recovered by large-scale sequencing, and that conserved noncoding regions should be included for disease mutation identification. Only seven of the candidate genes we report have been previously targeted by mutation in mice or rats, showing that despite ongoing efforts to functionally annotate genes in the mammalian genome, an enormous gap remains between phenotype and function. Our data show that the classical positional mapping approach of disease mutation identification can be extended to large target regions using high-throughput sequencing.
Directory of Open Access Journals (Sweden)
Yan Wang
Full Text Available Nijmegen breakage syndrome (NBS with NBS1 germ-line mutation is a human autosomal recessive disease characterized by genomic instability and enhanced cancer predisposition. The NBS1 gene codes for a protein, Nbs1(p95/Nibrin, involved in the processing/repair of DNA double-strand breaks. Hepatocellular carcinoma (HCC is a complex and heterogeneous tumor with several genomic alterations. Recent studies have shown that heterozygous NBS1 mice exhibited a higher incidence of HCC than did wild-type mice. The objective of the present study is to assess whether NBS1 mutations play a role in the pathogenesis of human primary liver cancer, including HBV-associated HCC and intrahepatic cholangiocarcinoma (ICC. Eight missense NBS1 mutations were identified in six of 64 (9.4% HCCs and two of 18 (11.1% ICCs, whereas only one synonymous mutation was found in 89 control cases of cirrhosis and chronic hepatitis B. Analysis of the functional consequences of the identified NBS1 mutations in Mre11-binding domain showed loss of nuclear localization of Nbs1 partner Mre11, one of the hallmarks for Nbs1 deficiency, in one HCC and two ICCs with NBS1 mutations. Moreover, seven of the eight tumors with NBS1 mutations had at least one genetic alteration in the TP53 pathway, including TP53 mutation, MDM2 amplification, p14ARF homozygous deletion and promoter methylation, implying a synergistic effect of Nbs1 disruption and p53 inactivation. Our findings provide novel insight on the molecular pathogenesis of primary liver cancer characterized by mutation inactivation of NBS1, a DNA repair associated gene.
Directory of Open Access Journals (Sweden)
Ki Young Yoo
2010-03-01
Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.
Molecular genetic mutation analysis in Menkes-disease with prenatal diagnosis
DEFF Research Database (Denmark)
László, Aranka; Endreffy, Emoke; Tümer, Zeynep
2010-01-01
Menkes disease (MD) is an X-linked recessive multisystemic lethal, heredodegenerative disorder. Progressive neurodegeneration and connective tissue disturbances with microscopically kinky hair are the main symptoms. Molecular genetic mutation analysis was made at a Hungarian male infant suffering...... from MD and prenatal diagnosis was done in this MD loaded family. METHOD: The 12th exon of ATP7A gene has been analyzed by dideoxy-finger printing (DDF), polymerase chain reaction (PCR), direct sequencing of exon 12. The specific mutation was screened from chorionic villi of the maternal aunt at the 14......th gestational week. RESULTS: In the exon 12th a basic pair substitution with Arg 844 His change was detected leading to very severe fatal missense mutation....
Daverio, M S; Vidal-Rioja, L; Frank, E N; Di Rocco, F
2017-12-01
Llama, the most numerous domestic camelid in Argentina, has good fiber-production ability. Although a few genes related to other productive traits have been characterized, the molecular genetic basis of fiber growth control in camelids is still poorly understood. Fibroblast growth factor 5 (FGF5) is a secreted signaling protein that controls hair growth in humans and other mammals. Mutations in the FGF5 gene have been associated with long-hair phenotypes in several species. Here, we sequenced the llama FGF5 gene, which consists of three exons encoding 813 bp. cDNA analysis from hair follicles revealed the expression of two FGF5 alternative spliced transcripts, in one of which exon 2 is absent. DNA variation analysis showed four polymorphisms in the coding region: a synonymous SNP (c.210A>G), a single base deletion (c.348delA), a 12-bp insertion (c.351_352insCATATAACATAG) and a non-sense mutation (c.499C>T). The deletion was always found together with the insertion forming a haplotype and producing a putative truncated protein of 123 amino acids. The c.499C>T mutation also leads to a premature stop codon at position 168. In both cases, critical functional domains of FGF5, including one heparin binding site, are lost. All animals analyzed were homozygous for one of the deleterious mutations or compound heterozygous for both (i.e. c.348delA, c.351_352insCATATAACATAG/c.499T). Sequencing of guanaco samples showed that the FGF5 gene encodes a full-length 270-amino acid protein. These results suggest that FGF5 is likely functional in short-haired wild species and non-functional in the domestic fiber-producing species, the llama. © 2017 Stichting International Foundation for Animal Genetics.